Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
  • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
  • C07D487/08—Bridged systems
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents

Definitions

• Ras proteins are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
• Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein.
• Ras In the inactive state, Ras is bound to GDP.
• Ras Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change.
• the GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M.
• Mutated ras genes (Ha-r ⁇ s, Ki4a-ra_?, Ki4b-r ⁇ s and N-ras) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
• Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras.
• the Ras C-terminus contains a sequence motif termed a "CAAX” or "Cys-Aaa ⁇ -Aaa ⁇ -Xaa” box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 370:583-586 (1984)).
• this motif serves as a signal sequence for the enzymes farnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C15 or C20 isoprenoid, respectively.
• the Ras protein is one of several proteins that are known to undergo post-translational famesylation.
• Other farnesylated proteins include the Ras-related GTP-binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin.
• James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also farnesylated. James, et al., have also suggested that there are farnesylated proteins of unknown structure and function in addition to those listed above.
• Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al, Cell, 62:81-88 (1990); Schaber et al, J. Biol Chem., 265: 14701-14704 (1990); Schafer et al, Science, 249: 1133-1139 (1990); Manne et al, Proc. Natl. Acad. Sci USA, 87:7541-7545 (1990)).
• Inhibition of farnesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells.
• direct inhibition of farnesyl- protein transferase would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
• FPTase farnesyl-protein transferase
• FPP farnesyl diphosphate
• Ras protein substrates
• the peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation.
• Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260:1934-1931 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)).
• deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound.
• the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
• farnesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7- 112930).
• the present invention comprises conformationally constrained compounds that do not resemble peptides and which inhibit the farnesyl-protein transferase. Further contained in this invention are chemotherapeutic compositions containing these farnesyl transferase inhibitors and methods for their production.
• the compounds of this invention are useful in the inhibition of farnesyl-protein transferase and the famesylation of the oncogene protein Ras.
• the inhibitors of farnesyl-protein transferase are illustrated by the formula A:
• Rla and Rib are independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, C2- C6 alkynyl, RlOo-, Rl lS(0) m -, R10C(O)NR10-,
• R ⁇ and R3 are independently selected from: H, unsubstituted or substituted Cl-8 alkyl, unsubstituted or substituted C2-8 alkenyl, unsubstituted or substituted C2-8 alkynyl, unsubstituted or substituted aryl,
• R2 and R3 are attached to the same C atom and are combined to form -(CH2)u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(0) m , -NC(O)-, and -N(CORlO)- ;
• R2 and R3 are optionally attached to the same carbon atom
• R4 and R6 are independently selected from: H, Cl-4 alkyl, C3-6 cycloalkyl, heterocycle, aryl, aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) aryl or heterocycle, c) halogen, d) HO, n * ⁇ e » ⁇ O . f) -S ⁇ 2R n , or g) N(RlO) 2 ; or
• R4 and R6 may be joined in a ring
• R5 is selected from: Cl-4 alkyl, C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) aryl or heterocycle, c) halogen,
• R8 is independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, C -
• R9 is selected from: a) hydrogen, b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br, RlOO-,
• R11OC(O)NR10- and c) C1-C6 alkyl unsubstituted or substituted by perfluoroalkyl, F, Cl, Br, RlOo-, RHS(0) m -, R1°C(0)NR10-,
• RIO is independently selected from hydrogen, C1-C14 alkyl, unsubstituted or substituted benzyl and unsubstituted or substituted aryl;
• RU is independently selected from C1-C6 alkyl and unsubstituted or substituted aryl;
• A3 is selected from: a) a bond, b) unsubstituted or substituted aryl, and c) unsubstituted or substituted heteroaryl;
• Gi and G ⁇ are independently selected from: O or H2;
• V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) C 1 -C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C2-C2O alkenyl, provided that V is not hydrogen if Al is S(0)m and V is not hydrogen if Al is a bond, n is 0 and A ⁇ is S(0)m;
• W is a heterocycle
• Z is selected from: 1) an unsubstituted or substituted group selected from aryl, heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl, and heteroarylsulfonyl, wherein the substituted group is substituted with one or more of: a) Cl-4 alkyl, unsubstituted or substituted with: Cl-4 alkoxy, NR 4 R6, C3-6 cycloalkyl, unsubstituted or substituted aryl, heterocycle, HO, -S(0)mR ⁇ or - C(0)NR4R6, b) aryl or heterocycle, c) halogen, d) OR 4 , e) NR4R6, f) CN, g) N02, h) CF3, i) -S(0) m R 5 , j) -C(0)NR 4 R6, or k) C3-C6 cycloalkyl; or
• Rla and Rib are independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, C 2 - C6 alkynyl, RlOo-, Ri lS(0) m -, R1°C(0)NR10-,
• R2 and R3 are independently selected from: H, unsubstituted or substituted Cl-8 alkyl, unsubstituted or substituted C 2 -8 alkenyl, unsubstituted or substituted C 2 -8 alkynyl, unsubstituted or substituted aryl,
• R2 and R3 are attached to the same C atom and are combined to form -(CH2)u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(0) m , -NC(O)-, and -N(CORIO)- ;
• R2 and R are optionally attached to the same carbon atom
• R4 and R6 are independently selected from: H, Cl-4 alkyl, C3 -6 cycloalkyl, heterocycle, aryl, aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) aryl or heterocycle, c) halogen, d) HO,
• R and R6 may be joined in a ring
• R5 is selected from: Cl-4 alkyl, C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with: a) Cl-4 alkoxy, b) aryl or heterocycle, c) halogen,
• R8 is independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, C 2 -
• R9 is selected from: a) hydrogen, b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br, RlOO-, R n S(0)m-, Rl°C(O)NRl0-, (RlO) 2 NC(0)-, Rl0 2 N- C(NRlO)-, CN, N0 2 , RlOC(O)-, N3, -N(RlO) 2 , or
• Rll ⁇ C(O)NRl0-, and c) C1-C alkyl unsubstituted or substituted by perfluoroalkyl,
• Rl is independently selected from hydrogen, C1-C14 alkyl, unsubstituted or substituted benzyl and unsubstituted or substituted aryl;
• RU is independently selected from C1-C6 alkyl and unsubstituted or substituted aryl;
• A is selected from: a) a bond, b) unsubstituted or substituted aryl, or c) unsubstituted or substituted heteroaryl;
• Gl and G ⁇ are independently selected from: O or H 2 ;
• V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) C ⁇ -C 0 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S, and N, and e) C 2 -C20 alkenyl, provided that V is not hydrogen if Al is S(0) m and V is not hydrogen if Al is a bond, n is 0 and A ⁇ is S(0)m;
• W is a heterocycle
• Z is selected from:
• an unsubstituted or substituted group selected from aryl, heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl, heteroarylsulfonyl, wherein the substituted group is substituted with one or more of: a) Cl-4 alkyl, unsubstituted or substituted with: Cl-4 alkoxy, C3-6 cycloalkyl, unsubstituted or substituted aryl, heterocycle, HO, -S(0)mR ⁇ , or -
• n 0, 1, 2, 3 or ⁇ 4
• p 0, 1, 2, 3 or * 4
• q is 1 or 2
• r is 0, 1, 2, 3, 4 , or 5; provided that r is 0 when V is hydrogen; t is 0 or 1; and u is 4 or 5;
• inhibitors of farnesyl-protein transferase are illustrated by the formula C:
• Rla is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
• Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, RlOO-, -N(RlO) 2 , or C2-C6 alkenyl, and c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, C3-C10 cycloalkyl, C 2 -C6 alkenyl, RlOO-, or
• R is selected from H and CH3;
• R2 is selected from: H; O or C 1-5 alkyl, unbranched or branched, unsubstituted or substituted with one or more of:
• R2 and R are optionally attached to the same carbon atom
• R4 and R6 are independently selected from:
• R5 is selected from:
• R8 is independently selected from: a) hydrogen, b) C l -C6 alkyl, C 2 -C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N0 2 , (RlO) 2 N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO) 2 , or RHOC(O)NR10-, and c) C1-C6 alkyl substituted by Cl-C ⁇ perfluoroalkyl, RlOO-, RlOC(0)NRlO-, (RlO) 2 N-C(NRlO)-, RlOc(O)-,
• R ⁇ a and R ⁇ b are independently selected from hydrogen, ethyl, cyclopropyl or methyl;
• R O is independently selected from hydrogen, -C14 alkyl, substituted or unsubstituted benzyl and substituted or unsubstituted aryl;
• RU is independently selected from C1-C6 alkyl and substituted or unsubstituted aryl
• Al is selected from: a bond, -C(O)-, O, -N(R10)-, or S(0) m ;
• A3 is selected from: a) a bond, b) unsubstituted or substituted aryl, and c) unsubstituted or substituted heteroaryl;
• G and G ⁇ are independently selected from: O or H 2 ;
• Y is selected from: a bond or O;
• Z is an unsubstituted or substituted aryl, wherein the substituted aryl is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
• n 0, 1 or 2; n is O or 1; provided that n is not 0 if Al is a bond, O,
• Rla is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
• Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, Rl°0-, -N(RlO) 2 , or C2-C6 alkenyl, and c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, C3-C10 cycloalkyl, C 2 -C6 alkenyl, Rl°0-, or -N(RlO) 2;
• R3 is selected from H and CH3;
• R2 is selected from: H; O or C 1-5 alkyl, unbranched or branched, unsubstituted or substituted with one or more of: 1) aryl, 2) heterocycle,
• R2 and R3 are optionally attached to the same carbon atom
• R 4 and R6 are independently selected from:
• R5 is selected from:
• R ⁇ is independently selected from: a) hydrogen, b) C1-C6 alkyl, C 2 -C6 alkenyl, C -C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, N0 2 ,
• RlO 2 N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO) 2 , or Rl lOC(O)NRl0-, and c) C1-C6 alkyl substituted by Cl -C6 perfluoroalkyl, RlOO-, RlOC(0)NRlO-, (RlO) 2 N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO) 2 , or Rl 1QC(0)NR10-;
• R9a and R9b are independently selected from hydrogen, ethyl, cyclopropyl or methyl;
• RlO is independently selected from hydrogen, C1-C14 alkyl, substituted or unsubstituted benzyl and substituted or unsubstituted aryl;
• RU is independently selected from C1-C6 alkyl and substituted or unsubstituted aryl
• Al is selected from: a bond, -C(O)-, O, -N(R10)-, or S(O) m,
• A is selected from: a) a bond, b) unsubstituted or substituted aryl, and c) unsubstituted or substituted heteroaryl;
• Gi and G ⁇ are independently selected from: O or H 2 ;
• Y is selected from: a bond or O;
• Z is an unsubstituted or substituted aryl, wherein the substituted aryl is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
• n is O or 1 ; provided that n is not 0 if A is a bond, O,
• Rla is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
• R b is independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, RlOO-, -N(RlO) 2 , or C2-C6 alkenyl, and c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, C3-C10 cycloalkyl, C 2 -C6 alkenyl, RlOO-, or
• R3 is selected from H and CH3;
• R2 is selected from: H; O or C 1-5 alkyl, unbranched or branched, unsubstituted or substituted with one or more of:
• R2 and R3 are optionally attached to the same carbon atom
• R 4 and R6 are independently selected from:
• R5 is selected from:
• R8 is independently selected from: a) hydrogen, b) C 1 -C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C l -C6 perfluoroalkyl, F, Cl, RlOO-, R10C(0)NR -, CN, N ⁇ 2, (RlO)2N-C(NRlO)-, RlOC(O)-, RlO ⁇ C(O)-, -N(RlO)2, or RHOC(O)NR10-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-, RlOC(0)NRlO-, (R10) 2 N-C(NR10)-, RlOc(O)-,
• R and R b are independently selected from hydrogen, ethyl, cyclopropyl or methyl;
• RlO is independently selected from hydrogen, C1-C14 alkyl, substituted or unsubstituted benzyl and substituted or unsubstituted aryl;
• R 1 is independently selected from C1-C6 alkyl and substituted or unsubstituted aryl
• Al is selected from: a bond, -C(O)-, O, -N(R10)-, or S(0) m ;
• A3 is selected from: a) a bond, b) unsubstituted or substituted aryl, and c) unsubstituted or substituted heteroaryl;
• G and G ⁇ are independently selected from: O or H2; Y is selected from: a bond or O;
• Z is an unsubstituted or substituted aryl, wherein the substituted aryl is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
• n 0, 1 or 2; n is O or 1; provided that n is not 0 if Al is a bond, O,
• Rla is selected from: hydrogen, C3-C10 cycloalkyl or C1-C6 alkyl;
• Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C10 cycloalkyl, Rl°0-, -N(RlO) 2 , or C 2 -C6 alkenyl, and c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, C3-C10 cycloalkyl, C 2 -C6 alkenyl, RlOO-, or
• R3 is selected from H and CH3;
• R2 is selected from: H; O or C 1-5 alkyl, unbranched or branched, unsubstituted or substituted with one or more of:
• R 4 and R6 are independently selected from:
• R5 is selected from:
• R8 is independently selected from: a) hydrogen, b) C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, RlOO-, R10C(O)NR10-, CN, NO2, (RlO)2N-C(NRlO)-, RlOc(O)-, RlO ⁇ C(O)-, -N(RlO)2, or Rl l ⁇ C(O)NRl0-, and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, RlOO-, Rl0C(O)NRl0-, (R10) 2 N-C(NR10)-, RlOc(O)-, Rl ⁇ C(O)-, -N(RlO) 2 , or Ri 10C(0)NR10- ;
• R9a and R9b are independently selected from hydrogen, ethyl, cyclopropyl or methyl;
• R O is independently selected from hydrogen, C1-C14 alkyl, substituted or unsubstituted benzyl and substituted or unsubstituted aryl;
• RU is independently selected from C1-C6 alkyl and substituted or unsubstituted aryl;
• Al is selected from: a bond, -C(O)-, O, -N(R10)-, or S(0) m ;
• A3 is selected from: a) a bond, b) unsubstituted or substituted aryl, and c) unsubstituted or substituted heteroaryl;
• Gi and G ⁇ are independently selected from: O or H 2 ;
• Y is selected from: a bond or O;
• Z is an unsubstituted or substituted aryl, wherein the substituted aryl is substituted with one or more of the following: a) Cl-4 alkyl, unsubstituted or substituted with:
• the compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention.
• any variable e.g. aryl, heterocycle, R , R2 etc.
• its definition on each occurence is independent at every other occurence.
• combinations of substituents/or variables are permissible only if such combinations result in stable compounds.
• alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms; “alkoxy” represents an alkyl group of indicated number of carbon atoms attached through an oxygen bridge.
• Halogen or “halo” as used herein means fluoro, chloro, bromo and iodo.
• aryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic.
• aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl or acenaphthyl.
• aroyl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and at least one ring is attached to a carboxy. Examples of such aroyl elements include benzoyl and naphthoyl.
• heterocycle or heterocyclic represents a stable 5- to 7-membered monocyclic or stable 8- to 11- membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring.
• the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure.
• heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazolyl,
• heteroaryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S.
• heterocyclic elements include, but are not limited to, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolyl, quinazolin
• heteroaroyl is intended to mean any stable monocylic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and at least one ring is attached to a carboxy, and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O and S.
• heteroaroyl elements include furoyl, thienoyl, pyrroloyl and nicotinoyl.
• the substituted group is intended to mean a substituted Cl-8 alkyl, substituted C 2 _8 alkenyl, substituted C 2 -8 alkynyl, substituted aryl or substituted heterocycle from which the substitutent(s) R ⁇ and R3 are selected.
• substituted aryl As used herein, the terms “substituted aryl”, “substituted heteroaryl”, “substituted heterocycle”, and “substituted cycloalkyl” are intended to include the cyclic group which is substituted with 1 or 2 substituents selected from the group which includes but is not limited to F, Cl, Br, CF3, NH 2 , N(Cl-C6 alkyl) 2 , N ⁇ 2, CN, (C1-C6 alkyl)0-, - OH, (C1-C6 alkyl)S(0)m-, (C1-C6 alkyl)C(0)NH-, H 2 N-C(NH)-, (C1-C6 alkyl)C(O)-, (C1-C6 alkyl)OC(O)-, N3,(Cl-C6 alkyl)OC(0)NH- and C1-C2O alkyl.
• substituents selected from the group which includes but is not limited to F,
• substituted Cl-4 alkyl, substituted C3-6 cycloalkyl, substituted aroyl, substituted aryl, substituted heteroaroyl, substituted arylsulfonyl, substituted heteroarylsulfonyl and substituted heterocycle include moieties containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound.
• cyclic moieties are formed.
• examples of such cyclic moieties include, but are not limited to:
• cyclic moieties may optionally include a heteroatom(s).
• heteroatom-containing cyclic moieties include, but are not limited to:
• cyclic amine and amide moieties are formed.
• examples of such cyclic moieties include, but are not limited to:
• Such cyclic moieties may optionally include another heteroatom(s).
• heteroatom-containing cyclic amine moieties include, but are not limited to:
• Lines drawn into the ring systems from substituents indicate that the indicated bond may be attached to any of the substitutable ring carbon atoms.
• Rla and R b are independently selected from: hydrogen, -N(R 10 ) 2 , R1°C(O)NR10- or unsubstituted or substituted C * i- C6 alkyl wherein the substituent on the substituted Cl-C6 alkyl is selected from unsubstituted or substituted phenyl, -N(RlO) , RlOo- and R!0C(O)NR10-.
• NR R 6 OR
• R ⁇ is selected from: H; O O and Cl-5 alkyl, unbranched or branched, unsubstituted or substituted wherein the substituted group is substituted with one or more of:
• R3 is selected from: hydrogen and Cl-C6 alkyl.
• R4 and R6 is selected from: hydrogen, unsubstituted or substituted Cl-C6 alkyl, unsubstituted or substituted aryl and unsubstituted or substituted cycloalkyl.
• R5 is unsubstituted or substituted Cl-C6 alkyl, unsubstituted or substituted aryl and unsubstituted or substituted cycloalkyl.
• R9 is hydrogen, chloro or methyl. Most preferably, R is hydrogen.
• RlO is selected from H, Cl-C6 alkyl and benzyl.
• Al and A ⁇ are independently selected from: a bond, -C(O)NRl0-, -NR10C(O)-, O, -N(R10)-, -S(0) 2 N(R10)_ an d-
• A3 is selected from a bond, unsubstituted or substituted aryl and unsubstituted or substituted heteroaryl.
• at least one of Gl or G ⁇ is oxygen.
• W is selected from imidazolinyl, imidazolyl, oxazolyl, pyrazolyl, pyyrolidinyl, thiazolyl and pyridyl. More preferably, W is selected from imidazolyl and pyridyl.
• X is a bond, CH 2 or CO.
• V is selected from hydrogen, heterocycle and aryl. More preferably, V is phenyl.
• Z is selected from unsubstituted or substituted phenyl, unsubstituted or substituted naphthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted furanyl and unsubstituted or substituted thienyl. More preferably, Z is unsubstituted or substituted phenyl.
• n and r are independently 0, 1, or 2.
• p is 1, 2 or 3.
• t is 1.
• V - A 1 (CR 1 a 2 ) n A 2 (CR 1 a 2 ) n (CR 1 b 2 ) p - X -(CR 1 b 2 fe is selected from:
• any substituent or variable e.g., Rla, R ? n , etc.
• - N(Rl0) 2 represents -NHH, -NHCH3, -NHC2H5, etc.
• substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
• the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
• such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, gly colic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
• the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
• Reactions used to generate the compounds of this invention are prepared by employing reactions as shown in the Schemes 1-15, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures.
• Schemes 1-15 The requisite intermediates are in some cases commercially available, or can be prepared according to literature procedures, for the most part.
• Final compounds can be generally prepared by reductive coupling or acylation of the requisite nitrogen-containing heterocycle with an aldehyde or carboxylic acid, respectively.
• Scheme 1 illustrates the synthesis of an imidazole carboxaldehyde by selective N-alkylation chemistry. 4-hydroxy- methylimidazole can be converted to the acetate I by standard procedures, and can be reacted with an alkyl halide, then treated with refluxing methanol to provide the regiospecifically alkylated imidazole II. The ester is hydrolyzed and the resulting alcohol oxidized to provide the aldehyde III.
• Scheme 2 illustrates the synthesis of a representative bicyclic nitrogen-containing heterocycle synthon from a functionalized piperazinone, and its coupling with an aldehyde to give a final product.
• Homoserine lactone is used to prepare a Boc-protected diamine IV via protection, diisobutylaluminum hydride reduction, and reductive amination with an amine.
• Intermediate IV may then be acylated with chloroacetyl chloride and cyclized with base to provide piperazinone V.
• the hydroxyl moiety of V may be converted to a methanesulfonate leaving group, then cyclized with lithium hexamethyldisilazide, to provide the protected bicyclic amine VI.
• Acid-promoted deprotection to provide VII may be followed by reductive coupling with a variety of aldehydes such as III to give compound VIII.
• the reductive alkylation can be accomplished at a pH of about 4 to about 7 with a variety of reducing agents, such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane, methanol or dimethylformamide.
• the final product XI is isolated in the salt form, for example, as a trifiuoroacetate, hydrochloride or acetate salt, among others.
• Scheme 3 illustrates the synthesis of an alternative variation of bicyclic nitrogen-containing heterocycle, and its coupling with an aldehyde to give a final product.
• a protected amine such as IX may be aminoethylated at the nitrogen by either heating with an oxazolidinone followed by N-protection, or by reductive amination of an amino aldehyde to provide X.
• the amino aldehydes can be prepared by standard procedures, such as that described by O. P. Goel et al. (Organic Syntheses. 1988, 67, 69-75), from the appropriate amino acids.
• the protected diamine X may be acylated with chloroacetyl chloride and cyclized with base to provide piperazinone XI.
• XII Deprotection of the ether group to give XII is followed by arylation and reduction to give an alcohol XIII.
• the hydroxyl moiety of XIII may be converted to a methanesulfonate leaving group, then cyclized with lithium hexamethyldisilazide, to provide the protected bicyclic amine XIV.
• Acid-promoted deprotection to provide XV may be followed by reductive coupling with an aldehyde such as III to give compound XVI.
• Scheme 4 illustrates the synthesis of a similar bicyclic nitrogen-containing heterocycle, and its coupling with an aldehyde to give a final product.
• Alkylation of XVII with l-chloro-3-iodopropane is followed by the Finkelstein reaction to give XVIII.
• Cyclization gives the alkyl-bridged compound XIX, and deprotection followed by reductive coupling with an aldehyde yields compound XXI.
• Scheme 5 shows the oxidation of an aldehyde of interest (e.g. Ill) to the corresponding carboxylic acid (e.g. XXII ), which may be coupled to an amine using well known amide-forming reactions.
• an aldehyde of interest e.g. Ill
• carboxylic acid e.g. XXII
• Scheme 6 piperazine XXIV (Scheme 6), prepared by lithium aluminum hydride reduction of piperazinone intermediate XXIII, may be coupled to carboxylate XXII to provide the amide XXV.
• final product XXVIII can be prepared by deprotection of the amino groups.
• the diamine product XXVIII can further be selectively protected to obtain XXIX, which can subsequently be reductively alkylated with a second aldehyde to obtain XXX. Removal of the protecting group and conversion to cyclized products such as the dihydroimidazole XXXII can be accomplished by literature procedures.
• the protecting group can be subsequently removed to unmask the alcohol XXXV.
• the alcohol can be oxidized under standard conditions (e.g. an aldehyde), which can then be reacted with a variety of organometallic reagents such as Grignard reagents, to obtain secondary alcohols such as XXXVII.
• the fully deprotected amino alcohol XXXVIII (Scheme 9) can be reductively alkylated (under conditions described previously) with a variety of aldehydes to obtain secondary amines, such as IXL, or tertiary amines.
• the Boc protected amino alcohol XXXV can also be utilized to synthesize 2-aziridinylmethylamines such as XL (Scheme 10). Treating XXXV with l,l'-sulfonyldiimidazole and sodium hydride in a solvent such as dimethylformamide leads to the formation of aziridine XL. The aziridine reacts in the presence of a nucleophile, such as a thiol, in the presence of base to yield, after deprotection, the ring- opened sulfide product XLI.
• a nucleophile such as a thiol
• intermediate XX can be reacted with aldehydes derived from amino acids such as O-alkylated tyrosines, according to standard procedures, to obtain compounds such as XLIV as shown in Scheme 11.
• R' is an aryl group
• XLIV can first be hydrogenated to unmask the phenol, and the amine group deprotected with acid to produce XLV.
• the amine protecting group in XLIV can be removed, and O-alkylated phenolic amines such as XLVI produced.
• the instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer.
• Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin (NF-1), neu, ser, abl, lck, fyn) or by other mechanisms.
• the compounds of the instant invention inhibit farnesyl- protein transferase and the famesylation of the oncogene protein Ras.
• the instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575- 4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of blindness related to retinal vascularization.
• the compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment.
• a component of NF- 1 is a benign proliferative disorder.
• the instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256: 1331-1333 (1992).
• the compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1:541-545(1995).
• the instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et ⁇ X.FASEB Journal, 2:A3160 (1988)).
• the instant compounds may also be useful for the treatment of fungal infections.
• the compounds of this instant invention are selective inhibitors of farnesyl- protein transferase.
• a compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl- protein transferase inhibitory activity, as assessed by the assay described in Example 5, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 6.
• a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
• the compounds of this instant invention are dual inhibitors of farnesyl- protein transferase and geranylgeranyl-protein transferase type I.
• Such a dual inhibitor will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed.
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 12 ⁇ M against K4B-Ras dependent activation of MAP kinases in cells.
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) against K4B-Ras dependent activation of MAP kinases in cells which is more than about 5 times lower than the inhibitory activity (IC50) against Myr-Ras dependent activation of MAP kinases in cells. Also more preferably, in a SEAP assay, the dual inhibitor compound has an inhibitory activity (IC50) that is less than about 10 nM against H-Ras dependent activation of MAP kinases in cells.
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 5 ⁇ M against transfer of a geranylgeranyl residue to a protein or peptide substrate comprising a CAAXG motif by geranylgeranyl-protein transferase type I in the presence of a modulating anion.
• IC50 in vitro inhibitory activity
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about 1 ⁇ M against transfer of a geranylgeranyl residue to a protein or peptide substrate comprising a CAAXG motif by geranylgeranyl-protein transferase type I in the presence of a modulating anion.
• IC50 in vitro inhibitory activity
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) in the in vitro assay as described in Example 5 that is less than about 1 ⁇ M against transfer of a farnesyl residue to a protein or peptide substrate, comprising a CAAXF motif, by farnesyl-protein transferase.
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) that is less than about lOOnM against transfer of a farnesyl residue to a protein or peptide substrate, comprising a CAAX ⁇ motif, by farnesyl-protein transferase.
• IC50 in vitro inhibitory activity
• the dual inhibitor compound has an in vitro inhibitory activity (IC50) in the in vitro assay as described in Example 8, that is less than about 100 nM against the anchorage independent growth of H-ra- ⁇ -transformed mammalian fibroblasts.
• the protein or peptide substrate utilized in the instant assay may incorporate any CAAX motif that is geranylgeranylated by
• GGTase-I GGTase-I.
• CAAX will refer to such motifs that may be geranylgeranylated by GGTase-I. It is understood that some of the
• CAAX containing protein or peptide substrates may also be farnesylated by farnesyl-protein transferase.
• farnesyl-protein transferase a protein or peptide substrates
• CAAX motifs include (the corresponding human protein is in parentheses): CVIM (K4B-Ras) (SEQ.ID.NO.: 1), CVLL (mutated H-
• Ras SEQ.ID.NO.: 4
• CLLL Rap-IA
• CQLL Rap- IB
• CSIM SEQ.ID.NO.: 7
• CAIM CAIM
• CKVL (SEQ.ID.NO.: 9) and CLIM (PFX) (SEQ.ID.NO.: 10).
• CAAX motif is CVIM (SEQ.ID.NO.: 1).
• CAAX is used to designate a protein or peptide substrate that incorporates four amino acid C- terminus motif that is farnesylated by farnesyl-protein transferase. It is
• CAAX containing protein or peptide substrates may also be geranylgeranylated by GGTase-I.
• GGTase-I geranylgeranylated by GGTase-I.
• CAAX motifs include (the corresponding human protein is in parentheses): CVLS (H-ras) (SEQ.ID.NO.: 11), CVIM (K4B-Ras)
• the compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers or diluents, optionally with known adjuvants, such as alum, in a pharmaceutical composition, according to standard pharmaceutical practice.
• the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
• a chemotherapeutic compound according to this invention the selected compound may be administered, for example, in the form of tablets or capsules, or as an aqueous solution or suspension.
• carriers which are commonly used include lactose and corn starch, and lubricating agents, such as magnesium stearate, are commonly added.
• useful diluents include lactose and dried corn starch.
• aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring agents may be added.
• sterile solutions of the active ingredient are usually prepared, and the pH of the solutions should be suitably adjusted and buffered.
• the total concentration of solutes should be controlled in order to render the preparation isotonic.
• the compounds of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
• the instant compounds may be useful in combination with known anti-cancer and cytotoxic agents.
• the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restinosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections. If formulated as a fixed dose, such combination products employ the compounds of this invention within the dosage range described below and the other pharmaceutically active agent(s) within its approved dosage range.
• Compounds of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a combination formulation is inappropriate.
• compositions useful in the treatment of cancer comprising the administration of a therapeutically effective amount of the compounds of this invention, with or without pharmaceutically acceptable carriers or diluents.
• suitable compositions of this invention include aqueous solutions comprising compounds of this invention and pharmacologically acceptable carriers, e.g., saline, at a pH level, e.g., 7.4.
• pharmacologically acceptable carriers e.g., saline
• the solutions may be introduced into a patient's blood-stream by local bolus injection.
• composition is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
• compositions of the instant invention may alternatively or in addition comprise a farnesyl pyrophosphate-competitive inhibitor.
• the compounds disclosed in the following patents and publications may be useful as farnesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Ser. Nos. 08/254,228 and 08/435,047.
• administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously.
• the protein substrate-competitive inhibitor and farnesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods.
• the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, and response of the individual patient, as well as the severity of the patient's symptoms.
• a suitable amount of compound is administered to a mammal undergoing treatment for cancer.
• Administration occurs in an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
• the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl-protein transferase (FPTase) in a composition.
• FPTase farnesyl-protein transferase
• the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention.
• the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques. Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
• potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample.
• a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl-protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and farnesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention.
• concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
• concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
• Step A Preparation of l-triphenylmethyl-4-(hydroxymethyl)- imidazole
• 4- (hydroxy methyl)imidazole hydrochloride 35.0 g, 260 mmol
• triethylamine 90.6 mL, 650 mmol
• a white solid precipitated from the solution.
• Chlorotriphenylmethane (76.1 g, 273 mmol) in 500 mL of DMF was added dropwise. The reaction mixture was stirred for 20 hours, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the titled product as a white solid which was sufficiently pure for use in the next step.
• Step B Preparation of l-triphenylmethyl-4-(acetoxymethyl)- imidazole
• Step A Alcohol described in Step A (260 mmol, prepared above) was suspended in 500 mL of pyridine. Acetic anhydride (74 mL, 780 mmol) was added dropwise, and the reaction was stirred for 48 hours during which it became homogeneous. The solution was poured into 2 L of EtOAc, washed with water (3 x 1 L), 5% aqueous HCI solution (2 x 1 L), saturated aqueous NaHC03, and brine, then dried (Na 2 S04), filtered, and concentrated in vacuo to provide the crude product. The acetate was isolated as a white powder which was sufficiently pure for use in the next reaction. Step C: Preparation of l-(4-cyanobenzyl)-5-(acetoxymethyl)- imidazole hvdrobromide
• the filtrate was concentrated in vacuo to a volume of 100 mL, reheated at 60 °C for another two hours, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in 500 mL of methanol, and warmed to 60 °C. After two hours, the solution was reconcentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the titled product hydrobromide as a white solid which was used in the next step without further purification.
• Step D Preparation of l-(4-cyanobenzyl)-5-(hydroxymethyl)- imidazole
• Step E Preparation of l-(4-cyanobenzyl)-5-imidazole carboxaldehvde
• Step F Preparation of (S)-4-(tet -butoxycarbonyl)-5-(2- hydroxyethyl -l-(3-trifluoromethylphenyl piperazin-2-one
• the titled compound was prepared from (S)-4-benzyloxy-
• Step G Preparation of (S)-4-(t-?rt-butoxycarbonyl)-5-[2- (methanesulfonyloxy)ethyl]-l-(3- trifluoromethylphenyl)piperazin-2-one
• Step H Preparation of l(R),5(S)-8-(r-?r ⁇ -butoxycarbonyl)-3-[(3- trifluoromethyl)phenyl]-3,8-diaza-2- oxobicy clor3.2.11 octane
• Step I Preparation of l(R),5(S)-3-[(3-trifluoromethyl)phenyl]-3,8- diaza-2-oxobicyclo
• Step J Preparation of l(R),5(S)-3-[(3-trifluoromethyl)phenyl]-8-
• Step A Preparation 2-r(3.4-dichlorobenzyl)oxy1nitrobenzene
• 3-fluorobenzaldehyde 14.9 mL, 141 mmol
• potassium carbonate 39.0 g, 282 mmol
• the DMF was removed in vacuo, and the resulting product was taken up in EtOAc/water.
• the organic phase was washed with brine, dried (Na 2 SO- t ), filtered, and concentrated in vacuo to provide the titled compound which was used in the next reaction without further purification.
• Step C Preparation of -V-[2-((3,4-dichlorobenzyl)- oxy phenyllethylenediamine A solution of the aniline hydrochloride described in Step B
• Step D Preparation of N-(tert-butoxycarbonyl)--V[2-((3,4- dichlorobenzyl)-oxy phenyllethylenediamine
• Step C The product described in Step C (20.8 g, 66.8 mmol) was taken up in 50 mL of THF and 50 mL of saturated aqueous NaHC ⁇ 3 solution, and cooled to 0 °C. Di-terf-butylpyrocarbonate (14.6 g, 66.8 mmol) was added, and the solution was allowed to warm to room temperature. After 3.5 h, the reaction was poured into EtOAc, washed with water and brine, dried (Na2S04), filtered, and concentrated in vacuo to provide the titled carbamate which was used in the next step without further purification.
• Step E Preparation of N-[2-(t ⁇ butoxycarbamoyl)ethyl]--V'-[2- ff3.4-dichlorobenzylVoxy phenvI1-2-chloroacetamide
• the product described in Step D (20.3 g, 49.4 mmol) was taken up in 150 mL of THF and 100 mL of saturated aqueous NaHC ⁇ 3 solution, and cooled to 0 °C.
• Chloroacetylchloride (4.4 mL, 54.4 mmol) was added dropwise, and the solution was stirred for two hours.
• Step F Preparation of 4-(?-?r. * -butoxycarbonyl)-l-[2-((3,4- dichlorobenzyl -oxy)phenyll-2-piperazinone
• Step G Preparation of 4-( rt-butoxycarbonyl)-l -(2- hydroxyphenyl -2-piperazinone
• Step F To a solution of the piperazinone described in Step F (2.00 g, 4.43 mmol) in 25 mL of methylene chloride was added sodium iodide (2.0 g, 13.3 mmol), and the solution was cooled to -15 °C. Solid AlBr3 was added (2.4 g, 8.9 mmol), and the solution was allowed to warm to room temperature and stir overnight. The reaction was diluted with 25 mL methylene chloride and 50 mL saturated NaHC03 solution, and di- tert-butylpyrocarbonate (1.95 g, 8.9 mmol) was added at room temperature.
• Step H Preparation of 4-( rf-butoxycarbonyl)-l-[2-((3- chloropropyl oxy phenyll-2-piperazinone
• Step I Preparation of 4-( rr ⁇ butoxycarbonyl)-l-[2-((3- iodopropyl oxy phenyl1-2-piperazinone
• Step J Preparation of ( ⁇ )-9-(tert-butoxycarbonyl)- ?-benzo-l,9- diaza-4-oxa- 12-oxobicycIof 6.3.1 ldodecane
• Step K Preparation of ( ⁇ )--?-benzo- 1 ,9-diaza-4-oxa- 12- oxobicyclor6.3.11dodecane hydrochloride
• Step L Preparation of ( ⁇ )-9-[l-(4-cyanobenzyl)-5- imidazolylmethyl]--?-benzo- 1 ,9-diaza-4-oxa- 12- oxobicyclor6.3.11dodecane dihvdrochloride
• Step A Preparation of 4-(terf-butoxycarbonyl)-l-[2-((2- formylphenyl)oxy phenyll-2-piperazinone
• Step B Preparation of 4-( r butoxycarbonyl)-l-[2-((2- hydroxymethylphenyl oxy phenyl ⁇ -2-piperazinone
• Step C Preparation of 4-(r-?rf-butoxycarbonyl)-l-[2-((2- methanesulfonyloxymethylphenyl)oxy)phenyl]-2- piperazinone To a solution of the alcohol described in Step B (105 mg,
• Step D Preparation of ( ⁇ )-9-(te ⁇ butoxy carbonyl)-l, 9-diaza-&, e- dibenzo-4-oxa-12-oxobicvclo.6.3. ⁇ dodecane
• Step E Preparation of ( ⁇ )-l,9-diaza-Z?,-?-dibenzo-4-oxa-12- oxobicyclof6.3.11dodecane hydrochloride
• Step F Preparation of ( ⁇ )-9-[l-(4-cyanobenzyl)-5- imidazolylmethyl]- 1 ,9-diaza-Z?, e-dibenzo-4-oxa- 12- oxobicvclor6.3.11dodecane dihydrochloride
• Step E To a solution of the amine hydrochloride described in Step E (ca. 0.054 mmol) in 1 mL of 1,2-dichloroethane at 0 °C was added 4 A powdered molecular sieves (50 mg), followed by sodium triacetoxyborohydride (28 mg, 0.13 mmol).
• the aldehyde described in Step E of Example 1 (15 mg, 0.071 mmol) was added, and the reaction was allowed to warm to room temperature. After 16 hours, the reaction was poured into EtOAc, washed with saturated aqueous NaHC0 3 and brine, dried (Na2SO- , filtered, and concentrated in vacuo.
• Step A Preparation of l-(4-cyanobenzyl)-5-imidazolecarboxylic acid sodium salt
• Step B Preparation of ( ⁇ )-l,9-diaza--?,e-dibenzo-4- oxabicvclor6.3.1 Idodecane
• Step C Preparation of ( ⁇ )-9-[l-(4-cyanobenzyl)-5- imidazolylcarbonyl]- 1 ,9-diaza-fr, e-dibenzo-4-oxa- bicyclor6.3.ndodecane hydrochloride
• Bovine FPTase was assayed in a volume of 100 ml containing 100 mM 7V-(2-hydroxy ethyl) piperazine--V-(2-ethane sulfonic acid) (HEPES), pH 7.4, 5 mM MgCl2, 5 mM dithiothreitol
• DTT 100 mM [3H]-farnesyl diphosphate ([3HJ-FPP; 740 CBq/mmol, New England Nuclear), 650 nM Ras-CVLS and 10 mg/ml FPTase at 31 °C for 60 min. Reactions were initiated with FPTase and stopped with 1 ml of 1.0 M HCL in ethanol. Precipitates were collected onto filter-mats using a TomTec Mach II cell harvestor, washed with 100% ethanol, dried and counted in an LKB b-plate counter. The assay was linear with respect to both substrates, FPTase levels and time; less than 10% of the [3H]-FPP was utilized during the reaction period.
• the modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature.
• a typical reaction contains (in a final volume of 50 mL): [ 3 H] geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl 2 , 10 mM ZnCl 2 ,
• the GGTase-type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, incorporated by reference.
• the Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl- GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: 13).
• Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 mL of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter. For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulf oxide and then diluted 25 -fold into the enzyme assay mixture. IC 50 values are determined with Ras peptide near KM concentrations. Enzyme and nonsaturating substrate conditions for inhibitor IC 50 determinations are as follows: 75 pM GGTase-I, 1.6 mM Ras peptide, 100 nM geranylgeranyl diphosphate. EXAMPLE 7
• the cell lines used in this assay consist of either Ratl or NIH3T3 cells transformed by either viral H-ras; an N-ras chimeric gene in which the C-terminal hypervariable region of viral-H-ras was substituted with the corresponding region from the N-ras gene; or ras-CVLL, a viral-H-ras mutant in which the C-terminal exon encodes leucine instead of serine, making the encoded protein a substrate for geranylgeranylation by GGTase-I.
• the assay can also be performed using cell lines transformed with human H-ras, N-ras or K4B-ras.
• the assay is performed essentially as described in DeClue, J.E. et al., Cancer Research 51:712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound(s) (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%). After 4 hours at 37°C, the cells are labelled in 3 ml methionine-free DMEM supplemented with 10% regular DMEM, 2% fetal bovine serum, 400 mCi[35S]methionine (1000 Ci/mmol) and test compound(s).
• lovastatin a compound that blocks Ras processing in cells by inhibiting the rate-limiting step in the isoprenoid biosynthetic pathway (Hancock, J.F. et al. Cell, 57: 1167 (1989); DeClue, J.E. et al. Cancer Res., 51:712 (1991); Sinensky, M. et al. J. Biol Chem., 265: 19937 (1990)), serve as a positive control in this assay.
• the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/lmM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min.
• the media is removed, the cells washed, and 3 ml of media containing the same or a different test compound added. Following an additional 16 hour incubation, the lysis is carried out as above.
• the immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-100.0.5% deoxycholate/0.1%/SDS/0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to prenylated and nonprenylated Ras proteins are compared to determine the percent inhibition of prenyl transfer to protein.
• IP buffer 20 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-100.0.5% deoxycholate/0.1%/SDS/0.1 M NaCl
• SALSA Soft Agar-Like Surrogate Assay measures the inhibition of anchorage-independent growth by prenyl-transf erase inhibitors. Only transformed cells are able to grow anchorage- independently in the SALSA format. Additionally, cells growing in the SALSA format grow in clumps, resembling the colonies formed in soft agar. SALSA may been used to measure the growth inhibition by prenyl-transferase inhibitors in a variety of transformed cell lines, including Ratl fibroblasts transformed with viral-H-ras (H-ras/ratl), as well as a panel of human tumor cell lines (HTL's).
• SALSA is performed in 96-well plates that are coated with a thin film of the polymer, PolyHEMA (Poly(2-hydroxyethyl methacrylate)), which prevents cells from attaching to the plate.
• Ratl fibroblast cells transformed with v-Ha-ras (this cell line has been deposited in the ATCC on August 19, 1997 under the terms of the Budapest convention and has been given a designation of ATCC 12387) are seeded at 5000 cells/well, grown for 4 hr, then vehicle or half-log dilutions of test compound (in either an 8 or 12 point titration) are added. The cells are then grown for 6 days at 37 degrees, without changing the growth media or adding fresh compound.
• cell growth is assessed via a colorimetric assay that measures the cleavage of the tetrazolium dye, MTT, to an insoluble purple formazan, a reaction dependent upon mitochondrial dehydrogenases.
• MTT tetrazolium dye
• SDS is added to 9% w/v to lyse the cells and solubilize the insoluble MTT-formazan.
• the amount of MTT metabolism is quantitated via spectrophotometric detection at 570 nM. Dose-inhibition curves and IC 50 's are determined.
• the SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI.
• the SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA).
• the plasmid pCMV- RE-AKI was constructed by Deborah Jones (Merck) and contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovims immediate early promoter.
• the plasmid also contains a bovine growth hormone poly- A sequence.
• the plasmid, pDSElOO was constructed as follows.
• a restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2-Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment.
• the vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme B gill and the ends filled in with Klenow DNA Polymerase I.
• the SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E.
• coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
• a DNA fragment containing viral-H-ras can be PCRed from plasmid "H-l” (Ellis R. et al. J. Virol. 36, 408, 1980) using the following oligos.
• Antisense 5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3'. (SEQ.ID.NO.: 15)
• the sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
• cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo.
• the PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end.
• the Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid in which the recombinant myr- viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
• a viral-H-ras clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "H-l" (Ellis R. et al. J. Virol. 36, 408, 1980) by PCR using the following oligos.
• Sense strand
• Antisense strand
• the sense strand oligo optimizes the 'Kozak' sequence and adds an Xhol site.
• the antisense strand mutates serine 189 to leucine and adds an Xbal site.
• the PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol-Xbal cut vector pCI (Promega). This results in a plasmid in which the mutated viral-H-ra -CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
• the human c-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
• Antisense strand
• the primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
• the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
• the mutated c-H-ra -Leu61 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
• the new recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from the CMV promoter of the pCI vector.
• the human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
• Antisense strand
• the primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end.
• the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glycine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 23)
• the mutated c-N-ras-Val-12 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I.
• the new recombinant plasmid will constitutively transcribe c-N-ras-Val-12 from the CMV promoter of the pCI vector.
• the human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
• Antisense strand
• the primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I stite at the C-terminal end.
• the c-K-ras fragment can be ligated into a Kpnl -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
• the mutated c-K-ras-Val-12 can be excised from the pAlter-1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I.
• the new recombinant plasmid will constitutively transcribe c-K-ras-Val-12 from the CMV promoter of the pCI vector.
• Human C33A cells (human epitheial carcenoma - ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf semm + IX Pen/Strep + IX glutamine + IX NEAA. Cells are grown at 37°C in a 5% C ⁇ 2 atmosphere until they reach 50 -80% of conflunecy.
• the transient transfection is performed by the CaP04 method (Sambrook et al., 1989).
• expression plasmids for H-ras, N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE-SEAP reporter construct.
• 600ml of CaCl 2 -DNA solution is added dropwise while vortexing to 600ml of 2X HBS buffer to give 1.2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red; Gibco cat.
• the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin.
• the 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM + 0.2% charcoal stripped calf semm + IX (Pen/Strep, Glutamine and NEAA ).
• Transfected cells are plated in a 96 well microtiter plate (lOOml well) to which drug, diluted in media, has already been added in a volume of lOOml. The final volume per well is 200ml with each drug concentration repeated in triplicate over a range of half-log steps.
• Incubation of cells and dmgs is for 36 hrs at 37° under C02- At the end of the incubation period, cells are examined microscopically for evidence of cell distress.
• 100ml of media containing the secreted alkaline phosphatase is removed from each well and transferred to a microtube array for heat treatment at 65°C for 1 hr to inactivate endogenous alkaline phosphatases (but not the heat stable secreted phosphatase).
• the heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD® (Tropix, Bedford, Mass.).
• a volume of 50 ml media is combinRased with 200 ml of CSPD cocktail and incubated for 60 minutes at room temperature. Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter constmct stimulated by the transiently expressed protein.
• Rodent fibroblasts transformed with oncogenically mutated human Ha- ras or Ki-ras (10 6 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0.
• the mice in each oncogene group are randomly assigned to a vehicle, compound or combination treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment.
• the farnesyl-protein transferase inhibitor may be administered by a continuous infusion pump.
• Compound, compound combination or vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Pharmacology & Pharmacy (AREA)
• Life Sciences & Earth Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• General Health & Medical Sciences (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Applications Claiming Priority (5)

Publications (2)

Family

ID=26313359

Family Applications (1)

Country Status (4)

Families Citing this family (6)

Citations (2)

• 1998
  • 1998-10-13 WO PCT/US1998/021599 patent/WO1999020609A1/en not_active Application Discontinuation
  • 1998-10-13 CA CA002306312A patent/CA2306312A1/en not_active Abandoned
  • 1998-10-13 AU AU96951/98A patent/AU9695198A/en not_active Abandoned
  • 1998-10-13 EP EP98951061A patent/EP1023270A4/de not_active Withdrawn

Patent Citations (2)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events