EP1104468A1 - Genetic method for the expression of polyproteins in plants - Google Patents

Genetic method for the expression of polyproteins in plants

Info

Publication number
EP1104468A1
EP1104468A1 EP99940345A EP99940345A EP1104468A1 EP 1104468 A1 EP1104468 A1 EP 1104468A1 EP 99940345 A EP99940345 A EP 99940345A EP 99940345 A EP99940345 A EP 99940345A EP 1104468 A1 EP1104468 A1 EP 1104468A1
Authority
EP
European Patent Office
Prior art keywords
propeptide
protein
linker
sequence
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99940345A
Other languages
German (de)
English (en)
French (fr)
Inventor
W. F. F A Janssens Lab. of Genetics BROEKAERT
I. E. J. A. F A Janssens Lab. of Gen. FRANCOIS
M. F. C. F A Janssens Lab. of Genetics DE BOLLE
Ian Jeffrey Evans
John Anthony Ray
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Syngenta Ltd
Original Assignee
Syngenta Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9818001.1A external-priority patent/GB9818001D0/en
Priority claimed from GBGB9826753.7A external-priority patent/GB9826753D0/en
Application filed by Syngenta Ltd filed Critical Syngenta Ltd
Publication of EP1104468A1 publication Critical patent/EP1104468A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site

Definitions

  • the present invention relates to a method for increasing protein expression levels, in particular by the coexpression of two or more proteins in plants within a single transcription unit, to the coexpression and secretion of two or more proteins in plants, to linker sequences for use in the method of the invention, to DNA constructs for use in the invention and to plants transformed with the constructs of the invention.
  • transgenic plants expressing multiple transgenes For many applications based on genetic modification of plants by transgenesis, it is desirable to express co-ordinately two or more transgenes. For instance, coexpression in plants of transgenes encoding antimicrobial proteins with different biochemical targets can result in enhanced disease resistance levels, resistance against a broader range of pathogens, or resistance that is more difficult to overcome by mutational adaptation of pathogens. Other examples include those aimed at producing a particular metabolite in transgenic plants by coexpression of multiple transgenes that are involved in a biosynthetic pathway. There are different ways to obtain transgenic plants expressing multiple transgenes. One frequently chosen option is to introduce each transgene individually via separate transformation events and to cross the different single-transgene expressing lines.
  • a second possibility is to introduce the different transgenes as linked expression cassettes, each with their own promoters and terminators, within a single transformation vector.
  • Such a set of transgenes will in this case segregate as a single genetic locus. It has been observed, however, that the presence of multiple copies of the same promoter within a transgenic plant often results in transcriptional silencing of the transgenes (Matzke. M.A. and Matzke, A.J.M., 1998, Cellular and Molecular Life Sciences 54. 94-103).
  • a vector containing four linked transgenes each driven by a CaMN35S promoter Van den Elzen P.J. et al. (Phil. Trans. R. Soc. Lon.
  • a third option would be to produce multiple proteins from one transcription unit by separating the distinct coding regions by so-called internal ribosomal entry sites, which allow ribosomes to reiterate translation at internal positions within a mRNA species.
  • internal ribosomal entry sites are well documented in animal systems (Kaminski A. et al., 1994, Genet. Eng. 16, 1 15-155) it is not known at present whether such sites are also functional in nuclear-encoded genes from plants.
  • Polycistronic genes can be expressed when inserted in plant chloroplastic genomes (Daniell H. et al., 1998, Nature Biotechnology 16,
  • a fourth strategy is based on the production of multiple proteins by proteolytic cleavage of a single polyprotein precursor encoded by a single transcription unit.
  • Potyviruses for instance, translate their genomic RNA into a single polyprotein precursor that encompasses proteolytic domains able to cleave the polyprotein precursor in cis (Dougherty, W.G. and Carrington. J.C., 1988, Annu. Rev. Phytopathol. 26, 123-143).
  • Beck von Bodman, S. et al., (1995, Bio/Technology 13. 587-591) have already exploited the potyviral system to co-express two enzymes involved in the biosynthesis of mannopine.
  • cytosolic processing and deposition is a drawback.
  • the extracellular space is the preferred deposition site, as most microorganisms occur at least during the early stages of infection in the extracellular space.
  • Proteins destined to the extracellular space are also synthesised via the secretory pathway but lack additional targeting information other than the leader peptide (Bednarek and Raikhel 1992, Plant Mol. Biol. 20. 133-150). Other examples of the application of this strategy are described in WO 95/24486 and WO95/17514.
  • the invention therefore provides a method of improving expression levels of a protein in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules.
  • the processing system described here can be used not only to co-express two or more different proteins, but also to obtain higher expression levels of a protein, particularly of small proteins.
  • the reason for the observed stimulatory effect on translational efficiency is currently unclear. It might be due to an effect of mRNA length or length of primary translation product on translational efficiency.
  • a signal sequence is operatively interconnected with the protein coding regions.
  • the expression "signal sequence " ' is used to define a sequence encoding a leader peptide that allows a nascent polypeptide to enter the endoplasmic reticulum and is removed after this translocation.
  • the signal sequence may be derived from any suitable source and may for example be naturally associated with the promoter to which it is operably linked.
  • a method of improving expression levels of a protein in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3'- terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules.
  • This method of the invention is particularly suitable for the expression of proteins which are 100 amino acids or less in length
  • the present invention provides a convenient and highly efficient method of co-expressing two or more proteins in a plant as a single transcription unit where the two proteins are joined by a cleavable linker, the construct being designed such that cleavage occurs in the secretory pathway of the plant thereby releasing the proteins extracellularly.
  • a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules.
  • the two or more protein encoding regions according to all aspects of the invention preferably do not encode identical proteins i.e. the method of the invention allows the production of different proteins in a single transcription unit.
  • the DNA sequence to be expressed according to the method of the invention is one which does not occur naturally in the plant used for the production of the multiple proteins i.e. one or more of the components of the DNA sequence will be heterologous to the plant host.
  • the method for the expression of multiple proteins described herein does not cover the use of a linker propeptide as expressed by the Ib-AMP gene and as described in SEQ ID Nos 14,15, 16. 17 or 18 of Published International Patent Application No.
  • WO 95/24486 separating three protein encoding regions each of which encodes Rs-AFP2; nor the insertion thereof into a plant genome.
  • the method of the invention does not use a linker propetide of the native Ib-AMP gene as shown in SEQ ID Nos 14, 15, 16, 17 or 18 of WO 95/24486.
  • the present invention there is provided a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules with the proviso that when the linker propeptide is derived from the Ib-AMP gene as described in SEQ ID Nos 14,15, 16, 17 or 18 of Published International Patent Application No. WO 95/24486 it does not separate three protein encoding regions each of which encodes Rs-AFP2.
  • the sequence of Rs-AFP2 is fully described in Published International patent Application no. WO 93/05153 published 18 March 1993.
  • the promoter sequence may for example be that naturally associated with the signal sequence, and/or it may be that naturally associated with the protein encoding sequence to which it is linked, or it may be any other promoter sequence conferring transcription in plants. It may be a constitutive promoter or it may be an inducible promoter.
  • the linker propeptide for use in all aspects and embodiments of the invention described herein is preferably a linker propeptide which is cleaved on passage of said DNA encoding the polyprotein precursor through the secretory pathway of the plant cells in which the polyprotein -encoding DNA is expressed.
  • the linker propeptide is preferably designed or chosen such that cleavage of the propeptide occurs by proteases which are naturally present in the secretory pathway of the plant cell in which the DNA encoding the polyprotein is expressed.
  • proteases which are naturally present in the secretory pathway of the plant cell in which the DNA encoding the polyprotein is expressed.
  • Particular promoters of the cauliflower mosaic virus such as the Penh 25S promoter of the 35S RNA
  • examples of such proteases include subtilisin-like proteases, .
  • the invention therefore provides a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence, said signal sequence being operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules said linker propeptide being cleaved on passage of said DNA encoding the polyprotein precursor through the secretory pathway of the plant cells in which the polyprotein -encoding DNA is expressed.
  • the linker propeptide is not derived from a virus.
  • the invention provides a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3'- terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules, said linker propeptide being cleaved on passage of said DNA encoding the polyprotein precursor through the secretory pathway of the plant cells in which the polyprotein -encoding DNA is expressed wherein cleavage of the propeptide occurs by proteases which are naturally present in the secretory pathway of said plant cell.
  • the linker propeptide may be a peptide which naturally contains processing sites for proteases occuring in the secretory pathway of plants such as the internal propeptides derived from the Ib-AMP gene which are described further herein, or may be a peptide to which such a protease processing site has been engineered at either or both ends thereof to facilitate cleavage of the sequence. Where a propeptide possesses one such protease processing site a further protease processing site may be added. If necessary or desired, repeats of the processing site, for example up to 6 repeats may be included.
  • a further protease processing site has been added to the 3' end of the DNA sequence coding for the C-terminal propeptides from Dahlia and Amaranthus which naturally possess a protease processing site at their N-terminal end for an unknown secretory pathway protease and these peptides are particularly suitable for use according to the method of the invention.
  • Certain Dahlia sequences including C-terminal propeptide sequences are described and claimed in copending British Patent Application No. 9818003.7.
  • Yet another strategy is based upon the use of virus e.g.
  • picornovirus sequences such as 20 amino acid sequences called the 2A sequence of the foot-and-mouth disease virus (FMDV) RNA, which results in the cleavage of polyproteins (Ryan and Drew 1994, EMPO J., 13, 928-933).
  • FMDV foot-and-mouth disease virus
  • a sequence which produces N-terminal sequence for example a plant derived sequence or a fragment thereof, to form a chimeric propeptide.
  • IbAMP is a gene from the plant Impatiens balsamina which encodes a peculiar polyprotein precursor featuring a leader peptide and six consecutive antimicrobial peptides. each flanked by propeptides ranging from 16 to 28 amino acids in length (Tailor R.H. et al, 1997, J. Biol. Chem. 272, 24480-24487). It is not known how and where processing of the IbAMP precursor occurs in its plant of origin.
  • One of the internal propeptides from IbAMP was used to separate two distinct plant defensin coding regions, one originating from radish seed (RsAFP2, Terras F.R.G. et al., 1992, J. Biol. Chem. 267, 15301 -15309; Terras et al 1995 Plant Cell, 7, 573-588) and one from dahlia seed (DmAMPl, Osborn R.W. et al., 1995, FEBS Lett. 368, 257-262).
  • C-terminal propeptides from either the DmAMPl precursor or the AcAMP2 precursor (De Bolle M.F.C. et al., 1993, Plant Mol. Biol. 22, 1 187-1190) or fragments of these.
  • These C-terminal propeptides were chosen based on our previous observation that they apparently can be cleaved in transgenic tobacco plants without influencing extracellular deposition of the mature proteins to which they are connected in the precursor (R.W. Osborn and S. Attenborough, personal communication; De Bolle M.F.C. et al, 1996, Plant Mol. Biol.
  • subtilisin-like protease processing site was engineered at the C-terminal part of the propeptides.
  • Subtilisin-like proteases are enzymes that specifically cleave at recognition sites of which the last two residues are basic (Barr, P.J., 1991, Cell 66, 1-3; Park CM. et al, 1994, Mol. Microbiol. 1 1 , 155-164). Although subtilisin-like proteases are best documented in fungi (e.g. Kex2-like proteases) and higher animals (e.g. furins), recent evidence suggests that such enzymes are also present in plants (Kinal H. et al, 1995, Plant Cell 7, 677-688; Tornero P. et al, 1997, J. Biol. Chem. 272, 14412-14419), including Arabidopsis (Ribeiro A. et al, 1995, Plant Cell 7, 785-794).
  • polyprotein precursors consisting of a leader peptide followed by two different plant defensins separated from each other by any of the above described internal propeptides can be processed in transgenic plants to release both plant defensins simultaneously.
  • the cleavage does occur such that at least the major part of the plant defensins are deposited in the extracellular space.
  • processing of the precursor occurred either in the secretory pathway or in the extracellular space.
  • the different propeptides shown to be cleaved in the transgenic plants do not reveal primary sequence homology.
  • sequences all appear to be rich in the small amino acids A, V, S and T and all contain dipeptidic sequences consisting of either two acidic residues, two basic residues or one acidic and one basic residue.
  • propeptide cleavage in the examples shown in this invention did apparently not occur within vacuoles, internal propeptides from vacuolar proteins (e.g. 2S albumins) might also be used if vacuolar deposition of the proteins would be desirable.
  • vacuolar proteins e.g. 2S albumins
  • a suitable targeting sequence may be added to one or more of the multiple protein encoding regions.
  • an endoplasmic reticulum targeting sequence such as that encoding KDEL (SEQ ID NO 65) may be added to the 3' end of one or more of the mature protein encoding regions, or a vacuolar targeting sequence (Chispeels and Raikhel 1992, Cell 68, 613-616) can be added to the 3' or 5' end of one or more of the protein encoding regions.
  • At least 40% of the sequence of the linker propeptide for use in accordance with all aspects and methods of the invention as described herein preferably consists of stretches of either two to five consecutive hydrophobic residues selected from alanine, valine. isoleucine, methionine. leucine, phenylalanine, tryptophan and tyrosine or stretches of two to five hydrophilic residues selected from aspartic acid, glutamic acid, lysine, arginine, histidine, serine, threonine. glutamine and asparagine.
  • the said hydrophobic residues are preferably alanine. valine. leucine, methionine and/or isoleucine and the said hydrophilic residues are preferably aspartic acid, glutamic acid, lysine and/or arginine.
  • the linker propeptide has within 7 residues of its N- or C- terminal cleavage site a sequence with two to five consecutive acidic residues, two to five basic residues or two to five consecutive intermixed acidic and basic residues. It is especially preferred that at least 40% of the sequence of the linker propeptide for use in accordance with all aspects of the invention as described herein preferably consists of stretches of either two to five consecutive hydrophobic residues selected from alanine, valine, isoleucine. methionine.
  • linker propeptides rich in the small amino acids A, V, S and T and containing dipeptidic sequences consisting of either two acidic residues, two basic residues or one acidic and one basic residue which on translation provides a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules is also preferred.
  • the linker propeptides have a dipeptidic sequence within seven amino acids from the ⁇ - and or C- terminal ends thereof, the said dipeptidic sequences consisting of either two acidic residues, two basic residues or an acidic and a basic residue wherein said dipeptidic sequences may be the same or different at each terminus.
  • said dipeptidic sequences are selected from the following EE, ED and/or KK.
  • the linker propeptide should hold the two (or more) protein domains sufficiently far apart so that they can fold appropriately and independently.
  • the linker polypeptide is suitably at least 10 and preferably at least 15 amino acids long. It is further advantageous that the linker propeptide should not interact with any secondary structural element in the two proteins which it links and should therefore itself have no particular secondary structure or form a solitary secondary structure element such as an alpha helix.
  • the linker propeptide sequence providing the cleavage site preferably comprises a linker sequence which isolatable from a natural source such as a plant or virus, or variant thereof or a frament of either of these.
  • the linker propeptide is isolatable from a plant protein, or a fragment, or variant or derivative thereof which can provide suitable cleavage sites.
  • Particular examples include a cleavable linker derived from the C-terminal propeptide region of a Dahlia gene such as those described and claimed in copending British Patent Application No. 9818003.7.
  • a viral sequence is used, it is preferably an element of a chimeric propeptide sequence.
  • variant refers to sequences of amino acids which differ from the base sequence from which they are derived in that one or more amino acids within the sequence are substituted for other amino acids.
  • Amino acid substitutions may be regarded as "conservative” where an amino acid is replaced with a different amino acid with broadly similar properties.
  • Non-conservative substitutions are where amino acids are replaced with amino acids of a different type. Broadly speaking, fewer non-conservative substitutions will be possible without altering the biological activity of the polypeptide.
  • Suitably variants have at least 85% similarity and preferably at least 90% similarity to the base sequence
  • two amino acid sequences with at least 85%o similarity to each other have at least 85% similar (identical or conservatively replaced) amino acid residues in a like position when aligned optimally allowing for up to 3 gaps, with the proviso that in respect of the gaps a total of not more than 15 amino acid residues is affected.
  • two amino acid sequences with at least 90% similarity to each other have at least 90% identical or conservatively replaced amino acid residues in a like position when aligned optimally allowing for up to 3 gaps with the proviso that in respect of the gaps a total of not more than 15 amino acid residues is affected.
  • a conservative amino acid is defined as one which does not alter the activity/function of the protein when compared with the unmodified protein.
  • conservative replacements may be made between amino acids within the following groups:
  • Sequence similarity may be calculated using sequence alignment algorithms known in the art such as, for example, the Clustal Method described by Myers and Miller (Comput. Appl. Biosci .4 1 1-17 (1988).) and Wilbur and Lipman (Proc. Natl. Acad. Sci. USA 80, 726-30 (1983) ) and the Wa ⁇ erman and Eggert method (The Journal of Molecular Biology (1987) 197, 723-728).
  • the MegAlign Lipman Pearson one pair method (using default parameters) which may be obtained from DNAstar Inc, 1228 Selfpark Street, Madison, Wisconsin, 53715, USA as part of the Lasergene system may also be used.
  • the linker propetide is a sequence isolatable from a plant protein and more preferably from the precursor of a plant antimicrobial protein such as a defensin. or a hevein- type antimicrobial peptide (Broekaert et al 1997, Crit. Rev. Plant Sci. 16, 297-323).
  • the linker propeptide is most preferably derivable from a defensin and/or a hevein type antimicrobial peptide, especially from the C-terminal propeptides from Dm-AMP 1 and Ac-AMP2 the sequences of which are as described in Figure 2 herein (SEQ ID NO 5 and SEQ ID NO 8).
  • the use of a linker propeptide derived from an antimicrobial peptide derived from the genus Impatiens is also preferred.
  • the Ib-AMP gene comprises five propeptide regions all of which are suitable for use in the present invention and which are described fully in Published International Patent Application WO 95/24486 at pages 29 and 40 to 42, the contents of which are incorporated herein by reference. All or part of the C-terminal propeptides derived from the Dm-AMP and Ac-AMP gene may be used.
  • the linker propeptide sequence used comprises a naturally occurring linker propeptide sequence which is modified so that amino acids from said sequence remaining attached to protein product after cleavage thereof is reduced, preferably so that none remain. Suitable modifications may be determined using routine methods as described hereinafter.
  • protein products of the invention are isolated and analyzed to see whether they include any residual amino acids derived from the propeptide linker.
  • the linker sequence may then be modified to eliminate some or all of these residues, provided the function of post-translational cleavage remains.
  • fragment refers to sequences from which amino acids have been deleted, preferably from an end region thereof. Thus these include the modified forms of the natural sequences mentioned above.
  • a linker propeptide of the invention may comprise one or more such fragments from different sources provided it functions as a post-translational cleavage site.
  • linker propeptide sequences are SEQ ID NOs 3, 4, 6, 7, 21, 22, 23, 24, 25, 26, 27. 28 and 29 as shown herein and variants therefore which act as a propeptide.
  • Particular examples of these are SEQ ID NOs 3, 4, 6, 7, 21. 22, 23, 24, 25, 26, 27, 28 and 29 themselves.
  • the propeptide sequences comprise SEQ ID NOs 3, 4, 6 or 7.
  • the present invention further provides a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide wherein the linker propeptide is derivable from a defensin and/or a hevein type antimicrobial peptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules.
  • cleavable linkers i.e. to provide a cleavable linkage site
  • cleavable linkers i.e. to provide a cleavable linkage site
  • propeptide it may be necessary to engineer an additional specific protease recognition site at either or both ends to facilitate cleavage of the sequence.
  • Suitable specific protease recognition sites include for example, recognition sites for subtilisin -like proteases recognising either a dipeptidic sequence consisting of two basic residues; tetrapeptidic sequences consisting of a hydrophobic residue, any residue, a basic residue and a basic residue or a tetrapeptidic sequence consisting of a basic residue, any residue, a basic residue and a basic residue.
  • Subtilisin-like protease recognition sites are particularly preferred for use in the method of the invention.
  • the present invention further provides a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3 ' -terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules and wherein an additional specific protease recognition site has been engineered at either or both ends of said linker propeptide to facilitate cleavage of the sequence.
  • the present invention further provides a method for the expression of multiple proteins in a transgenic plant comprising inserting into the genome of said plant a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide wherein the linker propeptide is derivable from a defensin and/or a hevein type antimicrobial peptide said propeptide providing a cleavage site whereby the expressed polyprotein is post-translationally processed into the component protein molecules and wherein an additional specific protease recognition site has been engineered at either or both ends of said linker propeptide to facilitate cleavage of the sequence.
  • the invention further provides the use of propeptides isolatable from plant derived proteins as cleavable linkers in polyprotein precursors synthesised via the secretory pathway in transgenic plants.
  • the propeptides are preferably isolatable from the precursor of a plant defensin or a hevein-type antimicrobial peptide (Broekaert et al 1997, Crit. Rev. Plant Sci. 16, 297-323).
  • the propeptides may also preferably be isolatable from an antimicrobial peptide derived from the genus Impatiens.
  • the invention provides the use of a propeptide wherein at least 40% of the sequence of the propeptide consists of stretches of either two to five consecutive hydrophobic residues selected from alanine, valine, isoleucine, methionine. leucine, phenylalanine, tryptophan and tyrosine or stretches of two to five hydrophilic residues selected from aspartic acid, glutamic acid, lysine, arginine, histidine, serine, threonine, glutamine and asparagine as a cleavable linker in polyprotein precursors synthesised via the secretory pathway in transgenic plants.
  • linker propeptide has within 7 residues of its N- or C- terminal cleavage site a sequence with two to five consecutive acidic residues, two to five basic residues or two to five consecutive intermixed acidic and basic residues.
  • At least 40% of the sequence of the linker propeptide consists of stretches of either two to five consecutive hydrophobic residues selected from alanine, valine, isoleucine, methionine, leucine, phenylalanine, tryptophan and tyrosine or stretches of two to five hydrophilic residues selected from aspartic acid, glutamic acid, lysine, arginine, histidine, serine, threonine, glutamine and asparagine and has within 7 residues of its N- or C- terminal cleavage site a sequence with two to five consecutive acidic residues, two to five basic residues or two to five consecutive intermixed acidic and basic residues.
  • the invention provides the use of a peptide sequence rich in the small amino acids A, V, S and T and containing dipeptidic sequences consisting of either two acidic residues, two basic residues or one acidic and one basic residue as a cleavable linker sequence wherein said sequence is isolatable from a plant defensin or a hevein-type antimicrobial protein.
  • the methods of the invention may be used to achieve efficient expression and secretion of any desired proteins and is particularly suitable for the expression of proteins which must naturally be synthesised in the secretory pathway in order to be folded in a functional form such as, for example, glycosylated proteins and those with disulphide bridges. Additionally, it is extremely advantageous for proteins involved in the defence of a plant to attack by a pathogen to be secreted efficiently to the extracellular space since this is usually the initial site of pathogen attack and the present methods of the invention provide an effective means of delivering multiple proteins extracellularly.
  • the method of the invention is also particularly suitable for producing small peptides which may then be used for immunisation purposes i.e. the transgenic plant or a seed derived therefrom may be used directly as a foodstuff thereby passively immunising the recipient.
  • proteins which may be expressed according to the methods of the present invention include, for example, antifungal proteins described in Published International Patent Application Nos WO92/15691, WO92/21699, WO93/05153, WO93/04586, WO94/1 151 1, WO95/04754, WO95/18229, W095/24486, WO97/21814 and W097/21815 including Rs- AFP 1 , Rs-AFP2, Dm-AMP I, Dm-AMP2, Hs-AFPl , Ah-AMPl , Ct-AMPl , Q-AMP2, Bn- AFP1 , Bn-AFP2, Br-AFPl , Br-AFP2, Sa-AFPl , Sa-AFP2, Cb-AMPl , Cb-AMP2.
  • PR-1 type proteins such as chitinases. glucanases such as beta 1.3 and betal ,6 glucanases. chitin-binding lectins. zeamatins, osmotins, thionins and ribosome- inactivating proteins and peptides derived therefrom or antifungal proteins showing 85% sequence identity, preferably greater than 90% sequence identity, more preferably greater than 95% sequence identity with any of said proteins where sequence identity is as defined above.
  • the cleavable linkers are used to join two or more proteins of interest and provide cleavage sites whereby the polyprotein is post-translationally processed into the component protein molecules.
  • the invention provides a DNA construct comprising a DNA sequence comprising a promoter region operably linked to a plant derived signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3'- terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide said propeptide providing a post-translational cleavage site.
  • the protein encoding region encode different proteins.
  • Preferred examples of propeptide linker sequences are as detailed above.
  • the invention provides a DNA construct wherein said DNA sequence encoding said linker propeptide encodes an internal propeptide from the Ib-AMP gene. In a further preferred embodiment of this aspect the invention provides a DNA construct wherein said DNA sequence encoding said linker propeptide encodes the C-terminal propeptide from the Dm-AMP or from the Ac-AMP gene.
  • the invention provides a DNA construct as described above wherein when the DNA sequence encoding the linker propeptide is derived from the Dm-AMP gene or from the Ac-AMP gene it additionally comprises one or more protease recognition sites at either or both ends thereof.
  • the invention provides a DNA construct comprising a DNA sequence comprising a promoter region operably linked to two or more protein encoding regions and a 3' terminator-region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide encoding the C-terminal propeptide from the Dm-AMP gene or the from the Ac-AMP gene said propeptide providing a post-translational cleavage site.
  • the invention provides a DNA construct as described above wherein the DNA sequence encoding the linker propeptide from Dm-AMP or Ac-AMP additionally comprises one or more protease recognition sites at either or both ends thereof.
  • the invention provides a transgenic plant transformed with a DNA construct according to any of the above aspects of the invention.
  • the invention provides a transgenic plant transformed with a DNA sequence comprising a promoter region operably linked to a signal sequence said signal sequence being operably linked to two or more protein encoding regions and a 3 '-terminator region wherein said protein encoding regions are separated from each other by a DNA sequence coding for a linker propeptide which on translation provides a cleavage site.
  • At least 40% of the sequence of the said linker propeptide consists of stretches of either two to five consecutive hydrophobic residues selected from alanine, valine, isoleucine, methionine, leucine, phenylalanine, tryptophan and tyrosine or stretches of two to five hydrophilic residues selected from aspartic acid, glutamic acid, lysine, arginine, histidine, serine, threonine, glutamine and asparagine.
  • the said hydrophobic residues are preferably alanine, valine. leucine, methionine and/or isoleucine and the said hydrophilic residues are preferably aspartic acid, glutamic acid, lysine and/or arginine.
  • linker propeptide has within 7 residues of its N- or C- terminal cleavage site a sequence with two to five consecutive acidic residues, two to five basic residues or two to five consecutive intermixed acidic and basic residues.
  • At least 40% of the sequence of the linker propeptide consists of stretches of either two to five consecutive hydrophobic residues selected from alanine, valine, isoleucine, methionine, leucine, phenylalanine, tryptophan and tyrosine or stretches of two to five hydrophilic residues selected from aspartic acid, glutamic acid, lysine, arginine, histidine, serine, threonine, glutamine and asparagine and has within 7 residues of its N- or C- terminal cleavage site a sequence with two to five consecutive acidic residues, two to five basic residues or two to five consecutive intermixed acidic and basic residues.
  • the DNA sequence providing the cleavage site encodes a peptide sequence rich in the small amino acids A, V. S and T and containing dipeptidic sequences consisting of either two acidic residues, two basic residues or one acidic and one basic residue.
  • the DNA sequence providing the cleavage site encodes a propeptide derived from the Ib-AMP gene such as for example that described in Figure 2.
  • the DNA sequence providing the cleavage site encodes the C- terminal propeptides from Dm-AMPI and Ac-AMP2 as described in Figure 2 which may optionally be engineered to include a further DNA sequence encoding a subtilisin-like protease recognition site.
  • the invention provides a vector comprising a DNA construct as described above.
  • linker sequences described herein are novel and theses and the coding sequence for these form a further aspect of the invention.
  • a nucleic acid which encodes a linker peptide of SEQ ID NO 4, 6, 7, 29, 21, 22. 23, 24, 25, 26, 27, 28 or the linker peptide shown in Figure 34 as well as variants thereof.
  • Particular variants will be those which have SEQ ID NO 77 linked at the C-terminal end.
  • sequence of the individual components of the DNA sequence i.e. the signal sequence, promoter sequence, linker sequence, protein sequence(s), terminator sequence for use in the methods according to the invention may be predicted from its known amino acid sequence and DNA encoding the protein may be manufactured using a standard nucleic acid synthesiser. Alternatively, DNA encoding the components of the invention may be produced by appropriate isolation from natural sources.
  • Figure 1 shows nucleotide sequence (SEQ ID NO 1) and corresponding amino acid sequence (SEQ ID NO 2) of coding region of the DmAMPl gene. The amino acids corresponding to mature DmAMPl are underlined. The nucleotides corresponding to the intron are double underlined.
  • Figure 2 shows schematic representation of the coding regions from the vector constructs (SEQ ID NOS 3-8). Amino acids sequences below the internal propeptides represent the propeptide sequences from which the linker propeptides were derived.
  • Figure 3 shows schematic representation of plant transformation vector pFAJ3105
  • Figure 4 shows schematic representation of plant transformation vector pFAJ3106
  • Figure 5 shows schematic representation of plant transformation vector pFAJ3107
  • Figure 6 shows schematic representation of plant transformation vector pFAJ3108
  • Figure 7 shows schematic representation of plant transformation vector pFAJ3109
  • Figure 8 shows nucleotide sequence (SEQ ID NO 9) and corresponding amino acid sequence (SEQ ID NO 10) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3105.
  • SEQ ID NO 9 amino acid sequence
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • Figure 9 shows nucleotide sequence (SEQ ID NO 1 1) and corresponding amino acid sequence (SEQ ID NO 12) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3106.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • Figure 10 shows nucleotide sequence (SEQ ID NO 13) and corresponding amino acid sequence (SEQ ID NO 14) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3107.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • Figure 11 shows nucleotide sequence (SEQ ID NO 15) and corresponding amino acid sequence (SEQ ID NO 16) of the open reading frame of the region comprised between the Ncol and Sa sites of plasmid pFAJ3108.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • Figure 12 shows nucleotide sequence (SEQ ID NO 19) and corresponding amino acid sequence (SEQ ID NO 20) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3109. The amino acids corresponding to mature DmAMP 1 are underlined.
  • Figure 13 shows the Dm-AMPI expression levels (as % of total soluble protein) of a series of transgenic individual plants transformed with construct pFAJ3105 and a series of transgenic individuals transformed with construct pFAJ3109.
  • Figure 14 shows RP-HPLC analysis on a C8-silica column of crude extracts from leaves transformed with construct pFAJ3105 (A) or pFAJ3106 (B). Extracts were prepared as described in Materials and Methods. The column was eluted with a gradient of acetonitrile in 0.1 % TFA (0-35 min. 15 % - 50 % acetonitrile in 0.1 % TFA).
  • FIG. 15 shows the results of reverse phase chromatography (RPC) of the extracellular fluid fraction of Arabidopsis plants transformed with construct 3105 (line 14). RPC was performed on a C8-silica column (Microsorb-MV, 4.6 x 250 mm, Rainin) equilibrated with 0.1 % trifluoroacetic acid (TFA).
  • RPC reverse phase chromatography
  • Figure 16 shows the results of RPC of an extract of Arabidopsis plants transformed with construct 3105 (line 14). Samples were two different fractions from IEC showing presence of either DmAMPl-CRPs or RsAFP2-CRPs, namely those fractions eluting between 0.17 - 0.33 M NaCl (A), and 0.33 - 0.49 M NaCl (B). RPC was performed as in the legend to Figure 14. Absorbance (full line) was measured on-line at 280 nm and acetonitrile concentration (dashed line) was measured on-line with a conductivity monitor. Fractions were collected and assessed for DmAMPl -CRP or RsAFP2-CRP using ELISA assays. Peak numbers in bold indicate presence of DmAMPl -CRP, peak numbers in italic indicate presence of RsAFP2-CRP.
  • Figure 17 shows the amino acid sequence of the polyprotein precursors encoded by constructs pFAJ3105, pFAJ3106 and pFAJ3108. Dashes indicate omission from the full sequence for sake of brevity. The sequence in italic is the DmAMPl leader peptide. the underlined sequence is mature DmAMPl , the bold sequence is the linker peptide. the double underlined sequence is mature RsAFP2. Arrows indicate processing sites according to the N-terminal sequence and mass spectrometry analyses of purified DmAMP-CRPs and RsAFP2-CRPs.
  • Figure 18 shows the RPC of the extracellular fluid fraction of Arabidopsis plants transformed with construct pFAJ3106 (line 9). RPC was performed and fractions analysed as described in the legend to figure 15. Peak numbers in bold indicate presence of DmAMPl -CRP, peak numbers in italic indicate presence of RsAFP2-CRP.
  • Figure 19 shows the RPC results of an extract of Arabidopsis plants transformed with construct 3108 (line 9).
  • the sample was a fraction from IEC showing presence of either DmAMPl -CRPs or RsAFP2-CRPs, namely those fractions eluting between 0.17 - 0.33 M NaCl and showing the presence of DmAMPl -CRPs.
  • RPC was performed and fractions analysed as in the legend to Figure 15. Peak numbers in bold indicate presence of DmAMPl - CRP.
  • Figure 20 is a schematic representation of the coding region of constructs pFAJ3105, pFAJ3343, pFAJ3344, pFAJ3345, pFAJ3346, and pFAJ3369.
  • Full arrowheads indicate experimentally determined cleavage sites. Open arrowheads indicate presumed cleavage sites.
  • SP DmAMPl signal peptide region of DmAMPl (see figure 1);
  • DmAMPl mature protein region of DmAMPl (see figure 1);
  • RsAFP2 mature protein region of RsAFP2 (Terras et al. 1995, Plant Cell, 7, 573-588).
  • Linker peptide sequences are shown in full (SEQ ID NOS 3, 29, 21-24 respectively).
  • Figure 21 is a schematic representation of the coding region of constructs pFAJ3367 with linker peptide of SEQ ID NO 24.
  • SP DmAMPl signal peptide region of DmAMPl (see figure 1); DmAMPl : mature protein region of DmAMPl (see figure 1); RsAFP2: mature protein region of RsAFP2 (Terras et al. 1995, Plant Cell, 7, 573-588); HsAFPl : mature protein region of HsAFPl (Osborn et al. 1995, FEBS Lett. 368, 257-262); AceAMPl; mature protein region of AceAMPl (Cammue et al. 1995, Plant Physiol. 109, 445-455).
  • Figure 22 is a schematic representation of the coding region of constructs pFAJ3106-2, pFAJ3107-2, and pFAJ3108-2.
  • SP DmAMPl signal peptide region of DmAMPl (see figure 1); DmAMPl : mature protein region of DmAMPl (see figure 1); RsAFP2: mature protein region of RsAFP2 (Terras et al. 1995, Plant Cell. 7, 573-588); RS Kex2p: recognition sequence (IGKR) of the Kex2 protease (Jiang and Rogers, 1999, Plant J., 18, 23-32); AcAMP 1 : mature protein region of AcAMPl (De Bolle et al. Plant Mol Biol. 31. 997-1008).
  • the linker propeptide sequences are shown in full as SEQ ID NOS 25, 26 and 27 respectively.
  • Figure 23 is a schematic representation of the coding region of constructs pFAJ3368 and pFAJ3370. Open arrowheads indicate presumed cleavage sites.
  • SP DmAMPl signal peptide region of DmAMPl (see figure 1); DmAMPl : mature protein region of DmAMPl (see figure 1); RsAFP2: mature protein region of RsAFP2 (Terras et al. 1995, Plant Cell, 7. 573-588); 2A sequence: cleavage recognition site of the Foot and Mouth Disease Virus polyprotein.
  • the linker propeptide sequence is shown in full as SEQ ID NO 28.
  • Figure 24 shows nucleotide sequence (SEQ ID NO 30) and corresponding amino acid sequence (SEQ ID NO 31) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3343.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 29).
  • Figure 25 shows the nucleotide sequence (SEQ ID NO 32) and corresponding amino acid sequence (SEQ ID NO 33) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3344.
  • DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 21).
  • Figure 26 shows the nucleotide sequence (SEQ ID NO 34) and corresponding amino acid sequence (SEQ ID NO 35) of the open reading frame of the region comprised between the ⁇ col and Sad sites of plasmid pFAJ3345.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 22).
  • Figure 27 shows the nucleotide sequence (SEQ ID NO 36) and corresponding amino acid sequence (SEQ ID NO 38) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3346.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 23).
  • Figure 28 shows the nucleotide sequence (SEQ ID NO 38) and corresponding amino acid sequence (SEQ ID NO 39) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3369.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 24) .
  • Figure 29 shows the nucleotide sequence and corresponding amino acid sequence of the open reading frame of the region comprised between the Ncol and Sa sites of plasmid pFAJ3367.
  • the amino acids corresponding to mature DmAMP, mature RsAFP2, mature HsAFPl and mature AceAMPl are underlined, double-underlined, dashed-underlined and dotted-underlined, respectively.
  • the amino acids corresponding to the internal linker peptides are in bold (SEQ ID NO 24).
  • Figure 30 shows the nucleotide sequence (SEQ ID NO 42) and corresponding amino acid sequence (SEQ ID NO 43) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3106-2.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 4).
  • Figure 31 shows the nucleotide sequence (SEQ ID NO 44) and corresponding amino acid sequence (SEQ ID NO 45) of the open reading frame of the region comprised between the Ncol and Sa sites of plasmid pFAJ3107-2.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 6).
  • Figure 32 shows the nucleotide sequence (SEQ ID NO 46) and corresponding amino acid sequence (SEQ ID NO 47) of the open reading frame of the region comprised between the iVcoI and Sad sites of plasmid pFAJ3108-2.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the amino acids corresponding to the internal linker peptide are in bold (SEQ ID NO 7).
  • Figure 33 shows the nucleotide sequence (SEQ ID NO 48) and corresponding amino acid sequence (SEQ ID NO 49) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3370.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the linker sequence is indicated in bold type (SEQ ID NO 28) with the amino acids corresponding to the 2A sequence indicated in bold italic.
  • Figure 34 shows the nucleotide sequence (SEQ ID 48) and corresponding amino acid sequence (SEQ ID NO 49) of the open reading frame of the region comprised between the Ncol and Sad sites of plasmid pFAJ3368.
  • the amino acids corresponding to mature DmAMPl and mature RsAFP2 are underlined and double-underlined, respectively.
  • the linker sequence is indicated in bold type with amino acids corresponding to the 2A sequence are indicated in bold italic.
  • a cD ⁇ A library was constructed from near-dry seeds collected from flowers of Dahlia merckii. Total R ⁇ A was purified from the seeds using the method of Jepson I. et al (1991, Plant Mol. Biol. Reporter 9, 131-138). 0.6 mg of total R ⁇ A was obtained from 2 g of D. merckii seed. PolyATract magnetic beads (Promega) were used to isolate approximately 2 ⁇ g poly-A+ R ⁇ A from 0.2 mg of total R ⁇ A.
  • the poly-A+ R ⁇ A was used to construct a cD ⁇ A library using a ZAP-cD ⁇ A synthesis kit (Stratagene). Following first and second strand synthesis, cD ⁇ As were ligated with vector D ⁇ A. After phage assembly using Gigapack Gold (Stratagene) packaging extracts, approximately 1 x 10 5 plaque forming units (pfu) were obtained.
  • AFP-5 (5'-TG(T,C)GA ⁇ AA ⁇ GC ⁇ YA,T)(G.C) ⁇ AA(A,G)AC ⁇ TGG) (SEQ ID NO 13) based on the N-terminal sequence CEKASKTW (SEQ ID NO 14) of DmAMPl , Osborn R.W. et al, 1995, FEBS Lett. 368, 257-262) and AFP-3EX (5 ' - CA(A,G)TT(A,G)AANTANCANAAA(A,G) CACAT) (SEQ ID NO 52) based on the C- terminal sequence MCFCYFNC (SEQ ID NO 53) of DmAMPl) and genomic DNA isolated from D.
  • a 144 bp PCR product was produced and isolated from an agarose gel.
  • the PCR product was cloned into pBluescript.
  • the insert of 10 transformants were sequenced.
  • the sequences represented 3 closely homologous DmAMPl -like genes one of which, PCR clone 4, encoded the observed mature DmAMPl .
  • the 144 bp PCR product mixture labelled with 32 -P CTP was used to probe Hybond N (Amersham) filter lifts made from plates containing a total of 6 x 10 4 pfu of the cDNA library. Thirty potentially positive signals were observed. 22 plaques were picked and taken through two further rounds of screening.
  • DmAMP2 (Osborn R.W. et al, 1995, FEBS Lett. 368, 257-262). None of the cDNAs encoded a mature protein region equivalent to the observed mature DmAMPl peptide sequence. Using the sequence of PCR clone 4 (above) and information from the N- and C- terminal ends of the peptides deduced from cDNA sequences, two pairs of oligonucleotides were designed for amplification of a gene encoding DmAMPl . Genomic DNA from D.
  • merckii was used in a PCR reaction with oligonucleotides MATAFP-5P (5'- ATGGC(C,G)AAN(A,C)(A,G)NTC (A,G)GTTGCNTT) (SEQ ID NO 66) and MATAFP-5 (5'- AAACACATGTGTTTCCCATT) (SEQ ID NO 54), the PCR product was cloned into pBluescript and clones were sequenced. A clone containing the 5 ' half of a DmAMPl gene was identified. Genomic DNA from D.
  • merckii was used in a PCR reaction with MATAFP-3 (5'- AGCGTGTCATGTGCGTAAT) (SEQ ID NO 55 ) and DM25MAT-3 (5'- TAAAGA AACCGACCCTTTCACGG) (SEQ ID NO 56), the PCR product was cloned into pBluescript and clones were sequenced. A clone containing the 3' half of a DmAMPl gene was identified. The 5' and 3' sections of the mature gene were combined to assemble the sequence of the coding region of the DmAMPl gene ( Figure 1). The DmAMPl gene encodes a precursor with a 28 amino acids leader peptide. a 50 amino acids mature protein and a 40 amino acids C-terminal propeptide.
  • the open reading frame is interrupted by a 92 bp intron located within the leader peptide region.
  • two PCR reactions were carried out with respectively the primer sets DMVEC-3 (5 ' - ATGCATCCATGGTGAATCGGTCGGTTGCGTTCTCCGCGTTCGTT CTGATCCTTTTCGTGCTCGCCATCTCAGATATCGCATCCGTTAGTGGAGAACTATG CGAGAAA) (SEQ ID NO 57) and DMVEC-2 (5'- AAACCGACCGAGCTCACGGATGTTCAACGTTTGGA AC) (SEQ ID NO 58), and DMVEC-3 and DMVEC4 (5'- AGCAAGCTTTTCGGGAGCTCAACAATTGA AGTAA)(SEQ ID NO 59).
  • DMVEC-3 primes at the top strand of the DmAMPl gene, corresponds to the leader peptide region without the intron and introduces an Ncol site at the translation start.
  • DMVEC-2 primes at the bottom strand of the DmAMPl gene at the 3'-end of the C-terminal propeptide region and introduces a Sad site behind the translation stop codon.
  • DMVEC-4 primes at the bottom strand of the DMAMP 1 gene at the 3' end of the mature protein region, fuses a stop codon behind this region and introduces a Sad site behind the stop codon.
  • pMJB 1 is an expression cassette vector containing in sequence a HmdIII site, the enhanced cauliflower mosaic 35S R ⁇ A (CaMV35S) promoter (Kay R. et al, 1987, Science 236, 1299-1302), aXhol site, the 5' untranslated leader sequence of tobacco mosaic virus (TMV) (Gallie D.R. and Walbot V., 1992, ⁇ ucl. Ac. Res.
  • pDMAMP ⁇ leader peptide region, mature protein region and C-terminal propeptide region
  • pDMAMPD leader peptide region and mature protein region
  • construct 3106 has a propeptide consisting of a part of the DmAMPl propeptide and a putative subtilisin-like protease processing site (IGKR) (SEQ ID NO 67) at its C-terminus.
  • IGKR putative subtilisin-like protease processing site
  • construct 3107 is identical to construct 3106 except that the entire DmAMPl propeptide was taken.
  • construct 3108 has a propeptide consisting of the AcAMP2 propeptide and a putative subtilisin-like protease processing site (IGKR) at its C-terminus.
  • IGFR subtilisin-like protease processing site
  • C-terminal cleavage of the internal propeptide in these constructs should be executed by a subtilisin-like protease, a member of which in yeast (Kex2) is known to occur in the Golgi apparatus (Wilcox CA. and Fuller R.S., 1991, J. Cell. Biol. 1 15, 297), while a member in tomato occurs in the apoplast (Tornero P. et al, 1997, J. Biol. Chem. 272, 14412-14419). Proteins deposited in the apoplast, the preferred deposition site for antimicrobial proteins engineered in transgenic plants (Jongedijk E. et al, 1995, Euphytica 85.
  • CCTGGCTCCACGTCCTCTGGGGTAGCCACCTCGTCAGCAGCGTTGGAACAATTGA AGTAACAGAAACAC (SEQ ID NO 60) were used in a first PCR reaction with plasmid pDMAMPE (see above) as a template.
  • the second PCR reaction was done using as a template plasmid pFRG4 (Terras F.R.G. et al, 1995, Plant Cell 7, 573-588) and as primers a mixture of the PCR product of the first PCR reaction, primer OWB 175 and primer OWB 172
  • pFAJ3099 The expression cassette in the resulting plasmid, called pFAJ3099, was digested with Hind ⁇ ll (flanking the 5' end of the CaMV35S promoter) and EcoRI (flanking the 3' end of the nopaline synthase terminator) and cloned in the corresponding sites of the plant transformation vector pGPTVbar (Becker D. et al, 1992, Plant Mol. Biol. 20, 1195-1 197) to yield plasmid pFAJ3105.
  • Plasmids pFAJ3106, pFAJ3107 and pFAJ3108 were constructed analogously except that primer OWB278 in the first PCR reaction was replaced by the following primers, respectively: OWB279 (5'-
  • Plasmid pFAJ3109 was constructed by cloning the H dIII-EcoRI fragment of plasmid pDMAMPD (see above) into the corresponding sites of plant transformation vector pGPTVbar (see above).
  • Arabidopsis thaliana ecotype Columbia-O was transformed using recombinant Agrobacterium tumefaciens by the inflorescence infiltration method of Bechtold N. et al. (1993, CR. Acad. Sci. 316, 1 194-1 199). Transformants were selected on a sand/perlite mixture subirrigated with water containing the herbicide Basta (Agrevo) at a final concentration of 5 mg/1 for the active ingredient phosphinothricin.
  • ELISA assays were set up as competitive type assays essentially as described by Penninckx I. A.M. A. et al (1996, Plant Cell 8, 2309-2323). Coating of the ELISA microtiter plates was done with 50 ng/ml RsAFP2 or DmAMPl in coating buffer. Primary antisera were used as 1000- and 2000-fold diluted solutions (DmAMPl and RsAFP2. respectively) in 3 % (w/v) gelatin in PBS containing 0.05 % (v/v) Tween 20.
  • Total protein content was determined according to Bradford (1976, Anal. Biochem. 72, 248-254) using bovine serum albumin as a standard.
  • Arabidopsis leaves were homogenized under liquid nitrogen and extracted with a buffer consisting of 10 mM Na ⁇ 2 P0 4 , 15 mM Na 2 HP0 4 , 100 mM KC1, 1.5 M NaCl. The homogenate was heated for 10 min at 85°C and cooled down on ice.
  • the heat-treated extract was centrifuged for 15 min at 15 000 x g and was injected on a reserved phase high pressure liquid chromatography column (RP-HPLC) consisting of C8 silica (0,46 cm x 25 cm; Rainin) equilibrated with 0.1 % (v/v) trifluoroacetic acid (TFA).
  • RP-HPLC high pressure liquid chromatography column
  • the column was eluted at 1 ml/min in a linear gradient in 35 min from 15 % to 50 % (v/v) acetonitrile in 0.1 % (v/v) TFA.
  • the eluate was monitored for absorbance at 214 nm, collected as 1 ml fractions, evaporated and finally redissolved in water. The fractions were tested by ELISA assays.
  • Intercellular fluid was collected from Arabidopsis leaves by immersing the leaves in a beaker containing extraction buffer (10 mM NaH 2 PO 4 , 15 mM Na 2 HPO 4 , 100 mM KCl, 1.5 M NaCl).
  • extraction buffer (10 mM NaH 2 PO 4 , 15 mM Na 2 HPO 4 , 100 mM KCl, 1.5 M NaCl).
  • the beaker with the leaves was placed in a vacuum chamber and subjected to six consecutive rounds of vacuum for 2 min followed by abrupt release of vacuum.
  • the infiltrated leaves were gently placed in a centrifuge tube on a grid separated from the tube bottom.
  • the intercellular fluid was collected from the bottom after centrifugation of the tubes for 15 min at 1800 x g.
  • the leaves were resubjected to a second round of vacuum infiltration and centrifugation and the resulting (extracellular) fluid was combined with that obtained after the first vacuum infiltration. After this step the leaves were extracted in a Phastprep (BlOlOl/Savant) reciprocal shaker and the extract clarified by centrifugation (10 min at 10,000 x g) and the resulting supernatant considered as the intracellular extract.
  • RsAFP2-CRPs in the extracts are, however, less reliable than those for the Dm-AMPI -CRPs.
  • Rs-AFP2 Elisa assays dilutions of extracts of transgenic plants yielded dose-response curves that deviated from those obtained for dilutions of standard solutions containing authentic Rs-AFP2, indicating that the majority of the Rs-AFP2 -CRPs in the extracts were imunologically not identical to RsAFP2 itself. Deviations from RsAFP2 standard dose- response curves were much more pronounced for extracts from plants transformed with constructs 3106, 3107, and 3108 than for those of plants transformed with 3105.
  • a transgenic line was selected among each of the populations transformed with either construct 3105 (line 1) or 3106 (line 2) and the selected lines were further bred to obtain plants homozygous for the transgenes.
  • extracts from the plants were prepared as described in Example 1 and separated by RP-HPLC on a C8-silica column. Fractions were collected and assessed for presence of compounds cross-reacting with antibodies raised against either DmAMPl or RsAFP2 using Elisa assays as described in Example 4.
  • construct 3105 IbAMP internal propeptide as linker peptide
  • construct 3106 partial DmAMPl C-terminal propeptide with subtilisin-like protease site as a linker peptide
  • DmAMPl -CRPs and RsAFP2-CRPs that appear to be identical or very closely related to DmAMPl and RsAFP2, respectively, based on their chromatographic behavior.
  • extracellular fluid and intracellular extract fractions were obtained from leaves of homozygous transgenic Arabidopsis lines transformed with either constructs 3105 (line 2), 3106 (line 2) or 3108 (line 12).
  • the cytosolic enzyme glucose- 6-phosphate dehydrogenase was used as a marker to detect contamination of the extracellular fluid fraction with intracellular components. As shown in Table 2, glucose-6-phosphate dehydrogenase was partitioned in a ratio of about 80/20 between intracellular extract fractions and extracellular fluid fractions.
  • 'Relative abundance is expressed as % of the sum of the contents in the EF and IE fractions.
  • Transgenic line 14 from the population transformed with construct 3105 was further bred to obtain plants homozygous for the transgene.
  • the DmAMPl -CRPs and RsAFP2-CRPs were purified by reversed phase chromatography from extracellular fluid prepared from leaves of this line. To this end, leaves were vacuum infiltrated with a buffer containing 50 mM MES (pH6) and a mixture of protease inhibitors (1 mM phenylmethylsulfonylfluoride, ImM N- ethylmaleimide, 5mM EDTA and 0.02 mM pepstatin A), and the extracellular fluid collected by centrifugation.
  • MES pH 6
  • protease inhibitors 1 mM phenylmethylsulfonylfluoride, ImM N- ethylmaleimide, 5mM EDTA and 0.02 mM pepstatin A
  • Arabidopsis leaves an alternative purification procedure was developed starting from a crude leaf extract. To this end, leaves were homogenized under liquid nitrogen and extracted with 50 mM MES (pH6) containing a mixture of protease inhibitors (1 mM phenylmethylsulfonylfluoride, ImM N-ethylmaleimide, 5mM EDTA and 0.02 mM pepstatin A). The homogenate was cleared by centrifugation (10 min at 10000 x g). The supernatant was then fractionated by ion exchange chromatography (IEC) and subsequently by reversed phase chromatography (RPC).
  • IEC ion exchange chromatography
  • RPC reversed phase chromatography
  • the different DmAMPl -CRPs and RsAFP2-CRPs purified from extracellular fluid were subjected to N-terminal amino acid sequence analysis (procedures as described in Cammue et al, 1992, J. Biol. Chem., 2228-2233) as well as to MALDI-TOF (matrix-assisted laser desorption ionization-time of flight) mass spectrometry (Mann and Talbo, 1996, Curr. Opinion Biotechnol. 7, 1 1-19).
  • the C-terminal amino acid was determined based on the best approximation of the predicted theoretical mass by the experimentally determined mass (Table 3).
  • DmAMP 1+S Both the minor DmAMPl-CRPs, p3105EFl, and the major DmAMPl-CRP, p3105EF2 (protein codes as in figure 15 and Table 3), had exactly the same N-terminal sequence as mature DmAMP 1.
  • p3105EF 1 and p3105EF2 had masses that were consistent with the presence of a single additional serine residue at their C-terminal end compared to authentic DmAMPl .
  • the mass of p3105EF2 corresponded exactly (within experimental error) to that calculated for a DmAMPl derivative with a C-terminal serine (hereafter called DmAMP l S)
  • DmAMP l S DmAMP l S
  • this protein might be a DmAMP 1+S derivative with reduced disulfide bridges.
  • the RsAFP2-CRP fraction p3105EF3 represents, based on N-terminal sequence and mass data, an RsAFP2 derivative with the additional pentapeptide sequence DVEPG at its N-terminus.
  • This protein is further referred to as DVEPG+RsAFP2.
  • the different DmAMPl-CRPs and RsAFP2-CRPs purified from total leaf extract were analyzed in the same way. The analyses indicated that the same molecular species were present in the total leaf extract, i.e. DmAMP 1+S, a putatively reduced form of DmAMP 1+S, and DVEPG+RsAFP2 (Table 3 see Example 10 below).
  • the specific antimicrobial activity, expressed as protein concentration required for 50 % growth inhibition of the test organism, of purified DmAMP 1+S was identical to that of authentic DmAMPl .
  • the slight drop in specific antimicrobial activity of DVPEG+RsAFP2 is most likely due to the presence of 5 additional N-terminal amino acids. Nevertheless, our data prove that processing of the polyprotein precursors in transgenic plants can result in the release of bioactive proteins.
  • the precursor is cleaved at the C-terminal end of the leader peptide in the same way as for the authentic DmAMP 1 precursor; (ii) the precursor is cleaved at the C-terminal end of the first amino acid of the linker peptide, thus releasing DmAMP 1+S; (iii) the precursor is further processed at the N-terminal end of the fifth last residue of the linker peptide, thus releasing DVEPG+RsAFP2. It is not known which proteases effect the observed cleavages, nor how many different proteases are involved.
  • Cleavages in the linker peptides might involve only endoproteinases or result from the coordinated action of endoproteinases and exopeptidases that further trim the cleavage products at their ends. Processing at the C- terminal side of the linker peptide occurs between the two acidic residues E and D.
  • the acidic doublet might be a target sequence for a specific endoproteinase.
  • An aspartic endoproteinase that is able to cleave between two consecutive acidic residues has previously been purified from Arabidopsis seeds (D'Hondt et al. 1993, J. Biol. Chem. 268, 20884- 20891).
  • the sequence ED occurs at the very C-terminal end in five out of six internal propeptides of the IbAMP 1 polyprotein precursor (Tailor et al. 1997, J. Biol. Chem. 272, 24480-24487).
  • the ED sequence does not occur at the C- terminal end of the propeptides but is separated by 4 amino acids from this end. Processing of this propeptide in Impatiens balsamina might involve cleavage of the ED sequence followed by partial N-terminal trimming of the resulting protein by an aminopeptidease.
  • an internal propeptide resembling the IbAMP 1 propeptide used in construct 3105 but in which the ED dipeptidic sequence is moved to the C-terminal end of the propeptide, would result in a cleavage product with only one or no extra N- terminal amino acids in the protein located C-terminally from the internal propeptide.
  • another IbAMP 1 propeptide which already has an ED sequence at its C- terminal end (Tailor et al, 1997, J. Biol. Chem. 272, 24480-24487) or a related sequence might give a similar improvement of processing accuracy.
  • Transgenic line 9 from the population of Arabidopsis plants transformed with construct pFAJ3106 was further bred to obtain plants homozygous for the transgene.
  • the DmAMPl- CRPs and RsAFP2-CRPs were purified by reversed phase chromatography from leaf extracellular fluid prepared in the same way as described above in Example 8 for the line transformed with construct pFAJ3105. The chromatogram of this separation is shown in Figure 18. DmAMPl-CRPs eluted in two peaks, called p3106EFl and p3106EF2. Both fractions had the same N-terminal sequence as DmAMPl (Table 3 see Example 10 below).
  • p3106EF2 corresponded to that predicted for a DmAMPl derivative with an additional lysine. We therefore conclude that it represents the cleavage product of the precursor cleaved at the signal peptide cleavage site and C-terminally behind the first residue (lysine) of the linker peptide; This protein is further referred to as DmAMP 1+K.
  • the RsAFP2-CRP fraction was found by N-terminal amino acid sequencing to start by the sequence LIGKRQK.
  • this protein called QLIGKR+ RsAFP2
  • QLIGKR+ RsAFP2 is derived from cleavage of the precursor N-terminally from the sixth last residue (glutamine) of the linker peptide.
  • the proposed cleavage steps involved in processing of the precursor of construct pFAJ3106 are shown in Figure 17.
  • Transgenic line 9 from the population of Arabidopsis plants transformed with construct pFAJ3108 was further bred to obtain plants homozygous for the transgene.
  • the DmAMP 1 - CRPs and RsAFP2-CRPs were purified from a total crude leaf extract of this line, following a procedure based on IEC and RPC as described above in Example 8 for the line transformed with construct 3105.
  • the chromatograms of the IEC and RPC separations are shown in Figure 19. The IEC separation yielded two peaks containing DmAMPl-CRPs. However, no RsAFP2-CRPs could be detected in any of the eluate fractions.
  • Table 3 Mass determined by MALDI-TOF-MS or EI-MS and N-terminal sequence determined by automated Edman degradation of DmAMPl -CRP and RsAFP2- CRP fractions purified as described in Figures 15, 16, 18 and 19. Also shown are the predicted C-terminal sequence that gives best correspondence between experimental mass and theoretical mass.
  • pFAJ3343 the codon for the N-terminal residue of the linker peptide occurring in pFAJ3105 has been deleted. It is expected that cleavage of mature DmAMPl will occur without addition of any amino acid from the linker peptide ( Figure 20).
  • constructs pFAJ3344, pFAJ3345 and pFAJ3346 the codons at the carboxyl-terminal end of the linker peptide in pFAJ3105 have been modified such that the last two, four and five residues have been deleted, respectively.
  • the linker peptide is derived from the fourth internal propeptide of the IbAMP precursor (Tailor R.H. et al, 1997, J. Biol. Chem. 272, 24480- 24487).
  • this linker peptide has been replaced by the first internal propeptide of the IbAMP precursor (Tailor R.H. et al, 1997, ibid.).
  • the doublet of acidic residues occurs at the C-terminus. It is expected that the cleavage will occur such that only one residue will remain attached to the N-terminus of RsAFP2 ( Figure 20).
  • polyprotein region in construct pFAJ3367 consists of the signal peptide region of
  • DmAMPl cDNA followed by the coding regions of four different antimicrobial peptides, each separated by the first internal propeptide region of the IbAMP precursor.
  • the coding region for the four different antimicrobial proteins are, in order (see Figure 21):
  • constructs can be made other mature peptide regions and with any other linker peptide regions described above.
  • polyprotein encoded by constructs pFAJ3106, pFAJ3107 and pFAJ3108 contain linker peptides with the Kex2 recognition site IGKR at their C-terminal ends.
  • Jiang L. and Rogers J.C. (1999, Plant J. 18, 23-32) have shown that polyproteins containing a IGKR site are not or poorly cleaved in transgenic tobacco plants. Improved cleavage was observed in polyproteins in which the IGKR sequence was replaced by the IGKRIGKRIGKR (SEQ ID NO 77) sequence.
  • pFAJ3106-2, pFAJ3107-2 and pFAJ3108-2 are identical to constructs pFAJ3106, pFAJ3107 and pFAJ3108 except for the replacement of the IGKR coding region by a region coding for IGKRIGKRIGKR ( Figure 22). Polyproteins encoded by these constructs will be efficiently cleaved both at the N-terminal end and the C-terminal end of the linker peptide.
  • constructs can be made in which the number of residues at either the N- or C-terminal end of the linker peptide region in constructs pFAJ3106, pFAJ3107 or pFAJ3108 is reduced.
  • the foot-and-mouth disease virus (FMDV) RNA is translated as a polyprotein whose cleavage depends on a 20 amino acids sequence called the 2A sequence (Ryan and Drew 1994, EMBO J. 13, 928-933). Cleavage of the polyproteins joined by the 2A sequence occurs between the 19 th amino acid (G) and the 20 th amino acid (P) of the 2A sequence via a process which is apparently independent of processing enzymes and which might be due to improper formation of the peptide bond between G and P (Halpin et al, 1999, Plant J. 17, 453-459). Halpin C et al. 1999 (Plant J.
  • hybrid linker peptides consisting at their N-terminal part of a linker peptide described in constructs pFAJ3105, pFAJ3106, pFAJ3107 or pFAJ3108 (or a part of such peptide) and at their C-terminal part of the FMDV 2A sequence (or a part of such peptide) are proposed.
  • constructs based on this principle are constructs pFAJ3370 and pFAJ3368 ( Figure 23).
  • Construct pFAJ3370 has a polyprotein region identical to that of construct pFAJ3105 except that the linker peptide is a 29 amino acids peptide consisting of the first 9 amino acids of the fourth internal propeptide of the IbAMP precursor (Tailor R.H. et al, 1997, J. Biol. Chem. 272, 24480-24487) followed by the 20 amino acids of the entire FMDV 2A sequence. Cleavage of this linker peptide should release a mature DmAMPl with an additional serine at its C-terminus and a mature RsAFP2 with an additional proline at its N-terminus.
  • Construct pFAJ3368 is identical to construct pFAJ3370 except that the C-terminal mature protein domain (in this case encoding RsAFP2) is replaced by a domain encoding this mature protein domain preceded by a signal peptide domain (in this case encoding RsAFP2 with its own signal peptide). If cleavage between G and P of the FMDV 2A sequence occurs prior to full translocation of the polyprotein into the endoplasmic reticulum then it is expected that construct pFAJ3368 will provide better targetting of both mature proteins to the extracellular space in comparison to construct pFAJ3370. In this case, the secreted mature proteins will consist of DmAMPl with an additional serine at its C-terminus and RsAFP2 with no added amino acids.
  • cleavage between G and P of the FMDV 2A sequence occurs after translocation of the polyprotein into the endoplasmic reticulum, then it is expected that the signal peptide attached to RsAFP2 will not be efficiently removed and in this case construct pFAJ3370 will be preferred over pFAJ3368.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP99940345A 1998-08-18 1999-08-17 Genetic method for the expression of polyproteins in plants Withdrawn EP1104468A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GB9818001 1998-08-18
GBGB9818001.1A GB9818001D0 (en) 1998-08-18 1998-08-18 Genetic method
GBGB9826753.7A GB9826753D0 (en) 1998-12-04 1998-12-04 Genetic method
GB9826753 1998-12-04
PCT/GB1999/002716 WO2000011175A1 (en) 1998-08-18 1999-08-17 Genetic method for the expression of polyproteins in plants

Publications (1)

Publication Number Publication Date
EP1104468A1 true EP1104468A1 (en) 2001-06-06

Family

ID=26314226

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99940345A Withdrawn EP1104468A1 (en) 1998-08-18 1999-08-17 Genetic method for the expression of polyproteins in plants

Country Status (7)

Country Link
EP (1) EP1104468A1 (pt)
JP (1) JP2002523047A (pt)
CN (1) CN1315999A (pt)
AU (1) AU5434099A (pt)
BR (1) BR9913076A (pt)
CA (1) CA2335379A1 (pt)
WO (1) WO2000011175A1 (pt)

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6677503B1 (en) 1999-06-23 2004-01-13 Pioneer Hi-Bred International, Inc. Sunflower anti-pathogene proteins and genes and their uses
US6667427B1 (en) 1999-10-14 2003-12-23 Pioneer Hi-Bred International, Inc. Sclerotinia-inducible promoters and their uses
WO2002061043A2 (en) 2001-01-29 2002-08-08 Cargill, Incorporated Fungal resistant transgenic plants
DE60109819T2 (de) * 2001-01-30 2006-01-19 Wisconsin Alumini Research Foundation, Madison Expression von multiplen proteinen in transgenen pflanzen
AU2002229407C1 (en) 2001-02-08 2005-09-01 Hexima Limited Plant-derived molecules and genetic sequences encoding same and uses therefor
CN102851306B (zh) * 2005-09-26 2016-05-18 绿色细胞有限公司 用于生产蛋白的转基因芦荟植物及其相关的方法
CA2653404C (en) * 2006-05-25 2015-06-30 Hexima Limited Multi-gene expression vehicle
US8153863B2 (en) 2007-03-23 2012-04-10 New York University Transgenic plants expressing GLK1 and CCA1 having increased nitrogen assimilation capacity
AR075257A1 (es) 2008-02-01 2011-03-23 Hexima Ltd Sistema de proteccion de plantas contra la infeccion por agentes patogenos
US9889184B2 (en) 2008-08-05 2018-02-13 Hexima Limited Anti-pathogen systems
JP5645155B2 (ja) * 2009-08-31 2014-12-24 国立大学法人 琉球大学 分子量マーカー及び分子量マーカーの作製方法
SG192063A1 (en) 2011-02-07 2013-08-30 Hexima Ltd Modified plant defensins useful as anti-pathogenic agents
AU2012242991B2 (en) * 2011-04-11 2017-03-02 Targeted Growth, Inc. Identification and the use of KRP mutants in plants
WO2013078433A1 (en) 2011-11-23 2013-05-30 University Of Hawaii Auto-processing domains for polypeptide expression
GB201609969D0 (en) 2016-06-07 2016-07-20 Univ Cape Town Drought resistance multigene construct
US20230250461A1 (en) * 2020-06-26 2023-08-10 Yale University Compositions and Methods for Selective Detection and/or Inhibition of Bacterial Pathogens in Microbial Communities

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5162601A (en) * 1989-11-22 1992-11-10 The Upjohn Company Plant potyvirus expression vector with a gene for protease
US5491076A (en) * 1993-11-01 1996-02-13 The Texas A&M University System Expression of foreign genes using a replicating polyprotein producing virus vector
GB9326271D0 (en) * 1993-12-23 1994-02-23 Zeneca Ltd Expression of self-processing polyprotein in transgenic plants
AU1743795A (en) * 1994-02-03 1995-08-21 Scripps Research Institute, The A cassette to accumulate multiple proteins through synthesis of a self-processing polypeptide
GB9404807D0 (en) * 1994-03-11 1994-04-27 Zeneca Ltd Biocidal proteins
GB9607899D0 (en) * 1996-04-17 1996-06-19 Scottish Crop Research Inst Virus-like particle

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0011175A1 *

Also Published As

Publication number Publication date
JP2002523047A (ja) 2002-07-30
WO2000011175A1 (en) 2000-03-02
AU5434099A (en) 2000-03-14
CA2335379A1 (en) 2000-03-02
CN1315999A (zh) 2001-10-03
BR9913076A (pt) 2001-05-08

Similar Documents

Publication Publication Date Title
WO2000011175A1 (en) Genetic method for the expression of polyproteins in plants
De Bolle et al. Antimicrobial peptides from Mirabilis jalapa and Amaranthus caudatus: expression, processing, localization and biological activity in transgenic tobacco
AU2002333330B2 (en) Production of peptides and proteins by accumulation in plant endoplasmic reticulum-derived protein bodies
NL8901932A (nl) Produktie van heterologe eiwitten in planten of plantecellen.
JP2008521767A (ja) タンパク質の単離および精製
US20070039073A1 (en) Novel synthetic genes for plant gums
EP1481061B1 (en) Denaturant stable and/or protease resistant, chaperone-like oligomeric proteins, polynucleotides encoding same and their uses
Hayashi et al. Accumulation of a fusion protein containing 2S albumin induces novel vesicles in vegetative cells of Arabidopsis
US5670635A (en) Seed storage protein with nutritionally balanced amino acid composition
AU772284B2 (en) Polynucleotide sequences
AU748910B2 (en) Novel synthetic genes for plant gums
US20030092624A1 (en) Denaturat stable and/or protease resistant, chaperone-like oligomeric proteins, polynucleotides encoding same, their uses and methods of increasing a specific activity thereof
Valdez-Ortiz et al. One-step purification and structural characterization of a recombinant His-tag 11S globulin expressed in transgenic tobacco
US20090253125A9 (en) Denaturat stable and/or protease resistant, chaperone-like oligomeric proteins, polynucleotides encoding same, their uses and methods of increasing a specific activity thereof
US7399597B2 (en) Epitope identification and modification for reduced allergenic activity in proteins targeted for transgenic expression
AU2003235249B8 (en) Methods for accumulating arbitrary peptides in plant protein bodies
AU2002301020B2 (en) Novel Synthetic Genes for Plant Gums
Zuo Sulfur-rich 2S proteins in Lecythidaceae and their methionine-enriched forms in transgenic plants
JP2004097005A (ja) ダイズβ−コングリシニンの液胞輸送シグナルペプチドおよびその利用

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010319

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SYNGENTA LIMITED

17Q First examination report despatched

Effective date: 20031202

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040615