Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

• INTRODUCTION Asthma is a disease of reversible bronchial obstruction, characterized by airway inflammation, epithelial damage, airway smooth muscle hypertrophy and bronchial hyperreactivity. Many asthma symptoms can be controlled by medical intervention, but incidence of asthma-related death and severe illness continue to rise in the United States. The approximately 4,800 deaths in 1989 marked a 46 percent increase since 1980. As many as 12 million people in the United States have asthma, up 66 percent since 1980, and annually, the disease's medical and indirect costs are estimated at over $6 billion.
• Atopy is characterized by a predisposition to raise an IgE antibody response to common environmental antigens.
• asthma symptoms and evidence of allergy such as a positive skin test to common allergens, are both present.
• Non-atopic asthma may be defined as reversible airflow limitation in the absence of allergies.
• bronchial hyperreactivity a characteristic of asthma thought to have a heritable component.
• Studies have demonstrated a genetic predisposition to asthma by showing, for example, a greater concordance for this trait among monozygotic twins than among dizygotic twins.
• the genetics of asthma is complex, however, and shows no simple pattern of inheritance. Environment also plays a role in asthma development, for example, children of smokers are more likely to develop asthma than are children of non-smokers.
• -1- is little or no biochemical data concerning the encoded product.
• genes that predispose to human diseases, such as cystic fibrosis, Huntington's disease, etc. are of interest because of their phenotypic effect.
• Biochemical characterization of such genes may be secondary to genetic characterization.
• a solution to this impasse has been found in combining classical genetic mapping with the ability to identify genes and, if necessary, to sequence large regions of chromosomes. Population and family studies enable genes associated with a trait of interest to be localized to a relatively small region of a chromosome. At this point, physical mapping can be used to identify candidate genes, and various molecular biology techniques used to pick out mutated genes in affected individuals.
• Positional cloning This "top-down" approach to gene discovery has been termed positional cloning, because genes are identified based on position in the genome. Positional cloning is now being applied to complex genetic diseases, which affect a greater fraction of civilization than do the more simple and usually rarer single gene disorders. Such studies must take into account the contribution of both environmental and genetic factors to the development of disease, and must allow for contributions to the genetic component by more than one, and potentially many, genes. The clinical importance of asthma makes it of considerable interest to characterize genes that underlie a genetic predisposition to this disease. Positional cloning provides an approach to this goal.
• the genes associated with a genetic predisposition to asthma are provided.
• the genes, herein termed ASTH1I and ASTH1J, are located close to each other on human chromosome 11 p, have similar patterns of expression, and common sequence motifs.
• the nucleic acid compositions are used to produce the encoded proteins, which may be employed for functional studies, as a therapeutic, and in studying associated physiological pathways.
• the nucleic acid compositions and antibodies specific for the protein are useful as diagnostics to identify a hereditary predisposition to asthma.
• ASTH1 genes and fragments thereof, encoded protein, ASTH1 genomic regulatory regions, and anti-/AS7H1 antibodies are useful in the identification of individuals predisposed to development of asthma, and for the modulation of gene activity in vivo for prophylactic and therapeutic purposes.
• the encoded ASTl ⁇ l protein is useful as an immunogen to raise specific antibodies, in drug screening for compositions that mimic or modulate ASTH ⁇ activity or expression, including altered forms of ASTH protein, and as a therapeutic.
• Asthma is reversible airflow limitation in a patient over a period of time.
• the disease is characterized by increased airway responsiveness to a variety of stimuli, and airway inflammation.
• a patient diagnosed as asthmatic will generally have multiple indications over time, including wheezing, asthmatic attacks, and a positive response to methacholine challenge, i.e. a PC 20 on methacholine challenge of less than about 4 mg/ml.
• Guidelines for diagnosis may be found in the National Asthma Education Program Expert Panel. Guidelines for diagnosis and management of asthma. National Institutes of Health, 1991 ; Pub. #91-3042.
• Atopy, respiratory infection and environmental predisposing factors may also be present, but are not necessary elements of an asthma diagnosis.
• Asthma conditions strictly related to atopy are referred to as atopic asthma.
• the human ASTH1I and ASTH1J gene sequences are provided, as are the genomic sequences 5' to ASTH1J.
• the major sequences of interest provided in the sequence listing are as follows:
• Microsatellite flanking sequences DNA SEQ ID NO:160-281
• the ASTH1 locus has been mapped to human chromosome 11p.
• the traits for a positive response to methacholine challenge and a clinical history of asthma were shown to be genetically linked in a genome scan of the population of Tristan da Cunha, a single large extended family with a high incidence of asthma (discussed in Zamel et al. (1996) Am. J. Respir. Crit. Care Med. 153:1902-1906).
• the linkage finding was replicated in a set of Canadian asthmatic families.
• the region of strongest linkage was the marker D11S907 on the short arm of chromosome 11. Additional markers were identified from the four megabase region surrounding D11S907 from public databases and by original cloning of new polymorphic microsatellite markers.
• TDT transmission disequilibrium test
• ASTH1 I produces a 2.8 kb mRNA expressed at high levels in trachea and prostate, and at lower levels in lung and kidney and possibly other tissues.
• ASTH11 cDNA clones have also been identified in prostate, testis and lung libraries. Sequence polymorphisms are shown in Table 3.
• ASTH11 has at least three alternate forms denoted as altl , alt2, and alt3. The alternative splicing and start codons give the three forms of ASTH1 I proteins different amino termini.
• the ASTH1 I proteins, altl , alt2 and alt3 are 265, 255 and 164 amino acids in length, respectively.
• a domain of the ASTH1 I and ASTH1 J proteins is similar in sequence to transcription factors of the ets family.
• the ets family is a group of transcription factors that activate genes involved in a variety of immunological and other processes.
• the family members most similar to ASTH11 and ASTH1 J are: ETS1 , ETS2, ESX, ELF, ELK1 , TEL, NET, SAP-1 , NERF and FLI.
• the ASTH1 I and ASTH1 J proteins show similarity to each other. Over the ets domain they are 66% similar (ie. have amino acids with similar properties in the same positions) and 46% identical to each other. All forms of ASTH1 I and ASTH1J have a helix turn helix motif, characteristic of some transcription factors, located near the carboxy terminal end of the protein.
• ASTH1J produces an approximately 6 kb mRNA expressed at high levels in the trachea, prostate and pancreas and at lower levels in colon, small intestine, lung and stomach.
• ASTH1J has at least three forms, consisting of the altl , alt2 and alt3 forms.
• the open reading frame is identical for the three forms, which differ only in the 5' UTR.
• the protein encoded by ASTH1 J is 300 amino acids in length.
• Mouse coding region sequence of asthlj is provided in SEQ ID NO:326, and the amino acid sequence is provided in SEQ ID NO:327.
• the mouse and human proteins have 88.4% identity throughout their length. The match in the ets domain is 100%.
• the mouse cDNA was identified by hybridization of a full-length human cDNA to a mouse lung cDNA library (Stratagene).
• ASTH1 genes is herein used generically to designate ASTH1I and ASTH1J genes and their alternate forms. The two genes lie in opposite orientations on a native chromosome, with the 5' regulatory sequences between them. Part of the genomic sequence between the two coding regions is provided as SEQ ID NO:1.
• the term "ASTH1 locus” is used herein to refer to the two genes in all alternate forms and the genomic sequence that lies between the two genes. Alternate forms include splicing variants, and polymorphisms in the sequence. Specific polymorphic sequences are provided in SEQ ID NOs:16-159. For some purposes the previously known EST sequences described herein may be excluded from the sequences defined as the ASTH1 locus.
• the DNA sequence encoding ASTH1 may be cDNA or genomic DNA or a fragment thereof.
• the term "ASTH1 gene” shall be intended to mean the open reading frame encoding specific ASTH1 polypeptides, introns, as well as adjacent 5' and 3' non-coding nucleotide sequences involved in the regulation of expression, up to about 1 kb beyond the coding region, but possibly further in either direction. The gene may be introduced into an appropriate vector for extrachromosomal maintenance or for integration into the host.
• cDNA as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3' and 5' non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns removed by nuclear RNA splicing, to create a continuous open reading frame encoding the ASTH1 protein.
• genomic ASTH1 sequence has non-contiguous open reading frames, where introns interrupt the protein coding regions.
• a genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It may further include the 3' and 5' untranslated regions found in the mature mRNA. It may further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc.,
• Genomic regions of interest include the non-transcribed sequences 5' to ASTH1J, as provided in SEQ ID NO:1. This region of DNA contains the native promoter elements that direct expression of the linked ASTH1J gene. Usually a promoter region will have at least about 140 nt of sequence located 5' to the ASTH1 gene and further comprising a TATA box and CAAT box motif sequence (SEQ ID NO: 14, nt. 597-736).
• the promoter region may further comprise a consensus ets binding motif, (C/A)GGA(A/T) (SEQ ID NO:14, nt 1-5).
• a region of particular interest containing the ets binding motif, TATA box and CAAT box motifs 5' to the ASTH1J gene, is provided in SEQ ID NO:14.
• the position of SEQ ID NO:14 within the larger sequence is SEQ ID NO:1 , nt 60359-61095.
• the promoter sequence may comprise polymorphisms within the CAAT box region, for example those shown in SEQ ID NO: 12 and SEQ ID NO: 13, which have been shown to affect the function of the promoter.
• the promoter region of interest may extend 5' to SEQ ID NO:14 within the larger sequence, e.g. SEQ ID NO:1 , nt 59000-61095; SEQ ID NO:1 , nt 5700-61095, etc.
• sequence of this 5' region, and further 5' upstream sequences and 3' downstream sequences, may be utilized for promoter elements, including enhancer binding sites, that provide for expression in tissues where ASTH1J is expressed.
• tissue specific expression is useful for determining the pattern of expression, and for providing promoters that mimic the native pattern of expression.
• Naturally occurring polymorphisms in the promoter region are useful for determining natural variations in expression, particularly those that may be associated with disease. See, for example, SEQ ID NO: 12 and 13.
• mutations may be introduced into the promoter region to determine the effect of altering expression in experimentally defined systems.
• Methods for the identification of specific DNA motifs involved in the binding of transcriptional factors are known in the art, e.g. sequence similarity to known binding motifs, gel retardation studies, etc. For examples, see Blackwell et al. (1995) Mol Med 1: 194-205; Mortlock et al. (1996)
• the regulatory sequences may be used to identify cis acting sequences required for transcriptional or translational regulation of ASTH1 expression, especially in different tissues or stages of development, and to identify cis acting sequences and trans acting factors that regulate or mediate ASTH1 expression.
• Such transcription or translational control regions may be operably linked to a ASTH1 gene in order to promote expression of wild type or altered ASTH1 or other proteins of interest in cultured cells, or in embryonic, fetal or adult tissues, and for gene therapy.
• the nucleic acid compositions of the subject invention may encode all or a part of the subject polypeptides. Fragments may be obtained of the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc. For the most part, DNA fragments will be of at least 15 nt, usually at least 18 nt, more usually at least about 50 nt. Such small DNA fragments are useful as primers for PCR, hybridization screening, etc. Larger DNA fragments, i.e. greater than 100 nt are useful for production of the encoded polypeptide. For use in amplification reactions, such as PCR, a pair of primers will be used.
• primer sequences The exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the subject sequence under stringent conditions, as known in the art. It is preferable to choose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. Amplification primers hybridize to complementary strands of DNA, and will prime towards each other.
• the ASTH1 genes are isolated and obtained in substantial purity, generally as other than an intact mammalian chromosome. Usually, the DNA will be obtained substantially free of other nucleic acid sequences that do not include an ASTH1 sequence or fragment thereof, generally being at least about 50%, usually at least about 90% pure and are typically "recombinant", i.e. flanked by one or more
• the DNA sequences are used in a variety of ways. They may be used as probes for identifying ASTH1 related genes. Mammalian homologs have substantial sequence similarity to the subject sequences, i.e. at least 75%, usually at least 90%, more usually at least 95% sequence identity with the nucleotide sequence of the subject DNA sequence. Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al. (1990) J Mol Biol 215:403-10.
• Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50°C and 10XSSC (0.9 M saline/0.09 M sodium citrate) and remain bound when subjected to washing at 55°C in 1XSSC. Sequence identity may be determined by hybridization under stringent conditions, for example, at 50°C or higher and 0.1XSSC (9 mM saline/0.9 mM sodium citrate).
• probes, particularly labeled probes of DNA sequences one can isolate homologous or related genes.
• the source of homologous genes may be any species, e.g.
• RNA is isolated from a cell sample. mRNA may be amplified by RT-PCR, using reverse transcriptase to form a complementary DNA strand, followed by polymerase chain reaction amplification using primers specific for the subject DNA sequences.
• mRNA sample is separated by gel electrophoresis, transferred to a suitable support, e.g. nitrocellulose, nylon, etc., and then probed with a fragment of the subject DNA as a probe.
• suitable support e.g. nitrocellulose, nylon, etc.
• Other techniques such as oligonucleotide ligation assays, in situ
• -10- hybridizations, and hybridization to DNA probes arrayed on a solid chip may also find use. Detection of mRNA hybridizing to the subject sequence is indicative of ASTH1 gene expression in the sample.
• the subject nucleic acid sequences may be modified for a number of purposes, particularly where they will be used intracellularly, for example, by being joined to a nucleic acid cleaving agent, e.g. a chelated metal ion, such as iron or chromium for cleavage of the gene; or the like.
• a nucleic acid cleaving agent e.g. a chelated metal ion, such as iron or chromium for cleavage of the gene; or the like.
• sequence of the ASTH1 locus may be mutated in various ways known in the art to generate targeted changes in promoter strength, sequence of the encoded protein, etc.
• the DNA sequence or product of such a mutation will be substantially similar to the sequences provided herein, i.e. will differ by at least one nucleotide or amino acid, respectively, and may differ by at least two but not more than about ten nucleotides or amino acids.
• the sequence changes may be substitutions, insertions or deletions. Deletions may further include larger changes, such as deletions of a domain or exon.
• Other modifications of interest include epitope tagging, e.g. with the FLAG system, HA, etc.
• fusion proteins with green fluorescent proteins may be used.
• GFP green fluorescent proteins
• Such mutated genes may be used to study structure-function relationships of ASTH1 polypeptides, or to alter properties of the protein that affect its function or regulation.
• constitutively active transcription factors, or a dominant negatively active protein that binds to the ASTH1 DNA target site without activating transcription may be created in this manner.
• the subject gene may be employed for synthesis of a complete ASTH1 protein, or polypeptide fragments thereof, particularly fragments corresponding to functional domains; binding sites; etc.; and including fusions of the subject polypeptides to other proteins or parts thereof.
• an expression cassette may be employed, providing for a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region.
• Various transcriptional initiation regions may be employed that are functional in the expression host.
• the polypeptides may be expressed in prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression.
• a unicellular organism such as E. coli, B. subtilis, S. cerevisiae, or cells of a higher organism such as vertebrates, particularly mammals, e.g. COS 7 cells, may be used as the expression host cells.
• Small peptides can also be synthesized in the laboratory.
• polypeptides may be isolated and purified in accordance with conventional ways.
• a lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique.
• the purified polypeptide will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure. Pure is intended to mean free of other proteins, as well as cellular debris.
• the polypeptide is used for the production of antibodies, where short fragments provide for antibodies specific for the particular polypeptide, and larger fragments or the entire protein allow for the production of antibodies over the surface of the polypeptide.
• Antibodies may be raised to the wild-type or variant
• ASTH Antibodies may be raised to isolated peptides corresponding to these domains, or to the native protein, e.g. by immunization with cells expressing ASTH1 , immunization with liposomes having ASTH1 inserted in the membrane, etc.
• Antibodies are prepared in accordance with conventional ways, where the expressed polypeptide or protein is used as an immunogen, by itself or conjugated to known immunogenic carriers, e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like.
• immunogenic carriers e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like.
• adjuvants may be employed, with a series of injections, as appropriate.
• the spleen is isolated, the lymphocytes immortalized by cell fusion, and then screened for high affinity antibody binding.
• the immortalized cells, i.e. hybridomas, producing the desired antibodies may then be expanded.
• the mRNA encoding the heavy and light chains may be isolated and mutagenized by cloning in E. coli, and the heavy and light chains mixed to further enhance the affinity of the antibody.
• Alternatives to in vivo immunization as a method of raising antibodies include binding to phage "display" libraries, usually in conjunction with in vitro affinity maturation.
• RNA sequence and/or hybridization analysis of any convenient sample from a patient e.g. biopsy material, blood sample, scrapings from cheek, etc.
• a nucleic acid sample from a patient having asthma that may be associated with ASTH1 is analyzed for the presence of a predisposing polymorphism in ASTHL
• a typical patient genotype will have at least one predisposing mutation on at least one chromosome.
• the presence of a polymorphic ASTH1 sequence that affects the activity or expression of the gene product, and confers an increased susceptibility to asthma is considered a predisposing polymorphism.
• Individuals are screened by analyzing their DNA or mRNA for the presence of a predisposing polymorphism, as compared to an asthma neutral sequence.
• Specific sequences of interest include any polymorphism that leads to clinical bronchial hyperreactivity or is otherwise associated with asthma, including, but not limited to, insertions, substitutions and
• an ASTH1 predisposing polymorphism may be modulated by the patient genotype in other genes related to asthma and atopy, including, but not limited to, the Fc ⁇ receptor, Class I and Class II HLA antigens, T cell receptor and immunoglobulin genes, cytokines and cytokine receptors, and the like. Screening may also be based on the functional or antigenic characteristics of the protein. Immunoassays designed to detect predisposing polymorphisms in ASTH1 proteins may be used in screening. Where many diverse mutations lead to a particular disease phenotype, functional protein assays have proven to be effective screening tools.
• Biochemical studies may be performed to determine whether a candidate sequence polymorphism in the ASTH1 coding region or control regions is associated with disease. For example, a change in the promoter or enhancer sequence that affects expression of ASTH1 may result in predisposition to asthma.
• Expression levels of a candidate variant allele are compared to expression levels of the normal allele by various methods known in the art. Methods for determining promoter or enhancer strength include quantitation of the expressed natural protein; insertion of the variant control element into a vector with a reporter gene such as ⁇ -galactosidase, luciferase, chloramphenicol acetyltransferase, etc. that provides for convenient quantitation; and the like.
• the activity of the encoded ASTH1 protein may be determined by comparison with the wild-type protein.
• nucleic acids for the presence of a specific sequence. Where large amounts of DNA are available, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis. Cells that express ASTH1 genes, such as trachea cells, may be used as a source of mRNA, which may be assayed directly or reverse transcribed into cDNA for analysis. The nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis. The use of the polymerase chain reaction is described in Saiki, et al.
• Amplification may also be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism.
• various methods are known in the art that utilize oligonucleotide ligation as a means of detecting polymorphisms, for examples see Riley et al. (1990) N.A.R. 18:2887-2890; and Delahunty et al. (1996) Am. J. Hum. Genet. 58: 1239-1246.
• a detectable label may be included in an amplification reaction.
• Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, e.g.
• the label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label.
• the label may be conjugated to one or both of the primers.
• the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.
• sample nucleic acid e.g. amplified or cloned fragment
• the nucleic acid may be sequenced by dideoxy or other methods, and the sequence of bases compared to a neutral ASTH1 sequence. Hybridization with the variant sequence may also be used to
• SSCP Single strand conformational polymorphism
• DGGE denaturing gradient gel electrophoresis
• mismatch cleavage detection and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility.
• a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP)
• the sample is digested with that endonuclease, and the products size fractionated to determine whether the fragment was digested. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels.
• an array of oligonucleotides are provided, where discrete positions on the array are complementary to at least a portion of mRNA or genomic DNA of the ASTH1 locus.
• Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a nucleic acid, e.g. mRNA, cDNA, genomic DNA, etc. from the ASTH1 locus.
• An array may include all or a subset of the polymorphisms listed in Table 3 (SEQ ID NOs:16-126).
• One or both polymorphic forms may be present in the array, for example the polymorphism of SEQ ID NO: 12 and 13 may be represented by either, or both, of the listed sequences.
• Such an array will include at least 2 different polymorphic sequences, i.e. polymorphisms located at unique positions within the locus, usually at least about 5, more usually at least about 10, and may include as many as 50 to 100 different polymorphisms.
• the oligonucleotide sequence on the array will usually be at least about 12 nt in length, may be the length of the provided polymorphic sequences, or may extend into the flanking regions to generate fragments of 100 to 200 nt in length.
• arrays For examples of arrays,
• Antibodies specific for ASTH1 polymorphisms may be used in screening immunoassays.
• a reduction or increase in neutral ASTH1 and/or presence of asthma associated polymorphisms is indicative that asthma is ASTH1 -associated.
• a sample is taken from a patient suspected of having ASTH1 -associated asthma.
• Samples include biological fluids such as tracheal lavage, blood, cerebrospinal fluid, tears, saliva, lymph, dialysis fluid and the like; organ or tissue culture derived fluids; and fluids extracted from physiological tissues. Also included in the term are derivatives and fractions of such fluids. Biopsy samples are of particular interest, e.g. trachea scrapings, etc.
• the number of cells in a sample will generally be at least about 10 3 , usually at least 10 more usually at least about 10 5 .
• the cells may be dissociated, in the case of solid tissues, or tissue sections may be analyzed. Alternatively a lysate of the cells may be prepared.
• Diagnosis may be performed by a number of methods. The different methods all determine the absence or presence or altered amounts of normal or abnormal ASTH1 in patient cells suspected of having a predisposing polymorphism in ASTHL For example, detection may utilize staining of cells or histological sections, performed in accordance with conventional methods.
• the antibodies of interest are added to the cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes.
• the antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection.
• a second stage antibody or reagent is used to amplify the signal.
• the primary antibody may be conjugated to biotin, with horseradish peroxidase- conjugated avidin added as a second stage reagent.
• Final detection uses a substrate that undergoes a color change in the presence of the peroxidase.
• the absence or presence of antibody binding may be determined by various methods, including flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc.
• An alternative method for diagnosis depends on the in vitro detection of binding between antibodies and ASTH1 in a lysate. Measuring the concentration of
• -17- ASTH1 binding in a sample or fraction thereof may be accomplished by a variety of specific assays.
• a conventional sandwich type assay may be used.
• a sandwich assay may first attach ASTH1 -specific antibodies to an insoluble surface or support.
• the particular manner of binding is not crucial so long as it is compatible with the reagents and overall methods of the invention. They may be bound to the plates covalently or non-covalently, preferably non-covalently.
• the insoluble supports may be any compositions to which polypeptides can be bound, which is readily separated from soluble material, and which is otherwise compatible with the overall method.
• the surface of such supports may be solid or porous and of any convenient shape.
• suitable insoluble supports to which the receptor is bound include beads, e.g. magnetic beads, membranes and microtiter plates. These are typically made of glass, plastic (e.g. polystyrene), polysaccharides, nylon or nitrocellulose. Microtiter plates are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples.
• Patient sample lysates are then added to separately assayable supports (for example, separate wells of a microtiter plate) containing antibodies.
• a series of standards containing known concentrations of normal and/or abnormal ASTH1 is assayed in parallel with the samples or aliquots thereof to serve as controls.
• each sample and standard will be added to multiple wells so that mean values can be obtained for each.
• the incubation time should be sufficient for binding, generally, from about 0.1 to 3 hr is sufficient.
• the insoluble support is generally washed of non-bound components.
• a dilute non-ionic detergent medium at an appropriate pH, generally 7-8, is used as a wash medium. From one to six washes may be employed, with sufficient volume to thoroughly wash non-specifically bound proteins present in the sample.
• a solution containing a second antibody is applied.
• the antibody will bind ASTH1 with sufficient specificity such that it can be distinguished from other components present.
• the second antibodies may be labeled to facilitate direct, or indirect quantification of binding. Examples of labels that permit direct measurement of second receptor binding include radiolabels, such as 3 H or 125 l, fluorescers, dyes, beads, chemilumninescers, colloidal particles, and the like.
• labels which permit indirect measurement of binding include enzymes where the substrate may provide for a colored or fluorescent product.
• the antibodies are labeled with a covalently bound enzyme capable of providing a detectable product signal after addition of suitable substrate.
• suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art.
• the incubation time should be sufficient for the labeled ligand to bind available molecules. Generally, from about 0.1 to 3 hr is sufficient, usually 1 hr sufficing.
• the insoluble support is again washed free of non-specifically bound material.
• the signal produced by the bound conjugate is detected by conventional means. Where an enzyme conjugate is used, an appropriate enzyme substrate is provided so a detectable product is formed. Other immunoassays are known in the art and may find use as diagnostics.
• Ouchterlony plates provide a simple determination of antibody binding.
• Western blots may be performed on protein gels or protein spots on filters, using a detection system specific for ASTH1 as desired, conveniently using a labeling method as described for the sandwich assay.
• Other diagnostic assays of interest are based on the functional properties of
• ASTH1 proteins are particularly useful where a large number of different sequence changes lead to a common phenotype, i.e. altered protein function leading to bronchial hyperreactivity.
• a functional assay may be based on the transcriptional changes mediated by ASTH1 gene products.
• Other assays may, for example, detect conformational changes, size changes resulting from insertions, deletions or truncations, or changes in the subcellular localization of ASTH1 proteins.
• PCR fragments amplified from the ASTH1 gene or its transcript are used as templates for in vivo transcription/translation reactions to generate protein products. Separation by gel electrophoresis is performed to determine whether the polymorphic gene encodes a truncated protein, where truncations may be associated with a loss of function.
• -19- Diagnostic screening may also be performed for polymorphisms that are genetically linked to a predisposition for bronchial hyperreactivity, particularly through the use of microsatellite markers or single nucleotide polymorphisms. Frequently the microsatellite polymorphism itself is not phenotypically expressed, but is linked to sequences that result in a disease predisposition. However, in some cases the microsatellite sequence itself may affect gene expression. Microsatellite linkage analysis may be performed alone, or in combination with direct detection of polymorphisms, as described above. The use of microsatellite markers for genotyping is well documented. For examples, see Mansfield et al. (1994) Genomics 24:225-233; Ziegle et al. (1992) Genomics 14:1026-1031 ; Dib et al., supra.
• Microsatellite loci that are useful in the subject methods have the general formula:
• U (R) n U' where U and U' are non-repetitive flanking sequences that uniquely identify the particular locus, R is a repeat motif, and n is the number of repeats.
• the repeat motif is at least 2 nucleotides in length, up to 7, usually 2-4 nucleotides in length. Repeats can be simple or complex.
• the flanking sequences U and U' uniquely identify the microsatellite locus within the human genome.
• U and U' are at least about 18 nucleotides in length, and may extend several hundred bases up to about 1 kb on either side of the repeat. Within U and U', sequences are selected for amplification primers.
• primer sequences are not critical to the invention, but they must hybridize to the flanking sequences U and U', respectively, under stringent conditions. Criteria for selection of amplification primers are as previously discussed. To maximize the resolution of size differences at the locus, it is preferable to chose a primer sequence that is close to the repeat sequence, such that the total amplification product is between 100-500 nucleotides in length.
• the number of repeats at a specific locus, n is polymorphic in a population, thereby generating individual differences in the length of DNA that lies between the amplification primers.
• the number will vary from at least 1 repeat to as many as about 100 repeats or more.
• the primers are used to amplify the region of genomic DNA that contains the repeats.
• a detectable label will be included in the amplification reaction, as previously described.
• Multiplex amplification may be performed in which several sets of primers are combined in the same reaction tube. This is particularly advantageous when limited amounts of sample DNA are available for analysis.
• each of the sets of primers is labeled with a different fluorochrome.
• the products are size fractionated. Fractionation may be performed by gel electrophoresis, particularly denaturing acrylamide or agarose gels.
• gel electrophoresis particularly denaturing polyacrylamide gels in combination with an automated DNA sequencer, see Hunkapillar et al. (1991) Science 254:59-74. The automated sequencer is particularly useful with multiplex amplification or pooled products of separate PCR reactions.
• Capillary electrophoresis may also be used for fractionation. A review of capillary electrophoresis may be found in Landers, et al. (1993) BioTechniques 14:98-111.
• the size of the amplification product is proportional to the number of repeats (n) that are present at the locus specified by the primers. The size will be polymorphic in the population, and is therefore an allelic marker for that locus.
• D11S2008 A number of markers in the region of the ASTH1 locus have been identified, and are listed in Table 1 in the Experimental section (SEQ ID NOs:160-273). Of particular interest for diagnostic purposes is the marker D11S2008, in which individuals having alleles C or F at this locus, particularly in combination with the CAAT box polymorphism and other polymorphisms, are predisposed to develop bronchial hyperreactivity or asthma.
• the association of D11S2008 alleles is as follows: llele Association with asthma Number of TATC repeats relative to allele C (SEQ ID NO:15)
• a DNA sequence of interest for diagnosis comprises the D11S2008 primer sequences shown in Table 1 (SEQ ID NO:242 and 243), flanking one or three repeats of SEQ ID NO: 15.
• microsatellite markers of interest for diagnostic purposes are CA39_2; 774F; 774J; 7740; L19PENTA1 ; 65P14TE1 ; AFM205YG5; D11S907; D11S4200; 774N; CA11-11 ; 774L; AFM283WH9; ASMI14 and D11S1900 (primer sequences are provided in Table 1 , the repeats are provided in Table 1 B).
• ASTH1 genes are useful for analysis of ASTH1 expression, e.g. in determining developmental and tissue specific patterns of expression, and for modulating expression in vitro and in vivo.
• the regulatory region of SEQ ID NO:1 may also be used to investigate analysis of ASTH1 expression.
• Vectors useful for introduction of the gene include plasmids and viral vectors. Of particular interest are retroviral-based vectors, e.g. Moloney murine leukemia virus and modified human immunodeficiency virus; adenovirus vectors, etc. that are maintained transiently or stably in mammalian cells.
• retroviral-based vectors e.g. Moloney murine leukemia virus and modified human immunodeficiency virus
• adenovirus vectors, etc. that are maintained transiently or stably in mammalian cells.
• a wide variety of vectors can be employed for transfection and/or integration of the gene into the genome of the cells.
• micro-injection may be employed, fusion, or the like for introduction of genes into a suitable host cell.
• suitable host cell See, for example, Dhawan et al. (1991) Science 254:1509-1512 and Smith et al. (1990) Molecular and Cellular Biology 3268-3271.
• Administration of vectors to the lungs is of particular interest. Frequently such methods utilize liposomal formulations, as described in Eastman et al. (1997) Hum Gene Ther 8:765-773: Oudrhiri et al. (1997) P.N.A.S. 94:1651-1656: McDonald et al. (1997) Hum Gene Ther 8:411-422.
• the expression vector will have a transcriptional initiation region oriented to produce functional mRNA.
• the native transcriptional initiation region e.g. SEQ ID NO: 14, or an exogenous transcriptional initiation region may be employed.
• the promoter may be introduced by recombinant methods in vitro, or as the result of homologous integration of the sequence into a chromosome.
• Many strong promoters are known in the art, including the ⁇ -actin promoter, SV40 early and late promoters, human cytomegalovirus promoter, retroviral LTRs, methallothionein responsive element (MRE), tetracycline-inducible promoter constructs, etc.
• Transcription cassettes may be prepared comprising a transcription initiation region, the target gene or fragment thereof, and a transcriptional termination region.
• the transcription cassettes may be introduced into a variety of vectors, e.g. plasmid; retrovirus, e.g. lentivirus; adenovirus; and the like, where the vectors are able to transiently or stably be maintained in the cells, usually for a period of at least about one day, more usually for a period of at least about several days to several weeks.
• Antisense molecules are used to down-regulate expression of ASTH1 in cells.
• the anti-sense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA.
• ODN antisense oligonucleotides
• the antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products.
• Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance.
• One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.
• Antisense molecules may be produced by expression of all or a part of the target gene sequence in an appropriate vector, where the transcriptional initiation is oriented such that an antisense strand is produced as an RNA molecule.
• the antisense molecule is a synthetic oligonucleotide.
• Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides in length, where the length is governed by efficiency of inhibition, specificity, including absence of cross-reactivity, and the like. It has been found that short oligonucleotides, of from 7 to 8 bases in length, can be strong and selective inhibitors of gene expression (see Wagner et al. (1996) Nature Biotechnology 14:840-844).
• a specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence.
• a specific sequence for the oligonucleotide may use an empirical method, where several candidate sequences are assayed for inhibition of expression of the target gene in an in vitro or animal model. A combination of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation.
• Antisense oligonucleotides may be chemically synthesized by methods known in the art (see Wagner et al. (1993) supra, and Milligan et al., supra.) Preferred oligonucleotides are chemically modified from the native phosphodiester structure, in order to increase their intracellular stability and binding affinity. A number of such modifications have been described in the literature, which alter the chemistry of the backbone, sugars or heterocyclic bases.
• phosphorothioates Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates.
• Achiral phosphate derivatives include 3'-O'-5'-S-phosphorothioate, 3'-S-5'-O- phosphorothioate, 3'-CH2-5'-O-phosphonate and 3'-NH-5'-O-phosphoroamidate.
• Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage. Sugar modifications are also used to enhance stability and affinity.
• the ⁇ -anomer of deoxyribose may be used, where the base is inverted with respect to the natural ⁇ -anomer.
• the 2'-OH of the ribose sugar may be altered to form 2'- O-methyl or 2'-O-allyl sugars, which provides resistance to degradation without comprising affinity. Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2'-deoxycytidine and 5-bromo-2'-deoxycytidine for deoxycytidine. 5- propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.
• catalytic nucleic acid compounds e.g. ribozymes, anti-sense conjugates, etc.
• Ribozymes may be synthesized in vitro and administered to the patient, or may be encoded on an expression vector, from which the ribozyme is synthesized in the
• -24- targeted cell for example, see International patent application WO 9523225, and Beigelman et al. (1995) Nucl. Acids Res 23:4434-42).
• oligonucleotides with catalytic activity are described in WO 9506764.
• Conjugates of anti-sense ODN with a metal complex, e.g. terpyridylCu(ll), capable of mediating mRNA hydrolysis are described in Bashkin et al. (1995) Appl Biochem Biotechnol 54:43-56.
• ASTH1 Protein A host may be treated with intact ASTH1 protein, or an active fragment thereof to modulate or reduce bronchial hypereactivity. Desirably, the peptides will not induce an immune response, particularly an antibody response. Xenogeneic analogs may be screened for their ability to provide a therapeutic effect without raising an immune response. The protein or peptides may also be administered to in vitro cell cultures.
• the polypeptide formulation may be given orally, or may be injected intravascularly, subcutaneously, peritoneally, etc. Methods of administration by inhalation are well-known in the art.
• the dosage of the therapeutic formulation will vary widely, depending upon the nature of the disease, the frequency of administration, the manner of administration, the clearance of the agent from the host, and the like.
• the initial dose may be larger, followed by smaller maintenance doses.
• the dose may be administered as infrequently as weekly or biweekly, or fractionated into smaller doses and administered daily, semi-weekly, etc. to maintain an effective dosage level. In many cases, oral administration will require a higher dose than if administered intravenously.
• the amide bonds, as well as the amino and carboxy termini, may be modified for greater stability on oral administration.
• the subject peptides may be prepared as formulations at a pharmacologically effective dose in pharmaceutically acceptable media, for example normal saline, PBS, etc.
• the additives may include bactericidal agents, stabilizers, buffers, or the like.
• the peptides may be encapsulated, introduced into the lumen of liposomes, prepared as a colloid, or another conventional technique may be employed that provides for an extended lifetime of the peptides.
• the peptides may be administered as a combination therapy with other pharmacologically active agents.
• the additional drugs may be administered separately or in conjunction with the peptide compositions, and may be included in the same formulation.
• the subject nucleic acids can be used to generate genetically modified non-human animals or site specific gene modifications in cell lines.
• transgenic is intended to encompass genetically modified animals having a deletion or other knock-out of ASTH1 gene activity, having an exogenous ASTH1 gene that is stably transmitted in the host cells, or having an exogenous ASTH1 promoter operably linked to a reporter gene.
• Transgenic animals may be made through homologous recombination, where the ASTH1 locus is altered.
• a nucleic acid construct is randomly integrated into the genome.
• Vectors for stable integration include plasmids, retroviruses and other animal viruses, YACs, and the like. Of interest are transgenic mammals, e.g. cows, pigs, goats, horses, etc., and particularly rodents, e.g. rats, mice, etc.
• a "knock-out" animal is genetically manipulated to substantially reduce, or eliminate endogenous ASTH1 function. Different approaches may be used to achieve the "knock-out”.
• a chromosomal deletion of all or part of the native ASTH1 homolog may be induced. Deletions of the non-coding regions, particularly the promoter region, 3' regulatory sequences, enhancers, or deletions of gene that activate expression of ASTH1 genes.
• a functional knock-out may also be achieved by the introduction of an anti-sense construct that blocks expression of the native ASTH1 genes (for example, see Li and Cohen (1996) Cell 85:319-329).
• Transgenic animals may be made having exogenous ASTH1 genes.
• the exogenous gene is usually either from a different species than the animal host, or is otherwise altered in its coding or non-coding sequence.
• the introduced gene may be a wild-type gene, naturally occurring polymorphism, or a genetically manipulated sequence, for example those previously described with deletions, substitutions or insertions in the coding or non-coding regions.
• the introduced sequence may encode an ASTH1 polypeptide, or may utilize the ASTH1 promoter operably linked to a reporter gene. Where the introduced gene is a coding sequence, it usually
• a promoter which may be constitutive or inducible, and other regulatory sequences required for expression in the host animal.
• constructs of interest include anti-sense ASTH1, which will block ASTH1 expression, expression of dominant negative ASTH1 mutations, and over-expression of a ASTH1 gene.
• a detectable marker such as lac Z may be introduced into the ASTH1 locus, where upregulation of ASTH1 expression will result in an easily detected change in phenotype.
• Constructs utilizing the ASTH1 promoter region, e.g. SEQ ID NO:1 ; SEQ ID NO:14, in combination with a reporter gene or with the coding region of ASTH1J or ASTH1I are also of interest.
• the modified cells or animals are useful in the study of ASTH1 function and regulation. Animals may be used in functional studies, drug screening, ef ⁇ , e.g. to determine the effect of a candidate drug on asthma. A series of small deletions and/or substitutions may be made in the ASTH1 gene to determine the role of different exons in DNA binding, transcriptional regulation, etc. By providing expression of ASTH1 protein in cells in which it is otherwise not normally produced, one can induce changes in cell behavior. These animals are also useful for exploring models of inheritance of asthma, e.g. dominant v. recessive; relative effects of different alleles and synergistic effects between ASTH1I and ASTH1J and other asthma genes elsewhere in the genome.
• DNA constructs for homologous recombination will comprise at least a portion of the ASTH1 gene with the desired genetic modification, and will include regions of homology to the target locus.
• DNA constructs for random integration need not include regions of homology to mediate recombination. Conveniently, markers for positive and negative selection are included. Methods for generating cells having targeted gene modifications through homologous recombination are known in the art. For various techniques for transfecting mammalian cells, see Keown et al. (1990) Methods in Enzymology 185:527-537.
• an ES cell line may be employed, or embryonic cells may be obtained freshly from a host, e.g. mouse, rat, guinea pig, etc. Such cells are grown on an appropriate fibroblast-feeder layer or grown in the presence of appropriate growth factors, such as leukemia inhibiting factor (LIF).
• LIF leukemia inhibiting factor
• ES cells When ES cells have been transformed, they may be used to produce transgenic animals. After transformation, the cells are plated onto a feeder layer in an appropriate medium. Cells containing the construct may be detected by employing a selective medium. After sufficient time for colonies to grow, they are picked and analyzed for the occurrence of homologous recombination or integration of the construct. Those colonies that are positive may then be used for embryo manipulation and blastocyst injection. Blastocysts are obtained from 4 to 6 week old superovulated females. The ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst.
• blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting litters screened for mutant cells having the construct. By providing for a different phenotype of the blastocyst and the ES cells, chimeric progeny can be readily detected.
• the chimeric animals are screened for the presence of the modified gene and males and females having the modification are mated to produce homozygous progeny. If the gene alterations cause lethality at some point in development, tissues or organs can be maintained as allogeneic or congenic grafts or transplants, or in in vitro culture.
• Transformation of genetic function may utilize non-mammalian models, particularly using those organisms that are biologically and genetically well-characterized, such as C. elegans, D. melanogaster and S. cerevisiae.
• transposon (Tc1) insertions in the nematode homolog of an ASTH1 gene or promoter region may be made.
• the subject gene sequences may be used to knock-out or to complement defined genetic lesions in order to determine the physiological and biochemical pathways involved in ASTH1 function.
• a number of human genes have been shown to complement mutations in lower eukaryotes.
• Drug screening may be performed in combination with the subject animal models.
• Many mammalian genes have homologs in yeast and lower animals. The study of such homologs' physiological role and interactions with other proteins can facilitate understanding of biological function.
• yeast has been shown to be a powerful tool for studying protein-protein interactions through the two hybrid system described in
• Drug Screening Assays By providing for the production of large amounts of ASTH1 protein, one can identify ligands or substrates that bind to, modulate or mimic the action of ASTHL Areas of investigation are the development of asthma treatments. Drug screening identifies agents that provide a replacement or enhancement for ASTH1 function in affected cells. Conversely, agents that reverse or inhibit ASTH1 function may stimulate bronchial reactivity. Of particular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, protein-DNA binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like. The purified protein may also be used for determination of three-dimensional crystal structure, which can be used for modeling intermolecular interactions, transcriptional regulation, etc.
• agent as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of altering or mimicking the physiological function of ASTHL Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
• Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
• Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
• the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
• Candidate agents are also found among biomolecules including, but not limited to: peptides, saccharides, fatty acids,
• Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic Compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
• the screening assay is a binding assay
• the label can directly or indirectly provide a detectable signal.
• Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like.
• Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
• the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
• reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
• assays of interest detect agents that mimic ASTH1 function.
• candidate agents are added to a cell that lacks functional ASTH1 , and screened for the ability to reproduce ASTH1 in a functional assay.
• the compounds having the desired pharmacological activity may be administered in a physiologically acceptable carrier to a host for treatment of asthma attributable to a defect in ASTH1 function.
• the compounds may also be used to enhance ASTH1 function.
• the therapeutic agents may be administered in a variety of ways, orally, topically, parenterally e.g. subcutaneously, intraperitoneally, by viral infection, intravascularly, etc. Inhaled treatments are of particular interest.
• the compounds may be formulated in a variety of ways.
• the concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt.%.
• compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
• Pharmaceutical grade organic or inorganic carriers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds.
• Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
• Pharmacogenetics is the linkage between an individual's genotype and that individual's ability to metabolize or react to a therapeutic agent. Differences in metabolism or target sensitivity can lead to severe toxicity or therapeutic failure by altering the relation between bioactive dose and blood concentration of the drug. In the past few years, numerous studies have established good relationships between polymorphisms in metabolic enzymes or drug targets, and both response and toxicity. These relationships can be used to individualize therapeutic dose administration.
• Genotyping of polymorphic alleles is used to evaluate whether an individual will respond well to a particular therapeutic regimen.
• the polymorphic sequences are used to evaluate whether an individual will respond well to a particular therapeutic regimen.
• a candidate ASTH1 polymorphism is screened with a target therapy to determine whether there is an influence on the effectiveness in treating asthma.
• Drug screening assays are performed as described above. Typically two or more different sequence polymorphisms are tested for response to a therapy.
• Drugs currently used to treat asthma include beta 2-agonists, glucocorticoids, theophylline, cromones, and anticholinergic agents.
• beta 2-agonists For acute, severe asthma, the inhaled beta 2-agonists are the most effective bronchodilators. Short-acting forms give rapid relief; long-acting agents provide sustained relief and help nocturnal asthma.
• First-line therapy for chronic asthma is inhaled glucocorticoids, the only currently available agents that reduce airway inflammation.
• Theophylline is a bronchodilator that is useful for severe and nocturnal asthma, but recent studies suggest that it may also have an immunomodulatory effect. Cromones work best for patients who have mild asthma: they have few adverse effects, but their activity is brief, so they must be given frequently.
• Cysteinil leukotrienes are important mediators of asthma, and inhibition of their effects may represent a potential breakthrough in the therapy of allergic rhinitis and asthma.
• diagnostic screening may be performed. Diagnostic methods have been described in detail in a preceding section. The presence of a particular polymorphism is detected, and used to develop an effective therapeutic strategy for the affected individual.
• molecular weight is average molecular weight
• temperature is in degrees centigrade
• pressure is at or near atmospheric.
• Tristan da Cunha Asthma phenotype measurements and blood samples were obtained from the inhabitants of Tristan da Cunha, an isolated island in the South Atlantic, and from asthma families in Toronto, Canada (see Zamel et al., (1996) supra.)
• the 282 inhabitants of Tristan da Cunha form a single large extended family descended from 28 original founders. Settlement of Tristan da Cunha occurred beginning in 1817 with soldiers who remained behind when a British garrison was withdrawn from the island, followed by the survivors of several shipwrecks.
• 1827 Five women from St. Helena, one with children, emigrated to Tristan da Cunha and married island men.
• One of these women is said to have been asthmatic, and could be the origin of a genetic founder effect for asthma in this population. Inbreeding has resulted in kinship resemblances of at least first cousin levels for all individuals.
• Tristan da Cunha family pedigrees were ascertained through review of baptismal, marriage and medical records, as well as reliably accurate historical records of the early inhabitants (Zamel (1995) Can. Respir. J. 2:18).
• the prevalence of asthma on Tristan da Cunha is high; 23% had a definitive diagnosis of asthma.
• the Toronto cohort included 59 small families having at least one affected individual. These were ascertained based on the following criteria: (i) an affected proband; (ii) availability of at least one sibling of the proband, either affected or unaffected; (iii) at least one living parent from whom DNA could be obtained. A set of 156 "triad" families consisting of an affected proband and his or her parents were also collected. Signed consent forms were obtained from each individual prior to commencement of phenotyping and blood sample collection. The Toronto patients were mainly of mixed European ancestry.
• a standardized questionnaire based on that of the American Thoracic Society (American Lung Association recommended respiratory diseases questionnaire for use with adults and children in epidemiology research. 1978. American Review of Respiratory Disease 118(2):7-53) was used to record the presence of respiratory symptoms such as cough, sputum and wheezing; the presence of other chest disorders including recent upper respiratory tract infection, allergic history; asthmatic attacks including onset, offset, confirmation by a physician, prevalence, severity and precipitating factors; other illnesses and smoking history; and all medications used within the previous 3 months.
• a physician-confirmed asthmatic attack was the principal criterion for a diagnosis of asthma.
• Skin atopy was determined by skin prick tests to common allergens: A. fumigatus, Cladospohum, Alternaria, egg, milk, wheat, tree, dog, grass, horse, house dust, cat, feathers, house dust mite D. farinae, and house dust mite
• D. pteronyssinus Atopy testing of Toronto subjects omitted D. pteronyssinus and added cockroach and ragweed allergens. Saline and histamine controls were also performed (Bencard Laboratories, Mississauga, Ontario). Antihistamines were withdrawn for at least 48 hours prior to testing. Wheal diameters were corrected by subtraction of the saline control wheal diameter, and a corrected wheal size of >3 mm recorded 10 min after application was considered a positive response.
• Airway responsiveness was assessed by a methacholine challenge test in those subjects with a baseline FEV1 (forced exhalation volume in one second) > 70% of predicted (Crapo et al. (1981) Am. Rev. Respir. Pis. 123:659). Methacholine challenge response was determined using the tidal breathing method (Cockcroft et al. (1977) Clin. Allergy 7:235). Doubling doses of methacholine from 0.03 to 16 mg/ml were administered using a Wright nebulizer at 4-min intervals to measure the provocative concentration of methacholine producing a 20% fall in FEV1 (PC20).
• PCR primer pairs were synthesized using Applied Biosystems 394 automated oligo synthesizer. The forward primer of each pair was labeled with either FAM, HEX, or TET phosphoramidites (Applied Biosystems). No oligo purification step was performed. Genomic DNA was extracted from whole blood. PCR was performed using
• thermocyclers (MJ Research). Reactions contained 10 mM Tris-HCl, pH 8.3; 1.5-3.0 mM MgCI 2 ; 50 mM KCI; 0.01 % gelatin; 250 ⁇ M each dGTP, dATP, dTTP, dCTP; 20 ⁇ M each PCR primer; 20 ng genomic DNA; and 0.75 U Taq Polymerase (Perkin Elmer Cetus) in a final volume of 20 ⁇ l. Reactions were performed in 96 well polypropylene microtiter plates (Robbins Scientific) with an initial 94°C, 3 min. denaturation followed by 35 cycles of 30 sec. at 94°C, 30 sec. at the annealing temp., and 30 sec.
• Dye label, annealing temperature, and final magnesium concentration were specific to the individual marker.
• Dye label intensity and quantity of PCR product (as assessed on agarose gels) were used to determine the amount to be pooled for each marker locus. The pooled products were precipitated and the product pellets mixed with 0.4 ⁇ l Genescan 500 Tamra size standard, 2 ⁇ l formamide, and 1 ⁇ l ABI loading dye. Plates of PCR product pools were heated to 80°C for 5 minutes and immediately placed on ice prior to gel loading.
• Amplitaq Gold (Perkin Elmer Cetus) and buffer D (2.5 mM MgCI 2 , 33.5 mM Tris-HCl pH 8.0, 8.3 mM (NH 4 ) 2 SO 4 , 25 mM KCI, 85 ⁇ g/ml BSA) were used in the PCR.
• a 'touchdown' amplification profile was employed in which the annealing temperature began at 66°C and decreased one degree per cycle to a final 20 cycles at 56°C. Products were run on 4.25% polyacrylamide gels using ABI 377 instruments. The data was processed with Genescan 2.1 and Genotyper 1.1 software.
• a genome scan was performed in the population of Tristan da Cunha using 274 polymorphic microsatellite markers chosen from among those developed at Oxford (Reed et al. (1994) Nature Genetics 7:390), Genethon (Dib et al. (1996) Nature 380:152) and the Cooperative Human Linkage Center (CHLC, Murray et al. (1994) Science 265:2049). Markers with heterozygosity values of 0.75 or greater were selected to cover all the human chromosomes, as well as for ease of genotyping and size of PCR product for multiplexing of markers on gels. Fifteen multiplexed sets were used to provide a ladder of PCR products in each of three dyes when separated by size. Published distances were used initially to estimate map resolution. More accurate genetic distances were calculated using the study population as the data was generated. The 274 markers gave an average 14 cM interval for the genome scan.
• a 50 ml culture of each YAC was grown in 2 x AHC at 30°C.
• the cells were pelleted by centrifugation and washed twice in sterile water. After resuspension of the cells in 4 ml of SCEM (1 M sorbitol, 0.1 M sodium citrate (pH 5.8), 10 mM
• Plugs were rinsed 3 times in TE (10 mM Tris pH 8.0, 1 mM EDTA) and incubated twice for 12 hours each at 50°C in lysis solution (0.5 M EDTA, pH 8.0;
• CHEF Mapper (BIO-RAD) and according to methods supplied by the manufacturer, then transferred to nitrocellulose. YACs which comigrated with yeast chromosomes were visualized by hybridization of the blot with radiolabelled YAC vector sequences (Scherer and Tsui (1991) supra.)
• Size-purified YAC DNA was prepared by pulsed field gel electrophoresis on a low melting temperature Seaplaque GTG agarose (FMC) gel, purified by GeneClean (BIO101) and radiolabeled for 30 mins with 32 P-dCTP using the Prime-It II kit (Sfratagene). 50 ⁇ l of water was added and unincorporated nucleotide was removed by Quick Spin Column (Boehringer Mannheim). 23 ⁇ l of 11.2 mg/ml human placental DNA (Sigma) and 36 ⁇ l of 0.5 M Na 2 HPO 4 , pH 6.0 were added to the approximately 150 ⁇ l of eluant.
• FMC Seaplaque GTG agarose
• the probe was boiled for 5 mins and incubated at 65°C for exactly 3 hours, then added to the prehybridized gridded BAC (Shizuya et al. (1992) Proc. Natl. Acad. Sci. 89:8794; purchased from Research Genetics) or chromosome 11 cosmid [Resource Center/ Primary Database of the German Human Genome Project, Berlin; Lehrach et al. (1990), In Davies, K.E. and Tilghman, S.M. (eds.). Genome Analysis Volume 1 : Genetic and Physical Mapping. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp.
• FISH Metaphase fluorescence in situ hybridization
• DIRVISH direct visual in situ hybridisation
• Metaphase FISH was carried out by standard methods (Heng and Tsui (1994) FISH detection on DAPI banded chromosomes. In Methods of Molecular Biolo ⁇ v: In Situ Hybridisation Protocols (K.H.A. Choo, ed.) pp. 35-49. Human Press, Clifton, N.J.). High resolution FISH, or DIRVISH, was used to map the relative positions of two or more clones on genomic DNA. The protocol used was as described by Parra and Windle (1993) Nature Genet. 5:17. Briefly, slides containing stretched DNA were prepared by adding 2 ⁇ l of a suspension of normal human lymphoblast cells at one end of a glass slide and allowing to dry. 8 ⁇ l lysis buffer (0.5% SDS, 50 mM EDTA, 200 mM Tris-HCL, pH 7.4) was added and the
• Probes were labeled either with biotin or with digoxygenin by standard nick translation (Rigby et al. (1977) J. Mol. Biol. 113:237). Hybridization and detections were carried out using standard fluorescence in situ hybridization techniques (Heng and Tsui (1994) supra.). Results were visualised using a Mikrophot SA microscope (Nikon) equipped with a CCD camera (Photometries). Images were recorded using Smartcapture software (Vysis).
• Clones flanking gaps in the map were end cloned by digestion with enzymes that do not cut the respective vector sequences (Nsil for BAC clones and Xbal for PAC clones), followed by religation and transformation into competent DH5 ⁇ . Clones which produced two end fragments and plasmid vector upon digestion with Notl and Nsil or Xbal were sequenced. Gaps in the tiling path were filled by screening a gridded BAC library with the end clone probes or by screening DNA pools of a human genomic PAC library (loannou et al. (1994) Nature Genetics 6:84; licensed from Health Research, Inc.) by PCR using primers designed from end clone sequences.
• BioNick Labeling System Gibco BRL
• Unincorporated biotin was removed by spin column chromatography.
• Approximately 100 ng of biotinylated genomic DNA was denatured and allowed to hybridize to 1 ⁇ g of blocked cDNA in a total volume of 20 ⁇ l in 120 mM NaPO 4 for 60 hours at 60°C under mineral oil. After hybridization, the biotinylated DNA was captured on streptavidin-coated magnetic beads (Dynal) in 100 ⁇ l of binding buffer (1 M NaCl, 10 mM Tris, pH 7.4, 1 mM EDTA) for 20 minutes at room temperature with constant rotation.
• PCR was performed on 1 , 2, 5, and 10 ⁇ l of eluate with Mbolb primers. Amplified products were analyzed on a 1.4% agarose gel. The reaction with the cleanest bands and least background was scaled up to produce approximately 1 ⁇ g of primary selected cDNA. This amplified primary selected cDNA was blocked with 1 ⁇ g of COT1 at 60°C for 1 hour followed by a second round of hybridization to 100 ng of the appropriate genomic DNA under the same conditions as the first round of selection. Washing of the bound cDNA, elution, and PCR of the selected cDNA was identical to the first round. 1 ⁇ l of PCR amplified secondary selected cDNA was cloned using the TA cloning system according to the
• ElectroMax HB101 cells (Gibco BRL) and plated on 20 cm diameter LB ampicillin plates.
• DNA was prepared from plates with > 2000 colonies by collection of the bacteria in LB ampicillin liquid and plasmid DNA purification by a standard alkaline lysis protocol (Sambrook et al. (1989) supra.) 5 ⁇ g of DNA from each plasmid pool preparation were electroporated into Cos 7 cells (ATCC) and RNA harvested using TRIZOL (Gibco BRL) after 48 hours of growth.
• RT-PCR products were digested with BstXI prior to a second PCR amplification. Products were cloned into pAMP10 (Gibco BRL) and transformed into DH5 cells (Gibco BRL). 96 colonies per BAC were picked and analyzed for insert size by PCR.
• Phage cDNA libraries were plated and screened with radiolabeled probes (exon trapping or cDNA selection products amplified by PCR from plasmids containing these sequences) by standard methods (Sambrook et al. (1989) supra.)
• RACE libraries were constructed using polyA+ RNA and the Marathon cDNA amplification kit (Clontech). Nested RACE primer sets were designed for each cDNA or potential gene fragment (trapped exon, predicted exon, conserved fragment, etc). The RACE libraries were tested by PCR using one primer pair for each potential gene fragment; the two strongly positive libraries were chosen for RACE experiments.
• Genomic sequencing DNA from cosmid, PAC, and BAC clones was prepared using Qiagen DNA prep kits and further purified by CsCI gradient. DNA was sonicated and DNA fragments were repaired using nuclease BAL-31 and T4 DNA polymerase. DNA fragments of 0.8-2.2 kb were size-fractionated by agarose gel electrophoresis and ligated into pUC9 vector. Inserts of the plasmid clones were amplified by PCR and sequenced using standard ABI dye-primer chemistry.
• ABI sample file data was reanalyzed using Phred (Phil Green, University of Washington) for base calling and quality analysis. Sequence assembly of reanalyzed sequence data was accomplished using Phrap (Phil Green, University of Washington). Physical gaps between assembled contigs and unjoined but overlapping contigs were identified by inspection of the assembled data using GFP (licensed from Baylor College of Medicine) and Consed (Phil Green, University of Washington). Material for sequence data generation across gaps was obtained by PCR amplification. Low coverage regions were resequenced using dye-primer and dye-terminator chemistries (ABI). Final base-perfect editing (to > 99% accuracy) was accomplished using Consed.
• PCR primers flanking each exon of the ASTH1 I and ASTH1J genes, or more than one primer pair for large exons, were designed from genomic sequence generated using Primer (publicly available from the Whitehead Institute for Biomedical Research) or Oligo 4.0 (licensed from National Biosciences).
• Radioactive SSCP was performed by the method of Orita et al. (1989, Proc. Natl. Acad. Sci. 86:2766). Briefly, radioactively labeled PCR products between 150 and 300 bp and spanning exons of the ASTH1 I and ASTH1 J genes were generated from a set of asthma patient and control genomic template DNAs, by incorporating ⁇ - 32 P dCTP in the PCR. PCR reactions (20 ⁇ l) included 1x reaction buffer, 100 ⁇ M dNTPs, 1 ⁇ M each forward and reverse primer, and 1 unit Taq DNA polymerase (Perkin-Elmer) and 1 ⁇ Ci ⁇ - 32 P dCTP.
• Inserts of the plasmid clones were amplified by PCR and sequenced using standard ABI dye-primer chemistry to determine the nature of the sequence variant responsible for the conformational changes detected by SSCP.
• Fluorescent SSCP was carried out according to the recommended ABI protocol (ABI User Bulletin entitled 'Multi Color Fluorescent SSCP').
• Unlabeled PCR primers were used to amplify genomic DNA segments containing different exons of the ASTH11 or ASTH1 J genes, in patient or control DNA.
• Nested fluorescently labeled (TET, FAM or HEX) primers were then used to amplify smaller products, 150 to 300 bp containing the exon or region of interest. Amplification was done using a " touchdown' PCR protocol, in which the annealing temperature
• Unlabeled PCR primers were used to amplify genomic DNA segments containing different exons of the ASTH1 I or ASTH1J genes, from patient or control DNAs. A set of nested PCR primers was then used to reamplify the fragment. Unincorporated primers were removed from the PCR product by Centricon-100 column (Amicon), or by Centricon-30 column for products less than 130 bp. The nested primers and dye terminator sequencing chemistry (ABI PRISM dye terminator cycle sequencing ready reaction kit) were then used to cycle sequence the exon and flanking region. Volumes were scaled down to 5 ⁇ l and 10% DMSO added to increase peak height uniformity. Sequences were compared between samples and heterozygous positions detected by visual inspection of chromatograms and using Sequence Navigator (licensed from ABI).
• PCR products were also compared by subcloning and sequencing, and comparison of sequences for ten or more clones.
• a genome scan was performed using polymorphic microsatellite markers from throughout the human genome, and DNA isolated from blood samples drawn from the inhabitants of Tristan da Cunha.
• Linkage analysis an established statistical method used to map the locations of genes and markers relative to other markers, was applied to verify the marker orders and relative distances between
• Cunha population was confirmed by genotyping and analyzing data from several markers near D11S907, spaced at intervals no greater than 5 cM across a possible linked region of about 30 cM. Sib-pair and affected pedigree member linkage analyses of these markers yielded confirmatory evidence for linkage and refined the genetic interval.
• Yeast artificial chromosome (YAC) clones were derived from the CEPH megaYAC library (Cohen et al. 1993 Nature 366:698). Individual YAC addresses were obtained from a public physical map of CEPH megaYAC STS (sequence tagged site; Olson et al. (1989) Science 245:1434) mapping data maintained by the Whitehead Institute and accessible through the world wide web (Cohen et al. 1993. supra.; http://www-genome.wi.mit.edu/cgi-bin/contig/phys_map).
• YAC clones spanning or overlapping other YACs containing D11S907 were chosen for map construction; STSs mapping to these YACs were used for map and clone verification. Some YACs annotated in the public database as being chimeric were excluded from the analyses. Multiple colonies of each YAC, obtained from a freshly
• the YAC map at ASTH1 provided continuous coverage of a 4 Mb region, the central 1 Mb of which was of greatest interest.
• YAC clones comprising a minimal tiling path of this region were chosen, and the size purified artificial chromosomes were used as hybridization probes to identify BAC and cosmid clones.
• Gridded filters of a 3x human genomic BAC library and of a human chromosome 11 -specific cosmid library were hybridized with radiolabeled purified YAC. Clones corresponding to the grid coordinates of the positives were streaked to colony
• a minimal tiling path of BAC and cosmid clones was chosen for genomic sequencing. Over 1 Mb of genomic sequence was generated at ASTHL On average, sequencing was done to 12x coverage (12 times redundancy in sequences). Marker order was verified relative to the STS map.
• BLAST searches Altschul et al. (1990) supra.) were performed to identify sequences in public databases that were related to those in the ASTH1 region. Sequence-based gene prediction was done with the GRAIL [Roberts (1991) Science 254:805] and Geneparser [Snyder and Stormo (1993) Nucleic Acids Res. 21 : 607] programs. Genomic sequence and feature data was stored in ACeBD.
• -47- a pool of trinucleotide and tetranucleotide repeat oligonucleotides.
• the plasmid inserts were sequenced, the set of sequences compared with those of the known microsatellite markers in the region, using Power assembler (ABI) or Sequencher (Alsbyte). Primer pairs flanking each novel microsatellite repeat were designed, and the heterozygosity of each new marker was tested by Batched Analysis of Genotypes (BAGs; LeDuc et al., 1995. PCR Methods and Applications 4:331). Additional microsatellites were found by analysis of the genomic sequence in AceDB. Table 1 lists all the microsatellite markers used for genotyping in the ASTH1 region and their repeat type, source and primers. Table 1 B lists some repeat sequences.
• 253E6TR1 AGGTTTAGGGGACAGGGTTTGG 1 17711.. GTTTCTTTCCTGGCTAACACGGTGAAATC
• AFM205YG5 (G) TATCAAGGTAATATAGTAGCCACGG
• AFM206XB2 (G) ATTGCCAAAACTTGGAAGC
• CA39_2 GAGACTCTGA CA
• CA GAGACTCTGA
• the microsatellite markers isolated from YACs from the ASTH1 region were genotyped in both the Tristan da Cunha and Toronto cohorts. Genetic refinement of the ASTH1 region was accomplished by applying the transmission/disequilibrium test (TDT; Spielman et al. (1993) Am. J. Hum. Genet. 52:506) to genetic data from the Tristan and Toronto populations, at markers throughout the ASTH1 region.
• TDT transmission/disequilibrium test
• FIG. 1 shows graphs of ⁇ 2 values for key ASTH1 region markers for both history of asthma with positive methacholine challenge, for the Toronto triad families, ⁇ 2 is plotted vs. genomic location of the marker on the physical map.
• the relative risk of affection vs. normal for this allele is 5.25.
• the markers defining the limits of linkage disequilibrium were D11 S907 and 65P14TE1.
• the physical size of the refined region is approximately 100 kb.
• a significant TDT test reflects the tendency of alleles of markers located near a disease locus (also said to be in "linkage disequilibrium" with the disease) to segregate with the disease locus, while alleles of markers located further from the disease locus segregate independently of affection status.
• An expectation that derives from this is that a population for which a disease gene (ie a disease predisposing polymorphism) was recently introduced would show statistically significant TDT over a larger region surrounding the gene than would a population in which the mutant gene had been segregating for a greater length of time. In the latter case, time would have allowed more opportunity for markers in the vicinity of the disease gene to recombine with it. This expectation is fulfilled in our populations.
• the Tristan da Cunha population founded only 10 generations ago, shows a broader TDT curve than does the set of Toronto families, which are mixed European in derivation and thus represent an older and more diverse, less recently established population.
• the tiling path of BACs, cosmids and PAC clones was subjected to exon trapping and cDNA selection to isolate sequences derived from ASTH1 region genes.
• Exon trap clones were isolated on the basis of size and ability to cross- hybridize. Approximately 300 putatively non-identical clones were sequenced.
• cDNA selection was performed with adult and fetal lung RNA using pools of tiling path clones. The cDNA selection clones were sequenced and the sequences assembled with those of the exon trap clones. Representative exon trapping clones spanning each assembly were chosen, and arranged as "masterplates" (96- well microtitre dishes) of clones. Exon trap masterplate clones and cDNA selection clones were subjected to expression studies.
• RNA species Human multi-tissue Northern blots were probed with PCR products of masterplate clones. In some cases, exon trapping clones did not detect RNA species, either because they did not represent expressed sequences, or represented genes with very restricted patterns of expression, or due to small size of the exon probe.
• ASTH1 I and ASTH1J were detected by exon trapping.
• ASTH1 I exons detected a 2.8 kb mRNA expressed at high levels in trachea and prostate, and at lower levels in lung and kidney.
• ASTH1 I exons were used as probes to screen prostate, lung and testis cDNA libraries; positive clones were obtained from each of these libraries. Isolation of a ASTH11 cDNA clone from testis demonstrates that this gene is expressed in this tissue, and possibly others, at a level not detectable by Northern blot analysis.
• ASTH1 J exons detected a 6.0 kb mRNA expressed at high levels in the trachea, prostate and pancreas and at lower levels in colon, small intestine, lung and stomach. Pancreas and prostate libraries were screened with exon clones
• ASTH1 J has three splice forms consisting of the altl form, found in prostate and lung cDNA clones, and in which the exons (illustrated in Figure 1) are found in the order: 5' a, b, c, d, e, f, g, h, i 3'.
• a second form, alt2, in which the exon order is: 5' a2, b, c, d, e, f, g, h, i 3' was seen in a pancreas cDNA clone.
• a third form, alt3, contains an alternate exon, a3, between exons a2 and b.
• the start codon is within exon b, so that the open reading frame is identical for the three forms, which differ only in the 5' UTR.
• the ASTH1J cDNAs shown as SEQ ID NO:2 (form altl); SEQ ID NO:3 (form alt2); SEQ ID NO:4 (form alt3) are 5427, 5510 and 5667 bp in length, respectively.
• the sequence of the entire protein coding region and alternate 5' UTRs are provided.
• the 3' terminus, where the polyA tail is added, varies by 7 bp between clones.
• the provided sequences are the longest of these variants.
• the encoded protein product is provided as SEQ ID NO:5.
• ASTH1 I was seen in three isoforms denoted as altl , alt2, and alt3.
• the exons of ASTH1 I and ASTH1J were given letter designations before the directionality of the cDNA was known, the order is different for the two genes.
• exons are in the following order: 5' i, f, e, d, c, b, a 3'.
• an alternative 5' exon, j substitutes for exon i, with the following exon arrangement: 5' j, f, e, d, c, b, a 3'.
• the alt3 form of the gene has the exon order: 5' f, k, h, g, e, d, c, b, a 3'.
• the alternative splicing and start codons in each of exons i, f and e give the three forms of ASTH11 protein different amino termini.
• the common stop codon is located in exon a, which also contains a long 3' UTR.
• Two polyadenylation signals are present in the 3' UTR; some cDNA clones end with a polyA tract just after the first polyA signal and for others the polyA tract is at the end of the sequence shown. Since the sequences shown for the altl ,
• nucleotide sequences of the altl , alt2 and alt3 forms of ASTH1J and the altl , alt2 and alt3 forms of ASTH1 I were used in BLAST searches against dbEST in order to identify EST sequences representing these genes. Perfect or near perfect matches were taken to represent sequence identity rather than relatedness. Accession numbers T65960, T64537, AA055924 and AA055327 represent the forward and reverse sequences of two clones which together span the last 546 bp (excluding the polyA tail) of the 3' UTR of ASTH1 I. No ESTs spanned any part of the coding region of this gene.
• One colon cDNA clone (accession number AA149006) spanned 402 bp including the last 21 bp of the ASTH1 J coding region and part of the 3' UTR.
• the genomic organization of genes in the ASTH1 region was determined by comparison by BLAST of cDNA sequences to the genomic sequence of the region.
• the genomic sequence of the ASHT1 region 5' to and overlapping ASTH1 J, is provided in SEQ ID NO:1.
• Genomic structure of the ASTH1 I and ASTH1J genes is shown in Figure 1; the intron/exon junction sequences are in Table 2.
• the protein encoded by ASTH1J (SEQ ID NO:5) is 300 amino acids in length.
• a BLASTP search of the protein sequence against the public nonredundant sequence database (NCBI) revealed similarity to one protein domain of transcription factors of the ets family.
• the ets family named for the E26 oncoprotein which originally defined this type of transcription factor, is a group of transcription factors which activate genes involved in a variety of immunological and other processes, or implicated in cancer.
• the family members most similar to ASTH11 and ASTH1 J are: ETS1 , ESX, ETS2, ELF, ELK1 , TEL, NET, SAP-1 , NERF and FLI.
• ASTH1 I and ASTH1J are predicted to contain two conserved modules, the N- terminal protein interaction domain (SAM-domain) and the C-terminal DNA-binding domain (ETS-domain).
• SAM-domain N- terminal protein interaction domain
• ETS-domain C-terminal DNA-binding domain
• the ASTH1 I altl (SEQ ID NO:7), alt2 (SEQ ID NO:9) and alt3 (SEQ ID NO:11) forms are 265, 255 and 164 amino acids in length, respectively, and differ at their 5' ends.
• the ASTH1 I and ASTH1J proteins show similarity to each other in the ets domain and between ASTH1J exon c and ASTH1 I exon e. They are more related to each other than to other proteins. Over the ets domain they are 66% similar (ie. have amino acids with similar properties in the same positions) and 46% identical to each other. All three forms of ASTH11 have the helix turn helix motif located near the carboxy terminal end of the protein.
• the alternate forms of the ASTH1 I protein may differ in function in critical ways.
• the activity of ets transcription factors can be affected by the presence of independently folding protein structural motifs which interact with the ets protein binding domain (helix loop helix).
• the differing 5' ends of the ASTH1 I proteins may help modulate activity of the proteins in a tissue-specific manner.
• Affected and unaffected individuals from the Toronto cohort were used to determine sequence variants, as were approximately 25 controls derived from populations not selected for asthma.
• Affected and unaffected individuals from the Tristan da Cunha population were also chosen; the set to be assayed was also selected to represent all the major haplotypes for the ASTH1 region in that
• Polymorphism analysis was accomplished by three techniques: comparative (heterozygote detection) sequencing, radioactive SSCP and fluorescent SSCP. Polymorphisms found by SSCP were sequenced to determine the exact sequence change involved.
• PCR and sequencing primers were designed from genomic sequence flanking each exon of the coding region and 5' UTRs of ASTH1 I and ASTH1J.
• the forward and reverse PCR primers were labeled with different dyes to allow visualization of both strands of the PCR product.
• a variant seen in one strand of the product was also apparent in the other strand.
• heterozygotes were also detected in sequences from both DNA strands.
• Polymorphisms associated with the ASTH11 locus are listed in Table 3. The sequence flanking each variant is shown. Polymorphisms were also deduced from comparison of sequences from multiple independent cDNA clones spanning the same region of the transcripts, and comparison with genomic DNA sequence. The polymorphisms in the long 3' UTR regions of these genes were found by this method. One polymorphism in each gene is associated with an amino acid change in the protein sequence. An alanine/valine difference in exon c of ASTH1 J is a conservative amino acid change. A serine/cysteine variant in exon g of ASTH1 I is not a conservative change, but would be found only in the alt3 form of the protein.
• the polymorphisms in the ASTH1 I and J transcribed regions were genotyped in the whole Tristan da Cunha and Toronto populations, as well as in a larger sample of non-asthma selected controls, by high throughput methods such as OLA (oligonucleotide ligation assay; Tobe et al. (1996) Nucl. Acids Res. 24:3728) or Taqman (Holland et al. (1992) Clin. Chem. 38: 462), or by PCR and restriction enzyme digestion.
• OLA oligonucleotide ligation assay
• Taqman Holland et al. (1992) Clin. Chem. 38: 462
• the population-wide data were used in a statistical analysis for significant differences in the frequencies of ASTH1 I or ASTH1J alleles between asthmatics and non-asthmatics.
• WIJ __Ia 05 +1103 AGACCCGATARGAGCTCCTTC 1 14499..
• WIJ __Ia 06 +794 AAAAGTGGATMCTCTGCAAAC 1 15544.
• WIJ__Ia 06 1535 AAAGGGTTAGYTTGTCCCCTT 1 15599.
• Cross-species sequence conservation can reveal the presence of functionally important areas of sequence within a larger region. Approximately 90 kb of sequence lie between ASTH1 I and ASTH1 J, which are transcribed in opposite directions ( Figure 1). The transcriptional orientation of these genes may allow coordinate regulation of their expression. The expression patterns of these genes are similar but not identical. Sequences found 5' to genes are critical for expression. To search for regulatory or other important regions, the genomic sequence between ASTH1 I and ASTH1J, was examined and plasmid clones derived from genomic sequencing experiments chosen for cross-species hybridization experiments. The criterion for probe choice was a lack of repeat elements such as Alu or LINEs. Inserts from these clones were used as probes on Southern blots of EcoRI-digested human, mouse and pig or cow genomic DNA. Probes that produced discrete bands in more than one species were considered conserved.
• conserved probes clustered in four locations. One region was located 5' to ASTH11 and spanned exon j of this gene. A second conserved region was located 5' to ASTH1 IJ, spanning approximately 10 kb and beginning 6 kb 5' to ASTH1J exon a (and is within SEQ ID NO:1). Two other clusters of conserved probes were noted in the region between ASTH1 I and J. They are approximately 10 and 6 kb in length. Promoters, enhancers and other important control regions are generally found near the 5' ends of genes or within introns.
• Methods of identifying and characterizing such regions include: luciferase assays, chloramphenicol acetyl transferase (CAT) assays, gel shift assays, DNAsel protection assays (footprinting), methylation interference assays, DNAsel hypersensitivity assays to detect functionally relevant chromatin-ree regions, other types of chemical protection assays, transgenic mice with putative promoter regions linked to a reporter gene such as ⁇ -galactosidase, etc.
• CAT chloramphenicol acetyl transferase
• gel shift assays gel shift assays
• DNAsel protection assays footprinting
• methylation interference assays DNAsel hypersensitivity assays to detect functionally relevant chromatin-ree regions
• transgenic mice with putative promoter regions linked to a reporter gene such as ⁇ -galactosidase, etc.
• the ASTH1 locus is associated with asthma and bronchial hyperreactivity.
• ASTH1 I and ASTH1J are transcription factors expressed in trachea, lung and several other tissues. The main site of their effect upon asthma may therefore be in trachea and lung tissues. Since ets family genes are transcription factors, a function for ASTH1 I and ASTH1J is activation of transcription of particular sets of genes within cells of the trachea and lung. Cytokines are extracellular signalling proteins important in inflammation, a common feature of asthma. Several ets family transcription factors activate expression of cytokines or cytokine receptors in response to their own activation by upstream signals. ELF, for example, activates IL-2, IL-3, IL-2 receptor ⁇ and GM-CSF, factors involved in signaling between cell types important in asthma. NET activates transcription of the IL-1 receptor antagonist gene. ETS1 activates the T cell receptor ⁇ gene, which has been linked to atopic asthma in some families (Moffatt et al. (1994) supra.)
• Cytokines are produced by structural cells within the airway, including epithelial cells, endothelial cells and fibroblasts, bringing about recruitment of inflammatory cells into the airway.
• a model for the role of ASTH11 and ASTH1 J in asthma that is consistent with the phenotype linked to ASTH1 , the expression pattern of these genes, the nature of the ASTH1 l/J genes, and the known function of similar genes is that aberrant function of ASTH1 I and/or ASTH1J in trachea or lung leads to altered expression of factors involved in the inflammatory process, leading to chronic inflammation and asthma.
• Primer extension analyses performed using total RNA isolated from both bronchial and prostate epithelial cells have revealed one major and five minor transcription start sites for ASTH1 J.
• the major site accounts for more than 90% of ASTH1 J gene transcriptional initiation. None of these sites are found when the primer extension analysis is performed using mRNA isolated from human lung fibroblasts that do not express ASTH1 J.
• TATAAAAA putative TATA box
• TATAAAA consensus sequence for TATA box protein binding as compared with 389 TATA elements
• the nuclear factor-1 (NF-1) family of transcription factors comprises a large group of eukaryotic DNA binding proteins. Diversity within this gene family is contributed by multiple genes (including: NF-1 A, NF-1 B, NF-1C and NF-1X), differential splicing and heterodimerization.
• C/EBP Transcription factor C/EBP (CCAAT-enhancer binding protein) is a heat stable, sequence-specific DNA binding protein first purified from rat liver nuclei.
• C/EBP binds DNA through a bipartite structural motif and appears to function exclusively in terminally differentiated, growth arrested cells.
• C/EBP ⁇ was originally described as NF-IL-6; it is induced by IL-6 in liver, where it is the major C/EBP binding component.
• CRP 1 , C/EBP ⁇ and C/EBP ⁇ Three more recently described members of this gene family, designated CRP 1 , C/EBP ⁇ and C/EBP ⁇ , exhibit similar DNA binding specificities and affinities to C/EBP ⁇ .
• C/EBP ⁇ and C/EBP ⁇ readily form heterodimers with each other as well as with C/EBP ⁇ .
• DNA array is made by spotting DNA fragments onto glass microscope slides which are pretreated with poly-L-lysine. Spotting onto the array is accomplished by a robotic arrayer. The DNA is cross-linked to the glass by ultraviolet irradiation, and the free poly-L-lysine groups are blocked by treatment with 0.05% succinic anhydride, 50% 1-methyl-2-pyrrolidinone and 50% borate buffer.
• the spots on the array are oligonucleotides synthesized on an ABI automated synthesizer. Each spot is one of the alternative polymorphic sequences indicated in Tables 3 to 8. For each pair of polymorphisms, both forms are included. Subsets include (1) the ASTH1J polymorphisms of Table 3, (2) the
• Genomic DNA from patient samples is isolated, amplified and subsequently labeled with fluorescent nucleotides as follows: isolated DNA is added to a standard PCR reaction containing primers (100 pmoles each), 250uM nucleotides, and 5 Units of Taq polymerase (Perkin Elmer). In addition, fluorescent nucleotides (Cy3-dUTP (green fluorescence) or Cy5-dUTP (red fluorescence), sold by Amersham) are added to a final concentration of 60 uM. The reaction is carried out in a Perkin Elmer thermocycler (PE9600) for 30 cycles using the following cycle profile: 92°C for 30 seconds, 58°C for 30 seconds, and 72°C for 2 minutes. Unincorporated fluorescent nucleotides are removed by size exclusion chromatography (Microcon-30 concentration devices, sold by Amicon).
• the sample is reduced to 5 ⁇ l and supplemented with 1.4 ⁇ l 20X SSC and 5 ⁇ g yeast tRNA. Particles are removed from this mixture by filtration through a pre-wetted 0.45 ⁇ microspin filter (Ultrafree-MC, Millipore, Bedford, Ma.). SDS is added to a 0.28% final concentration.
• the fluorescently-labeled cDNA mixture is then heated to 98°C for 2 min., quickly cooled and applied to the DNA array on a microscope slide. Hybridization proceeds under a coverslip, and the slide assembly is kept in a humidified chamber at 65°C for 15 hours.
• the slide is washed briefly in 1X SSC and 0.03% SDS, followed by a wash in 0.06% SSC.
• the slide is kept in a humidified chamber until fluorescence scanning was done.
• Fluorescence scanning and data acquisition Fluorescence scanning is set for 20 microns/pixel and two readings are taken per pixel. Data for channel 1 is set to collect fluorescence from Cy3 with excitation at 520 nm and emission at 550- 600 nm. Channel 2 collects signals excited at 647 nm and emitted at 660-705 nm, appropriate for Cy5. No neutral density filters are applied to the signal from either channel, and the photomultiplier tube gain is set to 5. Fine adjustments are then
• Phage MW1-J was isolated by screening a mouse 129Sv genomic phage library (Stratagene) with the 443bp BamHI-Smal fragment from the 5' region of the human asth1-J cDNA clone PA1001A as probe. The 23kb insert in MW1-J was sequenced.
• a 2.65kb Sad fragment (bp7115-bp9765) from MW1-J was isolated, cloned into the Sacl site of pUC19, isolated from the resultant plasmid as an EcoRI-Xbal fragment, inserted into the EcoRI-Xbal sites of pBluescriptll KS+ (Stratagene), and the 2.5kb Xhol-Mlul fragment isolated.
• a 5.4kb Hindlll fragment (bp11515-bp16909) was isolated from MW1-J, inserted into the Hindlll site of pBluescriptll KS+, reisolated as a Xhol-Notl fragment, inserted into the Xhol-Notl sites of pPNT, and the 9.5kb Xhol-Mlul fragment isolated.
• the two Xhol-Mlul fragments were ligated together to produce the final targeting construct plasmid, asthlexb.
• Asthlexb was linearized by digestion with Notl and purified by CsCI banding.
• RW4 ES cells Approximately 10 million RW4 ES cells (Genome Systems) were electroporated with 20 ⁇ g of linearized asthlexb and grown on mitomycin C inactivated MEFs (Mouse Embryo Fibroblasts) in ES cell medium (DMEM + 15% fetal bovine serum+1000U/ml LIF (Life Technologies)) and 400 ⁇ g/ml G418. After 24-48hrs, the cells were refed with ES cell medium. After 7-10 days in selection culture approximately 200 colonies were picked, trypsinized, grown in 96 well microtiter plates, and expanded in duplicate 24 well microtiter plates.
• mice heterozygous for the Asthl-J targeted allele are interbred to obtain mice homozygous for the asth1-J targeted allele. Homozygotes are identified by Ndel Southern blot screening described above. The germline offspring of the chimeric founders are 50% A/J or C57BL6 and 50% 129SvJ in genetic background. Subsequent generations of backcrossing with wild type A/J or C57BL/6 mates will result in halving of the 129SvJ contribution to the background. The percentage A/J or C57BL/6 background is calculated for each homozygous mouse from its breeding history.
• RNA and protein Various tissues of homozygotes, heterozygotes and wild type littermates at various stages of development from embryonic stages to mature adults are isolated and processed to obtain RNA and protein. Northern and western expression analyses as well as in situ hybridizations and immunohistochemical analyses are
• C57BL/6 backgrounds at varying stages of development are assessed for gross pathology and overt behavioral phenotypic differences such as weight, breeding performance, alertness and activity level, etc.
• a 3.4kb Hindlll fragment (bp17217-bp20622) was isolated from MW1-J, inserted into the Hindlll site of pBluescriptll KS+, reisolated as a Xhol-Notl fragment, inserted into the Xhol-Notl sites of pPNT, and the 9.5kb Rsrll-Mlul fragment isolated.
• the two Rsrll-Mlul fragments were ligated together to produce the final targeting construct plasmid, Asthlexc. Asthlexc was linearized by digestion with Notl and purified by CsCI banding.
• RW4 ES cells Approximately 10 million RW4 ES cells (Genome Systems) were electroporated with 20 ⁇ g of linearized asthlexc and grown on mitomycin C inactivated MEFs (Mouse Embryo Fibroblasts) in ES cell medium (DMEM + 15% fetal bovine serum+1000U/ml LIF (Life Technologies)) and 400 ⁇ g/ml G418. After 24-48hrs, the cells were refed with ES cell medium. After 7-10 days in selection culture approximately 200 colonies were picked, trypsinized, grown in 96 well
• Targeted clones are injected into blastocysts and high percentage chimeras bred to A/J and C57BL/6 mates analogously to that done for asthl-Jexb knockout mice.
• Heterozygote, homozygote and wild type littermates are obtained and analyzed analogously to that done for asthl-Jexb knockout mice.
• ASTH11 and ASTH1 J are novel human genes linked to a history of clinical asthma and bronchial hyperreactivity in two asthma cohorts, the population of Tristan da Cunha and a set of Canadian asthma families.
• a TDT curve in the ASTH1 region indicates that ASTH1 I and ASTH1 J are located in the region most highly associated with disease.
• the genes have been characterized and their genetic structure determined. Full length cDNA sequence for three isoforms of ASTH11 and three isoforms of ASTH1 J are reported.
• the genes are novel members of the ets family of transcription factors, which have been implicated in the activation of a variety of genes including the TCR ⁇ gene and cytokine genes known to be important in the aetiology of asthma.
• Polymorphisms in the ASTH1 I and ASTH1J genes are described. These polymorphisms are useful in the presymptomatic diagnosis of asthma susceptibility, and in the confirmation of diagnosis of asthma and of asthma subtypes.
• MOLECULE TYPE Genomic DNA
• SEQUENCE DESCRIPTION SEQ ID NO : 1 : GCACTTTTTG GGGAAGGTGG AAGAATAAAA GTAAGGGAGG TGTGCTGAGA CTTCAATTTT 60
• ATGTCTACTT TCAAGGTGCT CACAGGTCAG ATCTAGGATT ATTGCTACTA ACTGATATTT 540
• TTCATTCATT CAAGATGGAA TTAGTGCCCC AGACACAGAG GCAGGGGATA AATAGCAAAC 2700
• CAGAGTGGAT CTGGACATTC TGCATGAGCC CAGGGATCCT GAGAATGGAT TGGCTGAGCA 3360
• CTGAGTCTAA CTGGAAGCCA GAGGGCAAAG GAGGTACCCT TTCCAGCTCT GCAATTCTCT 3840
• CTCCTCTCAC CATCTGGTGG TCCCCGTGCC CACGCACCAG CTCGTTGGAT GGACATTTTG 7260
• AAAAAAAAAA AGAACCACAG GAGGGAGAGA TCATATATGA CCCCGTATGT GTGAAAAGTC 11700
• ATCAGTTCTA TACTTAATTA TAAATACTCT TGGGAATAAA ACATACTTAT CTAATAAGCA 15240
• AAAAAGAGCA AAAGGGAAAA AAAACCCCAA GCAGATGAAA AGTAAAGAAG GCAATGGTTA 17820

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Gastroenterology & Hepatology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Zoology (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Toxicology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (1)

Publications (2)

Family

ID=22266247

Family Applications (1)

Country Status (5)

Families Citing this family (7)

Citations (1)

• 1998
  • 1998-01-21 EP EP98904649A patent/EP1049800A4/de not_active Withdrawn
  • 1998-01-21 WO PCT/US1998/001260 patent/WO1999037809A1/en not_active Application Discontinuation
  • 1998-01-21 CA CA002314677A patent/CA2314677A1/en not_active Abandoned
  • 1998-01-21 AU AU62475/98A patent/AU6247598A/en not_active Abandoned
  • 1998-01-21 JP JP2000528715A patent/JP2002500895A/ja active Pending

Patent Citations (1)

Non-Patent Citations (9)

Also Published As

Similar Documents

Legal Events