CA2316269A1 - Peptide epitopes recognised by antifilaggrin autoantibodies in serum from rheumatoid arthritis patients - Google Patents

Abstract

The invention concerns peptides comprising epitopes recognised by antifilaggrin in serum from rheumatoid arthritis patients. Said epitopes comprising a tripeptide motif centred on a citrulline residue. The invention also concerns artificial antigens comprising said epitopes, and their use for diagnosing rheumatoid arthritis.

Description

PEPTIDIC EPITOPES RECOGNIZED BY A. TO-ANTIBODIES
ANTIFILAGGRIN PRESENT IN SERUM THESE PATIENTS
HAZARDS OF RHUMATOID POLYARTHRITIS.
The present invention relates to new preparations of antigens specifically recognized by specific autoantibodies of the rheumatoid arthritis.
Rheumatoid arthritis (hereinafter abbreviated in "PR") is the most common rheumatism chronic inflammatory. It is an auto disease immune, and the serum of affected patients contains autoantibodies, some of which are specific, and may constitute a marker of this disease, allowing its diagnosis even at early stages. Research has therefore were carried out in order to identify antigens recognized by these antibodies, in order to obtain purified preparations usable in techniques immunological diagnostic classics.
Auto-antibodies specifically present in RA patients who react with esophageal epithelial rat antigen have been described for the first time by BJJ YOUNG et al. in Br.
Med. J. 2: 97-99, (1979). These autoantibodies have been then called "anti-keratin antibodies".
During previous work, the team of Inventors obtained, from squamous epithelia human and murine preparations of related antigens with recognized filaggrin and profilaggrin specifically by the antibodies present in the serum patients with rheumatoid arthritis, and showed that the "anti-keratin antibodies" were in makes anti-filaggrin autoantibodies (below referred to as "AAF"). Application EP 0 511 116 describes these antigenic preparations, and their use for diagnosis of rheumatoid arthritis.

WO 99/35167 1'CT / FR98 / 02899

2 Filaggrins are a family of proteins which has been identified in various species, among others in humans, rats, mice, guinea pigs, at the level of squamous keratinizing epithelia [for review on filaggrines, cf. DALE et al. [The Keratinocyte Handbook, Cambridge University Press, pp 323-350, (1994)]. They are derived from dephosphorylation and proteolysis of a precursor, profilaggrine, which is made up essentially from separate repeats of filaggrin by interdomain peptide segments.
The gene coding for profilaggrin is consists of repeated subunits each of which codes for a filaggrin molecule, separated by portions coding for the interdomain peptide segments.
All repeat units coding for each of the human filaggrins are the same length (972 pairs of base in humans); however, in humans, significant variations (10-15 ° s) in the sequence of a subunit to another. If most are conservative, some of these variations induce changes amino acids and in some cases changes in the electrical charge of the protein. So the human filaggrins form, independently of post-transcriptional modifications, a population heterogeneous molecules of similar size but of sequences and charges (pHi equal to 8.3 t 1.1) different [GAN et al., Biochem. 29, p. 9432-9440 (1990) j.
Profilaggrin is a weighty protein high molecular (around 400,000 in humans) soluble in the presence of high concentrations of salts or urea.
It has a high content of basic amino acids (arginine and histidine), as well as glycine, serine and glutamic acid. It is poor in amino acids not polar and does not contain methionine, cysteine, or tryptophan. It is strongly phosphorylated on

3 serine residues, which gives it an isoelectric point close to neutrality.
Profilaggrine is cleaved into units filaggrin during a complex process of maturation, involving dephosphorylation, followed by protease cleavage at the segment level interdomains. This cleavage first generates fragments of intermediate size, then the functional molecules of filaggrin.
Filaggrins from dephosphorylation and the cleavage of profilaggrin are proteins bases with an amino acid content similar to that of profilaggrines. They participate in the organization of the keratin filaments, and undergo a progressive maturation during which the arginine residues, basic, are converted to residues citrulline, neutral, under the action of peptidylarginine deiminase [HARDING CR and SCOTT IR, J. Mol. Biol. 170, p. 651-673 (1983)]. This results in a reduction in their affinity for keratins from which they are detached;
they are then completely degraded under the action of various proteases.
The properties of filaggrins and profilaggrines have been particularly well studied in rats, mice and humans. The size of profilaggrin varies, depending on the species, from 300 to 400 kD and that of the filaggrines from 27 to 64 kD.
The polymorphism observed in humans between the sequences of filaggrine units inside a same profilaggrin gene does not appear in rats and the mouse. Filaggrins also have a large inter and intra-specific variability in their sequence. However, this variability does not affect their functional properties, nor their overall composition in amino acids, and their biochemical properties. Likewise, tissue localizations of profilaggrin and

4 fi.laggrines are identical in the different mammals studied.
By continuing their work, the Inventors found that profilaggrin in keratohyaline granules of the human epidermis were unlike filaggrins, not recognized by AAF [SIMON et al. Clin. Exp. Immunol. 100, 90-98 (1995)).
They then tested the responsiveness of the AAFs with recombinant filaggrin, and found that it does not more was not recognized. On the other hand, he had been previously observed that the forms of filaggrins human epidermis mainly recognized by AAF were the acid-neutral forms described by SIMON
et al. [J. Clin. Invest., 92, 1387, (1993)] and in the EP 0 511 116. The fact that these acidic forms neutral correspond to a late stage of maturation of filaggrin, allowed us to suppose that all or part post-translational modifications occurring up to this point were involved in training epitoges recognized by the AAF.
To verify this hypothesis, the Inventors have sought to reproduce in vitro, from filaggrin recombinant, these post-translational modifications, to determine which ones were likely influence the antigenicity of filaggrin.
They thus found that, in fact, the citrullination of filaggrin was enough to generate epitoges recognized by the AAF. Indeed, they observed, by in vitro elimination of filaggrin recombinant as the replacement of at least part arginines by citrullines allows obtaining a antigen specifically recognized by AAF present in the serum of RA patients. They also located regions that were after citrullination, strongly immunoreactive towards autoantibodies anti-filaggrin. This is particularly the region S
corresponding to the C-terminal portion (amino acids 144 to 324) and in particular to amino acids 144 to 314, as well as the region corresponding to amino acids 76 at 144, and the region corresponding to amino acids 71 at 119 from a unit of human filaggrin. These works have resulted in the obtaining of recognized artificial antigens specifically by the FAAs present in the serum of RA patients, and consisting of recombinant or synthetic polypeptides derived from filaggrin sequence, or portions thereof, by substitution of at least one arginine residue by a citrulline residue. These antigens, as well as their use, are the subject of Application FR FR 96 10651, filed on August 30, 1996 in the name of BIOMÉRIEUX.
By continuing their work, the Inventors managed to select from the sequence a filaggrin unit, peptides in which the substitution of at least one arginine residue with a residue citrulline gave birth to recognized epitopes specifically by the FAAs present in the serum of RA patients.
The sequences of these peptides are identified in the sequence list in the appendix under the numbers SEQ ID NO: 3, SEQ ID N0: 5, SEQ ID N0: 6.
We hear by . '~ filaggrin unit ", a polypeptide whose sequence is that of the product of translation of any of the coding subunits for a filaggrin domain of the profilaggrin gene human or another species, or is a sequence consensus, theoretical sequence obtained from filaggrin domain sequences.
The inventors have now identified epitoges recognized by anti-autoantibodies filaggrine. these epitoges include a motif tripeptide centered on a citrulline residue, specifically present on citrullinated peptides derived from the sequences SEQ ID N0: 3, SEQ ID NO: 5, SEQ ID N0: 6, and absent from the sequence SEQ ID N0: 4.
This is in particular the reason tripeptide Ser-Cit-His, in which Cit represents a citrulline residue.
The present invention relates to a peptide constituting an epitope recognized by autoantibodies anti-filaggrin present in patient serum with rheumatoid arthritis, characterized in l0 that said epitope comprises a centered tripeptide motif on a citrulline residue, specifically present on at minus one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6.
According to a preferred embodiment of the present invention, said peptide comprises at least one pentapeptide motif centered on a citrulline residue, present on at least one of the citrullinated peptides derived sequences SEQ ID N0: 3, SEQ ID NO: 5, SEQ ID N0: 6.
Advantageously, said peptide comprises the tripeptide motif Ser-Cit-His, in which Cit represents a citrulline residue.
By way of example, mention will be made of peptides derived, by citrullination, from peptides which include ie pentapeptide motif, Xl-Ser-Arg-His-X2 in which X1 = Ser or Gly, and X2 = Ser or Pro, and among these, peptides which include the hexapeptide motif XO-X1-Ser-Arg-His-X2, or the heptapeptide motif XO-X1-Ser-Arg-His-X2-X3, in which X1 and X2 are such that defined above, XO = Asp, and X3 = Gly or Arg.
The peptides according to the invention allow the preparation of artificial antigens specifically recognized by anti-autoantibodies filaggrin in the serum of patients with rheumatoid arthritis. These artificial antigens make also part of the object of the present invention.

Artificial antigens conforming to the invention include at least one peptide epitope centered on a citrulline residue, as defined above above. They are for example constituted by peptides at least 5 amino acids, preferably at least 10 amino acids, and advantageously at least 14 acids amines. I1 can be peptides constituted by at at least a fragment of at least one of the citrullinated peptides derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, or containing at least one such fragment. These peptides can include multiple epitopes citrullines specifically recognized by the AAF, from identical or different sequences.
The term "peptide" as used in the present Application means in particular protein or fragment protein, oligopeptide, extract, separate or substantially isolated or synthesized, especially those obtained by chemical synthesis or by expression in a recombinant organism; any peptide in the sequence of which one or more L-series amino acids are replaced by a D-series amino acid, and vice vice versa; any peptide with at least one of the CO- bonds NH, and advantageously all the CO-NH bonds of the peptide chain is (are) replaced) by one (of) NH-CO bonds; any peptide of which at least one of CO-NH bonds and advantageously all CO- bonds NH is or are replaced) by one or more bonds) NH-C0, the chirality of each aminoacyl residue, whether involved or not in one or more CO-NH bonds mentioned above mentioned, being either retained or reversed by relation to the aminoacyl residues constituting a peptide of reference, these compounds still being designated immunoretroids, a mimotope, etc.
Antigens according to the invention can for example be obtained by action of PAD (peptidyl arginine deiminase) on proteins or peptides S
natural, recombinant, or synthetic, containing arginine residues, and in particular comprising at least an arginine residue constituting the center of a motif identical to those present in the S sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6; they can also be obtained by peptide synthesis, by directly incorporating one or more residues citrulline, and preferably one or more epitoges comprising a citrulline residue, as defined above 10 above, in the synthesized peptide.
The present invention also relates to the use of antigens according to the invention, such as as defined above, for the in vitro diagnosis of PR.
The present invention particularly encompasses antigenic compositions for the diagnosis of presence of RA specific autoantibodies in a biological sample, which compositions are characterized in that they contain at least one 20 antigen according to the invention, optionally labeled and / cu conjugated with a carrier molecule.
The present invention also relates to a method for detecting class G autoantibodies specific for RA in a biological sample, 25 which method is characterized in that it comprises.
- bringing said biological sample into contact with at minus an antigen in accordance with the invention, as defined above, under conditions allowing training of an antigen / antibody complex with autoantibodies Specific for RA which may be present;
- detection, by any appropriate means, of the complex antigen / antibody possibly formed.
This detection method can be implemented work thanks to a kit comprising at least one 35 antigen according to the invention, as well as buffers and reagents suitable for building up a medium reaction allowing the formation of a complex antigen / antibody, and / or means for detecting said antigen / antibody complex.
Said kit may also include, where appropriate, reference samples, such as one or more several sera) negative) and one or more sera) positive.
The present invention will be better understood from using the additional description which follows, which is refers to examples of preparation and implementation antigens according to the invention.
EXAMPLE 1. IN VITRO DEIMINATION OF FILAGGRIN
RECOMBINANT BY PEPTIDYL ARGININE DEIMINASE (PAD).
Recombinant filaggrin is produced according to the following protocol.
A DNA fragment coding for a unit filaggrine is amplified by PCR, from genomic DNA
human (RAJI cells. ATCC CCL86) using the 2 following primers.
5 'primer.

5 'TTCCTATACCAGGTGAGCACTCAT 3' 3 'primer.
5 'AGACCCTGAACGTCCAGACCGTCCC 3' The amplification product is cloned into the SmaI site of the vector pUCl9. We proceed to the selection of recombinant clones, checking the presence of an insert of 972 bp obtained after digestion with SacI and XbaI. This insert is then subcloned into pUCl9. The insert resulting from this subcloning is then transferred to the vector pGEX (sold by the company PHARMACIA), between the EcoRI and HindIII sites. The expression vector thus obtained expresses, in E. coli, filaggrin in glutathione-S-transferase (GST) fusion, under control of the prokaryotic promoter Tac. The synthesis of recombinant protein is induced by addition isopropyl- (3-D-galactoside (IPTG) to the culture.

The recombinant filaggrin thus obtained will be hereinafter referred to as. "fil-gst".
We see after electrophoresis, the existence of 9 fragments that result from post proteolysis 5 translational of the whole filaggrin.
The mixture of the 9 fragments is subjected to a in vitro elimination by peptidyl arginine deiminase.
We use a peptidyl preparation rabbit muscle arginine deiminase (681 U / ml) l0 marketed by TAKARA BIOMED EUROPE, according to protocol recommended by the manufacturer.
The operating conditions are following.
- Reaction medium . 0.1 M Tris-HC1, CaCl2 10 mM, 5 mM DTT, pH 7.4;
- Enzyme / substrate ratio. 140 mU / ~ mole of filaggrin containing 10% arginine or 4 mU / ~ mole arginine;
- Incubation. between 0 and 60 min at 50 ° C;
Stop the reaction. heating 3 min in LAEMMLI stamp The 8 reactions are carried out in parallel following.
(1) BSA (bovine serum albumin) incubated in reaction medium (lh, 50 ° C) without PAD
(2) BSA incubated in reaction medium (lh, 50 ° C) with 60 mU PAD
(3) fil-gst incubated in reaction medium (lh, 50 ° C) without PAD
(4) fil-gst incubated in reaction medium (5 minutes at 50 ° C) with 60 mU PAD
(5) fil-gst incubated in reaction medium (15 minutes at 50 ° C) with 60 mU PAD

(6) fil-gst incubated in reaction medium (30 minutes at 50 ° C) with 60 mU PAD

WO 99/3516

7 PCT / FR98 / 02899 (7) fil-gst incubated in reaction medium (lh at 50 ° C) with 60 mU PAD

(8) fil-gst incubated in reaction medium (lh at 50 ° C) with 60 mU of PAD and in the presence of 10 mM
N-ethylmaleimide (PAD inhibitor).
1 ~ 1 of each sample is placed on a electrophoresis gel (PHAST ° -SDS 12.56 gel, PHARMACIA), and electrophoresis is carried out with the PHAST-SYSTEM ° device (PHARMACIA), under the conditions recommended by the l0 manufacturer. After transfer to nitrocellulose, it is revealed either with a pool of 5 sera from patients with PR, diluted to 1/2000 with either the monoclonal antibody anti-filaggrin AHF2 [SIMON et al. J. Invest. Dermatol.
105, 432, (1995)] at the concentration of 0.2 ~ g / ml.
The antigen / antibody complex is revealed at using a secondary antibody coupled to peroxidase, by the ECL technique.
The results show that in the absence of citrullination reaction, fil-gst is not recognized by sera from RA patients, as soon as 5 minutes of citrullination, it is detected by these will be. Or. Notes an increase in reactivity with the serum pool when the PAD is activated for 60 minutes at 50 ° C.
Furthermore, these results allow us to suppose that there are one or more epitopes of high affinity in the COOH-terminal half of filaggrin (positions 144 to 324), this or these epitope (s) being repeated) between positions 76 and 149.
E ~ I, E 2. CITRULLINATION OF S-47-S AND S-35-R PEPTIDES
BY THE PAD, AND TEST OF THE REACTIVITY OF THE PEPTIDES
CITRULLINATED.
The peptide of 49 amino acids S-47-S from sequence (code 1 letter).

corresponding to amino acids 71 to 119 of the sequence of a human filaggrin unit, and comprising 6 arginine residues, and the peptide of 37 amino acids S-35-R from sequence (code 1 letter).
NH ~ -SQDP, DSQAQSEDSERRSASASRNHRGSAQEQSRDGSR-COOH
corresponding to amino acids 155 to 191 of the sequence of a unit of human filaggrin, and containing 7 arginine residues, were prepared by l0 peptide synthesis. The peptides S-47-S and S-35-R are represented in the attached sequence list under the respective numbers SEQ ID N0: 3 and SEQ ID N0: 4.
These 2 peptides, as well as the fil-gst, were citrullines per action of PAD, for 30 minutes at 50 ° C, in the same reaction medium as that indicated at Example 1. The specific conditions for each peptide, and for the fil-gst are as follows.
- peptide S-97-S. 4 mU / ~ mole arginine - peptide S-35-R. 2.7 mU / ~ .mole arginine - fil-gst. as shown in Example 2.
We compare, by "dot-blot", the reactivity of each peptide and that of fil-gst, before and after action of the enzyme vis-à-vis the monoclonal antibody AHF4, and serum from a patient with RA.
The operating conditions are following.
- 0.5 ~ g per deposit of each antigen (peptides, fil-gst, acid-neutral variants of the filaggrin (VAF)) - Treatment of nitrocellulose 45 minutes at 80 ° C, before immunodetection.
- PR serum used at a dilution of 1/2000;
monoclonal antibody AHF4 used at a concentration of 0.2 ~ g / ml The results show that.

- AHF4 recognizes the peptide S-47- ~ and the fil-gst citrullinated or not, but does not recognize S-35-R, citrullinated or not.
- S-47-S is recognized, after ci ~ rullination, by the serum of the RA patient, while S-35-R, citrullinated or not, is not recognized. The same serum also recognizes VAF and citrullinated fil-gst, but does not recognize non-citrullinated fil-gst.
E7 ~ LE 3. SYNTHESIS OF E-12-H AND E-12-D PEPTIDES
CITRULLINES AND NON-CITRULLINES AND REACTIVITY TEST
PEPTIDES.
The peptides E-12-H and E-12-D have been determined by reference to the nucleotide sequences of the human profilaggrin gene described pa = GAN SQ and al. [Biochemistry, 29. 9432-9440, (1990)].
The peptide of 14 amino acids E-12-H from sequence (code 1 letter).

includes 1 arginine residue, and the peptide of 14 amino acids E-12-D from sequence (code 1 letter).
NHZ-ESSRDGSRHPRSHD-COOH
includes 3 arginine residues.
The peptides E-12-H and E-12-D are shown in the sequence list in the appendix under the numbers SEQ ID N0: 5 and SEQ ID N0: 6 respectively.
These peptides were prepared by synthesis solid phase peptide.
Citrullinated peptides E-12-H and E-12-D have been synthesized directly by incorporating a citrulline to replace an arginine.
For the peptide E-12-D, only the residue arginine corresponding to the Home amino acid of the sequence has been replaced by a citrulline during synthesis peptide.

The reactivity of each citrullinated peptide and non citrulliné was tested respectively against ur.
normal serum, two PR patient sera, antibody anti-filaggrin (AFAs) purified from a pool of 45 sera from RA patients and anti-filaggrin antibodies purified from 12 sera from RA patients.
EXPERIMENTAL PROTOCOL .
NUNC microtiter plate wells MAXISORP have been coated respectively with non-citrullinated and citrullinated peptides E-12-D and E-12-H, diluted to a concentration of 5 ~ .g / ml in PBS buffer (pH: 7.4) and incubated overnight at 4 ° C (volume final. 100 ~ g / well). Wells were saturated for 30 minutes at 37 ° C in PBS-Tween 20, 0.05% gelatin 2.5%, 200 ~ .1 / well. Negative control serum (normal serum) has been diluted 1/120. Anti-filaggrin antibodies have been diluted in PBS-Tween 20, 0.05% - gelatin 0.5% (PBS TG) so the final autoantibody concentrations anti-filaggrin are those indicated in table I
Annex. Negative control serum, PR sera and anti-filaggrin antibodies have been added (volume final. 100 ~ 1 / well) and incubated for 1 hour at 37 ° C and overnight at 4 ° C. Goat antibodies anti-gamma heavy chains of human immunoglobulins, labeled with peroxidase (sold by the company SOUTHERN BIOTECHNOLOGIES) have been added to each well (dilution in PBSTG. 1/2000, final volume 100 ~ 1 / well) and incubated for 1 hour at 37 ° C. The revelation was carried out by adding ortho-3o phenylenediamine (2mg / ml, for 10 minutes).
The results presented in Table I
annexed are given in OD ratio at 492 nm. signal citrullinated peptide / non-citrullinated peptide signal.
These results show that, in the majority cases, the ratio of citrullinated peptide OD to non-peptide citrulliné is greater than 1, and therefore illustrates the correct 1 ~
sensitivity of citrullinated peptides to non-citrullinated peptides for their reactivity towards anti-filaggrin autoantibodies.

LIST OF SEQUENCES

<110> BIOMERIOUS

SERRE, Guy GIRBAL-NEUHAUSER, lisabeth VINCENT, Christian SIMON, Michel SEBBAG, Mireille DALBON, Pascal JOLIVET-REYNAUD, Colette ARNAUD, Michel JOLIVET, Michel <120> PEPTIDE EPITOPES RECOGNIZED BY AUTO-ANTIBODIES

ANTIFILAGGRIN PRESENT IN PATIENT SRUM

POLYARTHRT_TE RHUMATOIDE ATTACKS

<130> MJPcb1067 / la <140>

<141>

<150> FR9716673 <151> 1997-12-30 <160> 6 <170> PatentIn Ver. 2.1 <210> 1 <211> 29 <212> DNA

<213> Homo sapiens <400> 1 ttcctatacc aggtgagcac tcat <210> 2 <211> 25 <212> DNA

<213> Homo sapiens <400> 2 agaccctgaa cgtccagacc gtccc <210> 3 <211> 99 <212>

<213> Homo sapiens <400> 3 stghsgsqhs htttqgrsda srgssgsrst sretrdqeqs gdgsrhsgs49 <210> 9 <211> 37 <212>

<213> Homo sapiens <400> 9 sqdrdsqaqs edserrsasa srnhrgsaqe qsrdgsr <210> 5 <2I1> 14 <212>

<213> Homo sapiens <400> 5 eqsadssrhs gsgh 1q <210> 6 <211> 19 <212>
<213> Homo sapiens <400> 6 essrdgsrhp rshd 14

Claims (7)

1) Peptide comprising an epitope recognized by anti-filaggrin autoantibodies present in the serum patients with rheumatoid arthritis, characterized in that said epitope comprises a motif tripeptide centered on a citrulline residue, specifically present on at least one of the peptides citrullines derived from the sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6. 2) Peptide according to claim 1, characterized by comprising the tripeptidal motif Ser-Cit-His, in which Cit represents a residue citrulline. 3) Specifically recognized artificial antigen by the anti-filaggrin autoantibodies present in the serum from patients with rheumatoid arthritis, characterized in that it comprises or consists of at least one peptide according to any of the claims 1 or 2. 4) Use of an antigen according to a any of claims 1 to 3, for the diagnosis in vitro of rheumatoid arthritis. 5) Antigenic composition for diagnosis the presence of specific autoantibodies of the rheumatoid arthritis in a biological sample, characterized in that it contains at least one antigen according to any one of claims 1 to 3, optionally labeled and/or conjugated with a molecule carrier. 6) Autoantibody detection method specific for rheumatoid arthritis in a biological sample, which method is characterized by what he understands.
- bringing said biological sample into contact with at least at least one antigen according to any of the claims 1 to 3, under conditions allowing the formation of a antigen/antibody complex with autoantibodies specific for rheumatoid arthritis possibly present;
- the detection, by any appropriate means, of the complex antigen/antibody possibly formed. 7) Necessary for the detection of autoantibodies specific for rheumatoid arthritis in a biological sample, characterized in that it comprises at least one antigen according to any of claims 1 to 3, as well as buffers and reagents suitable for forming a reaction medium allowing the formation of an antigen/antibody complex, and/or means for detecting said complex antigen/antibody.