EP1056762A1 - Immunisation genetique avec des proteines non structurales du virus de l'hepatite c - Google Patents

Immunisation genetique avec des proteines non structurales du virus de l'hepatite c

Info

Publication number
EP1056762A1
EP1056762A1 EP99904381A EP99904381A EP1056762A1 EP 1056762 A1 EP1056762 A1 EP 1056762A1 EP 99904381 A EP99904381 A EP 99904381A EP 99904381 A EP99904381 A EP 99904381A EP 1056762 A1 EP1056762 A1 EP 1056762A1
Authority
EP
European Patent Office
Prior art keywords
virus
nucleic acid
hepatitis
pharmaceutical composition
human
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99904381A
Other languages
German (de)
English (en)
Other versions
EP1056762A4 (fr
Inventor
Jack Wands
Jens Encke
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp filed Critical General Hospital Corp
Publication of EP1056762A1 publication Critical patent/EP1056762A1/fr
Publication of EP1056762A4 publication Critical patent/EP1056762A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/29—Hepatitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to recombinant nucleic acid molecules, and pharmaceutical compositions comprising the same, which are useful as, for example, anti- hepatitis C virus vaccine components in genetic immunization protocols, to methods of inducing an immune response against hepatitis C virus infection and to methods of treating individuals suffering from hepatitis C virus infection.
  • HNS Hepatitis C virus
  • HCN infection is an independent risk factor for the development of hepatocellular carcinoma as shown by the prevalence of anti-HCV antibodies (Colombo, et al., Lancet, 1989, ii, 1006-1008; Saito, et al., Proc. Natl. Acad. Sci. - 2 -
  • HCN is an enveloped, positive stranded R ⁇ A virus, approximately 9,500 nucleotides in length, which has recently been classified as a separate genus within the Flavivirus family. Heinz, Arch. Virol. (Suppl), 1992, 4, 163-171. Different isolates show considerable nucleotide sequence diversity leading to the subdivision of HCN genomes into at least eight genotypes. Simmonds, et al, J. Gen. Virol, 1993, 74, 2391-2399. In all genotypes, the viral genome contains a large open reading frame (ORF) that encodes a precursor polyprotein of 3010 to 3033 amino acids of approximately 330 Kd. Choo, et al, Proc. Natl Acad. Sci.
  • ORF open reading frame
  • HCN polypeptides are produced by proteolytic processing of the precursor polypeptide to produce core (C), envelope (El , E2) and non-structural ( ⁇ S2- ⁇ S5) proteins. Bartenschlager, et al, J. Gen. Virol, 1993, 67, 3835-3844; Grakoui, et al, J. Gen. Virol, 1993, 67, 2832-2843; and Selby, et al, J. Gen. Virol, 1993, 74, 1103-1113. This proteolysis is catalyzed by a combination of both cellular and viral encoded proteases.
  • the NS3 gene encodes for a serine protease which cleaves the viral polyprotein precursor post- transcriptionally at several functions and also serves as the viral helicase.
  • the NS5 region encodes for the RNA-dependent RNA-Polymerase of the virus.
  • the HCV genome also contains both a 5' untranslated region (5' UTR) and a 3' untranslated region (3' UTR).
  • the 5' UTR of 324 to 341 nucleotides represents the most highly conserved sequence among all HCN isolates reported to date. Han, etal, Proc. Natl Acad. Sci. USA , 1991 , 88, 1711 - 1715 ; and Bukh, et al. , Proc. Natl Acad. Sci. USA, 1992, 89, 4942-4946.
  • This 5' UTR has been postulated to contain important regulatory elements for replication and/or translation of HCN R ⁇ As.
  • the 5' UTR also contains several small open reading frames (ORF) but there is presently no evidence to suggest that these ORF sequences are actually translated.
  • ORF small open reading frames
  • HCN infection have only partially been defined.
  • Koziel, et al. examined the cytotoxic T lymphocyte (CTL) response of such cells and demonstrated an HLA class I-restricted CD8+ CTL response that was directed against both structural and non-structural regions of HCN polypeptides.
  • CTL cytotoxic T lymphocyte
  • HCV specific CTL activity appears to be associated with control of viral replication in individuals with chronic hepatitis. Rehermami, etal,J. Clin. Invest., 1996, 98, 1432-1440; and ⁇ elson, etal,J. Immunol, 1997, 158, 1473-1481.
  • nonstructural proteins ⁇ S3, NS4 and NS5 are sufficiently immunogenic to generate broad based and vigorous CTL-responses in vivo.
  • the advantage of this method compared to immunizations with soluble recombinant proteins or peptides is the ability to induce a strong inflammatory CD4+ T cell response as well as cytotoxic T cell activity, - 5 - presumably due to the intracellular processing of viral proteins into peptides and subsequent loading on MHC class I molecules in transfected cells and yet to be defined interactions with antigen presenting cells.
  • immunization with soluble protein leads primarily to a humoral immune response due to precessing through the MHC class II pathway.
  • Immunization with synthetic peptides has several disadvantages since only a limited number of epitopes are available for stimulation of the host immune response.
  • Vaccination and immunization generally refer to the introduction of a non- virulent agent against which an individual's immune system can initiate an immune response which will then be available to defend against challenge by a pathogen.
  • the immune system identifies invading "foreign" compositions and agents primarily by identifying proteins and other large molecules which are not normally present in the individual.
  • the foreign protein represents a target against which the immune response is made.
  • PCT Patent Application PCT/US90/01348 discloses sequence information of clones of the HCV genome, amino acid sequences of HCV viral proteins and methods of making and using such compositions including anti-HCV vaccines comprising HCV proteins and peptides derived therefrom.
  • the present invention relates to recombinant nucleic acid molecules comprising a nucleotide sequence that encodes a hepatitis C virus nonstructural protein, such as, for example, NS3, NS4, or NS5, or a combination thereof.
  • the present invention relates to pharmaceutical compositions comprising a recombinant nucleic acid molecule that comprises a nucleotide sequence that encodes a hepatitis C virus nonstructural protein.
  • the nucleotide coding sequence that encodes the hepatitis C virus nonstructural protein is operably linked to regulatory elements functional in human cells.
  • the pharmaceutical composition additionally comprises a pharmaceutically acceptable carrier or diluent, and optionally a facilitator such as, for example, bupivicaine.
  • the present invention relates to methods of immunizing an individual susceptible to hepatitis C virus comprising administering to such an individual, a pharmaceutical composition comprising a recombinant nucleic acid molecule which comprises a nucleotide coding sequence that encodes a hepatitis C virus nonstructural protein.
  • the nucleotide coding sequence that encodes the hepatitis C virus nonstructural protein is operably linked to regulatory elements functional in human cells.
  • the pharmaceutical composition additionally comprises a pharmaceutically acceptable carrier or diluent.
  • the individual is administered an amount effective to induce a protective immune response against hepatitis C virus infection.
  • the present invention relates to methods of treating an individual having hepatitis C virus comprising administering to such an individual, a pharmaceutical composition comprising a recombinant nucleic acid molecule which comprises a nucleotide coding sequence that encodes a hepatitis C virus nonstructural protein.
  • the nucleotide coding sequence that encodes the hepatitis C virus nonstructural protein is operably linked to regulatory elements functional in human cells.
  • the pharmaceutical composition additionally comprises a pharmaceutically acceptable carrier or diluent.
  • the individual is administered an amount effective to induce a therapeutic immune response against hepatitis C virus infection.
  • Figure 1A shows a schematic illustrating a single large ORF of HCV encodes for a polyprotein precursor of about 3011 -3030 aa which is cleaved by host signal and virus - 7 - proteases into the different structural and nonstructural proteins, as shown by the arrows.
  • Figure IB shows an exemplary autoradiography of the expression of nonstructural proteins following transient transfection of HuH-7 and stable transfection of SP2/0 cells. Lanes 1, 3 and 5 are mock DNA transfected cells and serve as a negative controls (Mock); lanes 2, 4 and 6 show specific bands of about 70 for NS3, about 30 for NS4 and 125 kD for NS5.
  • Lane 7-10 shows SP2/0 cells transfected with nucleic acid constructs containing the genes for NS3, NS4 and NS5, respectively.
  • Lanes 7 and 9 represent cell lysates derived from cells stably expressing HCV-core protein as negative control (SP2-10), whereas lanes 8 and 10 represent specific expression of NS3 and NS5.
  • Figure 2 A is a bar graph showing a representative humoral immune response to
  • FIG. 2B is a bar graph showing a representative T-cell proliferation measured 3 days after in vitro stimulation with specific or nonspecific recombinant proteins.
  • Figures 2C, 2D, and 2E are bar graphs showing representative cytokine secretion, IFN- ⁇ , IL-2, and IL-4, respectively, into the supernatant measured after 48 hours of in vitro stimulation.
  • Figures 3A and 3B are bar graphs showing a representative cytotoxic T-cell (CTL) response to NS3 and NS5, respectively, at different effector to target cell ratios (100: 1 , 30:1, 10:1, 3:1).
  • Figure 3C is a bar graph showing a representative chromium release assay against the stable transfected target cell lines.
  • CTL cytotoxic T-cell
  • Figure 4A is a table showing representative results of a tumor model to assess CTL activity.
  • Figure 4B is a photograph showing, from left to right, animals immunized with 1) mock DNA and challenged with SP2/NS5-21 cells; 2) pApNS5 and challenged with SP2/NS5-21 cells; 3) ⁇ ApNS5 and challenged with SP2-19, (stable expressing HCV core); and 4) animal immunized three times i.p. with recombinant NS5 protein and challenged with SP2/NS5-21 cells.
  • compositions and methods which prophylactically and/or therapeutically immunize or treat an individual against HCV infection.
  • Recombinant nucleic acid molecules comprising a nucleotide coding sequence that - 8 - encodes a HCV nonstructural protein, such as, for example, NS3, NS4, or NS5, or a combination thereof, are administered to the individual.
  • the protein encoded by the recombinant nucleic acid gene construct is expressed by the individual's cells and serves as an immunogenic target against which an anti-HCV immune responses are elicited.
  • the resulting immune responses are broad based; in addition to a humoral immune response, both arms of the cellular immune response are elicited.
  • the methods of the present invention are useful for conferring prophylactic and therapeutic immunity.
  • the methods of the present invention can also be practiced on mammals, other than humans, for biomedical research.
  • the methods of the present invention can be employed to both immunize an individual from HCV challenge as well as treat an individual suffering from HCV infection.
  • HCV nonstructural protein is meant to refer to HCV nonstructural proteins NS3, NS4, and NS5, and equivalents thereof. Equivalent proteins include peptide fragments of NS3, NS4, and NS5 which retain bioactivity as described herein.
  • HCV nonstructural protein is meant to refer to corresponding HCV nonstructural proteins from additional HCV isolates which may vary in sequence. Those having ordinary skill in the art can readily identify the HCV nonstructural proteins from additional HCV isolates. It is to be understood that nucleotide substitutions in the codon may be acceptable when the same amino acid is encoded.
  • HCV nonstructural protein also includes fusion proteins comprising the nonstructural protein, as well as therapeutically or prophylactically active fragments thereof.
  • the phrase "gene construct” is meant to refer to a recombinant nucleic acid molecule comprising a nucleotide coding sequence that encodes a HCV nonstructural protein, as well as initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the vaccinated individual.
  • the gene construct further comprises an enhancer, Kozak sequence (GCCGCCATG; SEQ ID NO: 1), and at least a fragment of the HCV 5' UTR. - 9 -
  • the phrase “genetic vaccine” refers to a pharmaceutical preparation that comprises a gene construct. Genetic vaccines include pharmaceutical preparations useful to invoke a prophylactic and/or therapeutic immune response to HCV.
  • nucleic acid refers to DNA, RNA, or chimeras formed therefrom.
  • gene constract(s) are introduced into the cells of an individual where it is expressed, thus producing at least one HCV nonstructural protein.
  • the regulatory elements of the gene constructs of the invention are capable of directing expression in mammalian cells, preferably human cells.
  • the regulatory elements include a promoter and a polyadenylation signal.
  • other elements such as an enhancer and a Kozak sequence, may also be included in the gene construct.
  • the gene constructs of the invention may remain present in the cell as a functioning extrachromosomal molecule or it may integrate into the cell's chromosomal DNA.
  • Nucleic acid such as DNA
  • linear nucleic acid can integrate into the chromosome may be introduced into the cell.
  • reagents which promote nucleic acid integration into chromosomes may be added.
  • DNA sequences which are useful to promote integration may also be included in the DNA molecule.
  • RNA may be administered to the cell. It is also contemplated to provide the gene construct as a linear minichromosome including a centromere, telomeres and an origin of replication.
  • the gene construct comprises recombinant nucleic acid molecules comprising a nucleotide coding sequence that encodes a HCV nonstructural protein.
  • the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes NS3.
  • the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes a HCV nonstructural protein that comprises NS4.
  • the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes a HCV nonstructural protein that comprises NS5.
  • the recombinant nucleic acid molecule comprises anucleotide coding sequence that encodes a any combination of HCV nonstructural proteins including NS3, NS4, and NS5 - 10 -
  • the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes a HCV nonstructural protein that comprises a fragment of HCV NS3, NS4, or NS5 protein, or a combination thereof.
  • the fragments include, but are not limited to, fragments containing 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 amino acids of the corresponding nonstructural protein.
  • the fragment can comprise a portion of the carboxy terminus of the protein, amino terminus, or any portion therebetween.
  • the recombinant nucleic acid molecule comprising a nucleotide coding sequence that encodes a HCV nonstructural protein may comprise less than the entire HCV nonstructural gene product without substantially altering the effectiveness of the vaccine. It is also contemplated that at least one nucleotide, as well as multiple, substitution may be made in the nucleotide coding sequence without affecting the amino acid sequence of the protein. It is also contemplated that at least one conservative amino acid substitution, as well as multiple substitutions, may be made throughout the protein without substantially reducing the immunogenic activity of the HCV nonstructural protein.
  • the recombinant nucleic acid molecule comprises a fragment of the 5' UTR that includes the last 9 nucleotides of the HCV 5' UTR, the last 25 nucleotides of the HCV 5' UTR, the last 50 nucleotides of the HCV 5' UTR, the last 75 nucleotides of the HCV 5' UTR, the last 100 nucleotides of the HCV 5' UTR, the last 150 nucleotides of the HCV 5' UTR, the last 200 nucleotides of the HCV 5' UTR, the last 250 nucleotides of the HCV 5' UTR, or the last 300 nucleotides of the HCV 5' UTR.
  • the gene construct includes the entire HCV 5' UTR. In some preferred embodiments, the gene construct includes the 9 most 3' nucleotides of the HCV 5' UTR.
  • the entire HCV 5' UTR of a preferred embodiment is GCCAGCCCCC GATTGGGGGCGACACTCCACCATAGATCACTCCCCTGTGAGGAACTACTGTCT TCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAG CCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGT GAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTA - 11 -
  • the regulatory elements necessary for gene expression of a DNA molecule include: a promoter, an initiation codon, a stop codon, and a polyadenylation signal.
  • enhancers are often required for gene expression. It is necessary that these elements be operably linked to the sequence that encodes the HCV nonstructural protein and that the regulatory elements are operable in the individual to whom they are administered.
  • Initiation codons and stop codon are generally considered to be part of a nucleotide sequence that encodes the HCV nonstructural protein.
  • Promoters and polyadenylation signals used must be functional within the cells of the individual.
  • regulatory sequences may be selected which are well suited for gene expression in the cells the construct is administered into.
  • codons may be selected which are most efficiently transcribed in the cell.
  • One having ordinary skill in the art can produce DNA constructs which are functional in the mammalian, preferably human, cells.
  • promoters useful to practice the present invention include but are not limited to promoters from Simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus (HIV) such as the HIV Long Terminal Repeat (LTR) promoter, Moloney virus, ALV, Cytomegalovirus (CMV) such as the CMV immediate early promoter, Epstein Barr Virus (EBV), Rous Sarcoma Virus (RSV) as well as promoters from human genes such as human Actin, human Myosin, human Hemoglobin, human muscle creatine and human metalothionein.
  • SV40 Simian Virus 40
  • MMTV Mouse Mammary Tumor Virus
  • HIV Human Immunodeficiency Virus
  • LTR HIV Long Terminal Repeat
  • ALV a virus
  • CMV Cytomegalovirus
  • EBV Epstein Barr Virus
  • RSV Rous Sarcoma Virus
  • polyadenylation signals useful to practice the present invention include but are not limited to SV40 polyadenylation signals and LTR polyadenylation signals.
  • the SV40 polyadenylation signal which is in pCEP4 plasmid (Invitrogen, San Diego CA), referred to as the SV40 polyadenylation signal, is used.
  • enhancers may be selected from the group including but not limited to: human - 12 -
  • human Myosin human Hemoglobin
  • human muscle creatine and viral enhancers such as those from CMV, RSV and EBV.
  • Plasmids pCEP4 and pREP4 from Invitrogen contain the Epstein
  • Routes of administration include, but are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterially, intraoccularly and oral as well as transdermally or by inhalation or suppository.
  • Preferred routes of administration include intramuscular, intraperitoneal, intradermal and subcutaneous injection.
  • Delivery of gene constructs which encode HCV nonstructural protein can confer mucosal immunity in individuals immunized by a mode of administration in which the material is presented in tissues associated with mucosal immunity.
  • the gene construct is delivered by administration in the buccal cavity within the mouth of an individual.
  • Gene constructs may be administered by means including, but not limited to, traditional syringes, needleless injection devices, or "microprojectile bombardment gene guns".
  • the genetic vaccine may be introduced by various means into cells that are removed from the individual. Such means include, for example, ex vivo transfection, electroporation, microinjection and microprojectile bombardment. After the gene construct is taken up by the cells, they are reimplanted into the individual. It is contemplated that otherwise non-immunogenic cells that have gene constructs incorporated therein can be implanted into the individual even if the vaccinated cells were originally taken from another individual. According to some embodiments of the present invention, the gene construct is administered to an individual using a needleless injection device.
  • the gene construct is simultaneously administered to an individual intradermally, subcutaneously and intramuscularly using a needleless injection device.
  • Needleless injection devices are well known and widely available.
  • One having ordinary skill in the art can, following the teachings herein, use needleless injection devices to deliver genetic material to cells of an individual. Needleless injection devices are well - 13 - suited to deliver genetic material to all tissue. They are particularly useful to deliver genetic material to skin and muscle cells.
  • a needleless injection device may be used to propel a liquid that contains DNA molecules toward the surface of the individual's skin. The liquid is propelled at a sufficient velocity such that upon impact with the skin the liquid penetrates the surface of the skin, permeates the skin and muscle tissue therebeneath.
  • the genetic material is simultaneously administered intradermally, subcutaneously and intramuscularly.
  • a needleless injection device may be used to deliver genetic material to tissue of other organs in order to introduce a nucleic acid molecule to cells of that organ.
  • the genetic vaccines according to the present invention comprise about 1 nanogram to about 1000 micrograms of nucleic acid, preferably DNA.
  • the vaccines contain about 10 nanograms to about 800 micrograms of nucleic acid.
  • the vaccines contain about 0.1 to about 500 micrograms of nucleic acid.
  • the vaccines contain about 1 to about 350 micrograms of nucleic acid.
  • the vaccines contain about 25 to about 250 micrograms of nucleic acid. In some preferred embodiments, the vaccines contain about 100 micrograms nucleic acid.
  • One skilled in the art can readily formulate a vaccine comprising any desired amount of nucleic acid.
  • compositions of the present invention are formulated according to the mode of administration to be used.
  • One having ordinary skill in the art can readily formulate a pharmaceutical composition that comprises a gene construct.
  • Pharmaceutical compositions of the present invention include single genetic constructs encoding either NS3, NS4, or NS5 , or any combination thereof.
  • pharmaceutical compositions of the present invention include multiple genetic constructs encoding either NS3, NS4, or NS5, or any combination thereof.
  • pharmaceutical compositions of the present invention include single or multiple genetic constructs encoding a fragment of NS3, NS4, or NS5, or any combination thereof.
  • pharmaceutical compositions of the present invention include a single genetic construct encoding fusion proteins of all or any fragment of NS3, NS4, or NS5 proteins.
  • an isotonic formulation is used.
  • additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose.
  • isotonic solutions such as phosphate buffered saline are preferred.
  • Stabilizers include - 14 - gelatin and albumin.
  • a vasoconstriction agent is added to the formulation.
  • the pharmaceutical preparations according to the present invention are provided sterile and pyrogen free.
  • the gene constructs of the invention may be formulated with or administered in conjunction with agents that increase uptake and/or expression of the gene construct, referred to herein as "facilitators," by the cells relative to uptake and/or expression of the gene construct by the cells that occurs when the identical genetic vaccine is administered in the absence of such agents.
  • agents that increase uptake and/or expression of the gene construct referred to herein as "facilitators”
  • agents that increase uptake and/or expression of the gene construct referred to herein as "facilitators”
  • agents include: CaPO 4 , DEAE dextran, anionic lipids; extracellular matrix-active enzymes; saponins; lectins; estrogenic compounds and steroidal hormones; hydroxylated lower alkyls; dimethyl sulfoxide (DMSO); urea; and benzoic acid esters anilides, amidines, urethanes and the hydrochloride salts thereof such as those of the family of local anesthetics.
  • the gene constructs are encapsulated within/administered in conjunction with lipids/polycationic complexes.
  • a preferred facilitator is bupivicaine.
  • compositions can be conveniently administered in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical art, for example, as described in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, PA, 1980), the disclosure of which is incorporated herein by reference in its entirety.
  • DNA-based vaccination with plasmids encoding for three different nonstructural proteins of HCV is shown to elicit strong antigen- specific immune responses in both arms of the immune system. After three immunizations, all animals developed detectable antibody responses.
  • nonstructural proteins are far better antigens to stimulate humoral immune responses compared to previous studies using the structural HCV core structural protein. Tokushige, et al. , Hepatology, 1996, 24, 14-20; and Geissler, etal, J. Immunol, 1997, 755, 1231-1237.
  • the humoral immune response to the nonstructural proteins may be enhanced by addition of compounds which activate antigen presenting cells, such as, for example, cytokine expressing plasmids, suchasIL-2 andGM-CSF.
  • cytokine expressing plasmids such asIL-2 andGM-CSF.
  • Generation of inflammatory CD4+ T-cell responses with - 15 - a predominant T H 1 phenotype were demonstrated for all three plasmids encoding for NS3, NS4 and NS5.
  • tumor weight in those animal who developed tumors was significantly reduced compared to notice immunized with mock DNA or recombinant NS5 protein.
  • This model also demonstrates the capability of assessing high level cellular it immune responses against fiaviviral nonstructural proteins in an animal model as measured inhibition of tumor growth.
  • the genes encoding for the individual nonstructural proteins were cloned with engineered start and stop codons into an expression plasmid driven by a CMV -promoter and RS V enhancer (pApO31).
  • the expression vector (pcDNA3) containing a selection marker was also used to generate stable SP2/0 transfected cell lines (see Fig. 1 A).
  • plasmid designated pBRTM/HCVl covering the full-length ORF of HCV was used to clone into the expression vectors of the present invention.
  • pBRTM/HCVl covering the full-length ORF of HCV was used to clone into the expression vectors of the present invention.
  • HCV can be obtained from GenBank Accession Numbers X61596 and D 16435, the disclosures of which are incorporated herein by reference in their entirety.
  • Constructs pApO31-NS3, pApO31-NS4 and pApO31-NS5 were PCR-cloned after inserting engineered start- and stop-codons as well as restriction enzyme sites using the following primers: for NS3: 5'-GGTCTAGATTGATGGCGCCCATCACGGC-3' (Xba I) (SEQ ID NO:3), 5'- CACACGCGTTCACGTGACGACCTCCAGGT-3' (Mlu I) (SEQ ID NO:4), For NS4: 5' GGTCTAGATGAGCACCTGGGTGCTC-3' (Xba I) (SEQ ID NO:5), 5'- CCAGGATCCTCAGCATGGAGTGGTACA-3' (BamH I) (SEQ ID NO:6), and for NS5: 5'-
  • the nonstructural protein encoding gene fragments were cloned into the pcDNA3 and pcDNA3.1 Zeo(-) expression vectors (Invitrogen, San Diego) with a neomycin selectable marker.
  • a Xba I and Mlu I fragment of NS3 and NS5 was subcloned into the Nhe I/Mlu I site of Litmus -38 vector (New England Biolabs, MA), then cut with EcoR I and Sal I and religated into the EcoR I/Xho I multiple cloning site of pcDNA3 and pcDNA 3.1/Zeo (-), respectively.
  • a Xba I and BamH I fragment containing NS4 was relegated into Litmus -20 (New England Biolabs), recut with Kpn I and EcoR I and subsequently ligated into the pcDNA3 vector. Plasmids were designated pcDNA3-NS3, pcDNA3-NS4 and pcDNA3.1/Zeo(l)-NS5.
  • One skilled in the art having the DNA sequences encoding any of the HCV nonstructural proteins can design primers for preparing any of the gene constructs of the present invention.
  • nucleotide base substitutions may be made without affecting the binding of the primers.
  • the primers may be prepared with endonuclease - 17 - restriction sites for cloning and ligating purposes, as known to those skilled in the art.
  • one skilled in the art can prepare any of the gene constructs of the present invention by designing the appropriate primers and performing PCR amplification. The PCR products are ligated into an expression vector.
  • Plasmids comprising the nucleotide coding sequence for the HCV nonstructural proteins described above each contain the nucleotide coding region for the HCV nonstructural protein placed under the transcriptional control of the CMV promoter and the RSV enhancer element.
  • Example 2 In Vitro Expression The plasmid constructs were sequenced across the gene inserts and protein expression was certified in vitro in HuH-7 cells after transient transfection and in SP2/0 target cells after stable transfection, respectively. Protein bans of about 70 forNS3, 30 forNS4 and 125 kD for NS5 were found to be expressed within the cell but not secreted into the culture medium (see Figure IB). HuH-7 human hepatoma cell line was transiently transfected with the various constructs by the calcium phosphate method to assess expression levels of HCV nonstructural proteins.
  • cell lysates were prepared in modified RIPA buffer (0.15 M NaCl, 1 % NP- 40, 50 mM Tris, 0.5% DOC and 1% SDS), after metabolic labeling with 35 S-methionine and cysteine for 4 hours.
  • Cell lysates were precleared with horse serum and then bound to Sepharose A by preincubation overnight with polyclonal antisera WU 110 (NS3), W 148/151 (NS4) and WU 115 (NS5).
  • WU 110 polyclonal antisera
  • NS4 polyclonal antisera
  • WU 115 N-clonal antisera
  • the NS5 protein expression was also determined by Western blot and immunofluorescence analysis using a murine mAb (Biogenesis, Sandown, NH).
  • a murine mAb Biogenesis, Sandown, NH.
  • a syngeneic BALB/c mouse myeloma derived cell line SP2/0 was transfected by electroporation with the pcDNA3 plasmid containing the viral gene inserts of interest.
  • Cells growing under G418 selection were cloned by limited dilution (0.3 cell/well) and screened by the methods described above.
  • Lanes 1, 3 and 5 are mock DNA transfected cells and serve as a negative controls (Mock). Lanes 2, 4 and 6 show specific bands of about 70 for NS3, about 30 for NS4 and 125 kD for NS5. (Lane 7-10): SP2/0 cells were transfected with pcD3 based constructs containing the genes forNS3, NS4 andNS5. After antibiotic selection cells were cloned by limiting dilution (0.3 cells/well), and expanded and analyzed either by radioactive labeling and immunoprecipitation of NS3 or Western blot for NS5 as described above.
  • Lane 7 and 9 represent cell lysates derived from cells stable expressing HCV-core protein as negative control (SP2-19), lane 8 and 10 specific expression of NS3 and NS5. These cells were used for in vitro stimulation and as target cells in the CTL-assays.
  • mice Female B ALB/c (h-2d) mice were kept under standard-pathogen-free conditions in the animal facility of the Massachusetts General Hospital. Mice were obtained from Charles River Laboratories (Wilmington, MA) and used at the age of 6 to 20 weeks for the in vivo studies. A total of 100 ⁇ g of plasmid DNA in 100 ⁇ of 0.9% NaCl were injected two and three times over five different sites into the quadriceps muscle of the mice. Boostered injections were given into the opposite leg every fourteen days. As positive controls for all immunologic experiments, 5 ⁇ g of recombinant NS3, NS4 and NS5 nonstructural protein (Mikrogen, Kunststoff) was injected i.p.
  • HbsAg hepatitis B surface antigen
  • Levels of anti-NS3, NS4 and NS5 antibodies were determined in the serum of each immunized animal by an established ELISA technique.
  • microtiter plates (Falcon, Microtest HIM Flexible Assay Plate) were coated with the above-described recombinant proteins overnight at 4C (0.5 ⁇ g/well). After blocking with fetal bovine serum (FBS) for 2 hours at 20C, a 1 :50 dilution of mouse serum was added to the plates and incubated at 20C for an additional hour.
  • FBS fetal bovine serum
  • mice were vaccinated three times intraperitoneally (i.p.) with recombinant NS3, NS4 andNS5 nonstructural proteins in combination with complete Freund's adjuvant (CFA) and, as expected, demonstrated a strong humoral immune response (data not shown).
  • CFA complete Freund's adjuvant
  • Figure 2B shows T-cell proliferation measured 3 days after in vitro stimulation with specific or nonspecific recombinant proteins. Cells were incubated with H 3 - thymidine for 18 hours and harvested. The ⁇ cpm was determined by subtracting background activity (e.g. incubation without antigen).
  • mice were anesthetized with isoflurane (Aerrane, Anaquest, NJ) and spleen cells were harvested. Erythrocytes were removed by incubation in 0.83% NH 4 C1/0.17M Tris pH 7.4, for 5 minutes at 25C. Spleen cells were washed two times and cultured in triplicate using 96 well round bottom plates at 5xl0 5 cells/well in 200 ⁇ l complete DMEM (Mediatech, Washington, DC) containing 10% FBS and 2-mercaptoethanol. Cells were stimulated with recombinant nonstructural protein (NS3, NS4 and NS5) (Mikrogen, Kunststoff) at different concentrations (0, 0.01 , 0.1 and 1 ⁇ g/ml).
  • NS3, NS4 and NS5 recombinant nonstructural protein
  • effector cells were stimulated with recombinant HCV-core or HbsAg proteins (Energix) at the same concentrations. After stimulation for 3 days, 3 H-thymidine was added (1 ⁇ Ci/well). Cells were incubated for additional 18 hours and the 3 H-thymidine incorporation into DNA was measured after harvesting. Incorporation of radioactivity was corrected for background activity ( ⁇ cpm). For determination of cytokine release effector cells were cultured as described above and IL-2, IL- 4 and interferon- ⁇ levels were measured in the culture supernatant by commercial kits according to manufacturer's instructions (Endogen, Boston, MA).
  • spleen cells were harvested and restimulated with either recombinant antigen or antigen expressed by stable transfected cell lines in vitro.
  • Substantial lymphocyte proliferation was induced by all nonstructural proteins at different antigen concentrations as measured by [ 3 H]thymidine incorporation (see Figure 2B).
  • Spleen cells derived from immunized mice were suspended in complete DMEM with 10% FCS and 2-mercaptoethanol (5 x 10 _5 M) and analyzed for cytotoxic activity following 5 days of in vitro stimulation.
  • Recombinant murine IL-2 was added once at a concentration of 5 U/ml and responder cells (4x 10 7 ) were co-cultured with 2 x 10 6 irradiated (10,000 rad) syngeneic SP2/0 cells stably expressing either the full length NS3 orNS5 protein (SP2/NS3-3, SP2/NS5-21).
  • cytotoxic effector lymphocyte populations were harvested and a 4 hour 51 Cr-release assay was performed in 96 well round bottom plates using 51 Cr-labeled Sp2/NS3-3 or SP2/NS5-21.
  • Parental SP2/0 or SP2-19 expressing the HCV core protein were used as controls for antigen specificity of lysis and background activity.
  • Assays for CTL activity were performed at lymphocyte effector to target (E:T) ratios of 100: 1 , 30: 1 , 10:1 and 3:1, respectively.
  • T cell depletion experiments were employed by incubating effector cells with either an anti-CD4+ or CD8+ mAb containing hybridoma supernatant GK 1.5 (anti-CD4, rat); 3.155 (anti-CD8, rat)) for 30 min at 4C, washed, then incubated at 37C with complement (1:5 dilution of low toxicity rabbit complement (Cedarlane Laboratories, Ontario, Canada)).
  • splenocytes were incubated with CD8+ or CD4+ reactive monoclonal antibodies (mAbs) in the presence of complement.
  • the cytotoxic activity was mediated by CD8+ cells ( Figure 3C).
  • Figure 3 shows cytotoxic T-cell (CTL) response to NS3 (A) and NS5 (B) at different effector to target cell ratios (100:1, 30:1, 10:1, 3:1).
  • CTL cytotoxic T-cell
  • Example 7 Assessment of Cytotoxic T-Lymphocyte Activity In Vivo CTL experiments have been extremely difficult to perform because no one has been able to establish, until now, stable cell lines expressing the nonstructural proteins for use in CTL activity. Mice were immunized intramuscularly (i.m.) three times with either mock DNA or pApNS5 vector. Some animals were also immunized i.p. with recombinant NS5 protein or a combination of the both.
  • Recombinant protein (5 ⁇ g i.p.) was given as mixture of NS5-4 (aa 2622-2868) and NS5-12 (aa 2007-2268) E.coli expressed protein (Mikrogen, Kunststoff, Germany) covering parts of HCV-NS5a and HCV NS5b regions (about 50% of full length NS5).
  • 2 x 10 6 syngeneic SP2/0 derived cells stable expressing NS5 were washed and resuspended in 200 ⁇ l PBS an inoculated subcutaneously into the right flank.
  • SP2/0 cells were either expressing HCV NS5 (SP2/NS5-21) or HCV core protein SP2/19).
  • tumor formation was assessed 15 days after inoculation and the number of animals with tumors and tumor weight was determined.
  • mice immunized with mock DNA and, challenged with a NS5 expressing murine myeloma cell line (SP2/NS5-21) developed tumors after 15 days. Moreover, tumor size was less as determined by measurement of tumor weight as compared to mice immunized with mock DNA or recombinant NS 5 protein or mice immunized with the same syngeneic SP2/0 cell line expressing a different HCV structural protein (HCV-core) as a control ( Figures 4A and 4B). Indeed, 90 - 100 % of mice immunized with mock DNA or challenged with SP2-19 cells demonstrated tumor formation, thus demonstrating the specificity of the CTL activity in this small animal tumor model.
  • HCV-core HCV structural protein
  • Figure 4A shows representative results obtained from a tumor model to assess CTL activity.
  • Mice were immunized three times i.m. with either pApNS5 or Mock DNA (100 ⁇ g) or recombinant NS5 protein i.p. (5 ⁇ g). The final group received a combination of DNA- immunization and recombinant protein. Fifteen days after tumor challenge with SP2NS5-21 or SP2-10 cells, the number of mice that developed tumors was determined and the tumor weight was measured.
  • Figure 4B shows animal immunized with Mock DNA and challenged with SP2 NS 5 -21 cells; animal immunized with pApNS 5 and challenged withSP2/NS5-21 cells; animal immunized with pApNS 5 and challenged with SP2- 19, (stable expressing HCV core);and animal immunized three times i.p. with recombinant NS5 protein and challenged with SP2/NS5-21 cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne une molécule d'acide nucléique comprenant une protéine non structurale de l'hépatite C, y compris en particulier des séquences d'ADN. L'invention concerne également des compositions pharmaceutiques contenant des molécules d'acide nucléique comprenant une protéine non structurale de l'hépatite C y compris une séquence nucléotidique codant NS3, NS4 ou NS5 ou une combinaison de ces dernières, liée de manière fonctionnelle à des éléments régulateurs fonctionnels dans des cellules humaines. L'invention concerne en outre des méthodes d'immunisation d'individus infectés ou susceptibles d'être infectés par le virus de l'hépatite C, les méthodes consistant à administrer les compositions pharmaceutiques.
EP99904381A 1998-01-30 1999-01-28 Immunisation genetique avec des proteines non structurales du virus de l'hepatite c Withdrawn EP1056762A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US7315698P 1998-01-30 1998-01-30
US73156P 1998-01-30
PCT/US1999/001823 WO1999038880A1 (fr) 1998-01-30 1999-01-28 Immunisation genetique avec des proteines non structurales du virus de l'hepatite c

Publications (2)

Publication Number Publication Date
EP1056762A1 true EP1056762A1 (fr) 2000-12-06
EP1056762A4 EP1056762A4 (fr) 2003-07-23

Family

ID=22112053

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99904381A Withdrawn EP1056762A4 (fr) 1998-01-30 1999-01-28 Immunisation genetique avec des proteines non structurales du virus de l'hepatite c

Country Status (9)

Country Link
EP (1) EP1056762A4 (fr)
JP (1) JP2002501737A (fr)
KR (2) KR20060057653A (fr)
CN (3) CN101126095A (fr)
AU (1) AU746258B2 (fr)
BR (1) BR9908540A (fr)
CA (1) CA2318744A1 (fr)
IL (1) IL137458A0 (fr)
WO (1) WO1999038880A1 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6562346B1 (en) * 1999-10-27 2003-05-13 Chiron Corporation Activation of HCV-specific T cells
CA2390082C (fr) * 1999-11-24 2010-06-29 Chiron Corporation Polypeptide non structurel du virus de l'hepatite c
US6986892B1 (en) 1999-11-24 2006-01-17 Chiron Corporation Immunogenic Hepatitis C virus non-structural polypeptides
DK1436397T3 (da) 2001-10-11 2010-08-09 Merck Sharp & Dohme Hepatitis C virus vaccine
FR2855758B1 (fr) 2003-06-05 2005-07-22 Biomerieux Sa Composition comprenant la polyproteine ns3/ns4 et le polypeptide ns5b du vhc, vecteurs d'expression incluant les sequences nucleiques correspondantes et leur utilisation en therapeutique
KR101913674B1 (ko) * 2011-10-24 2018-10-31 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 개선된 hcv 백신 및 이것을 사용하는 방법

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994016737A1 (fr) * 1993-01-26 1994-08-04 Weiner David B Compositions et procedes d'administration de matieres genetiques
WO1996037606A1 (fr) * 1995-05-22 1996-11-28 Bionova Corporation Procedes et compositions de diagnostic d'infections par le virus de l'hepatite c et de vaccination contre le virus de l'hepatite c
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization
WO1997044469A2 (fr) * 1996-05-24 1997-11-27 Chiron Corporation Proteine de fusion a epitopes multiples
WO1997047358A1 (fr) * 1996-06-11 1997-12-18 Merck & Co., Inc. Genes synthetiques de l'hepatite c
WO1999029843A1 (fr) * 1997-12-11 1999-06-17 Smithkline Beecham Corporation Proteine tronquee du virus ns5b de l'hepatite c et procedes associes d'identification de composes antiviraux

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE433460T1 (de) * 1990-04-04 2009-06-15 Novartis Vaccines & Diagnostic Protease von hepatitis c virus

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994016737A1 (fr) * 1993-01-26 1994-08-04 Weiner David B Compositions et procedes d'administration de matieres genetiques
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization
WO1996037606A1 (fr) * 1995-05-22 1996-11-28 Bionova Corporation Procedes et compositions de diagnostic d'infections par le virus de l'hepatite c et de vaccination contre le virus de l'hepatite c
WO1997044469A2 (fr) * 1996-05-24 1997-11-27 Chiron Corporation Proteine de fusion a epitopes multiples
WO1997047358A1 (fr) * 1996-06-11 1997-12-18 Merck & Co., Inc. Genes synthetiques de l'hepatite c
WO1999029843A1 (fr) * 1997-12-11 1999-06-17 Smithkline Beecham Corporation Proteine tronquee du virus ns5b de l'hepatite c et procedes associes d'identification de composes antiviraux

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHOO Q-L ET AL: "GENETIC ORGANIZATION AND DIVERSITY OF THE HEPATITIS C VIRUS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 88, 1 March 1991 (1991-03-01), pages 2451-2455, XP000652139 ISSN: 0027-8424 *
ENCKE J. ET AL.: "Genetic immunization generates cellular and humoral immune responses against the nonstructural proteins of the hepatitis C virus in a murine model" JOURNAL OF IMMUNOLOGY, vol. 161, no. 9, 1 November 1998 (1998-11-01), pages 4917-4923, XP002233910 *
INCHAUSPE G.: "Gene vaccination for hepatitis C" SPRINGER SEMINARS IN IMMUNOPATHOLOGY, vol. 19, no. 2, 1997, pages 211-221, XP008014824 *
INCHAUSPE G.: "Mechanism of protection in hepatitis C virus infection" MEDECINE ET MALADIES INFECTIEUSES, vol. 25, October 1995 (1995-10), pages 1067-1073, XP008017646 *
PAPA S. ET AL.: "Development of a multigenic plasmid vector for HCV DNA immunization" RESEARCH IN VIROLOGY, vol. 149, no. 5, September 1998 (1998-09), pages 315-319, XP002233911 *
SAITO T ET AL: "PLASMID DNA-BASED IMMUNIZATON FOR HEPATITIS C VIRUS STRUCTURAL PROTEINS: IMMUNE RESPONSES IN MICE" GASTROENTEROLOGY, vol. 112, no. 4, April 1997 (1997-04), pages 1321-1330, XP001013414 ISSN: 0016-5085 *
See also references of WO9938880A1 *
STUYVER L ET AL: "CLONING AND PHYLOGENETIC ANALYSIS OF THE CORE, E2, AND NS3/NS4 REGIONS OF THE HEPATITIS C VIRUS TYPE 5A+" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 202, no. 3, 1994, pages 1308-1314, XP002057873 ISSN: 0006-291X *

Also Published As

Publication number Publication date
CN101126095A (zh) 2008-02-20
CN1289339A (zh) 2001-03-28
KR20060057653A (ko) 2006-05-26
JP2002501737A (ja) 2002-01-22
CA2318744A1 (fr) 1999-08-05
WO1999038880A1 (fr) 1999-08-05
IL137458A0 (en) 2001-07-24
CN101126094A (zh) 2008-02-20
EP1056762A4 (fr) 2003-07-23
AU2478699A (en) 1999-08-16
CN100335637C (zh) 2007-09-05
KR20010086226A (ko) 2001-09-10
KR100628411B1 (ko) 2006-09-28
BR9908540A (pt) 2000-11-28
AU746258B2 (en) 2002-04-18

Similar Documents

Publication Publication Date Title
Tokushige et al. Expression and immune response to hepatitis C virus core DNA–based vaccine constructs
US6235888B1 (en) Hepatitis C virus vaccine
WO2001021807A1 (fr) Proteine enveloppe 2 (e2) du virus de l'hepatite c qui ne possede pas tout ou partie de la region 1 hypervariable (hvr1), acides nucleiques correspondants, virus chimeriques et utilisation de ces derniers
AU746258B2 (en) Genetic immunization with nonstructural proteins of hepatitis C virus
JP6259831B2 (ja) Ｃ型肝炎ウイルスに対するキメラワクチン抗原
US20070032444A1 (en) Genetic immunization with nonstructural proteins of hepatitis C virus
AU701747B2 (en) Hepatitis virus vaccines
Ghorbani et al. Comparison of antibody-and cell-mediated immune responses after intramuscular hepatitis C immunizations of BALB/c mice
US6025341A (en) Chimeric hepatitis B/hepatitis C virus vaccine
KR100902197B1 (ko) 티모신에 의한 유전적 면역화 증대
AU741876B2 (en) Hepatitis virus vaccines
AU2002360315B2 (en) Thymosin augmentation of genetic immunization
AU2298602A (en) Hepatitis virus vaccines
AU2002360315A1 (en) Thymosin augmentation of genetic immunization
JP2008508890A6 (ja) 組換え生鶏痘ウィルスベクター及びｃ型肝炎ウィルスに対する薬剤組成物中でのそれらの使用
JP2008508890A (ja) 組換え生鶏痘ウィルスベクター及びｃ型肝炎ウィルスに対する薬剤組成物中でのそれらの使用

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000830

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU NL PT SE

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 07K 14/18 B

Ipc: 7A 61K 39/29 B

Ipc: 7A 61K 39/12 B

Ipc: 7C 12N 15/85 B

Ipc: 7C 12N 5/10 B

Ipc: 7C 12N 15/51 B

Ipc: 7C 07H 21/04 B

Ipc: 7C 07H 21/02 A

A4 Supplementary search report drawn up and despatched

Effective date: 20030604

17Q First examination report despatched

Effective date: 20040824

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20080602