JP2002065276A - Human malignant melanoma antigen - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a malignant melanoma antigen capable of being applied to diagnosis/treatment for cancer or a gene encoding it. SOLUTION: By preparing a cDNA by the use of a mRNA obtained from a malignant melanoma cell strain, transducing this cDNA into COS7 cell together with HLA-A3 cDNA, acting this COS7 cell on HLA-A3 restrictive T cell by coculture and measuring the amount of interferon γ released from this T cell by the ELIZA method, the new human malignant melanoma antigen is isolated and its T cell epitope (ATYKQINIFK) is identified.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel human malignant melanoma antigen useful for diagnosis and immunotherapy of various cancers including melanoma, more specifically, T cells established from tumor-infiltrating lymphocytes, for example, The present invention relates to a common antigen recognized by HLA-A3-restricted and melanoma-reactive T cells, DNA encoding the antigen, and use thereof.

[0002]

2. Description of the Related Art Malignant melanoma is a cancer in which immunotherapy using interleukin 2 or the like is relatively effective. However, its antitumor effect in vivo is affected by cytotoxic T cells (CTLs) that react with tumor cells. ) Has been shown to be important. After immunotherapy, tumor-reactive T cells are activated, and T cell receptors (TCRs) on T cells are converted to HLA.
(Human leukocyte antigen) Recognizes a peptide (tumor antigen) formed by degrading a tumor cell protein presented on the surface of a tumor cell by a molecule and damages the tumor cell. Furthermore, it is thought that it secretes various cytokines, induces and activates other immune cells such as macrophages, and causes tumor rejection in vivo. Tumor-reactive T cells recognize not only autologous tumor cells, but also common tumor antigens that respond to tumor cells from other patients sharing HLA, and those that recognize unique antigens that react only to autologous tumor cells May be.

In order to elucidate the immune response mechanism against human tumor cells and to develop a new immunotherapy, it is important to identify tumor antigens recognized by these tumor-reactive T cells. When tumor-reactive T cells have been established, it is possible to isolate a malignant melanoma antigen using a functional cDNA expression cloning method utilizing the reactivity. For example, the use of tumor-reactive cytotoxic T cells from metastatic melanoma patients and tumor cell lines expressing HLA-A2 to prevent, diagnose and treat melanoma or mammals with metastatic melanoma. To isolate human Malignant Melanoma Antigen MART-1 that is possible
No. 05481. To date, typical examples include pigment cell (melanocyte) tissue-specific proteins such as MART-1 and gp100, and Cancer-Testis, which is expressed in testes in various tumors and normally.
Antigens (CT antigens), mutant peptide antigens produced by genetic abnormalities in tumor cells, have been isolated. In the United States National Cancer Institute, the melanocyte-specific antigen MART-1 and g
Phase I clinical trials of various immunity / gene therapy using p100 have been conducted, and tumor regression has been observed in some patients.

[0004]

At present, cancer is the leading cause of death.
Despite advances in treatment, many advanced cancers cannot yet be treated. To improve this, new early diagnostics and treatments need to be developed. In particular, as a problem in developing immunotherapy,
(1) HLA presenting antigen has diversity, (2)
Tissue-specific antigens and CT antigens are common antigens that are easy to use in the treatment of many patients, but are not essential molecules for tumor cells, so they tend to lose antigen. (3) Tumor-specific mutant peptide antigens , Although tumor-specific and tumor rejection may be strong, it is difficult to treat many patients at present, as custom-made treatment is required for each individual patient. It is said that it is necessary to isolate a strong antigen and to analyze the characteristics of the antigen. An object of the present invention is to provide a malignant melanoma antigen that can be applied to diagnosis and treatment of cancer, a gene encoding the same, and the like.

[0005]

Means for Solving the Problems The present inventors have conducted intensive studies in order to solve the above problems, and have prepared cDNA using mRNA obtained from a malignant melanoma cell line,
A was introduced into COS7 cells together with the HLA-A3 cDNA, and the COS7 cells and HLA-A3-restricted T cells (T
IL1086) and co-cultured,
Interferon γ released from IL1086 (IF
By measuring the amount of Nγ) by the ELISA method, a novel human malignant melanoma antigen was found, its T cell epitope was identified, and the present invention was completed.

That is, the present invention relates to a DNA encoding the following peptide (a) or (b): (a) a peptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (b) an amino acid sequence shown in SEQ ID NO: 1; Consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted or added,
And a peptide (b) comprising an amino acid sequence represented by SEQ ID NO: 2 which encodes a peptide having the immunity-inducing activity (claim 1) or the following peptide (a) or (b):
In the amino acid sequence shown in SEQ ID NO: 2, a peptide comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity (Claim 2), the following (a) or (b) a DNA encoding the peptide of (b); (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3; (b) one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 3 A protein comprising the amino acid sequence described above and having immunity inducing activity (Claim 3); a protein encoding the following peptide (a) or (b); b) an amino acid sequence represented by SEQ ID NO: 4 in which one or several amino acids have been deleted, substituted or added, and A protein having an activity (claim 4), a complementary sequence of the DNA according to any one of claims 1 to 4, and a DNA comprising any or all of the DNA according to any one of claims 1 to 4 and its complementary sequence. (Claim 5)
A nucleotide sequence represented by SEQ ID NO: 5 or a complementary sequence thereof and a DNA containing a part or all of these sequences (claim 6); a nucleotide sequence represented by SEQ ID NO: 6 or a complementary sequence thereof and DNA containing part or all of the sequence
(Claim 7), the base sequence shown in SEQ ID NO: 7 or its complementary sequence, DNA containing a part or all of these sequences (Claim 8), the base sequence shown in SEQ ID NO: 8 or its complement And a DNA having a part of or all of these sequences (claim 9) or a peptide that hybridizes with the DNA according to any one of claims 1 to 9 under stringent conditions and has immunity-inducing activity Alternatively, it relates to a DNA encoding a protein (claim 10).

[0007] The present invention also relates to a peptide comprising the amino acid sequence shown in SEQ ID NO: 1 (Claim 11) or the amino acid sequence shown in SEQ ID NO: 1 in which one or several amino acids are deleted, substituted or added. A peptide having an immunity-inducing activity (Claim 12), a peptide having an amino acid sequence represented by SEQ ID NO: 2 (Claim 13), an amino acid sequence represented by SEQ ID NO: 2, Several amino acids deleted,
A peptide comprising the substituted or added amino acid sequence and having immunity-inducing activity (claim 14); a protein comprising the amino acid sequence represented by SEQ ID NO: 3 (claim 15); and an amino acid sequence represented by SEQ ID NO: 3 A protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added and having immunity-inducing activity (claim 16), or a protein comprising the amino acid sequence shown in SEQ ID NO: 4 (claim 17)
In the amino acid sequence represented by SEQ ID NO: 4, a protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity (Claim 18); Peptides or proteins containing a part or all of the amino acid sequence constituting any of the peptides or proteins (claim 1
9), a fusion peptide or fusion protein in which the peptide or protein according to any one of claims 11 to 19 is linked to a marker protein and / or a peptide tag (claim 20), or any of claims 11 to 20 22. An antibody that specifically binds to the peptide or protein according to claim 21 (claim 21), or the antibody according to claim 21 (claim 22), wherein the antibody is a monoclonal antibody. The present invention relates to a recombinant peptide or protein (claim 23) to which the above antibody specifically binds.

[0008] The present invention also provides a host cell (Claim 24) comprising an expression system capable of expressing the peptide or protein according to any one of Claims 11 to 20, or Claim 23, and HLA expression ability. Wherein the host cell according to claim 24 (claim 25), or the gene function of any one of claims 11 to 20, or the peptide or protein according to claim 23, is defective on a chromosome. Non-human animals (Claim 26) and Claim 11
(20) or a non-human animal characterized by overexpressing the peptide or protein according to (23), or the non-human animal is a mouse or a rat. Item 27 relates to a non-human animal according to Item 26 or 27 (Claim 28).

The present invention also relates to a test substance, and
24. A method for screening for a substance that promotes or suppresses immunity-inducing activity, comprising measuring and evaluating the immunity-inducing activity of T cells using any one of claims 20 or 23 or the peptide or protein of claim 23, and T cells. Claim 2
9) and the test substance, the host cell according to claim 25, and T
Immunity-inducing activity in the T cells using
A screening method for a substance that promotes or suppresses immunity-inducing activity (Claim 30), wherein a host cell transfected with a vector expressing a HLA and a vector expressing a test polypeptide; A method for screening for a substance that promotes or suppresses immunity-inducing activity (Claim 31), characterized in that the immunity-inducing activity in the T cells is measured and evaluated using the method described above, and an HLA transfected with a vector expressing a test polypeptide. A method for screening for a substance that promotes or suppresses immunity-inducing activity, comprising using a host cell capable of expression and a T-cell to measure and evaluate the immunity-inducing activity of the T-cell (Claim 32). 29. The test substance is administered to the non-human animal according to any of 26 to 28, and the immunity-inducing activity on T cells of the non-human animal is measured. A method of screening for a substance that promotes or suppresses immunity-inducing activity (claim 33), and that measuring and evaluating immunity-inducing activity is measurement and evaluation of interferon-γ activity in T cells. A method for screening a substance for promoting or suppressing immunity inducing activity according to any one of claims 29 to 33 (claim 3).
4) The method of claim 29, wherein the T cell is an HLA-A3-restricted T cell.

[0010] The present invention further provides an immunity-inducing activity-promoting substance obtained by the screening method according to any one of claims 29 to 35 (claim 36) and a screening method according to any one of claims 29 to 35. An anti-tumor comprising an immunity-inducing activity inhibitor (claim 37), any one of claims 11 to 20, or a peptide or protein according to claim 23, or an immunity-inducing activity promoter according to claim 36 as an active ingredient. Agent (Claim 38)
Or any one of claims 11 to 20, or claim 23
An activated T cell (Claim 39) induced by in vitro stimulation with the peptide or protein according to the present invention or the immunity-inducing activity promoting substance according to the claim 36 (Claim 39);
20. A probe for diagnosing cancer comprising all or a part of the antisense strand of DNA or RNA encoding the peptide or protein according to any one of claims 20 or 23 (claim 40); A diagnostic agent for cancer characterized by containing a diagnostic probe and / or the antibody according to claim 21 or 22, or a diagnostic agent for cancer, wherein the diagnostic agent for cancer is malignant melanoma, esophageal cancer, bladder cancer, lung cancer , Brain tumors,
The diagnostic agent for cancer according to claim 41, which is a diagnostic agent for one or more cancers selected from pancreatic cancer, prostate cancer, and breast cancer (claim 42).

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION Peptides or proteins to be used in the present invention include a melanoma antigen epitope derived from malignant melanoma (ATYKQINIFK) comprising the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, and the antigen epitope. And a protein consisting of the amino acid sequence shown in SEQ ID NO: 3, a protein consisting of the amino acid sequence shown in SEQ ID NO: 3, and a protein consisting of the amino acid sequence shown in SEQ ID NO: 4 (these peptides or proteins). Hereinafter may be referred to as “MART-3”). Further, as the peptide or protein to be the subject of the present invention, in the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4, one or several amino acids are deleted, substituted or added, and A protein having an immunity-inducing activity can be exemplified, where the immunity-inducing activity means antibody production, cell-mediated immunity,
An activity that induces an immune response such as immune tolerance. Among such immunity-inducing activities, for example, T that increases the frequency of T cell precursor cells such as helper T cells and cytotoxic T cells (CTLs) in peripheral blood. Those having cell-inducing activity are particularly preferred. Furthermore, examples of the peptide or protein to be an object of the present invention include a peptide or protein comprising a peptide or protein containing a part or all of the above peptide or protein and having immunity inducing activity. The above-mentioned peptide and protein of the present invention, and recombinant peptides and proteins to which antibodies specifically binding to these peptides or proteins specifically bind, are hereinafter collectively referred to as “the present malignant melanoma antigen”.
There is that. The origin of the present melanoma antigen is not limited to humans.

The DNA to be used in the present invention includes MA
In the DNA encoding RT-3, the amino acid sequence shown in any one of SEQ ID NOs: 1 to 4, consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity. Examples include DNAs encoding peptides and proteins, base sequences shown in any of SEQ ID NOS: 5 to 8, or their complementary sequences, and DNAs containing a part or all of these sequences. For example, cDNA encoding MART-3 is:
CDN using mRNA obtained from melanoma cell line
A was prepared, and this cDNA was introduced into COS7 cells together with HLA-A3 cDNA.
A3 restricted T cells (TIL1086) can be contacted by co-culturing, and screening can be performed by measuring the amount of interferon gamma (IFNγ) released from TIL1086 by the ELISA method.

[0013] In addition, the base sequence shown in any one of SEQ ID NOs: 5 to 8 or a sequence complementary thereto and a part or all of these sequences are used as probes to obtain D-cells derived from various malignant melanomas.
By hybridizing the NA library under stringent conditions and isolating DNA hybridizing to the probe, it has the desired immunity-inducing activity as effective as the malignant melanoma antigen MART-3. DNAs encoding proteins can also be obtained. Hybridization conditions for obtaining such DNA include, for example, hybridization at 42 ° C. and washing at 42 ° C. with a buffer containing 1 × SSC and 0.1% SDS. ,
Hybridization at 65 ° C. and 0.1 × SS
C, a washing treatment at 65 ° C. with a buffer containing 0.1% SDS can be more preferably mentioned. In addition, as factors that affect the stringency of hybridization, there are various factors other than the above-mentioned temperature conditions, and those skilled in the art can appropriately combine various components,
It is possible to realize a stringency equivalent to the stringency of hybridization exemplified above.

[0014] The fusion protein or fusion peptide of the present invention may be any as long as the present malignant melanoma antigen is bound to a marker protein and / or a peptide tag. It is not particularly limited as long as it is a known marker protein, and specific examples thereof include alkaline phosphatase, the Fc region of an antibody, HRP, GFP, and the like. The peptide tag of the present invention includes Myc Tag, His tag, FLAG tag, GST
Conventionally known peptide tags such as tags can be specifically exemplified. Such a fusion protein can be prepared by a conventional method, and it purifies the malignant melanoma antigen MART-3 and the like using the affinity of Ni-NTA and His tag, detects a protein having T cell inducing activity, It is useful as a quantification of an antibody against melanoma antigen MART-3 and the like, as a diagnostic marker for malignant melanoma, and as a research reagent in the field.

Specific examples of the antibody that specifically binds to the protein or peptide of the present invention include immunospecific antibodies such as monoclonal antibodies, polyclonal antibodies, chimeric antibodies, single-chain antibodies, and humanized antibodies. These can be prepared by a conventional method using a peptide or protein such as the above-mentioned melanoma antigen MART-3 or a part thereof as an antigen, and among them, a monoclonal antibody is preferable in terms of its specificity, Especially MART-
A monoclonal antibody that specifically recognizes three epitopes (ATYKQINIFK) or a complex of the epitope and HLA is more preferable. Such an antibody such as a monoclonal antibody is useful, for example, in diagnosing malignant melanoma and the like, and treating e.g. missile therapy, as well as elucidating the onset mechanism of a malignant tumor such as melanoma.

Furthermore, the antibody of the present invention can be used to prepare the present melanoma antigen or epitope (ATYKQINIFK) in animals (preferably other than humans) using a conventional protocol.
Or a fragment thereof, or a fragment thereof, which is produced by administering a cell that expresses a complex of the melanoma antigen, particularly the epitope (ATYKQINIFK) and HLA on the membrane surface,
For example, the preparation of monoclonal antibodies includes the hybridoma method (Nature 256, 495-497, 1975), the trioma method, and the human B cell hybridoma method (Immunology Today 4, 72, which yields antibodies produced by continuous cell line cultures).
1983) and EBV-hybridoma method (MONOCLONAL ANT)
IBODIES AND CANCER THERAPY, pp.77-96, Alan R.Liss,
Inc., 1985).

In order to prepare a single-chain antibody against the above malignant melanoma antigen of the present invention, a method for preparing a single-chain antibody (US Pat. No. 4,946,778) can be applied. Also,
In order to express a humanized antibody, transgenic mice or other mammals are used, or a clone expressing the present malignant melanoma antigen is isolated and identified using the above antibody, and affinity chromatography is performed. Can be used to purify the polypeptide. The antibody against the present melanoma antigen or a peptide containing the antigen epitope may be used for diagnosis or treatment of melanoma or the like. Recombinant peptides or proteins to which these antibodies specifically bind are also included in the present melanoma antigens of the present invention as described above.

The present invention also relates to a host cell comprising an expression system capable of expressing the above-described malignant melanoma antigen and an HLA-expressing ability comprising an expression system capable of expressing the present malignant melanoma antigen. Host cells. The introduction of the gene encoding the present malignant melanoma antigen into host cells is described in Davis et al. (BASIC METHODS IN MOLECULAR BIOLOG
Y, 1986) and Sambrook et al. (MOLECULAR CLONING: A LABO
RATORY MANUAL, 2nd Ed., Cold Spring Harbor Laborat
ory Press, Cold Spring Harbor, NY, 1989) and methods described in many standard laboratory manuals, eg, calcium phosphate transfection, DEA
E-dextran mediated transfection, transvection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scraping
(scrape loading), ballistic introductio
n), infection, etc.

The host cells include Escherichia coli,
Bacterial prokaryotic cells such as Streptomyces, Bacillus subtilis, Streptococcus and Staphylococcus, fungal cells such as yeast and Aspergillus, insect cells such as Drosophila S2 and Spodoptera Sf9, L cells, CHO cells, COS cells, HeLa cells, C127 cells, BALB / c3T3
Cells (including mutants lacking dihydrofolate reductase and thymidine kinase), BHK21 cells, HEK
293 cells, Bowes malignant melanoma cells and other animal cells, and plant cells. In addition, the above HL
Examples of the host cell having the ability to express A include, in addition to cells having the ability to express HLA, cells transfected with the HLA cDNA to cells that do not have the ability to express HLA. For example, host cells capable of expressing HLA-A3 include 526 mel, 624 mel, and HL
In addition to ALA-A3 expressing cells such as A-A3-positive B cells, COS7 cells, 586 mel, SKmel
23, A375 and the like which are not originally capable of expressing HLA-A3 and transfected with HLA-A3 cDNA.

The expression system may be any expression system capable of expressing the present malignant melanoma antigen in a host cell, such as expression systems derived from chromosomes, episomes and viruses. A vector derived from a bacterial plasmid-derived, yeast plasmid-derived, papovavirus such as SV40, vaccinia virus, adenovirus, fowlpox virus, pseudorabies virus, retrovirus, bacteriophage-derived, transposon-derived and combinations thereof, Examples include those derived from genetic elements of plasmids and bacteriophages, such as cosmids and phagemids. The expression system may include control sequences that regulate as well as cause expression.

The host cell comprising the above expression system, the cell membrane of such a cell, and the present melanoma antigen obtained by culturing such a cell can be used in the screening method of the present invention as described later. For example, as a method for obtaining a cell membrane, F. Pietri-Rouxel (Eur. J. Biochem.,
247, 1174-1179, 1997) and the like. In addition, the present malignant melanoma antigen can be recovered and purified from a cell culture by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange. Known methods including chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography, preferably high performance liquid chromatography are used. In particular, as a column used for affinity chromatography, for example, a column to which an antibody against the present malignant melanoma antigen is bound, or when a normal peptide tag is added to the above-described malignant melanoma antigen, the affinity for the peptide tag is high. The present malignant melanoma antigen can be obtained by using a column to which a certain substance is bound.

In the present invention, a non-human animal in which the function of the gene encoding the present melanoma antigen is deficient on the chromosome is defined as a part of or all of the gene encoding the present melanoma antigen on the chromosome is disrupted. A non-human animal that has been inactivated by a gene mutation such as deletion or substitution and has lost the function of expressing the malignant melanoma antigen.A non-human animal that overexpresses the malignant melanoma antigen is a wild animal. A non-human animal that produces such a malignant melanoma antigen in a larger amount than a non-human animal. Examples of the non-human animal in the present invention include, but are not limited to, non-human animals such as rodents such as mice and rats.

By the way, the homozygous non-human animals born according to Mendel's law include the present malignant melanoma antigen-deficient or overexpressed type and its homozygous non-human type. By simultaneously using the defective or overexpressed type and its littermate wild type in animals, it is possible to perform an accurate comparative experiment at the individual level,
A wild-type non-human animal, that is, an animal of the same species as a non-human animal whose gene function encoding the present malignant melanoma antigen is defective or overexpressed on the chromosome, and an animal of the same litter, for example, the present invention described below. It is preferable to use them together in screening. A method for producing such a non-human animal in which the function of the gene encoding the present melanoma antigen is deficient or overexpressed on the chromosome will be described below using a knockout mouse or a transgenic mouse of the present melanoma antigen as an example.

For example, a mouse lacking the function of the gene encoding the present melanoma antigen on the chromosome, that is, a knockout mouse of the present melanoma antigen is obtained by using a gene fragment obtained from a mouse gene library by a method such as PCR. Then, the gene encoding the present melanoma antigen is screened, the screened gene encoding the melanoma antigen is subcloned using a viral vector or the like, and identified by DNA sequencing. All or part of the gene encoding the present malignant melanoma antigen of this clone is replaced with a pMC1 neo gene cassette or the like, and the diphtheria toxin A fragment (DT-A) gene or the herpes simplex virus thymidine kinase (3 ′) is located at the 3 ′ end. A targeting vector is prepared by introducing a gene such as the HSV-tk) gene.

The thus prepared targeting vector is linearized, introduced into ES cells by electroporation (electroporation) or the like, and homologous recombination is performed. Among the homologous recombinants, G418 or ganciclovir is obtained. (G
E.A.) which has undergone homologous recombination with an antibiotic such as
Select S cells. In addition, it is preferable to confirm whether or not the selected ES cell is the desired recombinant by Southern blotting or the like. The confirmed ES cell clone is microinjected into a mouse blastocyst, and the blastocyst is returned to a foster parent mouse to produce a chimeric mouse. When this chimeric mouse is intercrossed with a wild-type mouse, a heterozygous mouse can be obtained, and by intercrossing the heterozygous mouse, the malignant melanoma antigen knockout mouse of the present invention is prepared. can do. As a method for confirming whether the malignant melanoma antigen knockout mouse has occurred, for example, RNA is isolated from the mouse obtained by the above method and examined by Northern blotting or the like. There is a method of examining the expression by Western blotting or the like.

The transgenic mouse of the present melanoma antigen is obtained by adding chicken β-actin, mouse neurofilament, S
A promoter such as V40, and rabbit β-globin;
A transgene is constructed by fusing a polyA or intron such as SV40, the transgene is microinjected into the pronucleus of a mouse fertilized egg, and the obtained oocytes are cultured, and then transplanted into an oviduct of a foster parent mouse, Thereafter, the transgenic mouse can be created by rearing the recipient animal and selecting a pup mouse having the above-mentioned cDNA from the pup mice born. In addition, selection of a pup mouse having cDNA can be performed by extracting a crude DNA from the tail of the mouse or the like, and conducting dot hybridization using a gene encoding the present malignant melanoma antigen as a probe or PCR using specific primers. It can be performed by a method or the like.

A gene or DNA encoding the melanoma antigen, a melanoma antigen, a fusion peptide or a fusion protein obtained by binding the melanoma antigen to a marker protein and / or a peptide tag;
Antibodies to the present melanoma antigen, host cells comprising an expression system capable of expressing the present melanoma antigen, etc., as specifically described below, malignant melanoma, esophageal cancer, bladder cancer, It is useful for the treatment and diagnosis of lung cancer, brain tumor, pancreatic cancer, prostate cancer, breast cancer, etc., and can be used not only for screening for substances that promote or suppress immunity-inducing activity, but also for activated T cells (CD4 antigen-positive T cells, It can also be used to elucidate the mechanism of immune response such as induction of all T cells such as CD8 antigen-positive T cells, helper T cells, killer T cells, and suppressor T cells.

As a method for screening a substance for promoting or suppressing immunity-inducing activity of the present invention, a test substance, the present malignant melanoma antigen and T cells such as HLA-A3-restricted T cells are used to induce immunity in the T cells. A method for measuring / evaluating activity, a method for measuring / evaluating immunity-inducing activity in T cells using a test substance, a cell membrane or a cell expressing the malignant melanoma antigen and T cells, and a method for measuring HLA- H such as A3
A method for measuring and evaluating immunity-inducing activity in T cells using host cells and T cells transfected with both a vector expressing the LA and a vector expressing the test polypeptide, and expressing the test polypeptide. Vector-transfected host cells capable of expressing HLA and T
Immunity-inducing activity in the T cells using
Examples of the method include an evaluation method, a method of administering a test substance to a non-human animal such as the knockout mouse or the transgenic mouse, and measuring and evaluating the immunity-inducing activity on T cells of the non-human animal. Examples of the cell membrane or cells include cells such as primary cultured cells obtained from a non-human animal or a wild-type non-human animal overexpressing the gene encoding the malignant melanoma antigen, and the malignant melanoma of the present invention. Host cells comprising an expression system capable of expressing an antigen, and cell membranes of these cells can be specifically exemplified. As a method for contacting such a cell membrane or cells with a test substance, a test substance A method in which a cell membrane or cell expressing the present malignant melanoma antigen is cultured in vitro in the presence of, and then contacted with T cells.

The screening method using the above-described test substance and T cells will be specifically described below with reference to examples, but the screening method of the present invention is not limited thereto. A method for measuring and evaluating immunity-inducing activity in T cells using the test substance, the malignant melanoma antigen and the T cells includes, for example, a method in which a test substance is used in the presence of HLA-A3-restricted T cells. A specific example of a method of contacting the present melanoma antigen, measuring the increase or decrease of T cell inducing activity such as CTL, and comparing / evaluating with a control in the absence of a test substance can be specifically exemplified. . In addition, the above HL
A method for measuring and evaluating immunity-inducing activity in T cells using a T cell and a host cell transfected with both a vector expressing A and a vector expressing the test polypeptide includes expressing HLA-A3. And HLA-A3-restricted T cells were co-cultured for a certain period of time after co-transfection of a host cell co-transfected with a vector expressing the test polypeptide and the vector expressing the test polypeptide, and then the HLA-A3-restricted MLA was expressed on the cell membrane surface. A specific example of a method for evaluating the decrease or increase of the tumor antigen using the amount of IFNγ released from the HLA-A3 restricted T cells into the medium as an index can be specifically exemplified.

The above-mentioned T cells such as the HLA-A3-restricted T cells used in the screening of the present invention can be obtained by in vitro transfection of malignant melanoma tissue-infiltrating lymphocytes isolated from cancer tissue of a melanoma patient with a high concentration of interleukin. 2 by culturing and growing in the presence for 30 to 70 days, or by separating a malignant melanoma tissue-infiltrating lymphocyte or a melanoma patient's peripheral blood mononuclear cell isolated from a cancer tissue of a melanoma patient,
MART-3 peptide or protein, or MAR
By introducing T-3 cDNA and stimulating it with antigen-presenting cells capable of expressing MART-3 peptide or protein, those skilled in the art can easily establish tumor-reactive T cells and the like.

The present invention also relates to an immunity-inducing activity-promoting substance used for the treatment of a patient in need of promoting the immunity-inducing activity obtained by the above screening method, a treatment of a patient in need of suppressing the immunity-inducing activity, The present invention relates to a substance for suppressing an immunity-inducing activity used in the method. The present invention also relates to malignant melanoma containing the present melanoma antigen as an active ingredient,
The present invention relates to an antitumor agent for esophageal cancer, bladder cancer, lung cancer, brain tumor, pancreatic cancer, prostate cancer, breast cancer and the like. For example, when the malignant melanoma antigen is administered orally, intravenously, intradermally, subcutaneously, or the like, an antitumor effect due to an increase in T cell inducing activity in vivo can be expected. Further, the above antibody can be used for missile therapy. The present invention also relates to activated T cells induced by in vitro stimulation with the present melanoma antigen.
For cells. For example, stimulation of peripheral blood lymphocytes and tumor-infiltrating lymphocytes with the present malignant melanoma antigen together with IL-2 induces tumor-reactive activated T cells, and the activated T cells are used effectively for adoptive immunotherapy. be able to.
Further, the malignant melanoma antigen can be expressed in vivo or in vitro in dendritic cells which are powerful antigen-presenting cells, and immunity can be induced by administering the antigen-expressing dendritic cells.

Furthermore, the present invention relates to a diagnostic probe for cancer comprising all or a part of the antisense strand of DNA or RNA encoding the present melanoma antigen, a diagnostic probe for this cancer and the present melanoma antigen. Malignant melanoma, esophageal cancer, bladder cancer, lung cancer, brain tumor,
The present invention relates to a diagnostic agent for cancer such as pancreatic cancer, prostate cancer, and breast cancer. The diagnostic probe is all or part of the antisense strand of DNA (cDNA) or RNA (cRNA) encoding the malignant melanoma antigen, and is long enough to be a probe (at least 20 bases or more). For example, by detecting the mRNA of the present malignant melanoma antigen obtained from a sample using the above-mentioned antisense strand, a disease such as malignant melanoma can be diagnosed. Specific examples of the specimen used for such detection include, but are not limited to, genomic DNA and RNA or cDNA that can be obtained from a biopsy of a subject's cells, such as blood, urine, saliva, and tissue. Instead, when such a sample is used, a sample amplified by PCR or the like may be used.

[0033]

EXAMPLES The present invention will be described more specifically below with reference to examples, but the technical scope of the present invention is not limited to these examples. Example A [Materials and Methods] A-1 (Establishment of Tumor-Reactive Cytotoxic T Cells) Malignant melanoma tissue-infiltrating lymphocytes isolated from cancer tissue of a malignant melanoma patient were cultured at a high concentration (6000 IU / m2) in vitro.
l) Interleukin 2 (Cetus-Oncology Devision,
The cells were grown by culturing in the presence of Chiron Corp. Emeryville, CA) for 30 to 50 days to establish tumor-reactive cytotoxic T cells (TIL1086).

A-2 (Determination of HLA restriction and examination of recognition of known antigen) Reference (Kawakami. Y., et al: Cloning of the Gene Cod)
ing for a Shared Human Melanoma Antigen Recognized
by Autologous T cells Infiltrationg intoTumor. Pr
USA 91: 3515-3519, 1994.), and malignant melanoma cell lines expressing various HLA (526 mel, 624 mel, 586 mel, S
Kmel23, A375), HLA-A3 positive B cells,
COS7 cells co-transfected with HLA-A3 cDNA and DNA encoding malignant melanoma antigen 5B6, COS7 cells co-transfected with HLA-A1 cDNA and DNA encoding malignant melanoma antigen 5B6
5 × 10 ⁴ of the cell lines listed in Table 1 such as cells and TIL1
After culturing 5 × 10 ⁴ 086 cells together for 20 hours,
The culture supernatant was collected, and HLA restriction was determined by measuring interferon γ released from TIL1086 by ELISA. Further, 100 ng of known malignant melanoma antigen gene cDNA and / or 50 ng of HLA-A3 cDNA was introduced into COS7 cells (5 × 10 ⁴ ) using a lipofectamine reagent (BRL, Gaitherburg, MD), and the known antigen by TIL1086 was introduced. The presence or absence of recognition was examined.

A-3 (Preparation of cDNA library) Total RNA was extracted from the allogeneic malignant melanoma cell line 888mel, which TIL1086 recognizes as HLA-A3 restricted, using the guanidine-cesium chloride method, and then an oligogodT column was used. Then, poly A + RNA was purified. After synthesizing a double-stranded cDNA having blunt ends with a random primer having a restriction enzyme HindIII sequence (Novagen), reverse transcriptase (Novagen) and T4 DNA synthase (Novagen), an EcoRI linker ( Novagen, Madison, WI). This DNA was digested with EcoRI (5 'end) and HindIII
(3 ′ end), and inserted into a eukaryotic cell expression plasmid vector VR1012 (gift from Chiron / Viagene, San Diego, CA) to construct a unidirectional cDNA library.

A-4 (Screening of tumor antigen cDNA using cytotoxic T cells) Bacteria of about 100 clones of a plasmid into which cDNA has been incorporated are used as a pool, cultured overnight, amplified, and then
zard 9600 DNA extraction system (Promega, Madison, WI)
Was used to extract plasmid DNA. 100-200 ng of cDNA per pool is replaced with 100 ng of HL
Lipofectamine reagent (BRL,
Using a Gaitherburg, MD) into COS7 cells (5 × 10 ⁴ cells) on a 96-microwell plate and 7.5
% Bovine serum in DMEM medium (SIGMA, St. Louis,
(MO) at 37 ° C. The next day, after replacing the culture supernatant with the fresh medium, TIL1086 cells (5 × 1
0 ⁴⁾ were added to the cells were cultured for 20 hours. Thereafter, the culture supernatant was collected, and the amount of interferon γ released from TIL1086 was measured by ELISA. Individual cDNA plasmids were separated from the positive pool in which interferon γ was detected, and introduced into COS7 cells together with HLA-A3 cDNA in the same manner as described above, and screening was performed, and a plasmid containing a cDNA encoding a tumor antigen was isolated. The nucleotide sequence of the cDNA in the obtained plasmid was determined using the Big Dye terminater cycle sequencing kit and ABI PRI.
SM 310 genetic analyzer (Perkin-Elmer, Foster Cit
y, CA).

A-5 (RACE method of full-length cDNA (Rapi
Analysis by d Amplification of cDNA Ends) 1 μg of poly A ⁺ RNA of melanoma cell line SKmel23
Using the Marathon ™ cDNA Amplification Kit (Clon
tech, Palo Alto, CA, USA). Novel melanoma antigen (5B6) cDNA gene-specific sense primer 1 (SP1: 26 of 5B6 cDNA isolated from a cDNA library)
Nucleotide sequence from the 5th to the 292nd: 5'-GGC
GGCGTC CAC ACC TAA GAA CA
G CAG C-3 ': SEQ ID NO: 9), gene-specific sense primer 3 (SP3: base sequence from position 438 to position 465 of 5B6 cDNA: 5'-TTT CT
C TTC CCA GCC AGT ATG CCA
CAG G-3 ': SEQ ID NO: 10), gene-specific antisense primer 1 (AP1: 6 of 6B6 cDNA)
Nucleotide sequence from the 98th position to the 671st position: 5'-CAA
AGG CGG GCG GGG TAG GAG
GGA ACT T-3 ': SEQ ID NO: 11), gene-specific antisense primer 2 (AP2: 5B6cDN)
Nucleotide sequence from positions 328 to 303 of A: 5'-
CTG TGG AGC TGC GTG AGA G
GGACT TC-3 ': SEQ ID NO: 12) was converted to Oligo1000M
(Beckman Coulter, Inc., Fullerton, CA). The amplification using these primers was performed under the following conditions. 1 cycle at 94 ° C. for 30 seconds, 5 cycles at 94 ° C., 4 minutes at 72 ° C., 5 cycles at 94 ° C., 7 cycles
5 cycles at 0 ° C for 4 minutes, 5 seconds at 94 ° C, 25 cycles at 68 ° C for 4 minutes, 1 cycle at 72 ° C for 7 minutes.

A-6 (cell line and tissue) Human malignant melanoma cell line (SKmel23, 888me)
1, 1362 mel, A375, 624 mel, 926
mel, 586 mel, 526 mel, 397 mel,
501Amel, 1363mel), human glioma cell line (U-87-MO, T98G), lung cancer cell line (K1
S, LU99, LK2, EBC1, SBC2, RERF
-LCMA), esophageal cancer cell lines (TE8, TE10), bladder cancer (KU7), prostate cancer (JCA1), prostate cancer cell line (PC3), breast cancer cell line (MDA231, HS57)
8), fibroblasts (MIA fibro), leukemia cell lines (HL60, K562, Molt4) and Burkitt's lymphoma cell line (Daudi) were penicillin (100 IU / ml) and streptomycin (100 μl), respectively.
g / ml) plus 10% fetal bovine serum
Cultured in MI. The pancreatic cancer cell lines (PK1, PK9) were respectively penicillin / streptomycin (1%) and L-
Glutamine (1%), HEPES (10 mM), EGF
(6 μg / l), RPMI1640 containing 10% fetal bovine serum supplemented with insulin (150 U / l), hydrocortisone (0.5 mg / l) and transferrin (10 mg / l). EB virus infected B cells (K4B, LG2EBV-B, 1088EBV-B,
888EBV-B) with penicillin (100 IU / ml)
And 10% fetal calf serum supplemented with streptomycin (100 μg / ml). Human kidney cell line (293UT) and monkey kidney cell line (C
OS-7) was cultured in a DMEM medium. Mouse malignant melanoma cell line (B16) and mouse lung cancer cell line (3LL)
Cultured in PMI medium. RNA from normal tissues (brain, heart, kidney, spleen, liver, small intestine, muscle, lung, testis, placenta, stomach, large intestine) was purchased from Invitrogen Corporation, Carlsbad, CA.

A-7 (Analysis of expression specificity by RT-PCR method) The total RNA of the above various tumor and normal cell lines was 5 × 10 ⁷
グ ア 1 × 10 ⁸ cells were extracted by the guanidine-cesium chloride method. Extracted total RNA or the above normal tissue RN
A using 2 μg each, Superscript II RNase H-Re
cDNA was prepared by verse transcriptase (GIBCO BRL), and the 1.1 kb cDNA contained the gene-specific primers SP1 and AP2 prepared in Example A-5,
The 4.6 kb cDNA contains the gene-specific primer SP1 prepared in Example A-5 and the reverse primer [5'-TGA CAA CAG CCA CAAG].
AACCC TG-3 '(SEQ ID NO: 13)] and PCR was performed under the following conditions. 1 cycle at 94 ° C for 2 minutes, 94 ° C for 30 seconds, 62 ° C for 30 seconds, 72 ° C for 1 second.
30 minutes x 30 cycles, 7 minutes x 1 cycle at 72 ° C. As a control, in order to confirm the expression of β-actin (838 bp), a β-actin-specific sense primer (5′-ATCTGGCACCACACCTTCT) was used.
ACAATGAGCTGCG-3 ': SEQ ID NO: 14) and antisense primer (5'-CGTCATACTC
CTGCTTGCTGATCCACATCTGC-
3 ′: SEQ ID NO: 15), heat denaturation at 94 ° C. for 30 seconds, annealing at 68 ° C. for 2 minutes, extension reaction at 72 ° C. for 2 seconds.
For 25 minutes, 25 cycles of PCR were performed. The PCR product (cDNA) obtained by these PCR was subjected to agarose gel electrophoresis (1.5%), stained with ethidium bromide (EtBr), and the band was detected by irradiation with ultraviolet light at 254 nm.

A-8 (Identification of Epitope Peptide Recognized by TIL1086) Using the isolated cDNA as a template, various antisense primers [Primer 1: 7th to 7th from 731th of 5B6 cDNA]
Up to the 12th nucleotide sequence: 5'-TAC ATT GG
T TAG GTC CAG AA-3 ': SEQ ID NO: 1
6), primer 2: nucleotide sequence from position 613 to position 594 of 5B6 cDNA: 5'-AAC AAT C
AG GGC TAC TGC AG-3 ': SEQ ID NO: 17), Primer 3: Base sequence from 452 to 433 of 5B6 cDNA: 5'-GGC TGG
GAA GAG AAA CAA CT-3 ': SEQ ID NO: 18), primer 4: nucleotide sequence from position 304 to position 285 of 5B6 cDNA: 5'-TCA TTT
GGT GGA GCT GCT GT-3 ': SEQ ID NO: 19), primer 5: base sequence from position 143 to position 124 of 5B6 cDNA: 5'-CCA TG
GCA TGT GGG AAA TG-3 ': SEQ ID NO: 20)] and a fragment from which the 3' end was sequentially deleted was amplified by PCR to obtain 5 types of deleted cDNA [5B6
T5 (base sequence from 1 to 731 of 5B6 cDNA), 5B6 T4 (base sequence from 1 to 613 of 5B6 cDNA), 5B6 T3 (5B6c
Base sequence from 1st to 452nd of DNA), 5B
6T2 (base sequence from 1st to 304th of 5B6 cDNA) and 5B6 T1 (base sequence from 1st to 143th of 5B6 cDNA)] were prepared.

Each of the above cDNAs was used as pcDNA3
(Invitrogen Corporation, Carlsbad, Calif.), Introduced into COS7 cells together with HLA-A3 cDNA, examined for recognition of TIL1086, and estimated the region where the epitope was present. In the deduced region, a peptide having an HLA-A3 binding motif (C-terminal positively charged amino acid) was synthesized by the F-moc method using an AMS222 multiple peptide synthesizer (Gilson Co. Inc., Worthington, OH). Purified by high performance liquid chromatography (PerSeptive Biosystems, Framingham, MA) and confirmed by mass spectrometry. In addition, the above HLA
-The peptide synthesized was added to COS7 cells into which A3 cDNA had been introduced, INFγ release from TIL1086 was measured, and peptide recognition by T cells was examined (Kawakami
Y., et al: Identification of New Melanoma Epitope
s on Melanosomal Proteins Recognized by Tumor Infi
ltrating T Lymphocytes Restricted by HLA-A1, -A2 a
nd -A3 alleles. Journal of Immunology 161: 6985, 19
98.).

Example B [Results] B-1 (Recognition of a novel common malignant melanoma antigen by HLA-A3-restricted TIL1086) Determination of HLA-restriction and examination of recognition of known antigen by the method described in Example A-2 Was done. Table 1 shows the results. From these results, TIL1086 was found to be an HLA-A3-positive malignant melanoma cell line (526 mel, 624 mel) and HLA-A3-positive melanoma cell lines.
A3 cDNA and DN encoding melanoma antigen 5B6
A co-transfected COS7 cells and HL
A-A3 cDNA and DN encoding T cell epitope
A co-transfected COS7 but recognizes HLA-A3-negative malignant melanoma cell line (586me
1, SKmel23, A375), HLA-A3-positive B cells, HLA-A1 cDNA and malignant melanoma antigen 5B
C cotransfected with DNA encoding 6
OS7 cells were found not to recognize. Also, HLA
When HLA-A3 cDNA was introduced into -A3-negative malignant melanoma cells, TIL1086 recognized this cell. Therefore, TIL1086 was considered to recognize a common malignant melanoma antigen in an HLA-A3-restricted manner. In addition, TIL10
86 has five known melanoma antigens (MART-1, gp
100, tyrosinase, TRP1, TRP2) did not recognize the possibility of recognizing a novel antigen.

[0043]

[Table 1]

B-2 (Isolation of Malignant Melanoma Antigen cDNA Recognized by TIL1086) Malignant melanoma cell line 88 was obtained by the method described in Example A-3.
A cDNA library was prepared from 8mel, and this cD
The NA library was prepared as described in Example A-4 using HLA-
When introduced into COS7 cells together with A3 cDNA,
COS7 cells expressing NA were screened with TIL1086. Individual cDN from positive pool
By rescreening A, a 877 bp cDNA that was thought to encode a tumor antigen was isolated and named 5B6 (FIG. 1). This isolated cDNA
Was determined and compared with the gene database, no identical gene was found.

B-3 (Isolation of full-length cDNA and its structure) Since a long open reading frame (ORF) was not recognized in the isolated 5B6 cDNA, the full-length cDNA was isolated. The 5'-, 3'-RACE method described in Example A-5 was performed using polyA + RNA extracted from the SKmel23 cell line. FIG. 2 shows an outline of the 5′-, 3′-RACE method. As a result of amplifying the 3 'end using SP1 prepared in Example A-5, 392 and 393 of 5B6 cDNA were obtained.
An insertion of 426 base sequences between bases and a fragment of about 3.3 kb (3'-RACE clone 1) having a different sequence from the 496th base were strongly amplified.
When amplification was performed using SP3 prepared in Example A-5, a fragment (3'-RACE clone 2) completely homologous to 5B6 cDNA was obtained. Next, amplification of the 5 'end was performed using AP1 prepared in Example A-5. As a result, deletion of 103 bases between 393 and 495 bases of 5B6 cDNA and 131 bases between 80 and 81 bases were performed. A fragment of about 0.9 kb (5'-RACE clone 1) containing the insertion was strongly amplified. When amplification was performed using AP2 prepared in Example A-5, a fragment of about 1.4 kb (5′-R) containing a region homologous to the above fragment was obtained.
ACE clone 2) was obtained. In addition, 5'-, 3'-RACE was performed using primers SP4, SP5, AP3, AP4, AP6 and AP7 shown in FIG. Based on the results of the above RACE method, two types of about 1.1 kb (FIG. 3: SEQ ID NO: 7) and 4.6 kb (FIGS. 4 to 7: SEQ ID NO: 8) having different 3 ′ end sequences by alternative splicing. Was obtained.

A database search was performed using the two types of base sequences and amino acid sequences obtained above.
Brain-derived KIAA almost identical to 6 kb cDNA
It was confirmed that 1435 protein was registered in GenBank as accession number AB037856. Also, as a result of performing frame analysis again, about 4.6
The presence of a 410 amino acid ORF was suggested in the kb cDNA. This ORF was suggested to be one of a group of genes having a characteristic sequence called a WD repeat sequence.
The functions of known proteins having a WD repeat sequence are diverse, such as signal transduction, transcriptional regulation, and formation of cytoskeleton. The function of the 4.6 kb gene itself is not well understood.

B-4 (Expression specificity of 5B6 mRNA) Next, the expression specificity of the 5B6 gene was determined by using mRNAs obtained from tumor cell lines, normal cell lines and normal tissues, as described in Example A-7. Was examined by the RT-PCR method as described above. FIG. 8 shows the results. From this result, the 4.6 kb cDNA
Indicates that expression was similarly observed in all the normal tissues, cell lines, and tumor cell lines examined, but the 1.1 kb cDNA
Contains limited tissues (normal placenta) and cell lines (most melanoma cell lines, some adenocarcinoma and squamous cancer cell lines)
The expression was observed only in E. coli. From these, R
It was found that the two cDNA genes obtained by the ACE method had different expression modes.

B-5 (Identification of Epitope Peptide) In order to estimate the region where the epitope exists on the isolated cDNA, five types of cDNAs were used as described in Example A-8.
[5B6 T1, 5B6 T2, 5B6 T3, 5B6 T
4,5B6 T5] into COS7 cells,
Recognition of these COS7 cells by TIL1086 was measured by an interferon gamma assay (Table 2). From these results, the 613 bp cDNA (5B6 T4) was negative, and the deleted 453 bp cDNA (5B6 T4)
3) positive, 304 bp (5B6 T2) cDNA
Was negative. Therefore, when the nucleotide sequence of 5B6 T4 cDNA was confirmed, it was thought that the
A point mutation in which the 53rd base C was replaced with A was detected, and this mutation caused the 5B6 T4 fragment to
6 was not recognized. An amino acid sequence containing this mutation and conforming to the HLA-A3 binding motif (9 to 12 amino acids, the C-terminal amino acid being a positively charged amino acid such as lysine) was searched, and six types of peptides serving as antigen epitope candidates were synthesized. .

[0049]

[Table 2]

The six candidate peptides synthesized above [AT
YKQINIFKKK, ATYKQINIFKK, TV
ATYKQINIFK, VATYKQINIFK, AT
YKQINIFK (SEQ ID NO: 1), TYKQINIF
K] for TIL1086. FIG. 9 shows the results. From these results, the peptide ATYKQINIFK (SEQ ID NO: 1) consisting of 10 amino acids was recognized by TIL1086 at the lowest peptide concentration, indicating that this peptide chain was an epitope of TIL1086. The identified T cell epitope is present in both the 1.1 kb and 4.6 kb cDNAs, and the 3'-longest ORF of these cDNAs.
O encoding another 20 amino acids present in the untranslated site
It was found that it was encoded by RF (FIGS. 3 and 4
7). Also, a peptide in which alanine was mutated to aspartic acid due to a point mutation in the 5B6 T4 cDNA was not recognized by TIL1086.

[0051]

According to the present invention, it is possible to provide peptides or proteins having physiologically important malignant melanoma antigen activity, particularly T cell epitopes, and DNAs encoding them. In addition, these malignant melanoma antigens, particularly T cell epitopes and DNAs encoding them are useful for treatment and diagnosis of various cancers, and can be used for screening for substances that promote or suppress immunity-inducing activity.

[0052]

[Sequence List] SEQUENCE LISTING <110> KEIO UNIVERSITY <120> Human Malignant Melanoma Antigens <130> 000000082 <140> <141> <160> 20 <170> PatentIn Ver. 2.1 <210> 1 <211> 10 <212> PRT <213> Homo sapiens <400> 1 Ala Thr Tyr Lys Gln Ile Asn Ile Phe Lys 1 5 10 <210> 2 <211> 30 <212> PRT <213> Homo sapiens <400> 2 Met Lys Ser Leu Ser Arg Ser Ser Thr Ala Leu Ser Arg Glu Trp Thr 1 5 10 15 Val Ala Thr Tyr Lys Gln Ile Asn Ile Phe Lys Lys Lys Met 20 25 30 <210> 3 <211> 140 <212> PRT <213> Homo sapiens <400 > 3 Met Asp Val Ser Arg Glu Glu Ala Pro Gln Trp Leu Glu Ser Asp Ser 1 5 10 15 Cys Gln Lys Cys Glu Gln Pro Phe Phe Trp Asn Ile Lys Gln Met Trp 20 25 30 Asp Thr Lys Thr Leu Gly Leu Arg Gln His His Cys Arg Lys Cys Gly 35 40 45 Gln Ala Val Cys Gly Lys Cys Ser Ser Lys Arg Ser Ser Tyr Pro Val 50 55 60 Met Gly Phe Glu Phe Gln Val Arg Val Cys Asp Ser Cys Tyr Asp Ser 65 70 75 80 Ile Lys Asp Glu Asp Arg Thr Ser Leu Ala Thr Phe His Glu Gly Lys 85 90 95 His Asn Ile Ser His Met Ser Met Asp Ile Ala Arg Gly L eu Met Val 100 105 110 Thr Cys Gly Thr Asp Arg Ile Val Lys Ile Trp Asp Met Thr Pro Val 115 120 125 Val Gly Cys Ser Leu Ala Thr Gly Phe Ser Pro His 130 135 140 <210> 4 <211> 410 <212 > PRT <213> Homo sapiens <400> 4 Met Ala Ala Glu Ile His Ser Arg Pro Gln Ser Ser Arg Pro Val Leu 1 5 10 15 Leu Ser Lys Ile Glu Gly His Gln Asp Ala Val Thr Ala Ala Leu Leu 20 25 30 Ile Pro Lys Glu Asp Gly Val Ile Thr Ala Ser Glu Asp Arg Thr Ile 35 40 45 Arg Val Trp Leu Lys Arg Asp Ser Gly Gln Tyr Trp Pro Ser Ile Tyr 50 55 60 His Thr Met Ala Ser Pro Cys Ser Ala Met Ala Tyr His His Asp Ser 65 70 75 80 Arg Arg Ile Phe Val Gly Gln Asp Asn Gly Ala Val Met Glu Phe His 85 90 95 Val Ser Glu Asp Phe Asn Lys Met Asn Phe Ile Lys Thr Tyr Pro Ala 100 105 110 His Gln Asn Arg Val Ser Ala Ile Ile Phe Ser Leu Ala Thr Glu Trp 115 120 125 Val Ile Ser Thr Gly His Asp Lys Cys Val Ser Trp Met Cys Thr Arg 130 135 140 Ser Gly Asn Val Leu Gly Arg His Phe Phe Thr Ser Trp Ala Ser Cys 145 150 155 160 Leu Gln Tyr Asp Phe Asp Thr Gln Tyr Ala Phe Val Gly Asp Tyr Ser 165 170 175 Gly Gln Ile Thr Leu Leu Lys Leu Glu Gln Asn Thr Cys Ser Val Ile 180 185 190 Thr Thr Leu Lys Gly His Glu Gly Ser Val Ala Cys Leu Trp Trp Asp 195 200 205 Pro Ile Gln Arg Leu Leu Phe Ser Gly Ala Ser Asp Asn Ser Ile Ile 210 215 220 Met Trp Asp Ile Gly Gly Arg Lys Gly Arg Thr Leu Leu Leu Gln Gly 225 230 235 240 His His Asp Lys Val Gln Ser Leu Cys Tyr Leu Gln Leu Thr Arg Gln 245 250 255 Leu Val Ser Cys Ser Ser Asp Gly Gly Ile Ala Val Trp Asn Met Asp 260 265 270 Val Ser Arg Glu Glu Ala Pro Gln Trp Leu Glu Ser Asp Ser Cys Gln 275 280 285 Lys Cys Glu Gln Pro Phe Phe Trp Asn Ile Lys Gln Met Trp Asp Thr 290 295 300 Lys Thr Leu Gly Leu Arg Gln His His Cys Arg Lys Cys Gly Gln Ala 305 310 315 320 Val Cys Gly Lys Cys Ser Ser Lys Arg Ser Ser Tyr Pro Val Met Gly 325 330 335 Phe Glu Phe Gln Val Arg Val Cys Asp Ser Cys Tyr Asp Ser Ile Lys 340 345 350 Asp Glu Asp Arg Thr Ser Leu Ala Thr Phe His Glu Gly Glu His Asn 355 360 365 Ile Ser His Met Ser Met Asp Ile Ala ArgGly Leu Met Val Thr Cys 370 375 380 Gly Thr Asp Arg Ile Val Lys Ile Trp Asp Met Thr Pro Val Val Gly 385 390 395 400 400 Cys Ser Leu Ala Thr Gly Phe Ser Pro His 405 410 <210> 5 <211> 30 < 212> DNA <213> Homo sapiens <400> 5 gccacttaca aacaaatcaa catttttaaa 30 <210> 6 <211> 877 <212> DNA <213> Homo sapiens <400> 6 agcgattctt gtcagaaatg tgagcagcca tttttctgga acataaagca gatgtcgag acctagcagatcgag acctagcagatgcagatcgatacgcagatgcagatcgatacgcagatcgacagcagatcgatac 120 taacatttcc cacatgtcca tggacattgc caggggactg atggtgacct gtgggaccga 180 ccgcattgta aagatctggg acatgacacc tgtggtgggc tgcagtctgg cgactgggtt 240 ttctccgcac tgatctgaga gctgggcggc gtccacacct aagaacagca gctccaccaa 300 atgaagtccc tctcacgcag ctccacagcg ctgtctcgtg aatggacagt agccacttac 360 aaacaaatca acatttttaa aaagaaaatg taaaggtagt gccataatct gcacttagca 420 ttggcttgct tcagttgttt ctcttcccag ccagtatgcc acaggtgaac tttcgaggtt 480 gtcattaaag atggggtctt gccaggtctt ggccaggctg gtcttgaact cccggactca 540 agcaactctc ctgacttggc ctcccaaagt gttggaatta caggcatgag ccactg cagt 600 agccctgatt gttttaaata gaagaaggtc tttagacaaa ctcaaccaat tgtcaaccag 660 aaaatgttgg aagttccctc ctaccccgcc cgcctttgag ttgtccggcc tttctggacc 720 taaccaatgt atttcttaaa tatatttgat tgatgtctca tggctcttta aatgtataaa 780 agcaagttgt gccccaaccc cggccacctt gggcacatgt tctcaggacc tcctgaggac 840 tgtgtccaca ggccatggtc acttatattt ggctcag 877 <210> 7 <211> 1084 <212> DNA <213> Homo sapiens <400> 7 ggaaggccgg acgctgttac ttcagggcca tcatgacaag gtgcagtcgc tgtgctacct 60 tcagctcacc aggcagctcg tctcctgttc ctcggacggc ggaattgcag tgtggaacat 120 ggatgttagc agagaagagg ctcctcagtg gttggaaagt gattcttgtc agaaatgtga 180 gcagccattt ttctggaaca taaagcagat gtgggacacc aagacgctgg ggctaagaca 240 acatcactgc aggaaatgcg ggcaggctgt ctgcgggaag tgcagcagca agcgctcaag 300 ttacccagtc atgggcttcg agttccaagt ccgggtttgt gattcttgtt acgactccat 360 caaagatgaa gatcggactt ctctagcgac ctttcatgaa ggaaaacata acatttccca 420 catgtccatg gacattgcca ggggactgat ggtgacctgt gggaccgacc gcattgtaaa 480 gatctgggac atgacacctg tggtgggctg cagtctggcg actgggt ttt ctccgcactg 540 atctgagagc tgggcggcgt ccacacctaa gaacagcagc tccaccaaat gaagtccctc 600 tcacgcagct ccacagcgct gtctcgtgaa tggacagtag ccacttacaa acaaatcaac 660 atttttaaaa agaaaatgta aagagatggg gtcttgccag gtcttggcca ggctggtctt 720 gaactcccgg actcaagcaa ctctcctgac ttggcctccc aaagtgttgg aattacaggc 780 atgagccact gcagtagccc tgattgtttt aaatagaaga aggtctttag acaaactcaa 840 ccaattgtca accagaaaat gttggaagtt ccctcctacc ccgcccgcct ttgagttgtc 900 cggcctttct ggacctaacc aatgtatttc ttaaatatat ttgattgatg tctcatggct 960 ctttaaatgt ataaaagcaa gttgtgcccc aaccccggcc accttgggca catgttctca 1020 ggacctcctg aggactgtgt ccacaggcca tggtcactta tatttggctc agaataaatc 1080 ttat 1084 <210> 8 <211> 4593 <212> DNA <213> Homo sapiens <400> 8 aggtctagaa ttcagcggcc gctttttttt ttcgcgaaca tggcggccga aatccactcc 60 aggccgcaga gcagccgccc ggtgctgctg agcaagatcg aggggcacca ggacgccgtc 120 acggccgcgc tgctcatccc caaggaggac ggcgtgatca cggccagcga ggacagaacc 180 atccgggtat ggctgaaaag agacagtggt caatactggc ccagcattta ccacacaatg 240 gcct ctcctt gctctgctat ggcttaccat catgacagca gacggatatt tgtgggccag 300 gataatggag ctgtaatgga atttcacgtt tctgaagatt ttaataaaat gaactttatc 360 aagacctacc cagctcatca gaaccgggtg tctgcgatta tcttcagctt ggccacagag 420 tgggtgatca gtaccggcca cgacaagtgt gtgagctgga tgtgcacgcg gagcgggaac 480 gtgctcggga ggcacttctt cacgtcctgg gcttcgtgtc tgcaatatga ctttgacact 540 cagtatgctt tcgttggtga ttattctggg cagatcaccc tgctgaagct tgaacagaac 600 acgtgttcag tcatcacaac cctcaaagga catgaaggta gtgtcgcctg cctctggtgg 660 gaccctattc agcggttact cttctcagga gcatctgaca acagcatcat catgtgggac 720 atcggaggaa ggaaaggccg gacgctgtta cttcagggcc atcatgacaa ggtgcagtcg 780 ctgtgctacc ttcagctcac caggcagctc gtctcctgtt cctcggacgg cggaattgca 840 gtgtggaaca tggatgttag cagagaagag gctcctcagt ggttggaaag tgattcttgt 900 cagaaatgtg agcagccatt tttctggaac ataaagcaga tgtgggacac caagacgctg 960 gggctaagac aacatcactg caggaaatgc gggcaggctg tctgcgggaa gtgcagcagc 1020 aagcgctcaa gttacccagt catgggcttc gagttccaag tccgggtttg tgattcttgt 1080 tacgactcca tcaaagatgaagatcggact tctctagcga cctttcatga aggagaacat 1140 aacatttccc acatgtccat ggacattgcc aggggactga tggtgacctg tgggaccgac 1200 cgcattgtaa agatctggga catgacacct gtggtgggct gcagtctggc gactgggttt 1260 tctccgcact gatctgagag ctgggcggcg tccacaccta agaacagcag ctccaccaaa 1320 tgaagtccct ctcacgcagc tccacagcgc tgtctcgtga atggacagta gccacttaca 1380 aacaaatcaa catttttaaa aagaaaatgt aaaggtgtgt tttggggcat ttgtggaact 1440 tacccatggg gactaatatg gaaaaggtct gtccatagtg gttccctgaa gactggaatt 1500 acttcagcaa aacttcccca tgaacagcta atgtgtagtg aaagaatgag ctagcaaatg 1560 agttttagcg gggacaaaaa atcaaacaaa aagtgaatgc ttagaacctt ctcaaagcag 1620 tcacaagtac agacacttca cttagcctag ggggccttcc agggttcttg tggctgttgt 1680 cagagcagga gctgggggag ggaagacttg ttctctcttt cttgaggggt ggcattagga 1740 acttacgaaa ccagagacct ttccctatga cttggcagta tgtgaatatc ctctacactt 1800 agttattgat aaacttctta aagagatctg ttattttcag gtagtgccat aatctgcact 1860 tagcattggc ttgcttcagt tgtttctctt cccagccagt atgccacagg tgaactttcg 1920 aggttgtcat taagtaagtt gtgaaa tttc tgtaataaca aaggcagtcc gcattcttcc 1980 ctttccccca aattcctagg gcaaaacttt tttatggtgc tgttaacatg ggagtcacac 2040 aagccgcctg actttttctc attgccatta gtaatgactg atggaaaacc cagccaccac 2100 tgtgatgcga aatgatcagt ctgttgcctg aaacagccca gtcctcttaa ctgaaacagc 2160 attctacttc ttgttccaag atgagcctct gcaatattct ggcaatttaa tataccccct 2220 acaaaagcac tccacagctt ttacactatt ttgactttga gttataacta gtattattca 2280 tgttttcata aaaagaagtt agtgacccag agctataatc atccatcaag tcttccacaa 2340 taattcccaa ctcataaatt gctttcctaa caactagcaa aagctattgt tcataatggc 2400 atttctaaag cttttgggca ctgtgtacca ggatgaggaa gagaagaaat gaggagcctg 2460 tcttttaata ttccagtatt tgtgtgtttg attttttttg acaacagtac atatatctat 2520 ttctctaggg atatggaagt aagtggagaa gggcctacct ttttaaagga caaatataaa 2580 aatagcaaca gtatctttgc taatcttact aatggatatt gattaaaaaa aaaaaaacct 2640 cagtactgca tcactgtgtt gggatcgtac caggacaata gggtcattcc atatgataaa 2700 actaaaggac taaatttgtt ttataatgat gtcttagagg gactgaaaag tttaaggagg 2760 cgatcaaact aaaatgtctt aatggctgtg t gacacacgt aaggaaagga aagggggtca 2820 cgcacatcat gtactggaat gatctgcatt aaacattgac ttgtcttcag aaataagact 2880 gaagggtttt gttgttcctt agagttttcg tgttacatca cctaaagaga tttcttttaa 2940 aaactttcta gactctttgc aaaatgtata ttactaacat agtttggaag aaaaattgag 3000 tagtggtaag ttttgttcaa gcacaatgtt gaatgttaag cttcctgtat taattttagt 3060 tcagttaatg gttcagccca tacaaaggtg ctatcctagg gattttatga attcctgaaa 3120 ggaaaataga atatgatcaa ttccttgccc tgtggaagag tgcagaactg tggttttgtt 3180 ttcctttgac ttctgtaaaa tgtgaccgtt tgacatctgt ggtagattga acggaatatc 3240 acagctgctg agtttactcc atagctttca aacctttttt attttaagaa attcttgaaa 3300 aaccctatgt tccatgggaa cataaagtta ttatagtgcc tcctaagggg ttaatataaa 3360 tcaaggagga agtttatatt taaggaagaa ttggagtgac gtatcttaga aaaggaaagg 3420 ctgatgtttc catatagctt gctctccacc aggcctatca tttttctttt tagagacaaa 3480 cgtgacaggc tagtcttgtc tctctcatat gctaggtagt aatggggtga tatttttata 3540 gaagtgggct aaaattattt tctcaatttt actgagtagg cacagaagaa aagtacagat 3600 aggctgatgg ttattgcctt attttgactg catttc tctt aaatggatca tttaaattag 3660 ttcttcaagt aacagtttac tggttgttcc attcctgaat atgcaggcta atttgtacag 3720 atagggatta aggaatacag actattagag aagatcctta tatttacatc tagtatatat 3780 gtggtaagga aatgccgatt cttcattata aacaagtttt aaaattgttc tttcttagtt 3840 caaatgatag caatgcccct atagcattag gtagaaacaa attattcatt acatcgtaaa 3900 tctctttacc atgtcctagc tctgtcctgc tacctaaagg atataaagaa atattattgc 3960 tctagaatgt attactttgt tctcccatga aagaattcag tttgttagta cctatatttt 4020 taaactggtg aaactgaccc aaatatgtaa taaataccat agtagctcag acccaaggag 4080 atatttttct aaaatcagtt ttcgttaaag tacttctact tccgttattg gatatggtat 4140 ctcctaaagt gtaaaaaaaa tctgttacta tatagtgata aaccatctgc tcatcgtaag 4200 tgtaaggctt aacaaataag taatacatgc tatatttatt caagtgtcta ttgcttaatt 4260 gttaattgtg agcagattta ttgaatgcct attctatttt ctgcagttta caatacaata 4320 actctttgag taagttgaag tttaattgtg caacaaattt gtattagagt acaatttaaa 4380 gtgtttttct ctatagcctt ttttgactgg ggaagcaagg ggtaatgtta attagtacac 4440 tttgttcttg tactagctat gtttctataa gatatggtgc c ctgtgtatt ccagagatgc 4500 tagaaaactg ttctttgctc ctatttgtgg gttctgtttt tgtgggtttt tttttttttg 4560 agaaaatgta cacaataaaa cattccttgc ttc 4593 <210> 9 <211> 28 <212> DNA <213> Artificial sequence <220> cg> ac> c1> ag> c1c> cg acagcagc 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: SP3 <400> 10 tttctcttcc cagccagtat gccacagg 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: AP1 <400> 11 caaaggcggg cggggtagga gggaactt 28 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: AP2 <400> 12 ctgtggagct gcgtgagagg gacttc 26 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Reverse Primer <400> 13 tgacaacagc cacaagaacc ctg 23 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Beta-actin Specifi c Sense Primer <400> 14 atctggcacc acaccttcta caatgagctg cg 32 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Beta-actin Specific Antisense Primer <400> 15 cgtcatactc ctgcttgctg atccacatct gc 32 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer 1 <400> 16 tacattggtt aggtccagaa 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer 2 <400> 17 aacaatcagg gctactgcag 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: Primer 3 <400> 18 ggctgggaag agaaacaact 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer 4 <400> 19 tcatttggtg gagctgctgt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer 5 <400> 20 ccatggacat gtgggaaatg 20

[Brief description of the drawings]

FIG. 1 shows the nucleotide sequence of MART-3 (5B6) of the present invention and the amino acid sequence in different reading frames.

FIG. 2 shows a 5′-, 3′-RA according to an embodiment of the present invention.
It is a figure which shows the outline | summary of a CE method.

FIG. 3 is a view showing a base sequence of MART-3 (1.1 kb) of the present invention.

FIG. 4 is a view showing a base sequence of MART-3 (4.6 kb) of the present invention.

FIG. 5 is a view showing the base sequence of MART-3 (4.6 kb) of the present invention, and is a continuation of FIG. 4.

FIG. 6 is a view showing the base sequence of MART-3 (4.6 kb) of the present invention, which is a continuation of FIG. 5;

FIG. 7 is a view showing the base sequence of MART-3 (4.6 kb) of the present invention, which is a continuation of FIG. 6;

FIG. 8 is a diagram showing the results of examining the expression specificity of MART-3 (5B6) mRNA of the present invention by RT-PCR.

FIG. 9 is a diagram showing the results of identifying MART-3 (epitope) of the present invention using HLA-A3-restricted T cells.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 37/04 C07K 16/32 4C084 C07K 14/82 19/00 4H045 16/32 C12P 21/08 19/00 C12Q 1/68 A C12N 5/10 G01N 33/15 Z C12P 21/08 33/50 Z C12Q 1/68 33/566 G01N 33/15 C12N 15/00 ZNAA 33/50 A61K 37/02 33/566 C12N 5 / 00 B (72) Inventor Hiroshi Kawakami 757-120 Katakuracho, Kanagawa-ku, Yokohama, Kanagawa, Japan (72) Inventor Rosenberg, Steven A 20854, Maryland, United States 20854, Potomac, Iron Gate Road 10104 F-term ( Reference) 2G045 AA29 AA34 AA35 CA18 CB01 CB17 DA36 FB01 FB02 FB03 4B024 AA01 AA12 BA45 CA04 DA02 EA04 GA05 HA14 HA15 4B063 QA01 QA19 QQ08 QQ42 QQ58 QR08 QR32. EA51 FA72 FA74

Claims (42)

[Claims] 1. A DNA encoding the following peptide (a) or (b): (a) a peptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (b) an amino acid sequence consisting of one or several amino acids deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1; Active peptides 2. A DNA encoding the following peptide (a) or (b): (a) a peptide consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) an amino acid sequence shown in SEQ ID NO: 2 consisting of an amino acid sequence in which one or several amino acids have been deleted, substituted or added, and immunity induction Active peptides 3. A DNA encoding the following peptide (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3; (b) an amino acid sequence consisting of the amino acid sequence shown in SEQ ID NO: 3 in which one or several amino acids have been deleted, substituted or added, and immunity induction Active protein 4. A DNA encoding the following peptide (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 4; (b) an amino acid sequence shown in SEQ ID NO: 4 consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and which induces immunity Active protein 5. A complementary sequence of the DNA according to any one of claims 1 to 4, and a DNA comprising the DNA according to any one of claims 1 to 4 and a part or all of the complementary sequence thereof. 6. A nucleotide sequence represented by SEQ ID NO: 5 or a sequence complementary thereto and a D sequence containing a part or all of these sequences.
NA. 7. The nucleotide sequence shown in SEQ ID NO: 6 or a sequence complementary thereto and a D sequence containing a part or all of these sequences
NA. 8. The base sequence shown in SEQ ID NO: 7 or a sequence complementary thereto and a D sequence containing a part or all of these sequences
NA. 9. A base sequence represented by SEQ ID NO: 8 or a sequence complementary thereto and a D sequence containing a part or all of these sequences
NA. 10. The DNA according to any one of claims 1 to 9,
Encoding a peptide or protein that hybridizes under stringent conditions with and has immunity-inducing activity. 11. A peptide comprising the amino acid sequence shown in SEQ ID NO: 1. 12. A peptide comprising an amino acid sequence shown in SEQ ID NO: 1 in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity. 13. A peptide comprising the amino acid sequence shown in SEQ ID NO: 2. 14. A peptide comprising an amino acid sequence shown in SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity. 15. A protein comprising the amino acid sequence shown in SEQ ID NO: 3. 16. A protein comprising an amino acid sequence shown in SEQ ID NO: 3 in which one or several amino acids have been deleted, substituted or added, and having immunity-inducing activity. 17. A protein comprising the amino acid sequence shown in SEQ ID NO: 4. 18. A protein comprising the amino acid sequence shown in SEQ ID NO: 4 with one or several amino acids deleted, substituted or added, and having immunity-inducing activity. 19. A peptide or protein comprising a part or all of the amino acid sequence constituting the peptide or protein according to claim 11. 20. A fusion peptide or fusion protein in which the peptide or protein according to any one of claims 11 to 19 is linked to a marker protein and / or a peptide tag. An antibody that specifically binds to the peptide or protein according to any one of claims 11 to 20. 22. The antibody according to claim 21, wherein the antibody is a monoclonal antibody. 23. A recombinant peptide or protein to which the antibody according to claim 21 or 22 specifically binds. 24. A host cell comprising an expression system capable of expressing the peptide or protein according to any one of claims 11 to 20, or 23. 25. The host cell according to claim 24, which has the ability to express HLA. 26. A non-human animal, wherein a gene function encoding the peptide or protein according to any one of claims 11 to 20 or 23 is deficient on a chromosome. 27. A non-human animal overexpressing any one of claims 11 to 20 or the peptide or protein according to claim 23. 28. The non-human animal according to claim 26, wherein the non-human animal is a mouse or a rat. 29. Using a test substance, any one of claims 11 to 20, or the peptide or protein according to claim 23, and a T cell to measure and evaluate immunity-inducing activity in the T cell. A method for screening for a substance that promotes or suppresses immunity inducing activity. 30. A substance for promoting or suppressing immunity inducing activity, which comprises using a test substance, the host cell according to claim 25, and T cells to measure and evaluate immunity inducing activity in said T cells. Screening method. 31. Using a T cell and a host cell transfected with both a vector expressing an HLA and a vector expressing a test polypeptide, and measuring and evaluating the immunity-inducing activity of the T cell. A method for screening for a substance that promotes or suppresses immunity inducing activity. 32. An immunological method comprising using a host cell capable of expressing HLA transfected with a vector expressing a test polypeptide and a T cell, and measuring and evaluating the immunity-inducing activity of the T cell. A method for screening a substance that promotes or suppresses inducing activity. 33. Promotion of immunity-inducing activity, comprising administering a test substance to the non-human animal according to any one of claims 26 to 28, and measuring and evaluating immunity-inducing activity on T cells of said non-human animal. Or a method of screening for an inhibitor. 34. The screening for a substance that promotes or suppresses the immunity-inducing activity according to any one of claims 29 to 33, wherein the measuring and evaluating the immunity-inducing activity is measuring and evaluating the interferon-γ activity in T cells. Method. 35. The method according to claim 29, wherein the T cells are HLA-A3 restricted T cells. A immunity-inducing activity-enhancing substance obtained by the screening method according to any one of claims 29 to 35. A immunity-inducing activity-suppressing substance obtained by the screening method according to any one of claims 29 to 35. 38. An antitumor agent comprising any one of claims 11 to 20, or the peptide or protein according to claim 23, or the immunity-inducing activity promoting substance according to claim 36 as an active ingredient. 39. An activated T cell induced by in vitro stimulation with any one of claims 11 to 20, or the peptide or protein according to claim 23, or the immunity inducing activity promoting substance according to claim 36. 40. A cancer diagnostic probe comprising all or a part of the antisense strand of DNA or RNA encoding the peptide or protein according to any one of claims 11 to 20, or 23. 41. A diagnostic agent for cancer, comprising the probe for diagnosing cancer according to claim 40 and / or the antibody according to claim 21 or 22. 42. A diagnostic agent for cancer, which is malignant melanoma, esophageal cancer,
42. The diagnostic agent for cancer according to claim 41, which is a diagnostic agent for one or more cancers selected from bladder cancer, lung cancer, brain tumor, pancreatic cancer, prostate cancer, and breast cancer.