EP1121435A1 - Camel, ein alternatieves translationsprodukt des tumorantigens lage-1 - Google Patents

Camel, ein alternatieves translationsprodukt des tumorantigens lage-1

Info

Publication number
EP1121435A1
EP1121435A1 EP99953854A EP99953854A EP1121435A1 EP 1121435 A1 EP1121435 A1 EP 1121435A1 EP 99953854 A EP99953854 A EP 99953854A EP 99953854 A EP99953854 A EP 99953854A EP 1121435 A1 EP1121435 A1 EP 1121435A1
Authority
EP
European Patent Office
Prior art keywords
seq
camel
tumor
lage
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99953854A
Other languages
English (en)
French (fr)
Inventor
Peter I. Schrier
Corlien A. Aarnoudse
Karl-Heinz Heider
Christoph Klade
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boehringer Ingelheim International GmbH
Leids Universitair Medisch Centrum LUMC
Original Assignee
Boehringer Ingelheim International GmbH
Leids Universitair Medisch Centrum LUMC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boehringer Ingelheim International GmbH, Leids Universitair Medisch Centrum LUMC filed Critical Boehringer Ingelheim International GmbH
Priority to EP99953854A priority Critical patent/EP1121435A1/de
Publication of EP1121435A1 publication Critical patent/EP1121435A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates to the field of cancer therapy, more specifically to tumor-associated antigens.
  • Cytotoxic T lymphocytes play an important role in the defense against melanoma.
  • Melanoma-specific CTL clones have been obtained from either tumor infiltrating lymphocytes (TIL) in vitro stimulated with cytokines, or from peripheral blood mononuclear cells (PBMC) cultured with (autologous) tumor cells. T cell responses against tumor cells are enhanced by cytokine transfection of the tumor cells, both in animal models and in in vitro human culture systems, (van Elsas et al., 1997; Gansbacher et al., 1990; Tepper et al., 1989; Fearon et al., 1990; Dranoff et al., 1993)
  • T cell targets can be divided in three groups: 1) tumor-specific antigens, not expressed in healthy tissues, except testis and placenta (e.g., MAGE, BAGE, GAGE, NY-ESO-1 , LAGE-1); 2) antigens that are lineage-specific and expressed in both melanoma and melanocytes (e.g., MART-1/ Melan- A, gp100, tyrosinase) and 3) unique, mutated antigens (e.g., ⁇ -catenin, CDK4, MUM-1) (reviewed by Van den Eynde and Brichard, 1995).
  • testis and placenta e.g., MAGE, BAGE, GAGE, NY-ESO-1 , LAGE-1
  • antigens that are lineage-specific and expressed in both melanoma and melanocytes e.g., MART-1/ Melan- A, gp100, tyrosinase
  • RDA Representational Difference Analysis
  • NY-ESO-1 is a gene originally identified by SEREX technology (Chen et al., 1997). It was shown to have two different reading frames (DNA sequences and derived protein sequences given in SEQ ID NO: 7 - 10), translation products of which were shown to contain epitopes of tumor specific T-cells (Jager et al., 1998; Wang et al., 1998).
  • melanoma cell line 518A2 and its IL-2- or GM-CSF-transfectants were compared for their CTL stimulating capacity in vitro. Stimulation of autologous PBMC with the IL-2 producing melanoma cells resulted in a melanoma-specific CTL response (van Elsas et al., 1997).
  • CTL clones derived from this culture recognized, besides autologous melanoma cell lines, also a panel of HLA-A * 0201 positive melanoma cell lines, but were not reactive with normal melanocytes.
  • 518A2 was shown to express a number of antigens previously identified to be recognized by anti-melanoma CTL (van Elsas et al., 1996), the CTL clones available recognize a new melanoma-specific antigen that is immunodominant in 518A2.
  • CAMEL CTL-recognized Antigen on Melanoma
  • CAMEL is encoded by a reading frame of the LAGE-1 s -cDNA (SEQ ID NO:3) that is distinct from that encoding the putative LAGE-1 protein (SEQ ID NO: 4). (This reading frame is designated ORF-1.)
  • a cDNA clone was identified that lacks the first 84 bp of the LAGE-1 3 sequence (SEQ ID NO: 3) which means that it is devoid of the initiation codon at position 54 of that sequence (Fig. 2a).
  • the first possible translation initiation site in this clone (4H8) is the ATG at position 94 of LAGE-1 s (SEQ ID NO: 3), which is however, not in frame with the first ATG at position 54. Therefore, the CAMEL protein (SEQ ID NO: 2) translated from the 4H8 cDNA clone is different from the putative LAGE-1 s protein (SEQ ID NO: 4).
  • the present invention is directed to the tumor-associated antigen CAMEL (SEQ ID NO: 2) which is encoded by an isolated DNA molecule with the sequence as defined in SEQ ID NO: 1.
  • the coding sequence of CAMEL corresponds to the ORF-1 of LAGE-1 cDNA (Lethe et al., 1997; WO 98/32855).
  • the present invention relates to immunogenic (poly)peptides derived from CAMEL.
  • a first group of peptides is selected from peptides inducing a humoral immune response (induction of antibodies). Such peptides are selected by randomly choosing continuous stretches of amino acids (at least 12-15), applying them to an individual and confirming the generation of antibodies by standard immunological assays, e.g. ELISA.
  • This group of immunogenic (poly)peptides also encompasses the entire CAMEL antigen or larger fragments thereof.
  • the second group of peptides which is preferred, can be presented by MHC molecules (in humans: HLA molecules), they have the potential to induce an immune response, in particular by eliciting a CTL response.
  • immunogenic peptides which have the ability to elicit a CTL response are selected from peptides with the sequence set forth in SEQ ID NO: 11 , 12, 24, 25 and 26.
  • SEQ ID NO: 11 , 12, 24, 25 and 26 the selection of peptide sequences from a given antigen is, in the first place, based on the requirement for such peptide to bind to an MHC molecule present in the repertoire of the patient to be treated.
  • Two classes of MHC molecules are distinguished, class I and class II.
  • Class I molecules consist of a membrane-inserted heavy chain and a non-covalently attached light chain. In their structure, MHC class I molecules resemble a moose's head, the antlers forming a groove which is recognized by the peptide.
  • HLA-A, B and C are the "classical" MHC class I molecules.
  • Additional immunogenic peptides may be identified by methods known in the art which rely on the correlation between MHC-binding and CTL induction, e.g. those used by Stauss et al., 1992, who identified candidate T-cell epitopes in human papilloma virus.
  • immunogenic peptides can be predicted based on their "peptide binding motif" synthetic peptides which represent CTL epitopes may be designed and synthesized.
  • synthetic peptides which represent CTL epitopes may be designed and synthesized.
  • the protein sequence is screened for stretches fitting to the basic anchor motif (two anchors in most cases), whereby allowance should be made for some variation in peptide lengths as well as in anchor occupancy. If a motif, for example calls for 9mers with lie or Leu at the end, 10mers with a fitting C-terminus should be considered as well, and other aliphatic residues at the C-terminus, like Val or Met, should also be considered. In this way, a list of peptide candidates is obtained.
  • Binding assays can be performed at this stage to exclude weak binders which occur frequently among peptides conforming to a basic motif. If a detailed study on peptide binding requirements is available, the candidates can also be screened for non-anchor residues detrimental or optimal for binding (Ruppert et al., 1993).
  • Examples for peptide candidates with potential immunogenicity that can be derived from the tumor-associated antigen of the present invention are the CAMEL-derived peptides with the sequence HLSPDQGRF and LMAQEALAF for HLA-A3 or RMAVPLLR ⁇ for HLA-A3101. Similarly, other peptides for these or for other alleles can be determined by the method mentioned above. The peptide binding can be tested in peptide binding assays.
  • immunogenicity of the selected peptide or peptide equivalent as defined below, which is the crucial parameter for peptide-based vaccine development and which in most cases strongly correlates with the stability of the peptide-MHC interaction (van der Burg et al., 1996)
  • the methods described by Sette et al., 1994, in combination with quantitative HLA-binding assays may be used.
  • immunogenicity of the selected peptide may be checked by performing in vitro CTL induction by known methods e.g. as described below for ex vivo CTL induction.
  • peptides derived from the naturally expressed tumor antigens functional equivalents thereof, i.e. peptides with partially altered sequences or substances mimicking peptides, e.g. "peptidomimetics” or retro-inverso peptides, may be obtained by the following methods:
  • amino acid substitutions may be introduced at anchor positions to increase peptide MHC class I- binding affinity.
  • the modified peptides are subsequently evaluated for enhanced binding and immunogenicity by screening for recognition by TIL (tumor-infiltrating lymphocytes) and CTL induction as described by Parkhurst at al, 1996, and Bakker et al., 1997.
  • the selection of peptides capable of eliciting a cellular immune response is carried out in several steps, as described in WO 97/30721 , which disclosure is incorporated herein by reference.
  • the candidates are first tested for their binding ability to an MHC molecule; subsequently good binders are tested for immunogenicity.
  • a general strategy for obtaining efficient immunogenic peptides has been described by Schweighoffer, 1997.
  • polypeptide of the present invention or immunogenic peptides derived from its sequence, respectively can be produced recombinantly or by peptide synthesis, as described in WO 96/10413, the disclosure of which is incorporated herein by reference.
  • a DNA molecule encoding the antigen or the CTL peptide of interest is inserted into an expression vector, transformed or transfected into an appropriate host cell, cultivated under conditions suitable for expression, recovered and purified.
  • various conventional techniques may be used, e.g. commercially available automatic synthesizers.
  • the tumor antigen of the present invention and the immunogenic peptides derived therefrom or the respective peptide equivalents are useful in cancer therapy, e.g. to induce, in the context of the appropriate MHC presenting molecule, an immunological response to tumors which express the corresponding antigen determinants.
  • the induction of CTLs can be accomplished in vivo or ex vivo.
  • a pharmaceutical composition comprising the peptide/antigen is administered to an individual suffering from a tumor associated with the respective tumor antigen in an amount sufficient to elicit an effective CTL response to the antigen-bearing tumor.
  • the present invention provides pharmaceutical compositions for therapeutic treatment which are intended for parenteral, topical, oral or local administration.
  • the compositions are for parenteral administration, e.g. for intravenous, subcutaneous, intradermal or intramuscular application.
  • the peptides/antigens are dissolved or suspended in a pharmaceutically acceptable carrier, preferably an aqueous carrier.
  • the composition may contain additional auxiliary substances, e.g. buffering agents, etc.
  • the peptides may be used alone or in combination with adjuvants, e.g. saponins, alumn, or, in a particularly preferred embodiment, polycations, like polyarginine or polylysine.
  • the peptides may also be linked to components assisting CTL priming, e.g. T helper peptides, lipids or liposomes or coadministered with such components or with immunostimulating substances, e.g. cytokines (IL-2, IFN- ⁇ ).
  • cytokines IL-2, IFN- ⁇
  • the immunogenic peptides may also be used to elicit a CTL response ex vivo.
  • An ex vivo CTL response to a tumor expressing the antigen is induced by incubating a patient's CTL precursor cells together with antigen presenting cells and the immunogenic peptide.
  • the thus activated CTLs are allowed to mature and expand to effector CTLs which are then readministered to the patient.
  • the tumor antigen may be pulsed onto APCs which present MHC class ll-reactive peptides
  • the peptides of the invention are preferably applied as a combination of peptides, e.g. different CAMEL-peptides.
  • the peptides of the invention are combined with peptides derived from other tumor antigens, e.g. LAGE-1 and ESO-NY-1.
  • the selection of the peptides is optimized towards covering multiple HLA types in order to be useful for a broad population of patients and/or towards a broad variety of malignancies, which is taken into account by combining peptides from a large variety of tumor antigens.
  • the number of peptides suitable to be combined to yield an efficient therapy may vary within a broad range, e.g. from about 2 to approximately 100.
  • the present invention is directed to an isolated DNA molecule with the sequence set forth in SEQ ID NO: 1 encoding CAMEL.
  • This DNA molecule which is designated "CAMEL-DNA”
  • contains the ORF-1 of LAGE-1 cDNA which is defined by nucleotides 54 - 336 of the sequence set forth in SEQ ID NO: 3.
  • the CAMEL-DNA of the present invention may be used, as an alternative to the use of the protein or the peptide, for cancer immunotherapy.
  • engineered derivatives may be utilized. These include sequences modified to encode (poly)peptides with improved immunogenicity, e.g. taking into account the modifications described above for the peptides. Another form of modification is the assembly of multiple sequences encoding immunologically relevant peptides in a so-called string-of-beads fashion, as described by Toes et al., 1997.
  • the sequences may also be modified by adding auxiliary coding elements, e.g. targeting functions that ensure more efficient delivery and processing of the immunogen (e.g. Wu et al., 1995).
  • the nucleic acid molecules may be delivered either directly or as part of a recombinant virus or bacterium.
  • any method that is known for gene therapy may be applied for nucleic acid-based cancer immunotherapy, both in vivo and ex vivo.
  • Examples for in vivo delivery are direct injection (injection of "naked” DNA) either intramuscularly or by "gene gun", which has been shown to result in the generation of CTLs against tumor antigens.
  • Examples for recombinant organisms are vaccinia virus, fowlpox virus and adenovirus or Listeria monocytogenes (see Coulie, 1997 for a comprehensive review).
  • synthetic nucleic acid carriers like cationic lipids, microspheres, microbeads, liposomes may be useful for in vivo delivery of the sequence encoding respective antigen/peptide.
  • various auxiliary agents that enhance the immune response may be co-applied, e.g.
  • cytokines either as proteins or as plasmids encoding these.
  • Examples for ex vivo delivery are transfection of dendritic cells (Tuting, T., 1997) or other antigen presenting cells which are applied as a cellular cancer vaccine.
  • the present invention is also directed to the use of cells that express the tumor-associated antigen of the invention, either naturally or upon transfection with the respective coding sequence, for the preparation of a tumor vaccine.
  • NY-ESO-1 is a recently described tumor antigen, identified by screening a cDNA library of an esophagus carcinoma with autologous patient serum (SEREX-method (Chen et al., 1997)). NY-ESO-1 is expressed in different tumor types but not in healthy tissues except the testis.
  • the epitope of specific CTL 1/29 was determined by cDNA expression cloning and a truncated LAGE-1 cDNA clone was found. This truncation led to the identification of the peptide epitope in an alternative reading frame, since the "normal" translation initiation site of LAGE-1 was absent.
  • COS/HLA-A*0201 cells transfected with full length LAGE-1 or NY-ESO-1 cDNA clones could stimulate the CTL clone to TNF- production as well. This probably means that two different proteins can be translated from one single mRNA.
  • NY-ESO-1 also has been described as the target of melanoma-specific HLA-A*0201 restricted CTL clones, which recognize an epitope translated in ORF3, located between aa 155 and 167 (Jager et al., 1998). Therefore, it is very likely that also LAGE-1 s will be recognized by these clones, but not LAGE-1 L , since the protein sequence is different at this part of the molecule.
  • the CAMEL-specific CTL clones recognize a peptide in an alternative reading frame, which is encoded in both LAGE-1 and NY-ESO- 1. This means that tumor cells expressing either LAGE-1 or NY-ESO-1 can be recognized by MLMAQEALAFL-specific CTL, which might enlarge the number of tumors that can be treated with immunotherapy based on this peptide.
  • FIG. 1 COS-7 transfection experiments with cDNA clone CAMEL and deletion constructs
  • COS-7 cells were transfected with cDNAs as indicated and tested with CTL 1/29 in a TNF- ⁇ release assay.
  • TNF- ⁇ release assay with predicted HLA-A * 0201 binding CAMEL peptides. Peptides as indicated were loaded on BLM, an HLA-A*0201 + melanoma cell line, at a concentration of 10 ⁇ g/ml and tested with CTL 1/29 in a TNF- ⁇ release assay.
  • COS/HLA-A*0201 cells were transfected with these cDNA clones and reactivity with CTL 1/29 was measured in a TNF- ⁇ release assay.
  • Figure 5 His-tagged CAMEL protein, synthesized in E.coli
  • SEQ ID NO: 1 CAMEL (4H8) cDNA sequence and translation
  • SEQ ID NO: 2 CAMEL protein sequence
  • SEQ ID NO: 3 LAGE-1 s cDNA sequence and translation
  • SEQ ID NO: 4 LAGE-1 s protein sequence
  • SEQ ID NO: 5 LAGE-1 L cDNA sequence and translation
  • SEQ ID NO: 6 LAGE-1 L protein sequence
  • SEQ ID NO: 7 NY-ESO-1 cDNA sequence
  • translation SEQ ID NO: 8 NY-ESO-1 protein sequence
  • SEQ ID NO: 9 NY-ESO-1 cDNA and alternative translation
  • SEQ ID NO: 10 protein sequence of alternatively translated NY-ESO-1
  • SEQ ID NO: 11 peptide sequence of the CAMEL CTL epitope (11 -mer)
  • SEQ ID NO: 12 peptide sequence of the CAMEL CTL epitope (10-mer)
  • SEQ ID NO: 13 oligonucleotide SP6F-pSV
  • SEQ ID NO: 14 oligonucleotide R1
  • SEQ ID NO: 15 oligonucleotide R2
  • SEQ ID NO: 16 oligonucleotide T7R-pSV
  • SEQ ID NO: 17 oligonucleotide F3
  • SEQ ID NO: 18 oligonucleotide ESO-1 B
  • SEQ ID NO: 19 oligonucleotide ESO-1A
  • SEQ ID NO: 20 oligonucleotide 4H8-A
  • SEQ ID NO: 21 oligonucleotide 4H8-C
  • Melanoma cell lines and COS-7 cells were maintained in DMEM containing 4.5 mM glucose supplemented with 8% FCS, 2 mM L-glutamine, 100 ⁇ g/ml of each penicillin and streptomycin.
  • Melanoma cell line 518A2 was established from the dissected metastasis of a male patient in 1985, as described before (Versteeg et al., 1988).
  • An IL-2 producing variant, 518/IL- 2.14, was obtained by transfection of 518A2 with the IL-2 cDNA (Osanto et al., 1993).
  • melanoma cells that were used as targets in TNF- ⁇ release assay are FM3.29, FM6, FM28.4 and FM55P (gifts from J. Zeuthen, Denmark), MM127, MM415, MM485 (gifts from N. Hayward, Australia), SK- MEL-23, SK-MEL-29 (obtained from T. Wolfel, Mainz), MM0221 , Mi3046/2, NA8, BLM (obtained from M. Visseren, Leiden). EBV-transformed B-LCL and the TNF- ⁇ -sensitive WEHI-164 clone 13 (a gift from Dr. P. Coulie, Brussels) were cultured in RPMI-1640, supplemented with L-glutamine and antibiotics as above, and 10% FCS.
  • a cDNA library of 518/IL-2.14 was constructed in the expression vector pSVsportl (GIBCO, BRL) using the Superscript Plasmid System (GIBCO, BRL).
  • poly-A + mRNA was isolated using the Fast-Track system (Invitrogen), followed by reverse-transcription with an oligo-dT/Notl primer.
  • Sail adapters were ligated to ds-cDNA and after Notl digestion and size fractionation, cDNA fragments were cloned into the pSVsportl vector digested with Sail and Notl.
  • ElectroMAX-DH10B GIBCO, BRL
  • 50-100 colonies were pooled for mini DNA isolation (QIAprep 8 plasmid kit, Qiagen).
  • the in this way obtained cDNA pools were transfected in duplicate into COS-7 cells, together with the restriction element HLA-A * 0201 (pBJ1.neo/HLA-A * 0201 , (Lin et al., 1990)), using the DEAE-dextran method.
  • COS-7 cells were seeded in 96-wells flatbottom plates at 1.5x10 4 cells per well in 100 ⁇ l DMEM, 8% FCS.
  • cDNA clone 4H8 Deletion constructs of cDNA clone 4H8 were obtained by PCR. PCR products were cloned in vector pCR3.uni (TA cloning system, Invitrogen). The constructs pCR-246 and pCR-464 were made with the vector-based forward primer, SP6F-pSV (SEQ ID NO: 13) and the reverse primers in cDNA 4H8, R1 (SEQ ID NO: 14) and R2 (SEQ ID NO: 15) respectively.
  • CTL reactivity against tumor target cells transfected COS-7 or peptide loaded cells was measured in a TNF- ⁇ release assay.
  • Target cells were seeded in duplicate or triplicate at 1.5-2x10 4 cells per well in a 96-wells flat bottom plate and 1500-2000 CTL were added to each well, in a total volume of 100 ⁇ l / well (IMDM, supplemented with antibiotics and 5% FCS). After 24 hours of co-culturing of effector and target cells, 50 ⁇ l out of each well was added to a fresh 96-wells flatbottom plate, containing 50 ⁇ l
  • TNF- ⁇ -sensitive WEHI-164 cells per well in IMDM, supplemented with antibiotics, 5% FCS, 2 ⁇ g/ml Actinomycin D and 40 mM LiCI.
  • a viability staining was performed 24 hours later by the addition of 50 ⁇ l of 3-(4,5dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) solution (2.5 mg/ml in PBS). After incubation for 2-4 hours at 37°C the OD5 50 - 6 5 0 was measured.
  • TNF- ⁇ release in pg/ml was calculated from a standard with known TNF- ⁇ concentrations.
  • cDNA synthesis was performed using oligo-dT and M-MLV reverse transcriptase (Promega). Primers used for LAGE-1 specific PCR were the F3 (SEQ ID NO: 17) and ESO-1 B primer (SEQ ID NO: 18). ESO-1 B was also used as a reverse primer in the NY-ESO-1 -specific PCR, while ESO-1A (SEQ ID NO: 19) was the forward primer in this reaction (Chen et al., 1997). Reactions were performed in a Biometra-Uno or -Trio programmed as follows: 5 minutes 95°C, 30 cycles of 1 min. 95°C, 1 min. 58°C, 1 min. 72°C, followed by 10 minutes 72°C.
  • a fragment containing the coding sequence of CAMEL was made by PCR with the following primers:
  • 4H8-A GAAGAACATATGCTGATGGCCCAGGAGGC (SEQ ID NO: 20)
  • 4H8-C TTAAAGATCTCAGAACCGCCCCTGGTCG (SEQ ID NO: 21)
  • This fragment was digested with Ndel and Bglll and cloned in the Ndel and BamHI sites of vector pET19b (Novagen, Madison, Wl).
  • This vector contains a 6xHis-tag coding sequence, allowing detection of the His-tagged protein with an anti-His antibody.
  • Antibodies against the CAMEL protein were raised by immunizing two rabbits with three synthetic peptides derived from hydrophobic regions of this molecule :
  • F4 (K)GAMLAAQERRVPRAAEV(K) (pos. 15-31 of SEQ ID NO: 2)
  • A5 (K)GQQGPRGREEAPRGVRM(K) (pos. 36 -52 of SEQ ID NO: 2)
  • B5 (K)KRRMEGAPAGPGGRTAA(K) (pos. 58 -73 of SEQ ID NO: 2) (The lysine residues at both termini enable the peptides to be linked to KLH.)
  • each peptide was linked chemically to 2.5 mg of the carrier molecule KLH (Keyhole Limpet Hemocyanin) and after dialyzing, 0.8 mg of this protein in CFA (Complete Freund's Adjuvants) was weekly injected subcutaneously.
  • CFA Complete Freund's Adjuvants
  • Another rabbit was injected six times with the three peptides, not linked to KLH, following the scheme of 300 ⁇ g s.c. in CFA, 300 ⁇ g s.c. in IFA, 4x boost of 150 ⁇ g.
  • the reactivity and specificity of the antisera were confirmed in ELISA and Western blot experiments.
  • antisera of both rabbits were reactive with the recombinant CAMEL protein synthesized in E.coli, but differed in their precise epitope: rabbit no. 1 produced antibodies against the CAMEL-B5 peptide, whereas the serum of rabbit no. 2 reacted with peptide F4.
  • the antisera will further be referred to as "antiserum B5" and "antiserum F4".
  • the CAMEL coding sequence was fused to the Aequorea victoria -derived Green Fuorescent Protein (GFP).
  • the CAMEL cDNA molecule was cloned into the pEGFP-N1 vector (Clontech), which contains a cDNA encoding the Enhanced, red shifted variant of GFP.
  • pEGFP-N1 vector (Clontech)
  • two primers were designed.
  • the forward primer designated CAMEL-XHO covers the initiation codon ATG and contains an Xho1 site and the reverse primer CAMEL-KPN (AAGGJACCTTGAACCGCCCCTGGTCG; SEQ ID NO: 23) contains a mutation of the stop-codon and a Kpn1 site.
  • the vector carrying the fusion construct was transfected into COS cells by calcium phosphate precipitation, protein lysates of the cells were used for Western blotting using CAMEL antisera against the CAMEL peptides B5 and F4, and anti- EGFP antibodies to detect the fusion protein according to standard protocols.
  • cDNA clone 4H8 encodes the target for melanoma-specific CTL1/29
  • the antigenic epitope of melanoma-specific CTL 1/29 was identified by the expression of cDNA library 518/IL2.14 and the restriction element HLA- A*0201 in COS-7 cells, followed by CTL screening in a TNF- ⁇ release assay.
  • a positive pool of cDNAs was subcloned and clone 4H8, called CAMEL (SEQ ID NO: 1), was found to stimulate TNF- ⁇ release by the CTL to a similar extent as the original 518/IL2.14 cell line (Fig. 1).
  • COS-7 cells or COS-7 cells transfected with HLA-A * 0201 or the 4H8 cDNA only were not recognized.
  • the isolated 4H8 cDNA clone has a 679 bp insert, which shows strong homology with NY-ESO-1 (SEQ ID NO: 7), a tumor antigen originally identified as a target for humoral immune responses by serum screening methods (SEREX) (Chen et al., 1997).
  • Colony hybridization of the cDNA library, using clone 4H8 as a probe resulted in the detection of 2 types of full length clones which were called LAGE-1 s (SEQ ID NO: 3) and LAGE-1 L (SEQ ID NO: 5) (Fig. 2a).
  • LAGE-1 L contains a 229 bp insertion at position 457, which has the consensus sequences for an intron, starting with a 5' GT and ending 3' AG. This indicates alternative splicing of LAGE-1 mRNA. However, cDNA clone 4H8 lacks the first 84 bp of the LAGE-1 cDNA sequence.
  • the peptide epitope of CTL 1/29 is coded in an alternative reading frame of LAGE-1 or NY-ESO-1
  • deletion constructs of cDNA 4H8 were transfected in HLA-A*0201 + COS-7 cells and tested in a TNF- ⁇ release assay. CTL reactivity was measured with all constructs (Fig. 1 b), indicating that the epitope was coded within the first 330 bp of clone 4H8.
  • An HLA-A * 0201 binding motif search was performed on the predicted protein sequence of that region (Drijfhout et al., 1995; D'Amaro et al., 1995), presuming that the ATG at position 10 in 4H8 functions as the translation initiation site.
  • cDNA clone 4H8 lacks the first 84 bp of the LAGE-1 s sequence, which means that it is devoid of the initiation codon at position 54 of that sequence (Fig. 2a).
  • the first possible translation initiation site in 4H8 corresponds with the ATG at position 94 of LAGE-1 s , which is however, not in frame with the first ATG at position 54. Therefore, the protein translated from the 4H8 cDNA clone is different from the putative LAGE-1 protein, since translation takes place in another reading frame (Fig. 2a and b).
  • 4H8 encodes a protein of 109 amino acids (SEQ ID NO: 2) with a predicted molecular weight of 11.7 kD.
  • the LAGE-1 s protein translated from the first ATG will be a 180 aa protein of 18.2 kD (SEQ ID NO: 4), while the unspliced variant, LAGE-1 L , encodes a 210 aa protein of 21.1 kD (SEQ ID NO: 6).
  • NY-ESO-1 protein (SEQ ID NO: 8) is probably of the same size as LAGE-1 s , but differs at 26 amino acids. However, if translation of LAGE- 1 S/L starts at the second ATG, proteins will be translated in another reading frame and are in that case identical to the protein translated from cDNA 4H8.
  • COS/HLA-A * 0201 cells transfected with LAGE-1 s the alternatively spliced LAGE-1 L (as well as with the NY-ESO-1) cDNA are able to stimulate CTL 1/29 (Fig. 4).
  • CTL 1/29 Fig. 4
  • protein translation also starts from the second start codon at nucleotide 94 in LAGE-1 s , notwithstanding the presence of the first ATG at position 54. Also in this case, this results in the "alternative reading frame" peptide, MLMAQEALAFL, recognized by CTL 1/29.
  • the CAMEL cDNA (SEQ ID No: 1) was cloned in a bacterial expression vector (pET19b) (Studier et al., 1990). This vector contains a 6xHis-tag coding sequence, allowing detection of the His-tagged protein with an anti-His antibody.
  • the pET19b-CAMEL construct was transformed into E.coli and the bacteria were treated with IPTG to induce expression of the His-tagged CAMEL protein. Extracts were analyzed by Western blotting using the Penta-His antibody. Western blotting of a lysate shows a 15.5 kD protein, only slightly higher than the expected 14.5 kD of the His-tagged CAMEL protein after staining with a anti-His antibody (Hg. 5).
  • the CAMEL cDNA (SEQ ID No: 1) was cloned in pET19b and expressed in E.Coli. Lanes 1 and 2 represent the samples taken at Oh, lanes 3 and 4 at 4h after induction with IPTG. Because CAMEL might be an unstable protein, induction of protein expression was performed in the absence
  • Hybridisation of Multiple Tissue Northern blots containing RNA of healthy human tissues with the LAGE-1 s cDNA showed high expression in testis and placenta and low, (but clear) expression in heart, skeletal muscle and pancreas (Fig. 6a).
  • the positive signals exist of two bands, probably reflecting LAGE-1 s /NY-ESO-1 (750 bp) and LAGE-1 L (1000 bp).
  • LAGE-1 mRNA was detected in a panel of tumor cell lines and tumor tissues and in a restricted number of healthy tissues by means of RT-PCR and Northern blot experiments. However, it remained to be determined whether in cells expressing the LAGE-1 mRNA also the alternatively translated CAMEL is produced.
  • CAMEL expression was detected. About half of the positive cases showed expression of CAMEL in 40% or more of the tumor cells, in some of the cases close to 100% of the tumor cells showed CAMEL-specific staining (an example is shown Figure 7, Colon AC). In the majority of tumor specimens expression was heterogeneous ranging from less than 10% of positive tumor cells to more than 70% of positive tumor cells (Table 2; examples are shown in Figure 7, arrows indicate positive tumor cell staining).
  • CAMEL SEQ ID NO:2
  • FLMAQGAML SEQ ID NO: 24
  • CAMEL16 AMLAAQERRV
  • CAMEL17 MLAAQERRV (SEQ ID NO:26)
  • HLA-A2 restricted CTL-epitopes from CAMEL (MLMAQEALAFL, SEQ ID NO:11) or tyrosinase (W ⁇ lfel et al., 1994; YMNGTMSQV, SEQ ID NO:27) were applied.
  • Negative controls included an HLA-A1 binding (and therefore irrelevant) peptide from MAGE-3 (Gaugler et al. , 1994; EVDPIGHLY, SEQ ID NO:28) or no peptide at all.
  • CAMEL10 binds with similar affinity to HLA-A2 as compared to the positive controls used in the assay.
  • the two other peptides (CAMEL16 and CAMEL17) showed only low affinity in this assay. Therefore in particular CAMEL10 represents a potential new HLA-A2 restricted CTL-epitope derived from CAMEL protein (FIG. 8).
  • Murine interleukine-4 displays potent anti-tumour activity in vivo. Cell 57, 503-512.
  • van Elsas A., van der Minne, C.E., Borghi, M., van der Spek, C.W., Braakman, E., Osanto, S., and Schrier, P.I. (1996).
  • Transfection of IL-2 augments CTL response to human melanoma cells in vitro: immunological characterization of a melanoma vaccine. Journal of Immunotherapy 20, 343-353.
  • c-Myc downregulates class I HLA expression in human melanomas. EMBO J. 7, 1023-1029.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP99953854A 1998-10-16 1999-10-15 Camel, ein alternatieves translationsprodukt des tumorantigens lage-1 Withdrawn EP1121435A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP99953854A EP1121435A1 (de) 1998-10-16 1999-10-15 Camel, ein alternatieves translationsprodukt des tumorantigens lage-1

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP98119583A EP1001022A1 (de) 1998-10-16 1998-10-16 CAMEL, ein alternatives Translationsprodukt des Tumorantigenes LAGE-1
EP98119583 1998-10-16
PCT/EP1999/007832 WO2000023584A1 (en) 1998-10-16 1999-10-15 Camel, an alternative translation product of the tumour antigen lage-1
EP99953854A EP1121435A1 (de) 1998-10-16 1999-10-15 Camel, ein alternatieves translationsprodukt des tumorantigens lage-1

Publications (1)

Publication Number Publication Date
EP1121435A1 true EP1121435A1 (de) 2001-08-08

Family

ID=8232812

Family Applications (2)

Application Number Title Priority Date Filing Date
EP98119583A Withdrawn EP1001022A1 (de) 1998-10-16 1998-10-16 CAMEL, ein alternatives Translationsprodukt des Tumorantigenes LAGE-1
EP99953854A Withdrawn EP1121435A1 (de) 1998-10-16 1999-10-15 Camel, ein alternatieves translationsprodukt des tumorantigens lage-1

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP98119583A Withdrawn EP1001022A1 (de) 1998-10-16 1998-10-16 CAMEL, ein alternatives Translationsprodukt des Tumorantigenes LAGE-1

Country Status (5)

Country Link
EP (2) EP1001022A1 (de)
JP (1) JP2002527109A (de)
CA (1) CA2346942A1 (de)
MX (1) MXPA01003697A (de)
WO (1) WO2000023584A1 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6794131B1 (en) 1998-01-27 2004-09-21 Ludwig Institute For Cancer Research Lage-1 tumor associated nucleic acids

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2527946T3 (es) 2003-03-05 2015-02-02 Dendreon Corporation Composiciones y métodos que emplean polipéptidos de marco de lectura alternativa para el tratamiento de cáncer y enfermedades infecciosas
DE102018107224A1 (de) 2018-02-21 2019-08-22 Immatics Biotechnologies Gmbh Peptide und Kombinationen von Peptiden nicht-kanonischen Ursprungs zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1961820B1 (de) * 1997-01-27 2012-11-28 Ludwig Institute for Cancer Research Ltd Impfstoffzusammensetzung welche LAGE-1-Tumor-assoziierte Nukleinsäuren oder LAGE-1 Polypeptide enthält
WO1999018206A2 (en) * 1997-10-08 1999-04-15 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Human cancer antigen ny eso-1/cag-3 and gene encoding same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0023584A1 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7563870B2 (en) 1997-01-27 2009-07-21 Ludwig Institute For Cancer Research Ltd. LAGE-1 tumor associated nucleic acids
US7998483B2 (en) 1997-01-27 2011-08-16 Ludwig Institute For Cancer Research Ltd. Lage-1 tumor associated nucleic acids
US6794131B1 (en) 1998-01-27 2004-09-21 Ludwig Institute For Cancer Research Lage-1 tumor associated nucleic acids

Also Published As

Publication number Publication date
JP2002527109A (ja) 2002-08-27
CA2346942A1 (en) 2000-04-27
EP1001022A1 (de) 2000-05-17
MXPA01003697A (es) 2003-10-14
WO2000023584A1 (en) 2000-04-27

Similar Documents

Publication Publication Date Title
Aarnoudse et al. Interleukin‐2‐induced, melanoma‐specific T cells recognize CAMEL, an unexpected translation product of LAGE‐1
AU749544B2 (en) Tumor antigen peptides originating in cyclophilin B
US20080107668A1 (en) Cytotoxic t-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
WO2007150077A2 (en) Cytotoxic t-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
CA2722364A1 (en) Melanoma antigens
WO2005095598A1 (ja) Ｗｔ１由来の癌抗原ペプチド
JP2012180359A (ja) メラノーマ関連ｍｈｃクラスｉ関連オリゴペプチドおよびその使用
AU748250B2 (en) Tumor antigen peptide derivatives
WO2009036246A2 (en) Immunogens that induce cytotoxic t-lymphocytes and their use in prevention, treatment, and diagnosis of cancer
CA2772551A1 (en) Cytotoxic t-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
NZ520673A (en) Tumour-specific animal proteins
WO1997011669A2 (en) Mhc-class ii restricted melanoma antigens and their use in therapeutic methods
US7071294B1 (en) Tumor antigen protein art-1 and tumor antigen peptide thereof
AU756398B2 (en) Novel compounds
EP1001022A1 (de) CAMEL, ein alternatives Translationsprodukt des Tumorantigenes LAGE-1
US6664232B1 (en) HLA-A2 restraint tumor antigen peptide originating in SART-1
MXPA01012012A (es) Antigeno (42) asociado a tumores.
CA2441225C (en) A novel trp2 isoform containing hla-a2 restricted cytotoxic t lymphocyte epitopes
AU2001275490A1 (en) MHC peptides over-expressed on prostate cancer cells and methods of use
Kast Peptide-based cancer vaccines
CA2387043A1 (en) Colon-tumour-associated antigens

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010516

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20040408

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20041019