EP1094844A1 - Formulations de vaccins a base de polynucleotides - Google Patents

Formulations de vaccins a base de polynucleotides

Info

Publication number
EP1094844A1
EP1094844A1 EP99933739A EP99933739A EP1094844A1 EP 1094844 A1 EP1094844 A1 EP 1094844A1 EP 99933739 A EP99933739 A EP 99933739A EP 99933739 A EP99933739 A EP 99933739A EP 1094844 A1 EP1094844 A1 EP 1094844A1
Authority
EP
European Patent Office
Prior art keywords
dna
pharmaceutical formulation
adjuvant
aluminum
immune response
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99933739A
Other languages
German (de)
English (en)
Other versions
EP1094844A4 (fr
Inventor
David B. Volkin
Robert K. Evans
Jeffrey B. Ulmer
Michael J. Caulfield
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Publication of EP1094844A1 publication Critical patent/EP1094844A1/fr
Publication of EP1094844A4 publication Critical patent/EP1094844A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/21—Retroviridae, e.g. equine infectious anemia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/245—Herpetoviridae, e.g. herpes simplex virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/29—Hepatitis virus
    • A61K39/292—Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16634—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to novel vaccine formulations comprising nucleic acid molecules and an adjuvant which does not substantially bind the nucleic acid molecules, and their methods of use.
  • a DNA vector containing a gene encoding a viral, bacterial, parasitic or tumor antigen has been shown to express that respective antigen in muscle cells and possibly other cell types subsequent to intramuscular injection.
  • a naked DNA vector has come to be known as a polynucleotide vaccine (PNV) or DNA vaccine.
  • PNV polynucleotide vaccine
  • the technique of using naked DNA as a prophylactic agent was reported in WO90/11092 (4 October 1990), in which naked polynucleotides were used to vaccinate vertebrates.
  • both humoral and cell-mediated responses have been shown to occur when using DNA plasmid vectors encoding influenza antigens as a PNV, providing both homologous and cross-strain protection against a subsequent live virus challenge.
  • the generation of both of these types of immune responses by a single vaccination approach offers a potential advantage over certain existing vaccination strategies.
  • the use of PNVs to generate antibodies may result in an increased duration of the antibody response, and may express an antigen having both the exact sequence of the clinically circulating strain of virus as well as the proper post-translational modifications and conformation of the native protein (vs. recombinant protein).
  • the generation of CTL responses by this means offers the benefits of cross-strain protection without the use of a live potentially pathogenic vector or attenuated virus.
  • PNVs have been in the form of DNA plasmid vectors which consist of a bacterial plasmid with a strong viral promoter, the DNA fragment containing an open reading frame which expresses the antigen of interest, and a polyadenylation/transcription termination sequence.
  • the DNA plasmid vector is transformed into and grown in a bacterial host (such as E. coli) then purified and injected into the host in an aqueous solution.
  • This PNV is taken up by a host cell (such as a muscle cell) wherein the antigen of interest is expressed.
  • the plasmid is constructed so as to lack a eukaryotic origin of replication to limit host cell replication and/or host genome integration of the PNV construct.
  • Benvenisty and Reshef (1986, Proc. Natl. Acad. Sci., 83: 9551-9555) showed expression of DNA co-precipitated with calcium phosphate and introduced into mice intraperitoneally into liver and spleen cells.
  • Persistent expression has been observed after intramuscular injection in skeletal muscle of rats, fish and primates, and cardiac muscle of rats.
  • a PNV may be delivered to the target cell by particle bombardment, whereby the polynucleotide is adsorbed onto gold microprojectiles and delivered directly intracellularly by high velocity bombardment.
  • This method has been used to induce an immune response to human growth hormone (Tang, et al., 1992, Nature 356: 152-154), influenza HA (Eisenbraun, et al., 1993, DNA Cell Biol 12: 791-797; Fynan, et al., 1993, Proc. Natl. Acad. Sci. 90: 11478- 11482) and HIV gpl20 (Eisenbraun, et al., 1993, DNA Cell Biol: 12: 791-797).
  • DNA vaccines are direct injection of the construct of interest in a saline or PBS solution without the addition of an adjuvant as seen with whole cell, acellular and subunit vaccines.
  • Adjuvants which have historically been used to enhance the immune response of classical whole cell, acellular and subunit vaccines include the mineral based compounds such as aluminum phosphate, aluminum hydroxide and calcium phosphate. These particular compounds are known in the art for a history of safe use as vaccine adjuvants, and are currently the only adjuvants approved for use in humans in the United States. Calcium phosphate is currently approved for use in humans in Europe.
  • An aluminum phosphate adjuvant is actually amorphous aluminum hydroxyphosphate, Al(OH) m (PO ) n and an aluminum hydroxide adjuvant is actually an aluminum oxyhydroxide composition, AIO(OH).
  • Aluminum phosphate is commercially available as an amorphous aluminum hydroxyphosphate gel (known as Adju-Phos ® ). These adjuvants have different charges at neutral pH, with AIO(OH) being positively charged and aluminum phosphate being negatively charged (see Gupta, et al., 1995, Ch.8 at page 231, in Vaccine Design: The Subunit and Adjuvant Approach, Eds. Powell and Newman, Plenum Press (New York and London).
  • Vaccines containing AlPO 4 as an adjuvant are known to stimulate IL-4 and a T H 2- type of helper T cell response, as well as increasing levels of IgGl and IgE antibodies (Vogel and Powell, 1995, Ch.7, in Vaccine Design: The Subunit and Adjuvant Approach, Eds. Powell and Newman, Plenum Press (New York and London) @ p. 142.
  • Aluminum hydroxide is commercially available in crystalline form as aluminum oxyhydroxide (Alhydrogel ® ), and is also known as boehmite.
  • Vaccines comprising AIO(OH) as an adjuvant also stimulate IL-4, T-helper-2 subsets, as well as increasing levels of IgGl and IgE antibodies (Vogel and Powell, 1995, Ch.7, in Vaccine Design: The Subunit and Adjuvant Approach, Eds. Powell and Newman, Plenum Press (New York and London) @ p. 146. It is also known in the art that preparations of both amorphous aluminum hydroxyphosphate gel and aluminum oxyhydroxide used in commercial vaccines vary. Shirodkar, et al. (1990, Pharm. Res.
  • Effective adjuvanticity is known to be dependent on adsorption of the antigen of interest to an aluminum adjuvant.
  • electrostatic forces are paramount in effective abso ⁇ tion. Seeber, et al. (1991, Vaccine 9: 201-203) show that the importance of electrostatic forces is such that antigens with a high isoelectric point should be adsorbed to Adju-Phos ® whereas antigens with a low isoelectric point may best be adsorbed to (Alhydrogel ® ).
  • calcium phosphate is another mineral salt which has been successfully used as an adjuvant to traditional protein vaccines.
  • the use of calcium phosphate as an adjuvant is known and was first disclosed by Relyveld, et al.
  • the present invention addresses this need by disclosing a DNA vaccine formulation comprising an adjuvant which does not substantially bind DNA and increases immunogenicity subsequent to vaccination of a vertebrate host.
  • the present invention relates to a novel vaccine formulation comprising nucleic acid molecules and an adjuvant provided in a biologically effective concentration so as to promote the effective induction of an immune response directed toward one or more specific antigens encoded by the nucleic acid molecule.
  • a particular embodiment of the present invention relates to a DNA vaccine formulation wherein the adjuvant comprises mineral-based particles which are negatively charged in the DNA suspension. These particles possess a sufficient negative charge as to substantially retard binding to the nucleic acid molecule of interest.
  • Such a DNA-adjuvant composition will increase the immune response and may decrease nuclease digestion of the DNA vaccine, within the vertebrate host subsequent to immunization.
  • a preferred embodiment of the present invention relates to a DNA vaccine formulation which comprises a non-DNA binding mineral-based adjuvant generated from one or more forms of an aluminum phosphate-based adjuvant.
  • An especially preferred embodiment of the present invention relates to a DNA vaccine formulation wherein the aluminum phosphate-based adjuvant possesses a molar PO 4 /Al ratio of approximately 0.9, including but not limited to Adju-Phos ® .
  • Another embodiment of the present invention relates to a DNA vaccine formulation which comprises a non-DNA binding mineral-based adjuvant generated from one or more forms of a calcium phosphate-based adjuvant.
  • DNA vaccines formulated with calcium phosphate increase antibody responses when the adjuvant is added at concentrations which do not result in a high percentage of bound DNA. In other words, calcium phosphate is an effective adjuvant for a DNA vaccine if the formulation contains a substantial amount of free DNA.
  • the nucleic acid molecule of the present invention may include a deoxyribonucleic acid molecule (DNA), such as genomic DNA and complementary DNA (cDNA) as well as a ribonucleic acid molecule (RNA).
  • DNA deoxyribonucleic acid molecule
  • cDNA genomic DNA and complementary DNA
  • RNA ribonucleic acid molecule
  • the nucleic acid molecules comprising the vaccine formulations of the present invention preferably do not show substantial binding to the chosen adjuvant.
  • the skilled artisan will be aware that within any such vaccine formulation, the possibility remains that a measurable, but not biologically determinative, amount of nucleic acid molecules used in the present invention may bind to the chosen adjuvant.
  • the DNA construct may be delivered to the host in the form of a recombinant viral vector (including but in no way limited to a recombinant adenovirus vector, a recombinant adeno-associated vector, recombinant retrovirus vector, a recombinant Sindbis virus vector, and a recombinant alphavirus vector, all known in the art).
  • the DNA construct may also be delivered via a recombinant bacterial vector, such as recombinant BCG or Salmonella.
  • the DNA may be associated with liposomes, such as lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture (see, for example, WO93/24640).
  • a preferred vaccine formulation of the present invention comprises a non- viral DNA vector, most preferably a DNA plasmid-based vector.
  • Standard recombinant DNA techniques for preparing and purifying DNA constructs are used to prepare the DNA polynucleotide constructs utilized in the exemplified PNV vaccine constructs disclosed throughout this specification.
  • Vaccine vectors for use in generating the vaccine formulations of the present invention, as well as practicing the related methods include but are not necessarily limited to the DNA plasmid vectors VI, V1J, VI Jneo, VUns, VI Jp, V1R and VUns-tPA.
  • Example sections exemplify various polynucleotide vaccine constructs, such as a DNA plasmid vector expressing hemagglutinin (HA), a surface glycoprotein of influenza A, the nucleoprotein of influenza A, the HBsAg surface antigen from hepatitis B, as well as gp 120 and gag constructs from HIV. Therefore, it is evident that this specification gives excellent guidance to the skilled artisan to utilize the nucleic acid formulations of the present invention with an additional construction not expressly exemplified in the Example sections. Therefore, numerous other constructs representing different DNA constructs, modes of delivery, disease and antigen targets are envisioned for use in the vaccine formulations of the present invention.
  • HA hemagglutinin
  • Examples of viral or bacterial challenges which may be amenable to either a prophylactic or therapeutic treatment include but are not limited to influenza, he ⁇ es simplex virus (HSV), human immunodeficiency virus (HIV), tuberculosis, human papilloma virus, hepatitis A, hepatitis B, and hepatitis C. It will also be within the scope of the present invention to provide prophylactic or, most likely, therapeutic treatment for non-infectious diseases, such as cancer, autoimmune disorders, and various allergies.
  • the present invention also relates to methods of generating an immune response in a vertebrate host, such as a human, by administering the DNA vaccine formulations of the present invention.
  • polynucleotide as used herein is a nucleic acid which contains essential regulatory elements such that upon introduction into a living, vertebrate cell, it is able to direct the cellular machinery to produce translation products encoded by the genes comprising the polynucleotide.
  • substantially retard binding “does not substantially bind”, or similar language as used herein refers the concept that a small proportion of the nucleic acid may in fact bind adjuvant within the vaccine formulation. However, any such bound material does not affect the intended biological consequence of the vaccine formulations of the present invention. Any decrease in biological activity in response to such binding may easily be overcome by adjusting slightly upward the dosage given to the vertebrate host.
  • promoter refers to a recognition site on a DNA strand to which the RNA polymerase binds.
  • the promoter forms an initiation complex with RNA polymerase to initiate and drive transcriptional activity.
  • the complex can be modified by activating sequences termed “enhancers” or inhibiting sequences termed “silencers.”
  • leader refers to a DNA sequence at the 5' end of a structural gene which is transcribed along with the gene.
  • the leader usually results in the protein having an N-terminal peptide extension sometimes called a pro- sequence.
  • this signal sequence which is generally hydrophobic, directs the protein into endoplasmic reticulum from which it is discharged to the appropriate destination.
  • intron refers to a portion or portions of a gene which does not encode a portion of the gene product. Introns from the precursor RNA are excised, wherein the resulting mRNA translates the respective protein.
  • cassette refers to the sequence of the present invention which contains the nucleic acid sequence which is to be expressed. The cassette is similar in concept to a cassette tape. Each cassette will have its own sequence. Thus by interchanging the cassette the vector will express a different sequence. Because of the restrictions sites at the 5' and 3' ends, the cassette can be easily inserted, removed or replaced with another cassette.
  • 3' untranslated region or "3 1 UTR” refers to the sequence at the 3' end of a structural gene which is usually transcribed with the gene. This 3' UTR region usually contains the poly A sequence. Although the 3' UTR is transcribed from the DNA it is excised before translation into the protein.
  • Non-Coding Region or "NCR” refers to the region which is contiguous to the 3' UTR region of the structural gene. The NCR region contains a transcriptional termination signal.
  • vector refers to some means by which DNA fragments can be introduced into a host organism or host tissue.
  • vectors include but are not limited to recombinant vectors, including DNA plasmid vectors, viral vectors such as adenovirus vectors, retrovirus vectors and adeno- associated virus vectors, as well as bacteriophage vectors and cosmid vectors.
  • biologically effective amount means sufficient PNV is injected to produce the adequate levels of the polypeptide.
  • This level may vary.
  • gene refers to a segment of nucleic acid which encodes a discrete polypeptide.
  • compositions useful for inducing immune responses are used interchangeably to indicate compositions useful for inducing immune responses.
  • Figure IA and Figure IB show the effect of aluminum phosphate on the generation of anti-HA antibody titers in mice at 4 weeks post 1 injection (Figure 1 A) and 8 weeks post 1 injection (Figure IB) at DNA HA doses of 0.5 ⁇ g and 10 ⁇ g.
  • Figure 2 A and Figure 2B show a time course measurement of anti-HA antibody titers in mice after a single innoculation of FR-9502 HA DNA (A Georgia 93), with ( •) and without ( ⁇ ) aluminum phosphate injection at DNA HA doses of 0.5 ⁇ g ( Figure 2 A) and 10 ⁇ g ( Figure 2B).
  • Figure 3 A and Figure 3B show that a range of DNA doses enhance the immune response in mice, as measured by anti-HA antibody production after a single innoculation of FR-9502 HA DNA (A/Georgia 93) as measured by HI titer ( Figure 3 A) or ELISA titer ( Figure 3B).
  • Figure 4 shows the enhancement of anti-NP antibody responses in mice after innoculation with NP plasmid DNA with or without aluminum phosphate at DNA doses of 5 ⁇ g and 50 ⁇ g at 6 weeks post 1 injection and 3 weeks post 2 injections.
  • Figure 5A (IL-2), Figure 5B (INF- ⁇ ), Figure 5C (IL-4) and Figure 5D (IL-10) show the effect of aluminum phosphate on respective cytokine secretion from antigen restimulation spleen cells of NP plasmid DNA inoculated mice (6 weeks post 1 injection and 3 weeks post 2 injection) at DNA doses of 5 meg and 50 meg with one, two or three injections.
  • Figure 6 A - Figure 6D show the effect of aluminum phosphate on the cytotoxic T lymphocyte response after a single innoculation of NP plasmid DNA innoculation in mice: Figure 6A (5 ⁇ g DNA, 6 weeks post injection, flu-infected target cells); Figure 6B (5 ⁇ g DNA, 6 weeks post injection, peptide pulsed target cells); Figure 6C (50 ⁇ g DNA, 6 weeks post injection, flu-infected target cells); and, Figure 6D (50 ⁇ g DNA, 6 weeks post injection, peptide-pulsed target cells).
  • Figure 7 shows the effect of aluminum phosphate on the antibody response to inoculation of mice with a DNA vaccine (VIR.S) encoding hepatitis B surface antigen.
  • VIR.S DNA vaccine
  • Recombivax HB® A l ⁇ g dose of Recombivax HB® was compared for immunogenicity with the VIR.S vaccine injected with or without 45 ⁇ g of aluminum phosphate (Adju- Phos®). Mice were injected at day 0 and day 42 with Recombivax HB® ( •), 100 ⁇ g HBV DNA with adjuvant ( ⁇ ), 100 ⁇ g HBV DNA without adjuvant ( ⁇ ), or 1 ⁇ g of HBsAg (protein) without adjuvant (0 ).
  • Figure 8 shows the effect of HBV DNA vaccine (VIR.S) dosing with and without adjuvant on HBsAg antibody production six weeks after a single injection of mice. Forty five ⁇ g of aluminum phosphate (AdjuPhos®) or aluminum hydroxyphosphate was added with 1 ⁇ g, 10 ⁇ g and 100 ⁇ g HBV DNA with and without adjuvant.
  • AdjuPhos® aluminum phosphate
  • Al hydroxyphosphate was added with 1 ⁇ g, 10 ⁇ g and 100 ⁇ g HBV DNA with and without adjuvant.
  • Figure 9 shows the effect of a second dose at day 42 (bleed at day 63) for the dosing effects disclosed for Figure 8.
  • Figure 10 shows the induction of a CTL response in response to DNA vaccination with VIR.S for a formulation with and without an aluminum phosphate adjuvant (45 ⁇ g/100 ⁇ l sample).
  • Figure 11 shows the effect of aluminum phosphate or calcium phosphate on the gpl20 and gag antibody response after inoculation of mice with a HIV env/gag DNA plasmid construct, as measured by an ELIS A assay.
  • Figure 12A and Figure 12B show a time course measurement of anti -
  • the present invention relates to a novel vaccine formulation comprising nucleic acid molecules and an adjuvant provided in a biologically effective concentration so as to promote the effective induction of an immune response directed toward one or more specific antigens encoded by the nucleic acid molecule.
  • a particular embodiment of the present invention relates to a DNA vaccine formulation wherein the adjuvant comprises mineral-based particles which are negatively charged in the DNA suspension. These particles possess a sufficient negative charge as to substantially retard binding to the nucleic acid molecule of interest.
  • a DNA-adjuvant composition will increase the immune response and may decrease nuclease digestion of the DNA vaccine, within the vertebrate host subsequent to immunization.
  • a preferred embodiment of the present invention relates to a DNA vaccine formulation which comprises a non-DNA binding mineral adjuvant generated from one or more forms of an aluminum phosphate-based adjuvant.
  • aluminum phosphate is oftentimes used in the art to describe members of a continuous series of aluminum hydroxyphosphate compositions in which the molar PO 4 /Al ratio ranges from about 0.3 to about 0.9 (Hem and White, 1995, Ch. 9, in Vaccine Design: The Subunit and Adjuvant Approach, Eds. Powell and Newman, Plenum Press (New York and London).
  • Hem and White supra at page 244-255 describe specific factors which will affect the surface charge of the resulting adjuvant.
  • Hem and White state that generating an aluminum phosphate adjuvant with aluminum salts having a weak affinity for aluminum, such as aluminum chloride, will result in an adjuvant with a higher phosphate content than using an aluminum salt with a higher affinity toward aluminum, such as a sulfate anion. It will also be possible to affect the final adjuvant composition by controlling the speed of mixing, the speed and conditions for adjuvant precipitation, heating, and other physical manipulations known to the skilled artisan.
  • An especially advantageous aluminum phosphate adjuvant is a substantially negatively charged aluminum phosphate based adjuvant wherein the molar PO 4 /Al is approximately 0.9.
  • Adju-Phos ® is a commercially available form of amo ⁇ hous aluminum hydroxyphosphate gel which represents an especially preferred adjuvant for use in the DNA vaccine formulations of the present invention. This preference depends on the fact that the amo ⁇ hous aluminum hydroxyphosphate Adju-Phos ® is comprised of negatively charged, micron-sized particles which do not substantially bind DNA in the formulations of the present invention.
  • an aluminum hydroxide adjuvant such as Alhydrogel
  • manipulating conditions including but not limited to adjuvant precipitation conditions, formulation buffer conditions, pH, temperature, and ionic strength.
  • the goal of such an adjuvant manipulation will be to generate an adjuvant with a negatively charged surface such that adjuvant-DNA binding will be substantially prohibited. Therefore, the skilled artisan will understand after review of this specification that negatively charged adjuvants which inhibit substantial adjuvant-DNA binding may be generated by any number of procedures which are well known and readily available.
  • non-commercial sources of aluminum phosphate-based adjuvants may be formed for use in the DNA vaccine formulations of the present invention. Such methods include but are in no way limited to mixing aluminum chloride and trisodium phosphate to generate aluminum phosphate.
  • non-commercial sources of aluminum phosphate-based adjuvants include but are in no way limited to mixing aluminum chloride and trisodium phosphate to generate aluminum phosphate.
  • the skilled artisan is aware that the nature of the adjuvant and its ability to bind to classic antigens is affected by numerous variables, including but not limited to adjuvant precipitation conditions, formulation buffer conditions, pH, temperature, and ionic strength. These same type of component manipulations will be available to the skilled artisan to alter the surface charge of various non-commercial forms of aluminum hydroxyphosphate adjuvants to create an adjuvant surface charge conducive to use in the DNA vaccine formulations of the present invention.
  • the present invention also relates to DNA vaccine formulations which comprise a calcium phosphate-based adjuvant.
  • a calcium phosphate adjuvant gel may be generated by known methods of mixing disodium hydrogen phosphate and calcium chloride.
  • a preferred calcium phosphate adjuvant for the vaccine formulations of the present invention is an adjuvant with a sufficient negative surface charge as to substantially retard binding to the DNA construct of interest.
  • the DNA vaccine formulations of the present invention will contain from about 1 to about 20,000 meg of aluminum or calcium (in an adjuvanted form such as aluminum phosphate, calcium phosphate), preferably from about 10 to about 10,000 meg and most preferably from about 25 to about 2,500 meg.
  • compositions may require particular amounts within these ranges, for example, about 20, 45, 90, 100, 200, 450, 750, 900, 1,500, 2,500, 3,500 meg, 10,000 meg, etc., or other amounts not listed here, may be used. It is noted that a majority of data reported for mice in the Example sections utilize a 100 ⁇ l injection of the DNA vaccine formulation. Therefore, a formulation comprising aluminum at 450 mcg/mL results in a 45 meg dose of aluminum, and is referred throughout the specification as an adjuvant dose, such as 450 mcg/mL of Adju-Phos®. It should be noted that the term "meg” is used interchangebly with " ⁇ g" throughout this specification to represent the unit of measurement, microgram.
  • the nucleic acid molecule of the present invention may include a deoxyribonucleic acid molecule (DNA), such as genomic DNA and complementary DNA (cDNA) as well as a ribonucleic acid molecule (RNA).
  • DNA deoxyribonucleic acid molecule
  • cDNA genomic DNA and complementary DNA
  • RNA ribonucleic acid molecule
  • the DNA of the present invention is associated, but preferably does not bind, a mineral-based adjuvant.
  • the DNA construct may be delivered to the host in the form of a recombinant viral vector (including but in no way limited to a recombinant adenovirus vector, a recombinant adeno-associated vector, recombinant retro virus vector, a recombinant Sindbis virus vector, and a recombinant alphavirus vector, all known in the art).
  • the DNA construct may also be delivered via a recombinant bacterial vector, such as recombinant BCG or Salmonella.
  • the DNA may be associated with lipids to form DNA-lipid complexes or with lipids in the form of liposomes, such as lecithin liposomes or other liposomes known in the art, to form DNA-liposome mixture (see, for example, WO93/24640.
  • a preferred vaccine formulation of the present invention comprises a non-viral DNA vector, most preferably a DNA plasmid-based vector.
  • Standard recombinant DNA techniques for preparing and purifying DNA constructs are used to prepare the DNA polynucleotide constructs utilized in the exemplified PNV vaccine constructs disclosed throughout this specification.
  • a gene of interest is ligated into an expression vector which has been optimized for polynucleotide vaccinations. Extraneous DNA is at least partially removed, leaving essential elements such as a transcriptional promoter, immunogenic epitopes, transcriptional terminator, bacterial origin of replication and antibiotic resistance gene.
  • the amount of expressible DNA to be introduced to a vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA construct, and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of about 1 ⁇ g to greater than about 5 mg, and preferably about 10 ⁇ g to 2 mg is administered directly into muscle tissue. Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, inhalation and oral delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided.
  • Vaccine vectors for use in practicing the present invention include but are not necessarily limited to the DNA plasmid vectors V 1 , V 1 J, V 1 R, V 1 Jp, V 1 Jneo, VUns, and VUns-tPA,
  • Vaccine vector VI was constructed from pCMVIE-AKI-DHFR (Whang et al., 1987, J. Virol. 61 : 1796). The AKI and DHFR genes were removed by cutting the vector with EcoRI and self-ligating. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted internal Sad site [at 1855 as numbered in Chapman, et al., 1991, Nuc. Acids Res. 19: 3979).
  • the template used for the PCR reactions was pCMVintA-Lux, made by ligating the Hindlll and Nhel fragment from pCMV6al20 (see Chapman et al., ibid.), which includes hCMV-IEl enhancer/promoter and intron A, into the Hindlll and Xbal sites of pBL3 to generate pCMVIntBL.
  • the primers used to remove the Sad site are: sense primer, 5'-GTATGTGTCTGAAAATGAGCGTGGAGATTGGGC TCGCAC-3' (SEQ ID NO:3) and the antisense primer, 5'-GTGCGAGCCCAATCTCCACGCTCATTTTCAGACACATAC-3' (SEQ ID NO:4).
  • the PCR fragment was cut with Sac I and Bgl II and inserted into the vector which had been cut with the same enzymes.
  • a VI J expression vector may be generated to remove the promoter and transcription termination elements from vector VI in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields.
  • VI J is derived from vectors VI and pUC18, a commercially available plasmid. VI was digested with Sspl and EcoRI restriction enzymes producing two fragments of DNA. The smaller of these fragments, containing the CMVintA promoter and Bovine Growth Hormone (BGH) transcription termination elements which control the expression of heterologous genes, was purified from an agarose electrophoresis gel.
  • BGH Bovine Growth Hormone
  • pUC18 was chosen to provide the "backbone" of the expression vector. It is known to produce high yields of plasmid, is well- characterized by sequence and function, and is of small size. The entire lac operon was removed from this vector by partial digestion with the Haell restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element described above.
  • Plasmids exhibiting either of two possible orientations of the promoter elements within the pUC backbone were obtained.
  • One of these plasmids gave much higher yields of DNA in E. coli and was designated VI J. This vector's structure was verified by sequence analysis of the junction regions and was subsequently demonstrated to give comparable or higher expression of heterologous genes compared with VI.
  • VI Jneo expression vector requires removal of the ampr gene used for antibiotic selection of bacteria harboring VI J because ampicillin may not be desirable in large-scale fermenters.
  • the ampr g en e from the pUC backbone of VI J was removed by digestion with Sspl and Earn 11051 restriction enzymes.
  • the remaining plasmid was purified by agarose gel electrophoresis, blunt- ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase.
  • the commercially available kanr gene derived from transposon 903 and contained within the pUC4K plasmid, was excised using the Pstl restriction enzyme, purified by agarose gel electrophoresis, and blunt-ended with T4 DNA polymerase. This fragment was ligated with the VI J backbone and plasmids with the katf gene in either orientation were derived which were designated as VI Jneo #'s 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the junction regions, and was shown to produce similar quantities of plasmid as V1J. Expression of heterologous gene products was also comparable to VI J for these VI Jneo vectors.
  • VI Jneo VUneo#3, referred to as VI Jneo hereafter, was selected which contains the kan r gene in the same orientation as the ampr gene in VI J as the expression construct.
  • the expression vector VlJns was generated by adding an Sfil site to VI Jneo to facilitate integration studies. A commercially available 13 base pair Sfil linker (New England BioLabs) was added at the Kpnl site within the BGH sequence of the vector.
  • VI Jneo was linearized with Kpnl, gel purified, blunted by T4 DNA polymerase, and ligated to the blunt Sfil linker. Clonal isolates were chosen by restriction mapping and verified by sequencing through the linker. The new vector was designated VlJns. Expression of heterologous genes in VI Jns (with Sfil) was comparable to expression of the same genes in VI Jneo (with Kpnl).
  • the DNA vaccine vector VI Jns-tPA was constructed in order to provide an heterologous leader peptide sequence to secreted and/or membrane proteins. Plasmid VlJns was modified to include the human tissue-specific plasminogen activator (tPA) leader. Two synthetic complementary oligomers were annealed and then ligated into VI Jn which had been Bglll digested.
  • tPA tissue-specific plasminogen activator
  • the sense and antisense oligomers were 5'-GATCACCATGGATGCAATGAAGAGAGGGCTC TGCTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCGA-3' (SEQ ID NO:5); and, 5'-GATCTCGCTGGGCGAAACGAAGA CTGCTCCACACAGCAGCAGCACACAGCAGAGCCCTCTCTTCATTGCATCC ATGGT-3' (SEQ ID NO:6).
  • the Kozak sequence is underlined in the sense oligomer.
  • These oligomers have overhanging bases compatible for ligation to Bglll-cleaved sequences. After ligation the upstream Bglll site is destroyed while the downstream Bglll is retained for subsequent ligations.
  • V1R DNA vaccine vector
  • This DNA vaccine vector is a derivative of VI Jns. This vector is useful to obtain a minimum-sized vaccine vector without unneeded DNA sequences, which still retained the overall optimized heterologous gene expression characteristics and high plasmid yields that VI J and VlJns afford. It was determined that (1) regions within the pUC backbone comprising the E.
  • VIR was constructed by using PCR to synthesize three segments of DNA from VlJns representing the CMVintA promoter/BGH terminator, origin of replication, and kanamycin resistance elements, respectively.
  • Restriction enzymes unique for each segment were added to each segment end using the PCR oligomers: Sspl and Xhol for CMVintA/BGH; EcoRV and BamHI for the kan r gene; and, Bell and Sail for the ori r . These enzyme sites were chosen because they allow directional ligation of each of the PCR-derived DNA segments with subsequent loss of each site: EcoRV and Sspl leave blunt-ended DNAs which are compatible for ligation while BamHI and Bell leave complementary overhangs as do Sail and Xhol. After obtaining these segments by PCR each segment was digested with the appropriate restriction enzymes indicated above and then ligated together in a single reaction mixture containing all three DNA segments.
  • the 5'-end of the ori r was designed to include the T2 rho independent terminator sequence that is normally found in this region so that it could provide termination information for the kanamycin resistance gene.
  • PCR oligomer sequences used to synthesize VIR are as follows: (1) 5'-GGTACA AATA TTGGCTATTGGCCATTGCATACG-3' (SEQ ID NO:7) [Sspl]; (2) 5'- CCACATCTCGAGGAACCGGGTCAATTCTTCAGCACC-3' (SEQ ID NO:8) [Xhol] (for CMVintA/BGH segment); (3) 5'-GGTACAGAT
  • ATCGGAAAGCCACGTTGTGTCTCAAAATC-3' (SEQ.ID NO:9) [EcoRV]; (4) 5'- CACATGGATCCGTAATGCTCTGCCAGTGTT ACAACC-3' (SEQ ID NO: 10) [BamHI], (for kanamycin resistance gene segment) (5) 5'- GGTACATGATCACGTAGAAAAGATCAAAGG
  • ATCTTCTTG-3' (SEQ ID NO:l l) [Bell]; (6) 5'-CCACATGTCGACCCG TAAAAAGGCCGCGTTGCTGG-3' (SEQ ID NO: 12): [Sail], (for E. coli origin of replication).
  • Example sections exemplify various polynucleotide vaccine constructs, such as a DNA plasmid vector expressing hemagglutinin (HA), a surface glycoprotein of influenza A, the nucleoprotein of influenza A, the HBsAg surface antigen from hepatitis B, as well as gp 120 and gag constructs from HIV. Therefore, it is evident that this specification gives excellent guidance to the skilled artisan to utilize the nucleic acid formulations of the present invention with an additional construction not expressly exemplified in the Example sections.
  • HA hemagglutinin
  • nucleic acid molecule used such as DNA plasmid, recombinant viral vectors such as adenovirus, adeno-associated virus, retrovirus
  • viral or bacterial challenges which may be amenable to either a prophylactic or therapeutic treatment include but are not limited to influenza, he ⁇ es simplex virus (HSV), human immunodeficiency virus (HIV), tuberculosis, human papilloma virus, hepatitis A, hepatitis B, and hepatitis C.
  • An improved HSV polynucleotide vaccine formulation of the present invention will comprise a nucleic acid vector encoding an HSV antigen of interest, including but not limited to gB, gD, ⁇ gB (encoding the amino-terminal 707 aa of HSV-2 gB) and ⁇ gD, alone or in combination.
  • the vaccine formulations of the present invention may also be directed to the prophylactic treatment of human immunodeficiency virus-1 (HIV-1).
  • HIV-1 is the etiological agent of acquired human immune deficiency syndrome (AIDS) and related disorders.
  • HIV-1 is an RNA virus of the Retroviridae family and exhibits the 5'LTR-g ⁇ g- o/-e «v-LTR3' organization of all retroviruses.
  • HIV-1 comprises a handful of genes with regulatory or unknown functions, including the tat and rev genes.
  • the env gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gpl ⁇ O) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gpl20) and the transmembrane 41-kDa envelope glycoprotein (gp41).
  • Gpl20 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
  • Gpl20 binds to the CD4 receptor present on the surface of helper T- lymphocytes, macrophages and other target cells. After gpl20 binds to CD4, gp41 mediates the fusion event responsible for virus entry.
  • Infection begins when g ⁇ l20 on the viral particle binds to the CD4 receptor on the surface of T4 lymphocytes or other target cells.
  • the bound virus merges with the target cell and reverse transcribes its RNA genome into the double- stranded DNA of the cell.
  • the viral DNA is inco ⁇ orated into the genetic material in the cell's nucleus, where the viral DNA directs the production of new viral RNA, viral proteins, and new virus particles.
  • the new particles bud from the target cell membrane and infect other cells.
  • a secreted form of gpl20 can be generated in the absence of rev by substitution of the gpl20 leader peptide with a heterologous leader such as from tPA (tissue-type plasminogen activator), and preferably by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides.
  • tPA tissue-type plasminogen activator
  • a tPA-gpl20 chimeric gene cloned into VlJns efficiently expresses secreted gp 120 in a transfected human rhabdomyosarcoma cell line.
  • Monocistronic gpl60 does not produce any protein upon transfection without the addition of a rev expression vector.
  • Representative construct components include but are not limited to tPA-gpl20MN, gpl ⁇ O ⁇ iB, g ⁇ gllffi: for anti-g ⁇ g CTL, tPA-gpl20 ⁇ iB, tPA-gpl40, and tPA-gpl60 with structural mutations: VI, V2, and/or V3 loop deletions or substitutions.
  • the protective efficacy of polynucleotide HIV immunogens against subsequent viral challenge is demonstrated by immunization with the non-replicating plasmid DNA. This is advantageous since no infectious agent is involved, assembly of virus particles is not required, and determinant selection is permitted. Furthermore, because the sequence of gag and protease and several of the other viral gene products is conserved among various strains of HIV, protection against subsequent challenge by a virulent strain of HIV that is homologous to, as well as strains heterologous to the strain from which the cloned gene is obtained, is enabled.
  • the i.m. injection of a DNA expression vector encoding gpl60 results in the generation of significant protective immunity against subsequent viral challenge.
  • gpl60-specific antibodies and primary CTLs are produced.
  • Immune responses directed against conserved proteins can be effective despite the antigenic shift and drift of the variable envelope proteins.
  • the DNA vaccine formulations of the present invention offers a means to induce cross-strain protective immunity without the need for self-replicating agents.
  • DNA constructs compares favorably with traditional methods of protein purification, thus facilitating the generation of combination vaccines. Accordingly, multiple constructs, for example encoding gpl60, gpl20, g ⁇ 41, or any other HIV gene may be prepared, mixed and co- administered. Because protein expression is maintained following DNA injection, the persistence of B- and T-cell memory may be enhanced, thereby engendering long- lived humoral and cell-mediated immunity.
  • HIV DNA-adjuvant-based formulations may also comprise antigenic protein as well as additional known adjuvants, such as saponin, to further enhance the immune response within the vertebrate host. It is within the purview of the skilled artisan to add such components to the vaccine formulations of the present invention.
  • DNA formulations which comprise DNA vaccine constructs providing an immune response to M. tuberculosis.
  • a preferred antigen is the Ag85 A, the Ag85B, or the Ag85C antigen.
  • Vaccine constructs include but are not limited to (1) a construct which contains the either the mature Ag85A, B or C coding region fused with tPA signal sequence; (2) a construct which contains the mature Ag85A, B, or C coding region with no signal sequence; (3) a construct which contains Ag85A, B, or C with its own signal sequence.
  • the vaccine formulations of the present invention are exemplified utilizing a DNA plasmid encoding HA from the A/Georgia/93 strain.
  • influenza genes which encode antigens of interest.
  • genes include but in not necessarily limited to human influenza virus nucleoprotein, basic polymerase 1 , nonstructural protein 1, hemagglutinin, matrix 1, basic polymerase 2 of human influenza virus isolate A/PR/8/34, the nucleoprotein of human influenza virus isolate A/Beijing/353/89, the hemagglutinin gene of human influenza virus isolate A/Texas/36/91, or the hemagglutinin gene of human influenza virus isolate B/Panama/46/90.
  • the vaccine formulations of the present invention may comprise combinations of DNA plasmid constructs expressing HA from other clinical strains, including but not limited to, A/H1N1 (A/Texas/91), and B (B/Panama/90), as well as DNA constructs encoding the internal conserved influenza nucleoprotein (NP) and Ml (matrix) from both A (Beijing/89; H3N2) and B strains may be utilized in order to provide group-common protection against drifted and shifted antigens.
  • the HA DNA will function by generating HA and resulting neutralizing antibodies against HA.
  • the present invention relates to methods of generating an immune response in a vertebrate host, especially a human, wherein the vaccine formulations are administered to the host by any means known in the art of DNA vaccines, such as enteral and parenteral routes.
  • These routes of delivery include but are not limited to intramusclar injection, intraperitoneal injection, intravenous injection, inhalation or intranasal delivery, oral delivery, sublingual administration, subcutaneous administration, transdermal administration, transcutaneous administration, percutaneous administration or any form of particle bombardment.
  • the preferred methods of delivery are intramuscular injection, intranasal and oral based deliveries.
  • An especially preferred method is intramuscular delivery.
  • particle bombardment use of aluminum adjuvants or calcium phosphate adjuvants as outlined in this specification will improve the immune response produced by DNA delivered ballistically, on gold beads or as compacted particles.
  • FR-9502 is a VI Jp based DNA plasmid vector with the gene encoding HA (A Georgia/93).
  • the FR-9502 plasmid DNA binds to all of the aluminum salts, except for Adju-Phos ® .
  • These results were based on a 15 minute, 16 hour or 72 hour incubation period using either 5 or 100 mcg/mL plasmid DNA and 450 mcg/mL of aluminum adjuvant, at 2-8 °C.
  • the binding studies were performed in saline because the presence of phosphate will change the surface charge of the adjuvant to become more like aluminum phosphate (Hem and White, 1995, Ch. 9, in Vaccine Design: The Subunit and Adjuvant Approach, Eds. Powell and Newman, Plenum Press (New York and London).
  • the binding studies for aluminum phosphate were performed in PBS to allow a better comparison with the PBS control in the subsequent animal studies designed to examine the immune response. The samples were centrifuged and aliquots of the supernatant were taken and applied to a 1% agarose gel. Ethidium bromide staining of the gel following electrophoresis revealed the amount of total plasmid in solution by comparison to standards.
  • Type of adjuvant 0.5 - 4 refer to aluminum hydroxyphosphate prepared by precipitation in 3, 6, 12 or 24 mM sodium phosphate, respectively.
  • the points of zero charge for aluminum hydroxide, aluminum hydroxyphosphate, and aluminum phosphate are estimated to be ⁇ 11, 7 and 5).
  • the aluminum concentration was 450 mcg/mL.
  • DNA concentration is expressed as mcg mL. Plasmid DNA at 5 and 100 mcg/mL was incubated in the presence and absence of 450 mcg/mL Adju-Phos in PBS buffer for 10 days at 2-8 oC. Aliquots of the DNA were then subjected to agarose gel electrophoresis and ethidium bromide staining. Densitometry was used to scan a negative of a photograph of the gel to determine the binding state of the DNA and the amount of supercoiled, open-circular and linear forms, by comparison to DNA standards.
  • This section examines the ability of aluminum phosphate to inhibit endogenous nucleases present in mouse and human sera. Since aluminum phosphate carries a negative surface charge one may reason that nucleases may bind to aluminum phosphate and lengthen the lifetime of the DNA in vivo, after intramuscular injection.
  • the results indicate that the addition of 450 mcg/mL aluminum phosphate (Adju-Phos ) to a PBS solution containing 5 mcg/mL DNA and either 10% human serum or 2.5% mouse serum resulted in a significant inhibition of nuclease digestion of DNA.
  • the results also suggest that in 10% bovine serum, different proteins were bound to the DNA in the presence of aluminum phosphate than in the absence of aluminum phosphate (as suggested by the change in mobility in a 1% agarose gel).
  • Example 3 shows the effect of aluminum phosphate (Adju- Phos ® ) on the immune response in mice.
  • Al phosphate Adju- Phos ®
  • the experimental conditions were the same as described in the previous paragraph, except for an evaluation of doubling the aluminum phosphate concentration to 900 mcg/mL.
  • mice Female BALB/c mice (10/group) were inoculated with FR-9502 HA DNA (A/Georgia 93) at doses of 0.5 or 10 ⁇ g and antibody titers (HI and IgG ELISA) were determined at 4 and 8 weeks after a single administration.
  • FR-9502 HA DNA A/Georgia 93
  • antibody titers HI and IgG ELISA
  • mice (10/group) 8 weeks after inoculation of DNA with and without aluminum phosphate were analyzed for immunoglobulin isotypes by an ELISA. Additional studies disclosed in Example Section 7 confirm that co- administration of aluminum phosphate with plasmid DNA encoding influenza HA enhanced the magnitude and duration of anti-HA antibodies in mice, compared to that induced by naked HA DNA alone.
  • antibody titers as measured by the functional assay hemagglutination inhibition (HI), were higher in mice vaccinated with the aluminum phosphate formulation of HA DNA.
  • a wide range of aluminum phosphate and DNA doses are confirmed to be effective in mice, whether measured by HI or an ELISA.
  • the enhancing effects of aluminum phosphate on a DNA construct encoding a second influenza antigen (nucleoprotein or NP) was also tested in mice and the data is also disclosed in
  • Example Section 7 As before, antibody responses were enhanced 5- to 50-fold by formulation of DNA with aluminum phosphate. In addition, it is shown that cytotoxic T lymphocyte responses against NP in these mice were not detrimentally affected.
  • EXAMPLE 4 EFFECT OF ALUMINUM PHOSPHATE (Adju-Phos ® ) ON IN VIVO GENE
  • Example Sections 1-4 show that a DNA vaccine formulation comprising an aluminum-phosphate-based adjuvant and HA plasmid DNA (A/Georgia/93) in PBS substantially increased the humoral immune response to the expressed HA protein in mice (approximately 4- to 11 -fold enhancement in antibody titer).
  • HA DNA formulated with aluminum hydroxide or aluminum hydroxyphosphate adjuvants shown to bind DNA inhibited the immune response to HA protein (compared to plasmid DNA alone in PBS).
  • Each solution contained plasmid DNA at 100 mcg/mL and aluminum hydroxyphosphate.
  • the solutions were prepared, mixed by inversion and incubated at 4°C. After 15 minutes of incubation, the solutions were centrifuged in a microcentrifuge for 2 minutes to pellet the adjuvant. Aliquots of the supernatant were taken, diluted 20-fold with PBS and subjected to a UV absorbance scan from 400 to 220 nm. The DNA concentration in the supernatant was determined, based on the assumption that an absorbance of 1.0 at 260 nm is produced by DNA at 50 mcg/mL. The results are shown below in Table 5.
  • an adjuvant in a DNA vaccine formulation that may, in some formulations, substantially bind DNA.
  • This adjuvant may be useful by including a phosphate buffer or other buffer that results in an inability to substantially bind DNA within this DNA vaccine formulation.
  • a refers to the geometric mean titer to the HA protein antigen
  • b 8-week GMT was determined by ELISA assay
  • HA DNA potency in Figure 1 A and IB is reported as the production of neutralizing antibodies as measured in vitro by a hemagglutinin inhibition (HI) assay.
  • HI hemagglutinin inhibition
  • a HA DNA vaccine formulation comprising aluminum phosphate as an adjuvant did not significantly alter the IgG antibody profile.
  • Table 3 shows that PBS- and A1PO4- based DNA vaccine formulations (measured at 0.5 and 10 ⁇ g doses at 4 and 8 weeks post-injection) result in similar isotype profiles of IgGl, IgG2a, IgG2b and IgG3 in response to HA DNA vaccination.
  • the profile of the humoral response to HA DNA vaccination the duration of the response in mice also indicates that the rise and fall of HA neutralizing antibodies follows a similar path, regardless of whether the formulation contained PBS or A1PO4.
  • Table 8 compares the ability of HA DNA to elicit neutralizing antibodies when A1PO4 is either co-injected with the DNA or administered to mice three days prior to 3 days after DNA immunization.
  • the DNA/A1PO4 formulations of the present invention provide a preferred formulation for stimulating an in vivo humoral response following DNA vaccination.
  • FIG. 3A and Figure 3B show that various A1PO4 concentrations co-administered within various dose ranges of HA DNA promote an enhanced humoral response at least 4 weeks post-injection. It is evident from these results that a wide A1PO4 dose range will be effective in providing the DNA adjuvant effect disclosed and exemplified within this specification. Therefore, the data presented in this Example Section show that A1PO4 acts as a adjuvant to significantly increase humoral responses upon DNA vaccination. This increased humoral response is not dependent upon specific dose combinations of adjuvant and DNA.
  • Influenza NP DNA Vaccine - Female BALB/c mice (10/group) were inoculated with a DNA plasmid encoding nucleoprotein (NP) from influenza virus A/PR/8/34 (H1N1) at doses of 0.5 ⁇ g or 50 ⁇ g and anti-NP titers were determined at 6 weeks after a single injection and at 3 weeks post two injections. Unless indicated otherwise, A1PO4 was co-administered at 450 ⁇ g /ml along with NP DNA. NP DNA potency is reported in Figure 4 as anti-NP antibodies measured as the geometric mean ELISA titer. Serum samples were collected from groups of 3 mice at the time of sacrifice for cellular immune responses.
  • NP nucleoprotein
  • Figure 5A (IL-2), Figure 5B (LNF- ⁇ ), Figure 5C (IL-4) and Figure 5D (IL-10) show that innoculation of mice with a NP DNA plasmid/AlPO4 vaccine formulation provided no significant alteration of cytokine secretion as compared to a NP DNA plasmid/PBS formulation injected at identical doses, as measured from spleen cells pooled from 3 mice/group.
  • cytotoxic T lymphocytes were generated from mice that had been immunized with DNA or that had recovered from infection with A/PR/8/34. Control cultures were derived from mice that had been injected with control DNA and from uninjected mice.
  • Single cell suspensions were prepared from pools of 3 spleens/group, red blood cells were removed by lysis with ammonium chloride, and spleen cells were cultured in RPMI 1640 supplemented with 10% Fetal Bovine Serum (FBS), 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 0.01 M HEPES (pH 7.5), and 2 mM 1-glutamine.
  • FBS Fetal Bovine Serum
  • penicillin 100 U/ml
  • streptomycin 100 ⁇ g/ml
  • HEPES 0.01 M HEPES
  • Target cells labeled with Na51CrO were pulsed with synthetic peptide NP147-155 at a concentration of 10 ⁇ M.
  • the target cells were then mixed with CTL at designated effecto ⁇ targer cell ratios in 96-well plates, and incubated at 370C for four hours in the presence of 5% CO2.
  • a 20 ⁇ l sample of supernatant from each cell mixture was counted to determine the amount of 51 Cr released from target cells and counted in a Betaplate scintillation counter (LKB- Wallac, Turku, Finland). Maximal counts, released by addition of 6M HC1, and spontaneous counts released without CTL were determined for each target preparation. Percent specific lysis was calculated as: [(E -S)/(M -S] x 100, where E represents the average cpm released from target cells in the presence of effector cells,
  • FIG. 6 A, Figure 6B, Figure 6C and Figure 6D show a minimal effect of the presence of A1PO4 on induction of an CTL response by innoculation with a NP DNA plasmid construct.
  • BALB/c mice were injected in the quadriceps of both legs with plasmid DNA encoding A/PR/8/34 (H1N1) with either 5 ⁇ g or 50 ⁇ g of plasmid DNA, in PBS or A1PO4.
  • the level of % specific lysis was determined through lymphocyte cultures derived from mice 6 weeks post injection. The results show that the CTL response was similar at both doses for both peptide-pulsed cells and flu- infected cells. Similar results were obtained for 5 ⁇ g or 50 ⁇ g doses at 3 weeks post 2 injections.
  • HBs major envelope protein
  • V1J derived from a pUC19 plasmid containing the human cytomegalovirus (CMV) immediate early promoter with its intron A sequence, multiple restriction sites (including Bgl II) for cloning and the bovine growth hormone polyadenylation signal sequence.
  • CMV human cytomegalovirus
  • the HB DNA plasmid vector expressing the adw subtype is VI Jns. S.
  • the HB DNA plasmid vector expressing the ayw subtype is VIR.S, which was prepared by subcloning the S gene from a pBR322 plasmid that contained the entire HBV genome into the Bglll restriction site of the VIR. Expression of the S gene was confirmed in RD cells (a human myoblast cell line) by calcium phosphate-mediated transfection using the CellPhect kit (Pharmacia) and detection of the HBsAg using the Auzyme EIA kit (Abbott Labs). Anti-HBs EIA (total antibody) - A microtiter plate modification of the
  • AUSAB EIA kit (Abbott Labs, N. Chicago, IL) was used to quantify antibodies to hepatitis B surface antigen (HBsAg).
  • Costar EIA 96-well flat bottom plates (Costar, Cambridge MA, #3591) were coated overnight at 4°C with recombinant HBsAg (prepared e.g., U.S.Patent Nos. 4,769,238; 4,935,235; and 5,196,194) at 4 ⁇ g/ml in Tris-saline, pH 9.5. Plates were washed 3 times with PBS and then blocked with 175 ⁇ l/well of PBS/5% FCS/ 0.1% azide for 2 hours at room temperature or overnight at 4°C.
  • Optical densities were read at 490 nm and 650 nm using a Molecular Devices microplate reader (Molecular Devices, Menlo Park, CA).
  • Anti-HBs titers (in mlU/mL) were calculated by the Softmax computer program (version 2.32) using a standard curve generated using a 4-parameter fit algorithm. Since the assay is species-independent, a set of human serum standards (Abbott quantitation kit) was used to generate the standard curve so that titers could be quantified relative to a reference standard in mlU/mL.
  • Anti-HBs EIA isotype-specific
  • Microtiter plates were coated with HBsAg and blocked as described above. Five-fold serial dilutions were made (in duplicate) in 8 consecutive wells of the plate for each serum sample. The plates were then incubated overnight at 4°C. After 3 wash cycles with PBS (using a TiterTech plate washer), alkaline phosphatase-conjugated goat anti-mouse immunoglobulin reagents specific for mouse IgGl or mouse IgG2a isotypes (Southern Biotechnology Associates, Birmingham, AL) were added at a final dilution of 1 :2000.
  • the plates were washed 6 times using a TiterTech plate washer, and then 60 ⁇ l per well of the enzyme substrate (p-nitrophenylphosphate [Sigma Chemical Co., St. Louis, MO] dissolved at 1 mg/mL in Tris saline, pH 9.5) was added. After 30 minutes at room temperature, the reaction was stopped with the addition of 60 ⁇ l/well of 3N NaOH. Optical densities were read at 405 nm using a Molecular Devices microplate reader. Data were collected using the Softmax computer program.
  • the enzyme substrate p-nitrophenylphosphate [Sigma Chemical Co., St. Louis, MO] dissolved at 1 mg/mL in Tris saline, pH 9.5
  • a standard curve was generated using mouse monoclonal anti-HBs antibodies of the IgGl (catalogue # 16021, Pharmingen, San Diego, CA) or IgG2a (cat. # 1601 ID, Pharmingen) isotypes.
  • Antibody concentrations relative to each isotype standard were calculated as described previously (Caulfield and Shaffer, 1984, J. Immunol. Methods 74: 205-215). Briefly, to calculate titers, an OD value of 0.1 units was set as the endpoint.
  • CTL assays Cytotoxic T Lymphocyte Assays
  • BALB/c mice were injected twice with a vaccine formulation consisting of HBV DNA plus aluminum phosphate or with naked HBV DNA.
  • a single cell suspension of effector cells was then prepared and cultured in vitro with HBs peptide (28-39)-pulsed syngeneic stimulator cells.
  • the cell suspension was assayed 7 days later for CTL activity against 51 Cr-labeled P815 cells.
  • the syngeneic stimulator cells were prepared as a single cell suspension from the spleens of unimmunized BALB/c mice as follows. After lysis of red blood cells with ammonium chloride buffer (Gibco BRL ACK buffer), the cells were washed by centrifugation for 10 minutes at 1200 rpm (Jouan centrifuge model CR422), resuspended in DMEM culture medium (Gibco BRL #11965-092), and then irradiated using a 60 Co source to deliver 2,000 - 4,000 rads.
  • ammonium chloride buffer Gibco BRL ACK buffer
  • the cells were then pulsed with a 10 ⁇ M final concentration of the H-2 K d peptide HBs (28-39) (Chiron Mimetopes, Clayton, Victoria, Australia) which has the sequence Ile-Pro-Gln-Ser- Leu-Asp-Ser-Trp-Trp-Try-Ser-Leu [SEQ ID NO: 14] (Schirmbeck et al, 1994, J. Virol. 68: 1418-1425).
  • the cells were mixed approximately every 20 minutes for 1.5 - 2.5 hours and then washed 3 times with RPMI-1640 medium.
  • Effector cells were prepared as single cell suspensions from spleens of immunized mice as described and then co-cultured with an approximately equal number of peptide-pulsed stimulator cells for 7 days at 37° C (5% CO 2 ) in "K" medium.
  • P815 (H-2 d ) mouse mastocytoma cells (ATCC, Rockville, MD) were radiolabeled by overnight culture with 0.5 - 1.2 mCi 51 Cr (Amersham, cat. # CJS.4) added to 75 cm 2 culture flasks (Costar #3376) containing ⁇ 5 x 10 5 cells per mL in a volume of 10 mL. The labeled cells were centrifuged at 1200 rpm for 5 minutes and the supernatant removed by aspiration.
  • the cells were washed, counted, resuspended in DMEM culture medium at ⁇ 10 6 cells per mL and then pulsed with 10 ⁇ M HBs (28- 39) peptide at 37° C for 2-3 hr with frequent mixing.
  • the target cells were then washed and adjusted to 10 5 cells per mL for plating. Meanwhile, effector cells from the 7 day restimulation cultures were harvested, washed, and added to triplicate wells of V bottom microtiter plates (Costar #3898) at 60 x 10 5 , 30 x 10 5 , 15 x 10 5 , and 7.5 x 10 5 cells per mL.
  • the 51 Cr-labeled target cells were plated at 10 4 cells per well in 100 ⁇ l "K" medium to achieve effecto ⁇ target ratios of 60:1, 30:1, 15:1, and 7.5:1.
  • Triplicate wells containing only target cells cultured in 0.2 mL of medium served as controls for spontaneous 51 Cr release whereas triplicate wells containing target cells cultured in 0.2 mL of medium containing 1.0 % Triton X-100 detergent (Sigma #T6878) served as controls for maximum 51 Cr release.
  • the plates were incubated for 4 hours at 37°C in a 5% CO 2 incubator and then centrifuged at 1200 rpm for 5 minutes to pellet the remaining target cells.
  • the supernatants (20 ⁇ l) were then harvested using an Impact multichannel pipetor (Matrix Technology, Lowell MA, model #6622) and then transferred to Betaplate filter mats (Wallac #1205-402). The mats were dried and then transferred to plastic bags which were sealed after the addition of ⁇ 11 mL of scintillation fluid.
  • a Betaplate model 1205 scintillation counter (Wallac) was used to quantify the radioactive 51 Cr contained in each spot on the mat corresponding to each well of the original 96-well plate. The % specific lysis was determined as set forth in Example Section 7.
  • Adjuvant effect of aluminum phosphate for VIR.S - A study comparing anti-HBs antibody production in mice inoculated with (1) a commercial hepatitis B vaccine (Recombivax HB®); (2) purified hepatitis B surface antigen without an adjuvant, and (3) VIR.S with aluminum phosphate and (4) VIR.S without aluminum phosphate was performed. Animals were utilized as described in Example Section 6. Female BALB/c mice were inoculated with the plasmid DNA construct VIR.S at a 100 ⁇ g dose either in the presence of 450 ⁇ g /ml aluminum phosphate or in the absence of the adjuvant.
  • Recombivax HB® As controls, one microgram of Recombivax HB® and 1 ⁇ g of HBsAg were injected into mice and bleeds were taken 21, 42 and 63 days after inoculation. Anti-HBs antibody production is shown in Figure 7.
  • the antibody response to a HBV DNA vaccine (which encodes the surface antigen from hepatitis B virus) was enhanced approximately 100-fold by formulation with aluminum phosphate.
  • the adjuvanted DNA vaccine generates a response equivalent to that induced with Recombivax HB®.
  • HB DNA Doseage Rates in the Presence ofAlP04 - VIR.S DNA was formulated at three dose levels (1.0, 10, and 100 ⁇ g) with a constant (450 ⁇ g/ml) concentration of aluminum adjuvants (aluminum phosphate and aluminum hydroxyphosphate) and then tested for the ability to induce anti-HBs antibodies in mice.
  • Figure 8 shows that 6 weeks after a single injection of vaccine, the response to a 10 ⁇ g dose of HBV DNA vaccine formulated with aluminum phosphate was superior to that induced with 100 ⁇ g of the naked DNA vaccine.
  • Figure 9 shows that injection of mice at day 0 and day 42 with DNA formulated at three dose levels (1.0, 10, and 100 ⁇ g) with a constant (450 ⁇ g/mL) concentration of aluminum adjuvants.
  • Anti-HBs antibodies in BALB/c mice were tested three weeks later at day 63 of the experiment.
  • boosting with a second dose of DNA vaccine formulated with aluminum phosphate generated a > 10-fold rise in anti-HBs titers.
  • the response to a 10 ⁇ g dose of HBV DNA vaccine formulated with aluminum phosphate was superior to that induced with 100 ⁇ g of the naked DNA vaccine.
  • Formulation of DNA in saline with aluminum hydroxide or aluminum hydroxyphosphate adjuvants was advantageous only at the 100 ⁇ g dose of DNA under conditions in which the aluminum adjuvants are saturated and free DNA is present. At lower doses of DNA where it is known that the DNA binds completely to aluminum hydroxide or aluminum hydroxyphosphate, the response is lower than that obtained with equivalent doses of naked DNA.
  • HBV DNA/AIP04 Induction of CTL Response After two injections of the HBV DNA vaccine plus aluminum phosphate adjuvant, spleen cells from BALB/c mice were restimulated in vitro with HBs peptide (28-39) and then assayed 7 days later for CTL activity against 51 Cr-labeled P815 cells.
  • Figure 10 shows that the formulation of the HBV DNA vaccine with or without aluminum phosphate generated equivalent CTL responses. There was no lysis of control P815 cells not pulsed with the HBs peptide indicating that lysis of the HBs peptide-pulsed cells was the result of activation of specific CTLs rather than natural killer (NK) cells that would be expected to lyse target cells indiscriminately. Therefore, a major advantages of naked DNA vaccination (i.e., induction of CTL responses) is preserved when the DNA is formulated with aluminum phosphate.
  • naked DNA vaccination i.e., induction of CTL responses
  • formulation of the DNA vaccine with aluminum phosphate enables the generation of an anti-HBs antibody response in both high responder (BALB/c) and low responder (C3H) mice given the 100 ⁇ g dose of DNA that is equivalent to the response to a 1 ⁇ g dose of a conventional HBs protein vaccine.
  • BALB/c high responder
  • C3H low responder
  • the response to the DNA vaccine was only 6.3 mlU/mL which is just above the detectable limit of ⁇ 1.0 mlU per mL.
  • the aluminum phosphate adjuvant combines the desired attributes of protein-based vaccines (i.e. the induction of high antibody titers) with the ability of DNA vaccines to induce cell-mediated antibody responses (see Example Section 7).
  • VlJns/tP A/opt gag was constructed from the vector VlJns, described in WO 97/3115 and herein incorporated by reference.
  • the optimized gag sequence within VlJns was constructed as follows: In order to provide an heterologous leader peptide sequence to secreted and/or membrane proteins, VI Jn was modified to include the human tissue-specific plasminogen activator (tPA) leader. Two synthetic complementary oligomers were annealed and then ligated into VI Jn which had been Bglll digested. These oligomers have overhanging bases compatible for ligation to Bglll-cleaved sequences.
  • tPA tissue-specific plasminogen activator
  • DNA plasmid VI Jns/tPA/gpl40 optA was constructed as described above for optimization and specifically as described in PCT International Application
  • mice Female Balb/C mice (10/group) were inoculated with VUns/tPA/gpl40optA and VUns/tPAopt gag at doses of 10 ⁇ g (5 ⁇ g of each construct) or 100 ⁇ g (50 ⁇ g of each construct).
  • Aluminum phosphate A1PO4 from a 2% solution
  • CaPO4 27.5mg/100ml stock
  • Controls included inoculations formulations with adjuvant and/or no DNA or DNA with no adjuvant.
  • Figure 11 shows the effects of various adjuvants with a HIV eng/gag DNA vaccine formulation on gpl20 and gag antibody responses in inoculated mice. Antibody production was measured by ELISA. As shown in Example 7 with HBV DNA vaccines, CTL responses with and without A1PO4 were approximately equal. Therefore, use of an adjuvanted HIV env/gag formulation did not decrease the ability of the vaccine to promote a specific CTL response.
  • DNA vaccine 100 ⁇ g per dose VUns.S2.S
  • Protein vaccine (1 ⁇ g): Recombivax HB® EXAMPLE 12 EFFECT OF ALUMINUM PHOSPHATE ON POTENCY OF A HERPES SIMPLEX DNA VACCINE IN GUINEA PIGS Plasmids VlJns:gD and VlJns: ⁇ gB encoding HSV-2 glycoprotein D (gD) and the amino-terminal 707 amino acids of glucoprotein B (gB), respectively have been described in McClements et al. (1996, Proc Natl Acad Sci USA 93: 11414-11420) .
  • the vaccines were prepared by diluting VUns:gD DNA and VlJns: ⁇ gB DNA into either sterile PBS, or sterile PBS containing AdjuPhos® at a final aluminum concentration of 450 ⁇ g/mL. Vaccines were thoroughly mixed by gentle vortexing then stored at 4°C for 24 hours. Immediately prior to injection, the vaccine formulations were subjected to gentle vortexing.
  • mice Female Duncan Hartley guinea pigs (Harlan Sprague Dawley; Indianapolis, IN) weighing between 450-550 grams at the time of the first immunization were injected with a total of 200 ⁇ L (100 ⁇ L per quadriceps muscle) containing 6 ⁇ g VI Jns:gD + 20 ⁇ g VI Jns: ⁇ gB, with or without 90 ⁇ g aluminum. Animals were boosted at five weeks.
  • Sera obtained at weeks 4 and 8 were assayed at ten-fold dilutions, ranging from 1 :30 to 1 :30,000, using gD- and gB-specific ELIS As (McClements et al, 1996, Proc Natl Acad Sci US A 93: 11414-11420). Endpoint titers were determined as described previously except that serum dilutions were considered positive if the OD 50 signal was > 0.05 above that of the preimmune sera at the same dilution (McClements et al, 1996, Proc Natl Acad Sci USA 93: 11414-11420). These results are presented in Table 12.
  • Rhesus monkeys - Groups of 5 young adult Rhesus of either sex were injected intramuscularly in both triceps muscles with 0.5 mL of a solution containing 500 mcg/mL of VI Jns-H A/Georgia plasmid encoding the HA from influenza A/Georgia/03/93 (H3N2), dissolved in phosphate-buffered saline or in phosphate- buffered saline with 500 mcg/mL or 1000 mcg/mL of aluminum phosphate adjuvant.
  • a separate control group received HA DNA and aluminum in contralateral arms.
  • Table 13 shows that greater antibody responses were seen in the two animals given HA DNA with aluminum adjuvant, with 1/2 in the alum group having at least fourfold rises in HI antibody and 2/2 having fourfold rises in virus neutralization, while 0/2 animals given HA DNA alone exhibited these responses.
  • Table 13 Antibod Res onses of Chim anzees to HA DNA Vaccine ⁇ Alum aduvant
  • EXAMPLE 14 EFFECT OF ALUMINUM PHOSPHATE ON POTENCY OF AN INFLUENZA DNA VACCINE IN HUMANS
  • INFLUENZA DNA VACCINE IN HUMANS The VI Jns-H A/Georgia plasmid (IDV) encoding the HA from influenza A Georgia/03/93 (H3N2) or placebo was administered with and without aluminum phosphate (AIPO4) at varying dosages to investigate whether AIPO4 would enhance immunogenicity. Seventy eight healthy subjects aged 18-45 were enrolled at a single site (Johns Hopkins University). Subjects with a hemagglutination inhibition (HI) titer >l/32 were excluded. Subjects received vaccine at day 0 and at 2 months and 6 months. This DNA vaccine, admininstered alone or in combination with AIPO4 was generally well tolerated in healthy adults.
  • HI hemagglutination inhibition
  • the VI Jns-H A/Georgia plasmid dose ranged from 0 ⁇ g to 500 ⁇ g while the aluminum phosphate dose ranged from 0 ⁇ g to 700 ⁇ g in this particular study.
  • Such alternative combinations should only be limited to physical parameters such as solubility, as well as the therapeutic and prophylactic affect to the patient.
  • Table 14 shows the proportion of subjects which exhibited at least a four fold rise in antibody production 3 weeks after immunization. It is evident that the addition of 700 ⁇ g of AIPO4 with the DNA vaccine enhanced the ability of the DNA vaccine to elicit HI and neutralizing antibody responses.
  • DNA vaccine formulations comprising nucleic acid molecules (such as a flu DNA vaccine) used in conjunction with an adjuvant which does not substantially bind the nucleic acid molecules (such as aluminum phosphate) results in a marked increase in an immune response of the host.
  • nucleic acid molecules such as a flu DNA vaccine
  • mice were generally 6 - 8 weeks of age at the start of experiments.
  • Adjuvant concentration was calculated on the basis of calcium or aluminum content.
  • Vaccine formulations were prepared by mixing plasmid DNA (in saline) with various concentrations of calcium or aluminum phosphate in 0.85% NaCl within 1 hr of injection.
  • the HBs DNA constructs utilized in this Example are described in Example 7.
  • the hepatitis B surface antigen (HBsAg) used herein is derived from Saccharomyces cerevisiae containing the gene for the adw subtype of HbsAg.
  • the HBsAg was formulated with aluminum hydroxide adjuvant at 10 - 20 ⁇ g HBsAg per 450 ⁇ g aluminum per mL.
  • ELISPOT assay for cytokine production Spleen cells from immunized mice were assayed for the ability to secrete IFN- ⁇ or IL-2 during in vitro restimulation with antigenic peptides by a modification of previous methods [25-27] . Briefly, 96- well polyvinylidine difluoride (PVDF)-backed plates (MAIP NOB 10; Millipore, Bedford, MA) were coated with antibody to (IFN- ⁇ ) (clone R4-6A2 Pharmingen #18181D) or IL-2 (clone JES6-1A12 Pharmingen #18161D), washed three times with PBS, and then blocked with RPMI-1640 medium containing 10% heat-inactivated FBS.
  • PVDF polyvinylidine difluoride
  • the plates were washed 6 more times before the addition of Streptavidin-HRP conjugate (Southern Biotech Assoc, Birmingham, AL; #7100-05). After 3 washes with PBS-Tween and 3 washes with PBS, spots were developed with 3-amino-9-ethylcarbazole (Sigma #A6926). Spots were counted using a stereomicroscope.
  • the ELISPOT assay was used to determine the number of T cells secreting interferon- ⁇ (IFN- ⁇ ) or IL-2 upon in vitro restimulation with antigenic peptides.
  • IFN- ⁇ interferon- ⁇
  • BALB/c mice were immunized with 10 ⁇ g of VIR.S DNA ⁇ aluminum phosphate on day 0 and 21. Eight days later, spleen cells were harvested for the ELISPOT assay.
  • the IFN- ⁇ response was elicited by overnight culture with HBs peptide [28-39] which, in addition to induction of CTLs, stimulates CD8 T cells to produce IFN- ⁇ .
  • mice immunized with HBV DNA + aluminum phosphate generated ⁇ 5-fold more IFN- ⁇ ELISPOTs than did mice immunized with the DNA vaccine alone. Furthermore, the affinity of T cells appeared to be increased since detectable responses could be elicited with 5-10 fold lower concentrations of peptide in mice immunized with HBV DNA + aluminum phosphate compared to mice immunized with naked DNA. Similarly, immunization with HBV + aluminum phosphate elicited a stronger IL-2 ELISPOT response than did injection of HBV DNA alone ( Figure 13B).
  • the IL-2 response was elicited with a 15mer HBs peptide [146-160] that had been identified by screening a set of 15mer peptides (offset by 1 amino acid) comprising the entire HBs protein.
  • the response to this peptide is mediated by CD4 T cells (data not shown).
  • immunization with HBV DNA + aluminum phosphate appears to elicit T cells with a higher affinity for the 15mer peptide than did immunization with HBV DNA alone.
  • the adjuvant also improved the quality of the
  • ELISPOTs both the size and intensity of spots was increased for IFN- ⁇ and IL-2 T cell responses to the HBV DNA vaccine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Communicable Diseases (AREA)
  • Hematology (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne une nouvelle formulation de vaccin comprenant des molécules d'acide nucléique et un adjuvant à base minérale à une concentration à efficacité biologique améliorant l'induction de la réaction immunitaire suite à une vaccination, en corrélation avec l'expression d'un ou plusieurs antigènes spécifiques codés par la molécule d'acide nucléique.
EP99933739A 1998-07-09 1999-07-08 Formulations de vaccins a base de polynucleotides Withdrawn EP1094844A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US11265598A 1998-07-09 1998-07-09
US112655 1998-07-09
PCT/US1999/015329 WO2000002591A1 (fr) 1998-07-09 1999-07-08 Formulations de vaccins a base de polynucleotides

Publications (2)

Publication Number Publication Date
EP1094844A1 true EP1094844A1 (fr) 2001-05-02
EP1094844A4 EP1094844A4 (fr) 2005-01-12

Family

ID=22345149

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99933739A Withdrawn EP1094844A4 (fr) 1998-07-09 1999-07-08 Formulations de vaccins a base de polynucleotides

Country Status (5)

Country Link
EP (1) EP1094844A4 (fr)
JP (1) JP2002520299A (fr)
AU (1) AU4973199A (fr)
CA (1) CA2336992A1 (fr)
WO (1) WO2000002591A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10012370A1 (de) * 2000-03-14 2001-09-27 Chiron Behring Gmbh & Co Adjuvans für Vakzinen
EP1282640A2 (fr) * 2000-05-01 2003-02-12 Powderject Vaccines, Inc. Immunisation au moyen d'acide nucleique
US20050129712A1 (en) * 2002-03-28 2005-06-16 Hansjorg Reimann Combined dna/protein vaccine compositions
AU2003269213B2 (en) 2002-09-27 2008-11-13 Powderject Research Limited Nucleic acid coated particles
US8080642B2 (en) 2003-05-16 2011-12-20 Vical Incorporated Severe acute respiratory syndrome DNA compositions and methods of use
US20100160415A1 (en) * 2005-10-05 2010-06-24 Bayhill Therapeutics, Inc Compositions and methods for treatment of autoimmune disease
JP7401457B2 (ja) * 2018-04-18 2023-12-19 バイオマジソン・インコーポレイテッド ワクチンの効力を決定するための方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998035562A1 (fr) * 1997-02-14 1998-08-20 Merck & Co., Inc. Formules de vaccins a base de polynucleotides

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5550214A (en) * 1994-02-10 1996-08-27 Brigham And Women's Hospital Isolated antigenic oncogene peptide fragments and uses

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998035562A1 (fr) * 1997-02-14 1998-08-20 Merck & Co., Inc. Formules de vaccins a base de polynucleotides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO0002591A1 *

Also Published As

Publication number Publication date
AU4973199A (en) 2000-02-01
CA2336992A1 (fr) 2000-01-20
JP2002520299A (ja) 2002-07-09
EP1094844A4 (fr) 2005-01-12
WO2000002591A1 (fr) 2000-01-20

Similar Documents

Publication Publication Date Title
Donnelly et al. Technical and regulatory hurdles for DNA vaccines
JP4580410B2 (ja) 改善された免疫応答を誘導し得る発現ベクターおよびこのベクターの使用方法
AU722326B2 (en) Polynucleotide vaccine formulations
CZ20022643A3 (cs) Farmaceutický prostředek
US20080102085A1 (en) Vaccine comprising gp120 and nef and/or tat for the immunization against hiv
CA2313005A1 (fr) Procede d'accroissement de la reponse immunitaire a la vaccination par un acide nucleique
JP5264840B2 (ja) ３つの完全な転写単位を有するプラスミドおよびｈｉｖに対する免疫応答を誘発するための免疫原組成物
JP2021509107A (ja) Ｂ型肝炎ウイルス（ｈｂｖ）ワクチンおよびその使用
AU2012211278A1 (en) RSV immunization regimen
Vajdy et al. Mucosal and systemic anti-HIV responses in rhesus macaques following combinations of intranasal and parenteral immunizations
EP1119630B1 (fr) Produits de recombinaison d'acide nucleique pour immunisation genetique
JP2007508319A (ja) 方法
US20020045594A1 (en) Polynucleotide vaccine formulations
WO2000002591A1 (fr) Formulations de vaccins a base de polynucleotides
WO2005056051A2 (fr) Vaccins contre l'hepatite b et leurs compositions
AU764010B2 (en) Polynucleotide vaccine formulations
US20040242522A1 (en) Polynucleotide vaccine formulations
Srivastava et al. DNA vaccines: focus on increasing potency and efficacy
KR101059721B1 (ko) 면역원성 조성물 및 의약
KR20160077194A (ko) Hiv-1 env dna 백신과 단백질 부스터
Liu et al. Use of novel DNA vectors and immunologic adjuvants in HIV vaccine development
Davis Gene-based vaccines
Rossi et al. Optimization of Mucosal Responses after Intramuscular Immunization with Integrase
Convergence IS5 1 Prospects for immunotherapy using dendritic cells.
Ramasamy Recombinant viruses as vectors for vaccines against human diseases–an overview of a rapidly developing field

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010209

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20010209;LT PAYMENT 20010209;LV PAYMENT 20010209;MK PAYMENT 20010209;RO PAYMENT 20010209;SI PAYMENT 20010209

A4 Supplementary search report drawn up and despatched

Effective date: 20041129

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060624