FR2773157A1 - PEPTIDE EPITOPES RECOGNIZED BY ANTIFILAGGRIN AUTOANTIBODIES PRESENT IN THE SERUM OF PATIENTS WITH RHUMATOID POLYARTHRITIS - Google Patents

Abstract

The invention concerns peptides comprising epitopes recognised by antifilaggrin in serum from rheumatoid arthritis patients. Said epitopes comprising a tripeptide motif centred on a citrulline residue. The invention also concerns artificial antigens comprising said epitopes, and their use for diagnosing rheumatoid arthritis.

Description

PEPTIDE EPITOPES RECOGNIZED BY AUTO-ANTIBODIES

  ANTIFILAGGRIN PRESENT IN THE SERUM OF PATIENTS WITH RHUMATOID POLYARTHRITIS. The present invention relates to new preparations of antigens specifically recognized by auto-antibodies specific for rheumatoid arthritis. Rheumatoid arthritis (hereinafter abbreviated as "RA") is the most common chronic inflammatory rheumatism. It is an autoimmune disease, and the serum of affected patients contains autoantibodies, some of which are specific, and can constitute a marker of this disease, allowing its diagnosis even at early stages. Research has therefore been carried out with a view to identifying antigens recognized by these antibodies, in order to obtain purified preparations which can be used in conventional techniques of immunological diagnosis. Autoantibodies specifically present in RA patients and reacting with a rat esophageal epithelial antigen have been described for the first time by B. J. J. YOUNG et al. in Br. Med. J. 2: 97-99, (1979). These autoantibodies were at the time called "anti-keratin antibodies" .25 In previous work, the inventors' team obtained, from human and murine squamous epithelia, preparations of antigens related to filaggrin and to profilaggrin, recognized specifically by the antibodies present in the serum of patients suffering from rheumatoid arthritis, and shown that the "antikeratin antibodies" were in

  makes anti-filaggrin autoantibodies (hereinafter referred to as "AAF"). Application EP 0 511 116 describes these antigenic preparations, and their use for the diagnosis of rheumatoid arthritis.

  Filaggrins are a family of proteins which has been identified in various species, notably in humans, rats, mice, guinea pigs, in the case of squamous keratinizing epithelia [for a review on filaggrins, cf. DALE et al. [The Keratinocyte Handbook, Cambridge University Press, pp 323-350, (1994)]. They

  derive from the dephosphorylation and proteolysis of a precursor, profilaggrin, which consists essentially of repeating domains of filaggrin separated10 by interdomain peptide segments.

  The gene coding for profilaggrin is made up of repeating subunits, each of which codes for a filaggrin molecule, separated by portions coding for the interdomain peptide segments.15 All repeating units coding for each of the human filaggrins have the same length ( 972 base pairs in humans); however, in humans, there are significant variations (10-15%) in sequence from one subunit to another. While most are conservative, some of these variations induce changes in amino acids and in some cases changes in the electrical charge of the protein. Thus human filaggrins form, independently of post-transcriptional modifications, a heterogeneous population of molecules of similar size but of sequences and charges (pHi equal to 8.3 1.1)

  different [GAN et al., Biochem. 29, p. 9432-9440 (1990)].

  Profilaggrin is a weighty protein

  high molecular (around 400,000 in humans) soluble in the presence of high concentrations of salts or urea.

  It has a high content of basic amino acids (arginine and histidine), as well as glycine, serine and glutamic acid. It is poor in non-polar amino acids and contains neither methionine, cysteine, nor tryptophan. It is strongly phosphorylated on serine residues, which gives it an iscelectric point close to neutrality. Profilaggrin is cleaved into filaggrin units during a complex maturation process, involving dephosphorylation, followed by protease cleavage in the interdomain segments. This cleavage first generates fragments of intermediate size, then the functional molecules of filaggrin.10 Filaggrins resulting from dephosphorylation and from cleavage of profilaggrin are basic proteins whose amino acid content is similar to that of profilaggrins. They participate in the organization of the keratin filaments, and undergo a progressive maturation during which the arginine residues, basic, are converted into citrulline residues, neutral, under the action of peptidylarginine deiminase [HARDING CR and SCOTT IR, J Mol. Biol. 170, p. 651-673 (1983)]. This leads to a reduction in their affinity for the keratins from which they are detached; they are then completely degraded under the action of various proteases. The properties of filaggrins and profilaggrins have been particularly well studied in rats, mice and humans. The size of profilaggrin varies, depending on the species, from 300 to

  400 kD and that of the filaggrines from 27 to 64 kD.

  The polymorphism observed in humans between the sequences of filaggrin units within the same profilaggrin gene does not appear in rats and mice. Filaggrins also exhibit great inter- and intra-specific variability in their sequence. However, this variability does not affect their functional properties, their overall amino acid composition, and their biochemical properties. Likewise, the tissue locations of profilaggrin and filaggrins are identical in the different mammals studied. While continuing their work, the inventors found that the profilaggrin present in the keratohyaline granules of the human epidermis was unlike filaggrins, not recognized by the AAF [SIMON et al. Clin. Exp. Immunol. 100, 90-98 (1995)]. They then tested the reactivity of the AAFs with recombinant filaggrin, and found that the latter was also not recognized. On the other hand, it had previously been observed that the forms of human epidermal filaggrins mainly recognized by the FAA were the acid-neutral forms described by SIMON et al. [J. Clin. Invest., 92, 1387, (1993)] and in application EP 0 511 116. The fact that these acid-neutral forms correspond to a late stage of maturation of

  filaggrin, made it possible to suppose that all or part of the post-translational modifications occurring up to this stage were involved in the formation of the epitopes recognized by the AAFs.

  To verify this hypothesis, the inventors sought to reproduce in vitro, from filaggrin

  recombinant, these post-translational modifications, to determine which were likely to influence the antigenicity of filaggrin.

  They thus found that in fact, the citrullination of filaggrin was sufficient to generate epitopes recognized by the AAF. In fact, by observing the in vitro elimination of recombinant filaggrin, they observed that the replacement of at least part of the arginines by citrullines makes it possible to obtain an antigen recognized specifically by the FAAs present in the serum of the patients with RA. They further located regions which, after citrullination, were highly immunoreactive against anti-filaggrin autoantibodies. These are in particular the region corresponding to the C-terminal portion (amino acids 144 to 324) and in particular to amino acids 144 to 314, as well as the region corresponding to amino acids 76 to 144, and the region corresponding to amino acids 71 to 119 of a unit of human filaggrin. This work resulted in the obtaining of artificial antigens recognized specifically by the FAAs present in the serum of RA patients, and constituted by recombinant or synthetic polypeptides, derived from the filaggrin sequence, or portions of that -ci, by substitution of at least one arginine residue by a citrulline residue. These antigens, as well as their use, are the subject of Application FR FR 96 10651, filed on August 30, 1996 in the name of BIOMERIEUX.15 By continuing their work, the Inventors have managed to select from the sequence

  of a filaggrin unit, peptides in which the substitution of at least one arginine residue by a citrulline residue gave rise to epitopes specifically recognized by FAA present in the serum of RA patients.

  The sequences of these peptides are identified in the annexed sequence list under the numbers SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.25 The term "filaggrin unit" means a polypeptide whose sequence is that of the product of

  translation of any of the subunits encoding a filaggrin domain of the gene for human profilaggrin or of another species, or else is a consensus sequence, theoretical sequence obtained from the sequences of the filaggrin domains.

  The inventors have now identified epitopes recognized by anti-filaggrin autoantibodies: these epitopes comprise a tripeptide motif centered on a citrulline residue, specifically present on citrulline peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, and absent from the sequence SEQ ID NO: 4. This is in particular the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue. The subject of the present invention is a peptide constituting an epitope recognized by anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis, characterized in that said epitope comprises a tripeptide motif centered on a citrulline residue, specifically present on at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. According to a preferred embodiment of the present invention, said peptide comprises at least one pentapeptide motif centered on a citrulline residue, present on at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. Advantageously, said peptide comprises the

  tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue.

  By way of example, mention will be made of peptides which comprise the pentapeptide motif, X1-Ser-Arg-His-X2 in which X1 = Ser or Gly, and X2 = Ser or Pro, and among these, peptides which comprise the hexapeptide motif X0-Xl-Ser-Arg-His-X2, or the heptapeptide motif X0-Xl-Ser-Arg-His-X2-X3, in which Xl and X2 are as defined above, X0 = Asp, and X3 = Gly or Arg.30 The peptides in accordance with the invention allow the preparation of artificial antigens

  specifically recognized by the anti-filaggrin auto-antibodies present in the serum of patients suffering from rheumatoid arthritis. These artificial antigens are also part of the object of the present invention.

  Artificial antigens according to the invention comprise at least one peptide epitope centered on a citrulline residue, as defined above. They are for example constituted by peptides5 of at least 5 amino acids, preferably at least 10 amino acids, and advantageously at least 14 amino acids. They may be peptides consisting of at least one fragment of at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5.10 SEQ ID NO: 6, or containing at least one such fragment . These peptides can comprise several citrullinated epitopes specifically recognized by AAF, of identical or different sequences. The term "peptide" as used in the present Application means in particular protein or protein fragment, oligopeptide, extract, separated or

  substantially isolated or synthesized, especially those obtained by chemical synthesis or by expression in a recombinant organism; any peptide in the sequence of which one or more amino acids of the L series are replaced by an amino acid of the D series, and vice-

  vice versa; any peptide of which at least one of the CO-NH bonds, and advantageously all of the CO-NH bonds of the peptide chain is (are) replaced by one (of) NH-CO bonds; any peptide with at least one CO-NH bond and advantageously all CO- bonds

  NH is or are replaced by one or more NH-CO bonds, the chirality of each aminoacyl residue, whether or not involved in one or more CO-NH bonds mentioned above, being either preserved , or reversed with respect to the aminoacyl residues constituting a reference peptide, these compounds being also designated immunoretroids, a mimotope, etc. Antigens in accordance with the invention can for example be obtained by the action of PAD (peptidyl arginine deiminase) on proteins or natural, recombinant or synthetic peptides comprising arginine residues, and in particular comprising at least one arginine residue constituting the center of a tripeptide motif identical to those present in the 5 sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6; they can also be obtained by peptide synthesis,

  by directly incorporating one or more citrulline residues, and preferably one or more epitopes comprising a citrulline residue, as defined above, in the synthesized peptide.

  The present invention also relates to the use of the antigens according to the invention, as defined above, for the in vitro diagnosis of RA. The present invention encompasses in particular antigenic compositions for the diagnosis of the presence RA-specific autoantibodies in a biological sample, which compositions are characterized in that they contain at least one

  antigen according to the invention, optionally labeled and / or conjugated with a carrier molecule.

  The present invention also relates to a method for detecting RA-specific class G autoantibodies in a biological sample, which method is characterized in that it comprises: - bringing said biological sample into contact with at least an antigen in accordance with the invention, as defined above, under conditions allowing the formation of an antigen / antibody complex with the RA specific autoantibodies which may be present;

  - detection, by any appropriate means, of the antigen / antibody complex possibly formed.

  This detection method can be implemented using a kit comprising at least one antigen according to the invention, as well as buffers and reagents suitable for constituting a reaction medium allowing the formation of an antigen / antibody complex, and / or means for detecting said antigen / antibody complex. Said kit may also include, where appropriate, reference samples, such as one or more negative serum (s) and one or more serum (s)

  positive. The present invention will be better understood with the aid of the additional description which follows, which is

  refers to examples of preparation and use of antigens according to the invention.

  EXAMPLE 1: IN VITRO DEIMINATION OF RECOMBINANT FILAGGRIN BY PEPTIDYL ARGININE DEIMINASE (P.A.D.).

  Recombinant filaggrin is produced according to the following protocol: A DNA fragment coding for a filaggrin unit is amplified by PCR, from human genomic DNA (RAJI cells: ATCC CCL86) using the following 2 primers: 20 5 'primer:

'TTCCTATACCAGGTGAGCACTCAT 3'

3 'primer:

'AGACCCTGAACGTCCAGACCGTCCC 3'

  The amplification product is cloned into the SmaI site of the vector pUC19. The recombinant clones are selected, checking the presence of a 972 bp insert obtained after digestion with SacI and XbaI. This insert is then subcloned into pUCl9. The insert resulting from this subcloning is then transferred into the vector pGEX (sold by the company PHARMACIA), between the EcoRI and HindIII sites. The expression vector

  thus obtained expresses, in E. coli, filaggrin in fusion with glutathione-S-transferase (GST), under the control of the prokaryotic promoter Tac. The synthesis of the recombinant protein is induced by the addition of isopropyl-p-D-galactoside (IPTG) to the culture.

  The recombinant filaggrin thus obtained will be called hereinafter: "filgst".

  We observe after electrophoresis, the existence of 9 fragments which result from a post-

  translational of the whole filaggrin.

  The mixture of the 9 fragments is subjected to elimination in vitro by peptidyl arginine deiminase.

  A preparation of rabbit muscle peptidyl arginine deiminase (681 U / ml) is used.

  marketed by TAKARA BIOMED EUROPE, according to the protocol recommended by the manufacturer.

  The operating conditions are as follows: - Reaction medium: 0.1 M Tris-HCl, 10 mM CaCl 2, 5 mM DTT, pH 7.4; - Enzyme / substrate ratio: 140 mU / tmole of filaggrin containing 10% arginine, ie 4 mU / 1mole of arginine; - Incubation: between 0 and 60 min at 50 C; - Stopping the reaction: heating for 3 minutes in a LAEMMLI buffer

  The following 8 reactions are carried out in parallel.

  (1) BSA (bovine serum albumin) incubated in

  reaction medium (lh, 50 C) without P.A.D.

  (2) BSA incubated in reaction medium (lh,

 C) with 60 mU of P.A.D.

  (3) fil-gst incubated in reaction medium

(1h, 50 C) without P.A.D.

  (4) fil-gst incubated in reaction medium (5 minutes at 50 ° C.) with 60 mU of P.A.D.

  (5) fil-gst incubated in reaction medium

  (15 minutes at 50 C) with 60 mU of P.A.D.

  (6) fil-gst incubated in reaction medium

  (30 minutes at 50 C) with 60 mU of P.A.D.

  l! (7) fil-gst incubated in reaction medium

(lh at 50 C) with 60 mU of P.A.D.

  (8) fil-gst incubated in reaction medium (1 h at 50 ° C.) with 60 mU of P. A.D. and in the presence of 10 mM of N-ethylmaleimide (inhibitor of P.A. D.). 1 μl of each sample is placed on an electrophoresis gel (PHAST -SDS gel 12.5%, PHARMACIA), and electrophoresis is carried out with the PHAST-SYSTEM device (PHARMACIA), under the conditions recommended by the manufacturer . After transfer to nitrocellulose, either with a pool of 5 sera from patients with

  PR, diluted to 1/2000 either with the anti-filaggrin monoclonal antibody AHF2 [SIMON et al. J. Invest. Dermatol. 105, 432, (1995)] at the concentration of 0.2 kg / ml.

  The antigen / antibody complex is revealed using a secondary antibody coupled to peroxidase, by the ECL technique. The results show that in the absence of a citrullination reaction, the fil-gst is not recognized by the sera of patients suffering from RA, whereas as of minutes of citrullination, it is detected by these sera. There is an increase in reactivity with the pool of sera when the P.A.D. for 60 minutes at 50 C.25 In addition, these results make it possible to assume that there are one or more epitopes of high affinity

  in the COOH-terminal half of the filaggrin (positions 144 to 324), this or these epitope (s) being repeated between positions 76 and 144.

  EXAMPLE 2: CITRULLINATION OF S-47-S AND S-35-R PEPTIDES BY THE P.A.D, AND TEST OF THE REACTIVITY OF PEPTIDES

  CITRULLINES. The peptide of 49 amino acids S-47-S of sequence (code 1 letter):

  NH2-STGHSGSQHSHTTTQGRSDASRGSSGSRSTSRETRDQEQSGDGSRHSGS-COOH

  corresponding to amino acids 71 to 119 of the sequence of a human filaggrin unit, and comprising 6 arginine residues, and the peptide of 37 amino acids S-35-R of sequence (code 1 letter): NH2SQDRDSQAQSEDSERRSASASRNHRGSAQEQSRDGSR-COOH corresponding to acids Amines 155 to 191 of the sequence of a human filaggrin unit, and comprising 7 arginine residues, were prepared by peptide synthesis. The peptides S-47-S and S-35-R are represented in the sequence list in the appendix under the respective numbers SEQ ID NO: 3 and SEQ ID NO: 4. These 2 peptides, as well as the filgst, have been citrullinated by the action of PAD, for 30 minutes at 50 ° C., in the same reaction medium as that indicated in Example 1. The specific conditions for each peptide, and for the fil-gst are as follows: - peptide S- 47-S: 4 mU / imole arginine - peptide S-35-R: 2.7 mU / pmole arginine

  - fil-gst: as shown in example 2.

  We compare, by "dot-blot", the reactivity of each peptide and that of the fil-gst, before and after action of the enzyme, vis-à-vis the monoclonal antibody AHF4, and the serum of a patient with PR.25 The operating conditions are as follows: - 0.5 μg per deposition of each antigen (peptides, fil-gst, acid-neutral variants of filaggrin (VAF)) Treatment of nitrocellulose 45 minutes at

 C, before immunodetection.

  - PR serum used at a dilution of 1/2000; monoclonal antibody AHF4 used at a concentration of 0.2 kg / ml The results show that: AHF4 recognizes the S-47-S peptide and the fil- gst citrullinated or not, but does not recognize S-35-R, citrullinated or not . - S-47-S is recognized, after citrullination, by the serum of the patient suffering from RA, while S-35-R, citrullinated or not, is not recognized. The same serum

  also recognizes VAF and citrullinated fil-gst, but does not recognize non-citrulline fil-gst. EXAMPLE 3 SYNTHESIS OF THE CITRULLIN AND NON-CITRULIN PEPTIDES E-12-H AND E-12-D10 AND TEST OF THE REACTIVITY OF THE PEPTIDES.

  The peptides E-12-H and E-12-D were determined by reference to the nucleotide sequences of the

  human profilaggrin gene described by GAN S.Q et15 al. [Biochemistry, 29: 9432-9440, (1990)].

  The peptide of 14 amino acids E-12-H of sequence (code 1 letter):

NH2-EQSADSSRHSGSGH-COOH

  includes 1 arginine residue, and the peptide of 14 amino acids E-12-D of sequence (code 1 letter):

NH2-ESSRDGSRHPRSHD-COOH

includes 3 arginine residues.

  The peptides E-12-H and E-12-D are shown

  in the sequence list in the appendix under the respective numbers SEQ ID NO: 5 and SEQ ID NO: 6.

  These peptides were prepared by peptide synthesis in solid phase.

  Citrullinated peptides E-12-H and E-12-D have

  were synthesized directly by incorporating a citrulline to replace an arginine.

  For the peptide E-12-D, only the arginine residue corresponding to the 8th amino acid of the sequence

  has been replaced by citrulline during peptide synthesis.

  The reactivity of each citrullinated and non-citrullinated peptide was tested respectively against a

  normal serum, from two sera from PR patients, anti-filaggrin antibodies (AFAs) purified from a pool of 455 sera from PR patients and anti-filaggrin antibodies purified from 12 sera from PR patients.

EXPERIMENTAL PROTOCOL:

  The wells of NTUNC MAXISORP microtiter plates were coated respectively with the non-citrullinated and citrullinated peptides E-12-D and E-12-H, diluted to a concentration of 5 tg / ml in PBS buffer (pH : 7.4) and incubated overnight at 4 ° C. (final volume: 100 tg / well). The wells were saturated for minutes at 37 ° C. with PBS-Tween 20, 0.05% 2.5% gelatin, 200 μl / well. The negative control serum (normal serum) was diluted 1/120. The anti-filaggrin antibodies were diluted in PBS-Tween 20, 0.05% - 0.5% gelatin (PBS TG) so that the final concentrations of anti-filaggrin autoantibodies were those indicated in the attached Table I20. Negative control serum, PR sera and anti-filaggrin antibodies were added (final volume: 100 μl / well) and incubated for 1 hour at 37 ° C. and overnight at 4 ° C. Anti-goat antibodies heavy gamma chains of human immunoglobulins, labeled with peroxidase (marketed by the company SOUTHERN BIOTECHNOLOGIES) were added to each well (dilution in PBSTG: 1/2000, final volume: 100 Ll / well) and subjected to incubation for 1 hour at

  37 C. The revelation was carried out by adding ortho-

  phenylenediamine (2mg / ml, for 10 minutes).

  The results presented in the appended Table I are given in OD ratio at 492 nm: citrullinated peptide signal / non-citrullinated peptide signal. These results show that, in the majority of cases, the ratio of citrullinated peptide / non-citrullinated peptide is greater than 1, and therefore illustrates the good sensitivity of citrullinated peptides compared to non-citrullinated peptides for their reactivity towards screw

anti-filaggrin autoantibodies.

TABLE I

  Peptide Serum PR1 Serum PR2 Serum Pool of AFAs AFAs purified From 12 PR sera control 10 * 20 * 5 * 10 * 20 * 5 * 10 * 20 * 10 * 10 * 10 * 10 * 10 * 10 * 10 * 10 * 10 * 10 * 10 * 10 *

  E-12-D 1.076 1.42 1.85 2.42 3.77 5.57 1.77 1.63 1.48 1.99 1.38 2.48 1.19 1.12 3.50 1, 87 5.19 1.13 1.57 1.11 1.65

  E-12-H 1 1.32 1.20 10.44 11.51 8.38 2.45 2.42 1.82 7.16 2.05 1.06 1.18 0.76 13.57 4, 14 3.18 1.14 3.66 1.22 5.84

*: AFAs concentration in Mg / ml.

rY3

17 2773157

LIST OF SEQUENCES

  (2) INFORMATION FOR SEQ ID NO: 1:

  (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear

  (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:

TTCCTATACC AGGTGAGCAC TCAT 24

  (2) INFORMATION FOR SEQ ID NO: 2:

  (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF STRANDS: simple (D) CONFIGURATION: linear

  (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:

AGACCCTGAA CGTCCAGACC GTCCC 25

  (2) INFORMATION FOR SEQ ID NO: 3:

  (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 49 amino acids (B) TYPE: amino acid

(C) NUMBER OF STRANDS:

  (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: peptide

  (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3:

  Ser Thr Gly His Ser Gly Ser Gln His Ser His Thr Thr Gln Gly

1 5 10 15

  Arg Ser Asp Ala Ser Arg Gly Ser Ser Gly Ser Arg Ser Thr Ser Arg

25 30

  Glu Thr Arg Asp Gln Glu Gln Ser Gly Asp Gly Ser Arg His Ser Gly

40 45

Ser

18 2773157

  (2) INFORMATION FOR SEQ ID NO: 4:

  (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 37 amino acids (B) TYPE: amino acid

(C) NUMBER OF STRANDS:

  (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: peptide

  (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4:

  Ser Gln Asp Arg Asp Ser Gln Ala Gln Ser Glu Asp Ser Glu Arg Arg

1 5 10 15

  Ser Ala Ser Ala Ser Arg Asn His Arg Gly Ser Ala Gln Glu Gln Ser

25 30

Arg Asp Gly Ser Arg

  (2) INFORMATION FOR SEQ ID NO: 5:

  (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 amino acids (B) TYPE: amino acid

(C) NUMBER OF STRANDS:

  (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: peptide

  (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5:

  Glu Gln Ser Ala Asp Ser Ser Arg His Ser Gly Ser Gly His

1 5 10

  (2) INFORMATION FOR SEQ ID NO: 6:

  (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 amino acids (B) TYPE: amino acid

(C) NUMBER OF STRANDS:

  (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: peptide

  (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6:

  Glu Ser Ser Arg Asp Gly Ser Arg His Pro Arg Ser His Asp

1 5 10

19 2773157

Claims (7)

  1) Peptide comprising an epitope recognized by antifilaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis, characterized in that said epitope comprises a tripeptide motif centered on a citrulline residue, specifically present on at least one of the citrulline peptides derived from sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.10 2) Peptide according to claim 1, characterized in that it comprises the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue. 3) Artificial antigen specifically recognized by the anti-filaggrin autoantibodies present in the serum of patients suffering from rheumatoid arthritis,   characterized in that it comprises or consists of at least one peptide according to any one of claims 1 or 2.   4) Use of an antigen according to any one of claims 1 to 3, for the diagnosis   in vitro rheumatoid arthritis. 5) Antigenic composition for the diagnosis of the presence of auto-antibodies specific for rheumatoid arthritis in a biological sample, characterized in that it contains at least one antigen   according to any one of claims 1 to 3, optionally labeled and / or conjugated with a carrier molecule.   6) Method for detecting auto-antibodies specific for rheumatoid arthritis in a biological sample, which method is characterized in that it comprises: - bringing said biological sample into contact with at   at least one antigen according to any of the claims   1 to 3, under conditions allowing the formation of a 2773157   antigen / antibody complex with any auto-antibodies specific for rheumatoid arthritis which may be present; - detection, by any appropriate means, of the antigen / antibody complex possibly formed. 7) Necessary for the detection of autoantibodies specific for rheumatoid arthritis in   a biological sample, characterized in that it comprises at least one antigen according to any one of claims 1 to 3, as well as buffers and reagents suitable for constituting a reaction medium   allowing the formation of an antigen / antibody complex, and / or means of detection of said antigen / antibody complex.