EP1042366A1

EP1042366A1 - Peptide epitopes recognised by antifilaggrin autoantibodies in serum from rheumatoid arthritis patients

Info

Publication number: EP1042366A1
Application number: EP98964536A
Authority: EP
Inventors: Guy Résidence du Lac SERRE; Elisabeth Girbal-Neuhauser; Christian Vincent; Michel Simon; Mireille Sebbag; Pascal Dalbon; Colette Jolivet-Reynaud; Michel Arnaud; Michel Jolivet
Original assignee: Biomerieux SA
Current assignee: Biomerieux SA
Priority date: 1997-12-30
Filing date: 1998-12-29
Publication date: 2000-10-11
Also published as: AU1971799A; FR2773157B1; FR2773157A1; CA2316269A1; WO1999035167A1

Abstract

The invention concerns peptides comprising epitopes recognised by antifilaggrin in serum from rheumatoid arthritis patients. Said epitopes comprising a tripeptide motif centred on a citrulline residue. The invention also concerns artificial antigens comprising said epitopes, and their use for diagnosing rheumatoid arthritis.

Description

PEPTIDE EPITOPES RECOGNIZED BY ANTIFILAGGRIN AUTOANTIBODIES PRESENT IN THE SERUM OF PATIENTS WITH RHUMATOID POLYARTHRITIS.

The present invention relates to new preparations of antigens specifically recognized by auto-antibodies specific for rheumatoid arthritis.

Rheumatoid arthritis (hereinafter abbreviated as "RA") is the most common chronic inflammatory rheumatism. It is an autoimmune disease, and the serum of affected patients contains autoantibodies, some of which are specific, and can constitute a marker of this disease, allowing its diagnosis even at early stages. Research has therefore been carried out with a view to identifying antigens recognized by these antibodies, in order to obtain purified preparations which can be used in conventional techniques of immunological diagnosis.

Autoantibodies specifically present in RA patients and reacting with a rat esophageal epithelial antigen have been described for the first time by B. J. J. YOUNG et al. in Br. Med. J. 2: 97-99, (1979). These autoantibodies were at the time called "anti-keratin antibodies". During previous work, the team of

The inventors obtained, from human and murine squamous epithelia, preparations of antigens related to filaggrin and to profilaggrin, recognized specifically by the antibodies present in the serum of patients suffering from rheumatoid arthritis, and showed that the "antibodies antikeratins "were in fact anti-filaggrin autoantibodies (hereinafter referred to as" AAF "). Application EP 0 511 116 describes these antigenic preparations, and their use for the diagnosis of rheumatoid arthritis. Filaggrins are a family of proteins which has been identified in various species, notably in humans, rats, mice, guinea pigs, in the case of squamous keratinizing epithelia [for a review on filaggrins, cf. DALE et al. [The Keratinocyte Handbook, Cambridge University Press, pp 323-350, (1994)]. They derive from the dephosphorylation and proteolysis of a precursor, profilaggrin, which consists essentially of repeating domains of filaggrin separated by peptide segments between domains.

The gene coding for profilaggrin consists of repeated subunits, each of which codes for a filaggrin molecule, separated by portions coding for the interdomain peptide segments. All the repeating units coding for each of the human filaggrins have the same length (972 base pairs in humans); however, in humans, there are significant variations (10-15%) in sequence from one subunit to another. While most are conservative, some of these variations induce changes in amino acids and in some cases changes in the electrical charge of the protein. Thus human filaggrins form, independently of post-transcriptional modifications, a heterogeneous population of molecules of similar size but of different sequences and charges (pHi equal to 8.3 ± 1.1) [GAN et al., Bioche. 29, p. 9432-9440 (1990)].

Profilaggrin is a high molecular weight protein (approximately 400,000 in humans) soluble in the presence of high concentrations of salts or urea. It has a high content of basic amino acids (arginine and histidine), as well as glycine, serine and glutamic acid. It is poor in non-polar amino acids and contains neither methionine, cysteine, nor tryptophan. It is strongly phosphorylated on Serine residues, which gives it an isoelectric point close to neutrality.

Profilaggrin is cleaved into filaggrin units during a complex maturation process, involving dephosphorylation, followed by protease cleavage in the interdomain segments. This cleavage first generates fragments of intermediate size, then the functional molecules of filaggrin. Filaggrins resulting from dephosphorylation and from cleavage of profilaggrin are basic proteins whose amino acid content is similar to that of profilaggrins. They participate in the organization of the keratin filaments, and undergo a progressive maturation during which the arginine residues, basic, are converted into citrulline residues, neutral, under the action of peptidylarginine deiminase [HARDING CR and SCOTT IR, J Mol. Biol. 170, p. 651-673 (1983)]. This leads to a reduction in their affinity for the keratins from which they are detached; they are then completely degraded under the action of various proteases.

The properties of filaggrins and profilaggrins have been particularly well studied in rats, mice and humans. The size of profilaggrin varies, depending on the species, from 300 to 400 kD and that of filaggrins from 27 to 64 kD.

The polymorphism observed in humans between the sequences of filaggrin units within the same profilaggrin gene does not appear in rats and mice. Filaggrins also exhibit great inter- and intra-specific variability in their sequence. However, this variability does not affect their functional properties, their overall amino acid composition, and their biochemical properties. Likewise, the tissue localizations of profilaggrin and filaggrins are identical in the different mammals studied.

While continuing their work, the inventors found that the profilaggrin present in the keratohyaline granules of the human epidermis was unlike filaggrins, not recognized by the AAF [SIMON et al. Clin. Exp. Immunol. 100, 90-98 (1995)]. They then tested the reactivity of AAFs with recombinant filaggrin, and found that it was not recognized either. On the other hand, it had previously been observed that the forms of human epidermal filaggrins mainly recognized by the FAA were the acid-neutral forms described by SIMON et al. [J. Clin. Invest., 92, 1387, (1993)] and in application EP 0 511 116. The fact that these acid-neutral forms correspond to a late stage in the maturation of the filaggrin, made it possible to assume that all or part of the post- translational intervening until this stage were involved in the formation of epitopes recognized by the AAF.

To verify this hypothesis, the inventors sought to reproduce in vi tro, from recombinant filaggrin, these post-translational modifications, in order to determine which were liable to influence the antigenicity of filaggrin.

They thus found that in fact, the citrullination of filaggrin was sufficient to generate epitopes recognized by the AAF. In fact, by observing the in vitro elimination of recombinant filaggrin, they observed that the replacement of at least part of the arginines by citrullines makes it possible to obtain an antigen specifically recognized by the AAF present in the serum of RA patients. They also located regions which, after citrullination, were highly immunoreactive against anti-filaggrin autoantibodies. This is especially the region corresponding to the C-terminal portion (amino acids 144 to 324) and in particular to amino acids 144 to 314, as well as the region corresponding to amino acids 76 to 144, and the region corresponding to amino acids 71 to 119 of a unit of human filaggrin. This work resulted in the obtaining of artificial antigens recognized specifically by the FAAs present in the serum of RA patients, and constituted by recombinant or synthetic polypeptides, derived from the sequence of filaggrin, or portions of that -ci, by substitution of at least one arginine residue by a citrulline residue. These antigens, as well as their use, are the subject of Application FR FR 96 10651, filed on August 30, 1996 in the name of BIOMÉRIEUX. By continuing their work, the inventors have succeeded in selecting from the sequence of a filaggrin unit, peptides in which the substitution of at least one arginine residue by a citrulline residue gives rise to epitopes recognized specifically by the AAF present in the serum of RA patients.

The sequences of these peptides are identified in the annexed sequence list under the numbers SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. The term "filaggrin unit" means a polypeptide whose sequence is that of the translation product of any of the subunits coding for a filaggrin domain of the gene for human profilaggrin or of another species, or else is a consensus sequence, theoretical sequence obtained from the sequences of the filaggrin domains.

The inventors have now identified epitopes recognized by anti-filaggrin autoantibodies: these epitopes comprise a tripeptide motif centered on a citrulline residue, specifically present on citrulline peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, and absent from the sequence SEQ ID NO: 4.

It is in particular the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue.

The present invention relates to a peptide constituting an epitope recognized by anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis, characterized in that said epitope comprises a tripeptide motif centered on a citrulline residue, specifically present on at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.

According to a preferred embodiment of the present invention, said peptide comprises at least one pentapeptide motif centered on a citrulline residue, present on at least one of the citrulline peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.

Advantageously, said peptide comprises the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue.

By way of example, mention will be made of peptides derived, by citrullination, from peptides which comprise the pentapeptide motif, Xl-Ser-Arg-His-X2 in which Xl = Ser or Gly, and X2 = Ser or Pro, and among those -this, peptides which comprise the hexapeptide motif X0-X1- Ser-Arg-His-X2, or the heptapeptide motif XO-Xl-Ser- Arg-His-X2-X3, in which XI and X2 are as defined above above, X0 = Asp, and X3 = Gly or Arg. The peptides in accordance with the invention allow the preparation of artificial antigens recognized specifically by the anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis. These artificial antigens are also part of the object of the present invention. Artificial antigens according to the invention comprise at least one peptide epitope centered on a citrulline residue, as defined above. They are for example constituted by peptides of at least 5 amino acids, preferably at least 10 amino acids, and advantageously at least 14 amino acids. They may be peptides consisting of at least one fragment of at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, or containing at least one such fragment. These peptides can comprise several citrullinated epitopes specifically recognized by AAF, of identical or different sequences.

The term "peptide" as used in the present Application means in particular protein or protein fragment, oligopeptide, extract, separated or substantially isolated or synthesized, in particular those obtained by chemical synthesis or by expression in a recombinant organism; any peptide in the sequence of which one or more amino acids of the L series are replaced by an amino acid of the D series, and vice versa; any peptide of which at least one of the CO-NH bonds, and advantageously all of the CO-NH bonds of the peptide chain is (are) replaced by one (of) NH-CO bonds; any peptide of which at least one of the CO-NH bonds and advantageously all of the CO-NH bonds is or are replaced by one or more NH-CO bonds, the chirality of each aminoacyl residue, whether either involved or not in one or more CO-NH bonds mentioned above, being either conserved or reversed with respect to the aminoacyl residues constituting a reference peptide, these compounds being also designated immunoretroids, a mimotope, etc.

Antigens according to the invention can for example be obtained by the action of PAD (peptidyl arginine deiminase) on proteins or peptides natural, recombinant, or synthetic, comprising arginine residues, and in particular comprising at least one arginine residue constituting the center of a tripeptide motif identical to those present in the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6; they can also be obtained by peptide synthesis, by directly incorporating one or more citrulline residues, and preferably one or more epitopes comprising a citrulline residue, as defined above, in the synthesized peptide.

The present invention also relates to the use of the antigens in accordance with the invention, as defined above, for the in vi tro diagnosis of RA. The present invention encompasses in particular antigenic compositions for diagnosing the presence of RA-specific autoantibodies in a biological sample, which compositions are characterized in that they contain at least one antigen according to the invention, optionally labeled and / or conjugated with a carrier molecule.

The present invention also relates to a method for detecting RA specific class G autoantibodies in a biological sample, which method is characterized in that it comprises:

- bringing said biological sample into contact with at least one antigen in accordance with the invention, as defined above, under conditions allowing the formation of an antigen / antibody complex with the auto-antibodies specific for RA which may be present ;

- detection, by any appropriate means, of the antigen / antibody complex possibly formed.

This detection method can be implemented using a kit comprising at least one antigen according to the invention, as well as buffers and reagents suitable for constituting a medium. reaction allowing the formation of an antigen / antibody complex, and / or means of detection of said antigen / antibody complex.

Said kit may also include, where appropriate, reference samples, such as one or more negative serum (s) and one or more positive serum (s).

The present invention will be better understood with the aid of the additional description which follows, which refers to examples of preparation and implementation of antigens in accordance with the invention.

EXAMPLE 1: IN VITRO DEIMINATION OF RECOMBINANT FILAGGRIN BY PEPTIDYL ARGININE DEIMINASE (P.A.D.). Recombinant filaggrin is produced according to the following protocol:

A DNA fragment coding for a filaggrin unit is amplified by PCR, from human genomic DNA (RAJI cells: ATCC CCL86) using the following 2 primers: 5 'primer:

5 'TTCCTATACCAGGTGAGCACTCAT 3' Primer 3 ':

5 'AGACCCTGAACGTCCAGACCGTCCC 3'

The amplification product is cloned into the SmaI site of the vector pUC19. The recombinant clones are selected, checking the presence of a 972 bp insert obtained after digestion with SacI and Xbal. This insert is then subcloned into pUC19. The insert resulting from this subcloning is then transferred into the vector pGEX (sold by the company PHARMACIA), between the EcoRI and HindIII sites. The expression vector thus obtained expresses, in E. coli, filaggrin in fusion with glutathione-S-transferase (GST), under the control of the prokaryotic promoter Tac. The synthesis of the recombinant protein is induced by the addition of isopropyl-β-D-galactoside (IPTG) to the culture. The recombinant filaggrin thus obtained will be called hereinafter: "fil-gst".

We observe after electrophoresis, the existence of 9 fragments which result from a post-translational proteolysis of the whole filaggrin.

The mixture of the 9 fragments is subjected to in vitro elimination by peptidyl arginine deiminase.

A preparation of rabbit muscle peptidyl arginine deiminase (681 U / ml) sold by TAKARA BIOMED EUROPE is used, according to the protocol recommended by the manufacturer.

The operating conditions are as follows:

- Reaction medium: 0.1 M Tris-HCl, 10 mM CaCl ₂ , 5 mM DTT, pH 7.4;

- Enzyme / substrate ratio: 140 mU / μmol of filaggrin containing 10% of arginine, ie 4 mU / μmol of arginine;

- Incubation: between 0 and 60 min at 50 ° C; - Stopping the reaction: heating for 3 minutes in a LAEMMLI buffer

The following 8 reactions are carried out in parallel.

(1) BSA (bovine serum albumin) incubated in reaction medium (1 h, 50 ° C) without P.A.D.

(2) BSA incubated in reaction medium (1 h, 50 ° C.) with 60 mU of P.A.D.

(3) fil-gst incubated in reaction medium (1 h, 50 ° C.) without P.A.D. (4) fil-gst incubated in reaction medium (5 minutes at 50 ° C) with 60 mU of P.A.D.

(5) fil-gst incubated in reaction medium (15 minutes at 50 ° C) with 60 mU of P.A.D.

(6) fil-gst incubated in reaction medium (30 minutes at 50 ° C) with 60 U of PAD (7) fil-gst incubated in reaction medium (1 h at 50 ° C.) with 60 mU of PAD

(8) fil-gst incubated in reaction medium (1 h at 50 ° C.) with 60 mU of P.A.D. and in the presence of 10 mM of N-ethylmaleimide (P.A.D. inhibitor).

1 μl of each sample is placed on an electrophoresis gel (PHAST ^® -SDS 12.5% gel, PHARMACIA), and electrophoresis is carried out with the PHAST-SYSTEM ^{® device} (PHARMACIA), under the conditions recommended by the manufacturer. After transfer to nitrocellulose, either with a pool of 5 sera from RA patients, diluted to 1/2000, or with the anti-filaggrin monoclonal antibody AHF2 [SIMON et al. J. Invest. Dermatol. 105, 432, (1995)] at the concentration of 0.2 μg / ml. The antigen / antibody complex is revealed using a secondary antibody coupled to peroxidase, by the ECL technique.

The results show that in the absence of a citrullination reaction, the fil-gst is not recognized by the sera of patients suffering from RA, whereas from 5 minutes of citrullination, it is detected by these sera. There is an increase in reactivity with the pool of sera when the P.A.D. for 60 minutes at 50 ° C. Furthermore, these results make it possible to assume that there are one or more epitopes of high affinity in the COOH-terminal half of the filaggrin (positions 144 to 324), this or these epitope (s) being repeated between the positions 76 and 144. EXAMPLE 2: CITRULLINATION OF S-47-S AND S-35-R PEPTIDES BY THE PAD, AND TEST OF THE REACTIVITY OF CITRULLINATED PEPTIDES.

The peptide of 49 amino acids S-47-S of sequence (code 1 letter): NH ₂ -STGHSGSQHSHTTTQGRSDASRGSSGSRSTSRETRDQEQSGDGSRHSGS-COOH corresponding to amino acids 71 to 119 of the sequence of a human filaggrin unit, and comprising 6 arginine residues, and the peptide of 37 amino acids S-35-R of sequence (code 1 letter):

NH ₂ -SQDRDSQAQSEDSERRSASASRNHRGSAQEQSRDGSR-COOH corresponding to amino acids 155 to 191 of the sequence of a human filaggrin unit, and comprising 7 arginine residues, were prepared by peptide synthesis. The peptides S-47-S and S-35-R are represented in the sequence list in the appendix under the respective numbers SEQ ID NO: 3 and SEQ ID NO: 4.

These 2 peptides, as well as the fil-gst, were citrullinated by the action of PAD, for 30 minutes at 50 ° C., in the same reaction medium as that indicated in Example 1. The specific conditions for each peptide, and for the thread-gst are:

- S-47-S peptide: 4 mU / μmole arginine

- peptide S-35-R: 2.7 mU / μmole arginine - fil-gst: as indicated in example 2.

We compare, by "dot-blot", the reactivity of each peptide and that of the fil-gst, before and after action of the enzyme, vis-à-vis the monoclonal antibody AHF4, and the serum of a patient with RA. The operating conditions are as follows:

0.5 μg per deposition of each antigen (peptides, fil-gst, acid-neutral variants of filaggrin (VAF)) - Treatment of nitrocellulose 45 minutes at

80 ° C, before immunodetection.

- PR serum used at a dilution of 1/2000; monoclonal antibody AHF4 used at a concentration of 0.2 μg / l The results show that: - AHF4 recognizes the peptide S-47-5 and the filgst, citrullinated or not, but does not recognize S-35-R, citrulline or not.

- S-47-S is recognized, after citrullination, by the serum of the RA patient, while S-35-R, citrulline or not, is not recognized. The same serum also recognizes VAF and citrullinated fil-gst, but does not recognize non-citrullinated fil-gst. EXAMPLE 3 SYNTHESIS OF THE CITRULLIN AND NON-CITRULIN PEPTIDES E-12-H AND E-12-D AND TEST OF THE REACTIVITY OF THE PEPTIDES.

Peptides E-12-H and E-12-0 were determined by reference to the nucleotide sequences of the human profilaggrin gene described by GAN S.Q et al. [Biochemistry, 29: 9432-9440, (1990)].

The peptide of 14 amino acids E-12-H of sequence (code 1 letter):

NH ₂ -EQSADSSRHSGSGH-COOH comprises 1 arginine residue, and the peptide of 14 amino acids E-12-D of sequence (code 1 letter):

NH ₂ -ESSRDGSRHPRSHD-COOH contains 3 arginine residues.

The peptides E-12-H and E-12-D are represented in the sequence list in the appendix under the respective numbers SEQ ID NO: 5 and SEQ ID NO: 6.

These peptides were prepared by peptide synthesis in solid phase.

The citrullinated peptides E-12-H and E-12-D were synthesized directly by incorporation of a citrulline in replacement of an arginine.

For peptide E-12-D, only the arginine residue corresponding to the 8 ^th amino acid of the sequence was replaced by a citrulline during the peptide synthesis. The reactivity of each citrulline and non-citrulline peptide was tested respectively against a normal serum, two sera from PR patients, anti-filaggrin antibodies (AFAs) purified from a pool of 45 sera. of RA patients and anti-filaggrin antibodies purified from 12 sera of RA patients. EXPERIMENTAL PROTOCOL :

The wells of NUNC MAXISORP microtiter plates were coated respectively with the non-citrullinated and citrullinated peptides E-12-D and E-12-H, diluted to a concentration of 5 μg / ml in PBS buffer (pH : 7.4) and incubated overnight at 4 ° C (final volume: 100 μg / well). The wells were saturated for 30 minutes at 37 ° C. in PBS-T een 20, 0.05% gelatin 2.5%, 200 μl / well. The negative control serum (normal serum) was diluted 1/120. The anti-filaggrin antibodies were diluted in PBS-Tween 20, 0.05% - 0.5% gelatin (PBS TG) so that the final concentrations of anti-filaggrin autoantibody are those indicated in Table I attached. Negative control serum, PR sera and anti-filaggrin antibodies were added (final volume: 100 μl / well) and incubated for 1 hour at 37 ° C and overnight at 4 ° C. Goat anti-heavy chain gamma antibodies of human immunoglobulins, labeled with peroxidase (marketed by the company SOUTHERN BIOTECHNOLOGIES) were added to each well (dilution in PBSTG: 1/2000, final volume: 100 μl / well) and subjected incubation for 1 hour at 37 ° C. The revelation was carried out by adding orthophenylenediamine (2 mg / ml, for 10 minutes).

The results presented in the attached Table I are given in OD ratio at 492 nm: citrullinated peptide signal / non-citrullinated peptide signal.

These results show that, in the majority of cases, the ratio of citrullinated peptide to non-citrullinated peptide is greater than 1, and therefore illustrates the good sensitivity of citrullinated peptides compared to non-citrullinated peptides for their reactivity towards anti-filaggrin autoantibodies.

TABLE I

AFAs concentration in μg / ml.

Claims

CLAIMS 1) Peptide comprising an epitope recognized by anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis, characterized in that said epitope comprises a tripeptide motif centered on a citrulline residue, specifically present on at least one of the citrulline peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. 2) Peptide according to claim 1, characterized in that it comprises the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue.

3) Artificial antigen specifically recognized by the anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis, characterized in that it comprises or consists of at least one peptide according to any one of claims 1 or 2. 4 ) Use of an antigen according to any one of claims 1 to 3, for the in vitro diagnosis of rheumatoid arthritis.

5) Antigenic composition for the diagnosis of the presence of auto-antibodies specific for rheumatoid arthritis in a biological sample, characterized in that it contains at least one antigen according to any one of claims 1 to 3, optionally labeled and / or conjugated with a carrier molecule. 6) Method for detecting autoantibodies specific for rheumatoid arthritis in a biological sample, which method is characterized in that it comprises: - bringing said biological sample into contact with at least one antigen according to any one of claims 1 to 3, under conditions allowing the formation of a antigen / antibody complex with any auto-antibodies specific for rheumatoid arthritis that may be present;

7) Required for the detection of autoantibodies specific for rheumatoid arthritis in a biological sample, characterized in that it comprises at least one antigen according to any one of claims 1 to 3, as well as buffers and reagents suitable for the constitution of a reaction medium allowing the formation of an antigen / antibody complex, and / or means for detecting said antigen / antibody complex.