AU3248600A - Inhibitors of prenyl-protein transferases - Google Patents

Description

WO 00/51614 PCT/USOO/05354 TITLE OF TEE INVENTION INHIBITORS OF PRENYL-PROTEIN TRANSFERASES BACKGROUND OF THE INVENTION 5 The present invention relates to certain compounds that are useful for the inhibition of prenyl-protein transferases and the treatment of cancer. In particular, the invention relates to prenyl-protein transferase inhibitors which are efficacious in vivo as inhibitors of geranylgeranyl-protein transferase type I (GGTase-I) and that inhibit the cellular processing of both the H-Ras protein and the K4B-Ras protein. 10 Prenylation of proteins by prenyl-protein transferases represents a class of post-translational modification (Glomset, J. A., Gelb, M. H., and Farnsworth, C. C. (1990). Trends Biochem. Sci. 15, 139-142; Maltese, W. A. (1990). FASEB J. 4, 3319 3328). This modification typically is required for the membrane localization and function of these proteins. Prenylated proteins share characteristic C-terminal 15 sequences including CAAX (C, Cys; A, an aliphatic amino acid; X, another amino acid), XXCC, or XCXC. Three post-translational processing steps have been described for proteins having a C-terminal CAAX sequence: addition of either a 15 carbon (farnesyl) or 20 carbon (geranylgeranyl) isoprenoid to the Cys residue, proteolytic cleavage of the last 3 amino acids, and methylation of the new C-terminal 20 carboxylate (Cox, A. D. and Der, C. J. (1992a). Critical Rev. Oncogenesis 3:365-400; Newman, C. M. H. and Magee, A. I. (1993). Biochim. Biophys. Acta 1155:79-96). Some proteins may also have a fourth modification: palmitoylation of one or two Cys residues N-terminal to the farnesylated Cys. While some mammalian cell proteins terminating in XCXC are carboxymethylated, it is not clear whether carboxy 25 methylation follows prenylation of proteins terminating with a XXCC motif (Clarke, S. (1992). Annu. Rev. Biochem. 61, 355-386). For all of the prenylated proteins, addition of the isoprenoid is the first step and is required for the subsequent steps (Cox, A. D. and Der, C. J. (1992a). Critical Rev. Oncogenesis 3:365-400; Cox, A. D. and Der, C. J. (1992b) Current Opinion Cell Biol. 4:1008-1016). 30 Three enzymes have been described that catalyze protein prenylation: farnesyl-protein transferase (FPTase), geranylgeranyl-protein transferase type I (GGPTase-I), and geranylgeranyl-protein transferase type-II (GGPTase-II, also called Rab GGPTase). These enzymes are found in both yeast and mammalian cells (Clarke, 1992; Schafer, W. R. and Rine, J. (1992) Annu. Rev. Genet. 30:209-237). -1- WO 00/51614 PCT/USOO/05354 Each of these enzymes selectively uses farnesyl diphosphate or geranyl-geranyl diphosphate as the isoprenoid donor and selectively recognizes the protein substrate. FPTase farnesylates CaaX-containing proteins that end with Ser, Met, Cys, Gln or Ala. For FPTase, CaaX tetrapeptides comprise the minimum region required for 5 interaction of the protein substrate with the enzyme. The enzymological characterization of these three enzymes has demonstrated that it is possible to selectively inhibit one with little inhibitory effect on the others (Moores, S. L., Schaber, M. D., Mosser, S. D., Rands, E., O'Hara, M. B., Garsky, V. M., Marshall, M. S., Pompliano, D. L., and Gibbs, J. B., J. Biol. Chem., 266:17438 (1991), U.S. Pat. 10 No. 5,470,832). The prenylation reactions have been shown genetically to be essential for the function of a variety of proteins (Clarke, 1992; Cox and Der, 1992a; Gibbs, J. B. (1991). Cell 65: 1-4; Newman and Magee, 1993; Schafer and Rine, 1992). This requirement often is demonstrated by mutating the CaaX Cys acceptors so that the 15 proteins can no longer be prenylated. The resulting proteins are devoid of their central biological activity. These studies provide a genetic "proof of principle" indicating that inhibitors of prenylation can alter the physiological responses regulated by prenylated proteins. The Ras protein is part of a signaling pathway that links cell surface 20 growth factor receptors to nuclear signals initiating cellular proliferation. Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein. In the inactive state, Ras is bound to GDP. Upon growth factor receptor activation, Ras is induced to exchange GDP for GTP and undergoes a conformational change. The GTP-bound 25 form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M. Willumsen, Ann. Rev. Biochem. 62:851-891 (1993)). Activation of Ras leads to activation of multiple intracellular signal transduction pathways, including the MAP Kinase pathway and the Rho/Rac pathway 30 (Joneson et al., Science 271:810-812). Mutated ras genes are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal. -2- WO 00/51614 PCTIUSOO/05354 The Ras protein is one of several proteins that are known to undergo post-translational modification. Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al., Cell, 62:81-88 (1990); Schaber et al., J. Biol. Chem., 5 265:14701-14704 (1990); Schafer et al., Science, 249:1133-1139 (1990); Manne et al., Proc. Natl. Acad. Sci USA, 87:7541-7545 (1990)). Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras. 10 The Ras C-terminus contains a sequence motif termed a "CAAX" or "Cys-Aaal Aaa 2 -Xaa" box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al., Nature 310:583-586 (1984)). Depending on the specific sequence, this motif serves as a signal sequence for the enzymes farnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the 15 cysteine residue of the CAAX motif with a C15 or C20 isoprenoid, respectively. (S. Clarke., Ann. Rev. Biochem. 61:355-386 (1992); W.R. Schafer and J. Rine, Ann. Rev. Genetics 30:209-237 (1992)). Direct inhibition of farnesyl-protein transferase would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis. 20 Other farnesylated proteins include the Ras-related GTP-binding proteins such as RhoB, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also farnesylated. James, et al., have also suggested that there are farnesylated proteins of unknown structure and function 25 in addition to those listed above. Inhibitors of famesyl-protein transferase (FPTase) have been described in two general classes. The first class includes analogs of farnesyl diphosphate (FPP), while the second is related to protein substrates (e.g., Ras) for the enzyme. The peptide derived inhibitors that have been described are generally cysteine containing 30 molecules that are related to the CAAX motif that is the signal for protein prenylation. (Schaber et al., ibid; Reiss et. al., ibid; Reiss et al., PNAS, 88:732-736 (1991)). Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al., Science, 260:1934-1937 35 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)). -3- WO 00/51614 PCT/USOO/05354 Mammalian cells express four types of Ras proteins (H-, N-, K4A-, and K4B-Ras) among which K4B-Ras is the most frequently mutated form of Ras in human cancers. The genes that encode these proteins are abbreviated H-ras, N-ras , K4A-ras and K4B-ras respectively. H-ras is an abbreviation for Harvey-ras. K4A-ras 5 and K4B-ras are abbreviations for the Kirsten splice variants of ras that contain the 4A and 4B exons, respectively. Inhibition of farnesyl-protein transferase has been shown to block the growth of H-ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype. It has also been demonstrated that certain inhibitors of farnesyl-protein transferase selectively block the processing of the H-Ras 10 oncoprotein intracellularly (N.E. Kohl et al., Science, 260:1934-1937 (1993) and G.L. James et al., Science, 260:1937-1942 (1993)). Recently, it has been shown that an inhibitor of farnesyl-protein transferase blocks the growth of H-ras-dependent tumors in nude mice (N.E. Kohl et al., Proc. Natl. Acad. Sci U.S.A., 91:9141-9145 (1994) and induces regression of mammary and salivary carcinomas in H-ras transgenic mice 15 (N.E. Kohl et al., Nature Medicine, 1:792-797 (1995). Indirect inhibition of farnesyl-protein transferase in vivo has been demonstrated with lovastatin (Merck & Co., Rahway, NJ) and compactin (Hancock et al., ibid; Casey et al., ibid; Schafer et al., Science 245:379 (1989)). These drugs inhibit HMG-CoA reductase, the rate limiting enzyme for the production of 20 polyisoprenoids includ-ing farnesyl pyrophosphate. Inhibition of farnesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells. It has been disclosed that the lysine-rich region and terminal CVIM sequence of the C-terminus of K-RasB confer resistance to inhibition of the cellular 25 processing of that protein by certain selective FPTase inhibitors. (James, et al., J. Biol. Chem. 270, 6221 (1995) Those FPTase inhibitors were effective in inhibiting the processing of H-Ras proteins. James et al., suggested that prenylation of the K4B Ras protein by GGTase-I contributed to the resistance to the selective FPTase inhibitors. 30 Selective inhibitors of GGTase-I have been previously disclosed (see for example U.S. Pat. No. 5,470,832, issued November 28, 1995). Other compounds have been described as selective inhibitors of GGTase-I (see for example PCT Publication No. WO 96/21456). Combinations of a selective inhibitor of FPTase and a selective inhibitor of GGTase-I have been disclosed as useful in the treatment of 35 cancer (PCT Publication No. WO 97/34664). -4- WO 00/51614 PCT/USOO/05354 Several groups of scientists have recently disclosed compounds that are non-selective FPTase/GGTase-I inhibitors. (Nagasu et al. Cancer Research, 55:5310-5314 (1995); PCT application WO 95/25086). It is the object of the instant invention to provide a prenyl-protein 5 transferase inhibitor which is efficacious in vivo as an inhibitor of geranylgeranyl protein transferase type I (GGTase-I), also known as CAAX GGTase. It is also the object of the present invention to provide a compound which inhibits the cellular processing of both the H-Ras protein and the K4B-Ras protein. 10 It is also the object of the present invention to provide a compound which is efficacious in vivo as an inhibitor of the growth of cancer cells characterized by a mutated K4B-Ras protein. A composition which comprises such an inhibitor compound is used in the present invention to treat cancer. 15 SUMMARY OF THE INVENTION The present invention comprises piperazine-containing compounds which inhibit prenyl-protein transferases, particularly geranylgeranyl-protein transferase type I. Further contained in this invention are chemotherapeutic 20 compositions containing these prenyl transferase inhibitors and methods for their production. The compounds of this invention are illustrated by the formula A: (R )r

(R

9 )q V - Al(CRa 2 )nA 2 (CRa 2 )n -W - (CRb 2 )p- -As-Z S A 25 DETAILED DESCRIPTION OF THE INVENTION The compounds of this invention are useful in the inhibition of prenyl protein transferases and the prenylation of the oncogene protein Ras. In a first -5- WO 00/51614 PCT/USOO/05354 embodiment of this invention, the inhibitors of prenyl-protein transferases are illustrated by the formula A: (R )r

(R

9 )q V - Al(CRa 2 )nA 2 (CR1 2 )n -W - (CR 1 b)N N-A 3 -Z S A 5 wherein: RIa and Rib are independently selected from: a) hydrogen, b) aryl, heterocycle, C3-C1O cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, 10 R 1 0 0-, R 1 I S(O)m-, R 10

C(O)NR

1 0 -, (R10)2NC(O)-, R 10 2N (NRIO)-, CN, N02, R 10 C(O)-, N3, -N(R 1 0 )2, or R 1 1

OC(O)NR

10 -, c) unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, 15 R 10 0-, RIIS(O)m-, R 10

C(O)NR

1 0 -, (R 1 0)2NC(O)-, R1 0 2N

C(NR

1 %)-, CN, R 10 C(O)-, N3, -N(R'0)2, and RI IOC(O)-NR 10 -;

R

8 is independently selected from: a) hydrogen, 20 b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, R 10 0-, RI iS(O)m-,

R

10 C(O)NR10-, (R 10 )2NC(O)-, R 10 2N-C(NR 1 0)-, CN, N02,

R

10 C(O)-, N3, -N(R 1 0 )2, or R 1 lOC(O)NR 10 -, -C(O)ORIO and 25 c) C1-C6 alkyl unsubstituted or substituted by aryl, cyanophenyl, heterocycle, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, R 1 0 0-, RilS(O)m-, R1 0 C(O)NH-, -6- WO 00/51614 PCT/USOO/05354

(R'

0 )2NC(O)-, R 10 2N-C(NR1 0 )-, CN, R1 0 C(O)-, N3, -N(R' 0 )2, or R1 0 0C(O)NH-;

R

9 is selected from: 5 a) hydrogen, b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br, R 1 0 0-, R 1 1 S(O)m-,

R

1 0 C(O)NR10-, (R 1 0)2NC(O)-, R1 0 2N-C(NR0)-, CN, N02,

R

1 0 C(O)-, N3, -N(R 10 )2, orRlIOC(O)NR 1 0 -, and c) C1-C6 alkyl unsubstituted or substituted by perfluoroalkyl, F, Cl, Br, 10 R 10 0-, RI IS(O)m-, R1 0 C(O)NR1 0 -, (R 1 0 )2NC(O)-, R1 0 2N C(NR10)-, CN, R 10 C(O)-, N3, -N(R10)2, or R I IOC(O)NR 10 -;

RI

0 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; 15 R II is independently selected from C1-C6 alkyl and aryl; AI and A 2 are independently selected from: a bond, -CH=CH-, -C=C-, -C(O)-,

-C(O)NR

1 0-, -NR 10 C(O)-, 0, -N(R 10 )-, -S(O)2N(R1 0 )-, -N(R 10 )S(O)2-, or S(O)m; 20 A 3 is selected from: -C(O)- or S(O)m; V is selected from: a) hydrogen, b) heterocycle, 25 c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from 0, S, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if AI is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; 30 W is a heterocycle; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; -7- WO 00/51614 PCT/USOO/05354 mis 0, 1 or 2; n is 0, 1, 2, 3 or 4; pis 0,1,2,3 or4; q is I or 2; 5 r is 0 to 5, provided that r is 0 when V is hydrogen; and s is 0 or 1, or the pharmaceutically acceptable salts thereof. 10 In a preferred embodiment of this invention, the inhibitors of prenyl protein transferase are illustrated by the formula A: (R )r

(R

9 )q V - Al(CRa 2 )nA 2 (CR Oa 2 )n -W - (CR "b 2 )p-N N-A 3 -Z S A wherein: 15 RIa is independently selected from: hydrogen or C1-C6 alkyl; Rib is independently selected from: a) hydrogen, 20 b) aryl, heterocycle, cycloalkyl, R1 0 0-, -N(R 10 )2 or C2-C6 alkenyl, c) unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, heterocycle, cycloalkyl, alkenyl, R 1 0 0- and -N(R 1 0 )2; 25 R8 is independently selected from: a) hydrogen, -8- WO 00/51614 PCT/USOO/05354 b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R 10

C(O)NR

10 -, CN, N02, (R 10 )2N-C(NR 10 )-, R 1 0 C(O)-, -N(R 1 0 )2, or R 1

IOC(O)NR

1 0 -,

-C(O)OR

10 and 5 c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-,

R

1 0

C(O)NR

10 -, (R 1 0 )2N-C(NR 1 0 )-, R 10 C(O)-, -N(R 1 0 )2, or RI IOC(O)NR1 0 -;

R

9 is selected from: 10 a) hydrogen, b) C2-C6 alkenyl, C2-C6 alkynyl, Cl-C6 perfluoroalkyl, F, Cl, R1 0 0-,

R

1 1 S(O)m-, R1 0 C(O)NR1 0 -, CN, N02, (R'0)2N-C(NR 1 %)-,

R

10 C(O)-, -N(R 1 0 )2, or R 1

IOC(O)NR

10 -, and c) C1-C6 alkyl unsubstituted or substituted by C1-C6 perfluoroalkyl, F, 15 Cl, R 1 0 0-, R 1 IS(O)m-, R 10

C(O)NR

10 -, CN, (R'0)2N-C(NR 10 )-,

R

1 0 C(O)-, -N(R 1 0)2, or R iOC(O)NR 10 -; RIO is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; 20 R I I is independently selected from C1-C6 alkyl and aryl;

A

1 and A 2 are independently selected from: a bond, -CH=CH-, -C~C-, -C(O)-,

-C(O)NR

10 -, 0, -N(R10)-, or S(O)m; 25 A 3 is selected from: -C(O)- or S(O)m; V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 30 pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from 0, S, and N, and -9- WO 00/51614 PCTIUSOO/05354 e) C2-C20 alkenyl, and provided that V is not hydrogen if Al is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 5 pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, or isoquinolinyl; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; mis 0, 1 or 2; 10 nis 0,1,2,3 or4; pis 0,1,2,3 or4; q is 1 or 2; r is 0 to 5, provided that r is 0 when V is hydrogen; and s is 0 or 1, 15 or the pharmaceutically acceptable salts thereof. A preferred embodiment of the compounds of this invention are illustrated by the formula B:

(R

8 )r R 9 a V - A1(CR1a 2 )nA2(CR1a 2 -NN / -A 3 Z B(CR' 2)p 20 wherein: Ria and Rib are independently selected from: a) hydrogen, 25 b) aryl, heterocycle, cycloalkyl, R 1 0 0-, -N(R 1 0 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R 10 )2; -10- WO 00/51614 PCT/USOO/05354

R

8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R1 0

C(O)NR

10 -, CN, 5 N02, (R' 0 )2N-C(NR 10 )-, R1 0 C(O)-, -N(R' 0 )2, or R llOC(O)NR 10 -,

-C(O)OR

1 0 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-,

R

1 0

C(O)NR

1 0-, (R 1 0 )2N-C(NR1O)-, R 10 C(O)-, -N(R10)2, or R I IOC(O)NR1 0 -; 10

R

9 a is hydrogen, C1-C6 alkyl or chloro; R1 0 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; 15 R 1 is independently selected from C1-C6 alkyl and aryl; Al and A 2 are independently selected from: a bond, -CH=CH-, -C=C-, -C(O)-,

-C(O)NR

10 -, 0, -N(R10)-, or S(O)m; 20 A 3 is selected from: -C(O)- or S(O)m; V is selected from: a) hydrogen, b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 25 pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from 0, S, and N, and 30 e) C2-C20 alkenyl, and provided that V is not hydrogen if AI is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; -11- WO 00/51614 PCT/USOO/05354 mis 0, 1 or 2; nis 0,1,2,3 or4; pis 0,1,2,3 or4;and r is 0 to 5, provided that r is 0 when V is hydrogen; 5 or the pharmaceutically acceptable salts thereof. Another preferred embodiment of the compounds of this invention are illustrated by the formula C: 10 (R )r N N R9a V - A1(CR1a 2 )nA2(CR1a 2 n N

N-A

3 _Z (CR' 2) p C wherein: RIa and Rib are independently selected from: 15 a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 10 0-, -N(R 1 0 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2; 20 R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, CI-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 10 0-, R 1 0 C(O)NR1 0 -, CN, N02, (R 10 )2N-C(NR 10 )-, R 1 0 C(O)-, -N(R' 0 )2, or R 1 I OC(O)NR1 0 -, 25 -C(O)OR 1 0 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 1 0 0-,

R

10

C(O)NR

1 0 -, (R 10 )2N-C(NR 10 )-, R1 0 C(O)-, -N(R'0)2, or R I IOC(O)NR 10 -; -12- WO 00/51614 PCT/USOO/05354

R

9 a is hydrogen, CI-C6 alkyl or chloro;

R

10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; 5 R 1 1 is independently selected from C1-C6 alkyl and aryl; AI and A 2 are independently selected from: a bond, -CH=CH-, -C=C-, -C(O)-,

-C(O)NR

1 0 -, 0, -N(R 1 O)-, or S(O)m; 10

A

3 is selected from: -C(O)- or S(O)m; V is selected from: a) hydrogen, 15 b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a 20 heteroatom selected from 0, S, and N, and e) C2-C20 alkenyl, and provided that V is not hydrogen if Al is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; 25 Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; m is 0, 1 or 2; nis 0,1,2,3 or4; pis 2,3 or4;and 30 r is 0 to 5, provided that r is 0 when V is hydrogen; or the pharmaceutically acceptable salts thereof. -13- WO 00/51614 PCT/USOO/05354 A further embodiment of the compounds of this invention is illustrated by the formula D: (R )r R V - A'(CRan (CR1b 2 D 5 wherein: Ria and Rib are independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 1 0 0-, -N(R 1 0 )2 or C2-C6 alkenyl, 10 c) Cl-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 1 0 0-, or -N(R10)2;

R

8 is independently selected from: a) hydrogen, 15 b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 10 0-, R 10

C(O)NR

1 0 -, CN, N02, (R 10 )2N-C(NR' 0 )-, R 10 C(O)-, -N(R 10 )2, or R 1 1

OC(O)NR

10 -, -C(O)ORIO and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R1 0 0-, 20 R 10

C(O)NR

10 -, (R 1 0 )2N-C(NR 1 0 )-, R 10 C(O)-, -N(R 1 0 )2, or

R

1

IOC(O)NR

10 -;

R

9 a is hydrogen, C1-C6 alkyl or chloro; 25 R 10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; RII is independently selected from C1-C6 alkyl and aryl; -14- WO 00/51614 PCT/USOO/05354 Al is selected from: a bond, -CH=CH-, -C-C-, -C(O)-, -C(O)NR 10 -, 0, -N(R1O)-, or S(O)m;

A

3 is selected from: -C(O)- or S(O)m; 5 V is selected from: a) heterocycle selected from pyridinyl and quinolinyl, and b) aryl; 10 Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; mis 0, 1 or 2; nis 0,1,2,3 or4; pis 0,1,2,3 or4;and 15 ris Oto5, or the pharmaceutically acceptable salts thereof. Another embodiment of the compounds of this invention is illustrated 20 by the formula E: (R)r 9a 1 a \ N /-\N-A 3-Z V-A(CR 2 )n (CR'b 2 N E wherein: 25 Ria and Rib are independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 1 0 0-, -N(R' 0 )2 or C2-C6 alkenyl, -15- WO 00/51614 PCT/USOO/05354 c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R1 0 0-, or -N(R10)2; R8 is independently selected from: 5 a) hydrogen, b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 10 0-, R1 0

C(O)NR

1 O-, CN, N02, (R 10 )2N-C(NR1 0 )-, R 10 C(O)-, -N(R 1 0)2, or R 1

IOC(O)NR

10 -,

-C(O)OR

10 and 10 c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-,

R

10

C(O)NR

10 -, (R 10 )2N-C(NR 10 )-, R 10 C(O)-, -N(R 1 0)2, or R I IOC(O)NR 10 -;

R

9 a is hydrogen, C1-C6 alkyl or chloro; 15

R

10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl;

R

11 is independently selected from C1-C6 alkyl and aryl; 20 Al is selected from: a bond, -CH=CH-, -C=C-, -C(O)-, -C(O)NR1 0 -, 0, -N(R 1 %)-, or S(O)m;

A

3 is selected from: -C(O)- or S(O)m; 25 V is selected from: a) heterocycle selected from pyridinyl and quinolinyl, and b) aryl; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; 30 mis 0, 1 or 2; nis 0,1,2,3or4; pis 2,3 or4;and ris 0 to 5, -16- WO 00/51614 PCT/USOO/05354 or the pharmaceutically acceptable salts thereof. A still further embodiment of the compounds of this invention is 5 illustrated by the formula F: (R) R N

(CR

1 b2)A3-Z F wherein: 10 Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 10 0-, -N(R 1 0 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 1 0 0-, or -N(R10)2; 15

R

8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, Cl-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R 10

C(O)NR

10 -, CN, 20 N02, (R'0)2N-C(NR 1 0)-, R 10 C(O)-, -N(R10)2, or R1 iOC(O)NRI0-, -C(O)OR1 0 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-,

R

10

C(O)NR

10 -, (R 1 0 )2N-C(NR 10 )-, R 10 C(O)-, -N(R 1 0 )2, or RI IOC(O)NR1 0 -; 25

R

9 a is hydrogen, C1-C6 alkyl or chloro;

RI

0 is independently selected from hydrogen, CJ-C6 alkyl, benzyl and aryl; -17- WO 00/51614 PCT/USOO/05354 R Il is independently selected from C1-C6 alkyl and aryl;

A

3 is -C(O)-; 5 Z is unsubstituted or substituted phenyl, unsubstituted or substituted napthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted 2,3 dihydrobenzofuran, unsubstituted or substituted quinoline or unsubstituted or substituted isoquinoline; 10 p is 1, 2 or 3; and r is 0 to 5, or the pharmaceutically acceptable salts thereof. 15 Another further embodiment of the compounds of this invention is illustrated by the formula G: (R 8) N R 9 a (CRib 2 N N-A 3 -Z G 20 wherein: Rib is independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 1 0 0-, -N(R 1 0 )2 or C2-C6 alkenyl, 25 c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2;

R

8 is independently selected from: -18- WO 00/51614 PCT/USOO/05354 a) hydrogen, b) unsubstituted or substituted aryl, CI-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R 1 0 C(O)NR1 0 -, CN, N02, (R10)2N-C(NR10)-, R 1 0 C(O)-, -N(R 10 )2, or R 1

IOC(O)NR

10 -, 5 -C(O)OR 1 0 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-,

R

10

C(O)NR

10 -, (R 1 0 )2N-C(NR 1 0)-, R 10 C(O)-, -N(R 1 0)2, or

R

1

IOC(O)NR

10 -; 10 R 9 a is hydrogen, C1-C6 alkyl or chloro; RIO is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; RIl is independently selected from C1-C6 alkyl and aryl; 15

A

3 is -C(O)-; Z is unsubstituted or substituted phenyl, unsubstituted or substituted napthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted 2,3 20 dihydrobenzofuran, unsubstituted or substituted quinoline or unsubstituted or substituted isoquinoline; p is 2 or 3; and ris 0 to 5, 25 or the pharmaceutically acceptable salts thereof. Specific examples of the compounds of this invention are as follows: 30 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-methoxyquinolin-4-oyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-diethylamino-3-ethoxypyrid-5 oyl)piperazine -19- WO 00/51614 PCT/USOO/05354 4-[l-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-ethylamino-4 isoquinolinoyl)piperazine 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1-(5-bromo- 1 -naphthoyl)piperazine 5 4-[L-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -[5-(pent- 1 -ynyl)- 1 naphthoyl]piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -[5-(prop- 1 -ynyl)- 1 10 naphthoyl]piperazine 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl] -1 -(5-propyl- 1 -naphthoyl)piperazine 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(4-bromo-3-methylbenzoyl)piperazine 15 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-[3-methyl -4-(prop-1 ynyl)benzoyl]piperazine 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-methyl-4-pentylbenzoyl)piperazine 20 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-cyclopropyleth-ynyl-5 methoxybenzoyl)piperazine 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-methoxy-2-pent-1 25 ynylbenzoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro-2 cyclohexylethynylbenzoyl)piperazine 30 4-[L-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro-2 cyclohexylethylbenzoyl)piperazine -20- WO 00/51614 PCT/US0O/05354 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl] -1 -(4-indoloyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1 -(3,5-dimethylbenzoyl)piperazine 5 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl] -1 -(8-quinolinoyl)piperazine 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl] -1 -(2-ethoxy- 1 -naphthoyl)piperazine 10 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(2-quinolinoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-methoxy-4 methylbenzoyl)piperazine 15 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(6-diethylamino-pyrid-2-oyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(1 -isoquinolinoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1-(2,3-dihydrobenzofuran-7 20 oyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3,4-dimethylbenzoyl) piperazine 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(1-naphthoyl)piperazine 25 or a pharmaceutically acceptable salt or optical isomer thereof. Specific compounds of this invention are as follows: 30 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-[3-methyl -4-(prop-1 ynyl)benzoyl]piperazine -21- WO 00/51614 PCT/USOO/05354 0 N N NC N\ N

CH

3 N

CH

3 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- I -(6-diethylamino-pyrid-2-oyl)piperazine 0 NC N N N -N 5 N \N(C 2

H

5 ) 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(1-naphthoyl)piperazine 0 N N NC N / 10 N or the pharmaceutically acceptable salts or optical isomers thereof. The compounds of the instant invention differ from previously disclosed piperazinone-containing and piperazine-containing compounds, (PCT Publ. 15 No. WO 96/30343 - October 3, 1996; PCT Publ. No. WO 96/31501 - October 10, 1996; PCT Publ. No. WO 97/36593 - October 9, 1997; PCT Publ. No. WO 97/36592 - October 9, 1997) that were described as inhibitors of farnesyl-protein transferase (FPTase), in that, among other things, the instant compounds are dual inhibitors of farnesyl-protein transferase and geranylgeranyl-protein transferase type I (GGTase-I). 20 The compounds are further characterized in that the inhibitory activity of the compounds against GGTase-I is greater than the inhibitory activity against FPTase. -22- WO 00/51614 PCT/USOO/05354 Preferably, the compounds of the instant invention inhibit FPTase in vitro (Example 28) at an IC 50 of less than 1 tM and inhibit GGTase-I in vitro (Example 29) at an IC 50 of less than 50 nM. Preferably, the ratio of the IC 50 of the compounds of the instant invention for in vitro inhibition of FPTase to the IC 50 of the compounds of the instant 5 invention for in vitro inhibition of GGTase type I is greater than 5. Also preferably, the compounds of the instant invention inhibit the cellular processing of the RapI protein (Example 34) at an EC 50 of less than about 1 yM. More preferably, the compounds of the instant invention inhibit the cellular processing of the Rapi protein (Example 34) at an EC 50 of less than about 50 nM. Also more preferably, the ratio of 10 the IC 50 of the compounds of the instant invention for in vitro inhibition of FPTase to the IC 50 of the compounds of the instant invention for in vitro inhibition of GGTase type I is greater than 25. Also more preferably, the ratio of the EC 50 of the compounds of the instant invention for inhibition of the cellular processing of the hDJ protein (Example 33) to the EC 50 of the compounds of the instant invention for inhibition of 15 the cellular processing of the RapI protein is about equal to or less than 1. The compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention. When any variable (e.g. aryl, heterocycle, R I, R 2 etc.) occurs more than one time in 20 any constituent, its definition on each occurrence is independent at every other occurrence. Also, combinations of substituents/or variables are permissible only if such combinations result in stable compounds. As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of 25 carbon atoms; "alkoxy" represents an alkyl group of indicated number of carbon atoms attached through an oxygen bridge. "Halogen" or "halo" as used herein means fluoro, chloro, bromo and iodo. As used herein, "cycloalkyl" is intended to include monocyclic saturated aliphatic hydrocarbon groups having the specified number of carbon atoms. 30 Examples of such cycloalkyl groups includes, but are not limited to, cyclopropyl, cyclobutyl, cyclohexyl, cycloheptyl and cyclooctyl. As used herein, "aryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic. Examples of such aryl elements include phenyl, naphthyl, 35 tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl or acenaphthyl. -23- WO 00/51614 PCTIUSOO/05354 The term heterocycle or heterocyclic, as used herein, represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of 5 N, 0, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings are fused to a benzene ring. The term heterocycle or heterocyclic includes heteroaryl moieties. The heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure. Examples of such heterocyclic elements include, but are not limited to, azepinyl, 10 benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydro benzothiopyranyl sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, 15 isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, piperidyl, piperazinyl, pyridyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiazolyl, 20 thiazolinyl, thienofuryl, thienothienyl, and thienyl. As used herein, "heteroaryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, 0, and S. Examples of such heterocyclic 25 elements include, but are not limited to, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, 30 isothiazolyl, naphthyridinyl, oxadiazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl, thienothienyl, and thienyl. As used herein in the definition of Z the substituted aryl and substituted heteroaryl include moieties containing from 1 to 3 substituents in addition 35 to the point of attachment to the rest of the compound. Preferably, such substituents -24- WO 00/51614 PCTIUSOO/05354 are selected from the group which includes but is not limited to F, Cl, Br, CF3, OCF3, NH2, N(CI-C6 alkyl)2, N02, SO2CH3, CN, (C1-C6 alkyl)O-, (aryl)O-, -OH, (CI-C6 alkyl)S(O)m-, (Ci-C6 alkyl)C(O)NH-, H2N-C(NH)L, (C1-C6 alkyl)C(O)-, (C1-C6 alkyl)OC(O)-, N3,(C1-C6 alkyl)OC(O)NH-, phenyl, pyridyl, imidazolyl, oxazolyl, 5 isoxazolyl, thiazolyl, thienyl, furyl, isothiazolyl and C1-C20 alkyl, C2-C6 alkenyl. When R 2 and R 3 are combined to form -(CH2)u-, cyclic moieties are formed. Examples of such cyclic moieties include, but are not limited to: In addition, such cyclic moieties may optionally include a 10 heteroatom(s). Examples of such heteroatom-containing cyclic moieties include, but are not limited to: LL S o N o COR10 The moiety formed when, in the definition of R 6 , R 7 and R7a, R 6 and R7 or R 7 and R7a are joined to form a ring, is illustrated by, but not limited to, the 15 following: N N3 -+NDN -- N Np -+N 0 0 Lines drawn into the ring systems from substituents (such as from Rla, Rib, R 8 etc.) indicate that the indicated bond -25- WO 00/51614 PCTIUSOO/05354 may be attached to any of the substitutable ring carbon atoms. Preferably, Ria and Rib are independently selected from: hydrogen, N(R' 0 )2, R1 0

C(O)NR

1 0- or unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted CI-C6 alkyl is selected from unsubstituted or 5 substituted phenyl, -N(R 10 )2, R 10 0- and R 10

C(O)NR

1 O-. Preferably, R 9 is hydrogen, chloro or Cl-C6 alkyl. Preferably, R 10 is selected from H, C1-C6 alkyl, benzyl and aryl. Preferably, Al and A 2 are independently selected from: a bond, -C(O)NRIO-, -NR 10 C(O)-, 0, -N(R 10 )-, -S(O)2N(R 10 )- and 10 -N(R1O)S(O) 2 -. Most preferably, Al and A 2 are a bond. Preferably, A 3 is -C(O)-. Preferably, V is selected from heteroaryl and aryl. More preferably, V is phenyl. Preferably, W is selected from imidazolyl, pyridinyl, thiazolyl, indolyl, 15 quinolinyl, and isoquinolinyl. More preferably W is selected from imidazolyl and pyridinyl. Preferably, Z is selected from unsubstituted or substituted phenyl, unsubstituted or substituted napthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted quinoline, unsubstituted or substituted isoquinoline and 20 unsubstituted or substituted 2,3-dihydrobenzofuran, wherein the substituted phenyl, substituted napthyl, substituted pyridyl, substituted quinoline, substituted isoquinoline and substituted 2,3-dihydrobenzofuran, are substituted with one or more of the following: a) OH, 25 b) alkoxy, c) aryloxy, d) C1-C6 alkyl, e)

NO

2 , f) halogen, 30 g) C2-C6 alkenyl, h) OCF3, i) SO2CH3, or j) (C1-C6 alkyl)C(O)NH -26- WO 00/51614 PCTIUSOO/05354 More preferably, Z is unsubstituted or substituted phenyl, unsubstituted or substituted napthyl, unsubstituted or substituted isoquinoline or unsubstituted or substituted 2,3-dihydrobenzofuran, wherein the substituted phenyl, substituted napthyl, substituted isoquinoline and substituted 2,3-dihydrobenzofuran, is 5 substituted with one or more of the following: a) OH, b) alkoxy, c) aryloxy, d) C1-C6 alkyl, 10 e) NO 2 , f) halogen, g) C2-C6 alkenyl, h) OCF3, i) SO2CH3, or 15 j) (C1-C6 alkyl)C(O)NH Preferably, n and r are independently 0, 1, or 2. Preferably p is 1, 2 or 3. Preferably s is 0. 20 Preferably, the moiety

(R

8 )r

(R

9 )q V - Al(CRa 2 )nA 2 (CRIa 2 )n -W - (CRb 2 )p~ is selected from:

R

9 a fN N and R

(R

8 )r CH2 (

CH

2

-CH

2 - (R-2r(R- / -27- WO 00/51614 PCTIUSOO/05354 Preferably, the moiety - A'(CR1a 2)A 2 (CR1)a _ 5 is not a bond. It is intended that the definition of any substituent or variable (e.g., Ria, R 9 , n, etc.) at a particular location in a molecule be independent of its definitions elsewhere in that molecule. Thus, -N(R10)2 represents -NHH, -NHCH3, -NHC2H5, etc. It is understood that substituents and substitution patterns on the compounds of 10 the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. The pharmaceutically acceptable salts of the compounds of this 15 invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, 20 lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like. The pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a 25 basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Reactions used to generate the compounds of this invention are 30 prepared by employing reactions as shown in the Schemes 1-14, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures. The 8 point of attachment to the ring of substituents (i.e., R ), as shown in the Schemes, is illustrative only and is not meant to be limiting. Substituent Z', as shown in the -28- WO 00/51614 PCTIUSOO/05354 Schemes, represents the substituent Z as defined hereinabove or a protected precursor thereof. These reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are 5 subsequently joined by the alkylation reactions described in the Schemes. Synopsis of Schemes 1-14: The requisite intermediates are in some cases commercially available, or can be prepared according to literature procedures, for the most part. In Scheme 1, for example, boc-protected piperazine VI, available commercially or by procedures 10 known to those skilled in the art, can be coupled to suitable substituted carboxylic acids using a variety of dehydrating agents such as DCC (dicyclohexycarbodiimide) or EDC-HCl (1 -ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) in a solvent such as methylene chloride, chloroform, dichloroethane, or dimethylformamide. The product VII is then deprotected with acid, for example 15 hydrogen chloride in chloroform or ethyl acetate, or trifluoroacetic acid in methylene chloride to give intermediate VIII. Intermediate VIII can itself be reductively alkylated with a variety of aldehydes, such as IX. The aldehydes can be prepared by standard procedures, such as that described by 0. P. Goel, U. Krolls, M. Stier and S. Kesten in Organic Syntheses, 1988, 67, 69-75, from the appropriate amino acid 20 (Scheme 2). The reductive alkylation can be accomplished at pH 5-7 with a variety of reducing agents, such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane, methanol or dimethylformamide. The product X can be deprotected to give the final compounds XI with trifluoroacetic acid in methylene chloride. The final product XI is isolated in the salt form, for example, as 25 a trifluoroacetate, hydrochloride or acetate salt, among others. The product diamine XI can further be selectively protected to obtain XII, which can subsequently be reductively alkylated with a second aldehyde to obtain XIII. Removal of the protecting group, and conversion to cyclized products such as the dihydroimidazole XV can be accomplished by literature procedures. 30 As shown in Scheme 3, the piperazine intermediate VIII can be reductively alkylated with other aldehydes such as 1-trityl-4-imidazolyl carboxaldehyde or 1-trityl-4-imidazolylacetaldehyde, to give products such as XVI. The trityl protecting group can be removed from XVI to give XVII, or alternatively, XVI can first be treated with an alkyl halide then subsequently deprotected to give the -29- WO 00/51614 PCT/USOO/05354 alkylated imidazole XVIII. Alternatively, the intermediate VIII can be acylated or sulfonylated by standard techniques. Scheme 4 illustrates the incorporation of an indole moiety for the substituent W in place of the preferred benzylimidazolyl moiety. 5 Scheme 5 illustrates synthesis of an instant compound wherein a non-hydrogen R9b is incorporated in the instant compound. Thus, a readily available 4-substituted imidazole XXVI may be selectively iodinated to provide the 5-iodoimidazole XXVII. That imidazole may then be protected and coupled to a suitably substituted benzyl moiety to provide intermediate XXVIII. 10 Attachment of the imidazolyl nitrogen via an ethyl linker to the piperazine nitrogen of intermediate VIII, described above, provides the instant compound XXIX. Compounds of the instant invention wherein the Al(CRla2)nA 2 (CRla 2 )n linker is oxygen may be synthesized by methods known 15 in the art, for example as shown in Scheme 6. The suitably substituted phenol XXX may be reacted with methyl N-(cyano)methanimidate to provide the 4 phenoxyimidazole XXXI. After selective protection of one of the imidazolyl nitrogens, the intermediate XXXII can undergo alkylation reactions. If the piperazine VIII is reductively alkylated with an aldehyde which 20 also has a protected hydroxyl group, such as XXXIII in Scheme 7, the protecting groups can be subsequently removed to unmask the hydroxyl group. The Boc protected amino alcohol XXXIV can then be utilized to synthesize 2 aziridinylmethylpiperazines such as XXXV. Schemes 8-12 illustrate syntheses of suitably substituted aldehydes 25 useful in the syntheses of the instant compounds wherein the variable W is present as a pyridyl moiety. Similar synthetic strategies for preparing alkanols that incorporate other heterocyclic moieties for variable W are also well known in the art. For example, Scheme 12 illustrates the preparation of the corresponding quinoline aldehyde. 30 Scheme 13 depicts a general method for synthesizing a key intermediate useful in the preparation of preferred embodiments of the instant invention wherein V is phenyl and W is imidazole. A piperazine moiety can be readily added to this benzyl-imidazole intermediate as set forth in Scheme 14. -30- WO 00/51614 PCT/USOO/05354 SCHEME 1 Z'-C-OH 11 0 BocN NH EDO HOBT, DIEA VI 0 HCI, EtOAc BoNN Z' Vll HCI -HN N Vill WO 00/51614 PCT/USOO/05354 SCHEME 2 Boc NH ix 0 Boc NH CHO Z NaBH(OAc) 3 Et 3 N , CICH 2

CH

2 CI Boc NH N NCF 3

CO

2 H Z' \CH 2 Cl2 NHBoc x 0 Boc 2 0

NH

2 N N Z CH 2 Cl2

NH

2 XI CHO 0 BocNH N N Z' NaBH(OAc) 3

NH

2 Et 3 N , CICH 2

CH

2 Ci XII -32- WO 00/51614 PCT/USOO/05354 SCHEME 2 (continued) BocN N N Z'

CF

3

CO

2 H, CH 2 Cl 2 ; NH NaHCO 3 0

NH

2 N\J N-' NC NH AgCN A xv N N Z' N N -33- WO 00/51614 PCTUSOO/05354 SCHEME 3 NaBH (OAC) 3 0 Et 3 N , CICH 2

CH

2 CI 7 t N \(CH 2 ) CHO Tr 0 Tr 1) Ar CH 2 X, CH 3 CN

CF

3

CO

2 H, 0H- 2 01 2 2) 0F 3 00 2 H, 0H 2 1 2 I

(C

2

H

5

)

3 SiH (0 2

H

5

)

3 SiH y

(H

2 )n~l Z N H XVII NI~ N XVIII -34- WO 00/51614 PCTUSOO/05354 SCHEME 4 9 0H 2 0-OEt 1. aq.LiOH H o H 2 0-OH i

BH

3 H 0H 2 0H-OH I DMSO, (F 3 000) 2 0 C N I78 H -8 9 HOI -N\/N z

CH

2 C-H ViII I NaBH(OAc) 3 H Et 3 N, 010H 2 0H 2 01 N/N-9 HN -35- WO 00/51614 PCTUSOO/05354 SCHEME 5 H H N N Tr, N11 2 Pr)

R

9 b RR9b Zn Brf (R 8 )r /(Fl 8 ) r/ Tr R~b ~i]Br-0H 2 -C-OEt aq. LIGH / ~ ii. MeOH, reflux

(R

8 )r xvl -36- WO 00/51614 PCT/USOO/05354 SCHEME 5 (continued) N 0

R

9 b N OH

BH

3 8 (R )r N Swern R 9b oxidation N \N OH 8 (R)r / R 9b H Z' H Vill NaBH(OAc) 3 (R )r Et 3 N , CICH 2

CH

2 CI R NO R9b0 N N (R )r XXIX -37- WO 00/51614 PCTIUSOO/05354 SCHEME 6

(R

8 )r~ OH i, Na, MeOH r---, 0-3ii. 120)C xxx K3, H Tr, \N TrCI, NEt 3

(

8 )>.\ 0 (R 8 )r\ 0 xxx' N Br-CH 2 -C-OEt ii, MeOH, reflux xxx"l NAOEt (R )r -38- WO 00/51614 PCT/USOO/05354 SCHEME 7 BnO XXXIII 0 BocNH CHO HCI N N4 b Z' NaBH(OAc) 3 Vill Et 3 N CICH 2

CH

2 CI BnO 20% Pd(OH) 2

H

2 NHBoc CH 3

CO

2 H HN /=NH N N~.N~ HO 02 NHBoc NaH, DMF 00C XXXIV N N Z' NBoc XXXV -39- WO 00/51614 PCTUSOO/05354 SCHEME 8 . OH 3 1) HNO 2 ,Br 2

CO

2

CH

3 2) KMnO 4 I

H

2 N N 3) MeOH,H--r

(R

8 )r MgCI

(R

8 )r ~ . C0 2 0H 3 ZnC1 2 ,NiCI 2 (Ph 3

P)

2 N NaBH 4 (excess) (R) C H 2 0H -j N (R )r SOTPY, Et 3 N CHO DMSO N -40- WO 00/51614 PCT/USOO/05354 SCHEME 9 1. EtO(CO)CI

(R

8 )r 2.

(R

8 )r Br MgCl

CO

2

CH

3 /N0 2

CH

3 Zn, CuCN N 3. S, xylene, heat N

(R

8 )r

(R

8 )r NaBH 4 S03-Py, Et 3 N (excess) CH 2 OH DMSO CHO N N N (r R)r BrCO2CH MgCl N 02CH3 2CH N ~ZnCl2, NiCl2(Ph3P)2 2H N (R 8 r R )r NaBH4 SO3-Py, Et3N CH2OH CHO (excess) DMSO N N -41- WO 00/51614 PCT/US00/05354 SCHEME 10 0 2

CH

3 Br 1. LDA,C0 2 B N 2. MeOH, H+ N

(R

8 )r (F~ MgCIl 0 2CH 3 ZnCl 2 , NiC1 2 (Ph 3

P)

2 N R)r NaBH 4 (excess) H 2 0H SO 3 Py, Et 3 N DMSO N

R

8 )r HO N -42- WO 00/51614 PCTUSOO/05354 SCHEME 11I Q0 2 0H 3 1. LDA, C0 2 Br a N B r 2. (0H 3

)

3 SiCHN 2 I (R 8 B r (R 8 Zn, NiCI 2 (Ph 3

P)

2 N 00H excess NaBH 4

(R

8 )r

SO

3 -Py, Et 3 N N CH 2 0H DMSO

(R

8 )r CHO -43- WO 00/51614 PCT/USOO/05354 SCHEME 12 0 2

CH

3 Br 1. LDA, C02 B Y N 2. MeOH, H+ (RSr 0 2

CH

3 ZnCl 2 , NiCl 2 (Ph 3

P)

2 N

(R

8 )r NaBH 4 (excess) H 2 OH SO 3 -Py, Et 3 N DMSO N

(R

8 )r HO N -44- WO 00/51614 PCT/USOO/05354 SCHEME 13 Br

NH

2 1. HMTA, EtOH dihydroxyacetone 2. H+, EtOH KSCN,

(R

8 )r (R8)r C 2

H

5 COOH HS OH </ OH

H

2 0 2 (COCI) 2 HOAc

H

2 O DMF, MeCN

(R

8 )r (R )r N CI

(R

8 )r 5 -45- WO 00/51614 PCT/USOO/05354 SCHEME 14 NQ N CI HN N O dilsopropylethyl amine

(R

8 )r <N N O''

H

2 , 10% Pd/C

(R

8 )r EtOH NH N (R")r -46- WO 00/51614 PCT/USOO/05354 The instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer. Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal 5 carcinoma, exocrine pancreatic carcinoma, mycloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin (NF-1), neu, src, abl, Ick, fyn) or by other mechanisms. The compounds of the instant invention inhibit prenyl-protein 10 transferase and the prenylation of the oncogene protein Ras. The instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization. 15 The compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the 20 invention to a mammal in need of such treatment. For example, a component of NF-i is a benign proliferative disorder. The instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S. Glenn et al. Science, 256:1331-1333 (1992). 25 The compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1:541-545(1995). The instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of 30 Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et al.FASEB Journal, 2:A3160 (1988)). The instant compounds may also be useful for the treatment of fungal infections. -47- WO 00/51614 PCT/USOO/05354 The instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies. The compounds of this invention may be administered 5 to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. 10 The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and 15 such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for 20 example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets 25 may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a water soluble taste masking material such as hydroxypropylmethyl-cellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose 30 acetate buryrate may be employed. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as -48- WO 00/51614 PCTIUSOO/05354 polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil. Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are 5 suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of 10 ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous 15 suspensions may also contain one or more preservatives, for example ethyl, or n propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame. Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut 20 oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol. 25 Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example 30 sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid. The pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or 35 mixtures of these. Suitable emulsifying agents may be naturally-occurring -49- WO 00/51614 PCT/USOO/05354 phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening, 5 flavoring agents, preservatives and antioxidants. Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant. The pharmaceutical compositions may be in the form of a sterile 10 injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. The sterile injectable preparation may also be a sterile injectable oil-in water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and 15 lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation. The injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant 20 circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUSTM model 5400 intravenous pump. The pharmaceutical compositions may be in the form of a sterile 25 injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for 30 example as a solution in 1,3-butane diol. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Compounds of Formula A may also be administered in the form of 35 suppositories for rectal administration of the drug. These compositions can be -50- WO 00/51614 PCTIUSOO/05354 prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various 5 molecular weights and fatty acid esters of polyethylene glycol. For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed. (For purposes of this application, topical application shall include mouth washes and gargles.) The compounds for the present invention can be administered in 10 intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. 15 As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts. When a compound according to this invention is administered into a 20 human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms. In one exemplary application, a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in 25 an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day. The compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their 30 particular usefulness against the condition that is being treated. For example, the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant prenyl-protein transferase inhibitors 35 and an antineoplastic agent. It is also understood that such a combination of -51- WO 00/51614 PCTIUSOO/05354 antineoplastic agent and inhibitor of prenyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery. Examples of an antineoplastic agent include, in general, microtubule 5 stabilizing agents (such as paclitaxel (also known as Taxol@), docetaxel (also known as Taxotere@), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-disruptor agents; alkylating agents, anti-metabolites; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and 10 growth inhibitors; hormonal/anti-hormonal therapeutic agents and haematopoietic growth factors. Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine 15 family of drugs, diynenes and the podophyllotoxins. Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide 20 phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like. Other useful antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, camptothecin, CPT- 11, topotecan, ara-C, 25 bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins. The preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel. Radiation therapy, including x-rays or gamma rays which are delivered 30 from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of prenyl-protein transferase alone to treat cancer. Additionally, compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, 35 and herein incorporated by reference. -52- WO 00/51614 PCT/USOO/05354 The instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Thus, the instant compounds may be utilized in combination with a compound which has Raf 5 antagonist activity. The instant compounds may also be co-administered with compounds that are selective inhibitors of farnesyl-protein transferase and/or compounds that are dual inhibitors of farnesyl-protein transferase and geranylgeranylprotein transferase type I. Such a selective inhibitor or dual inhibitor may be an inhibitor that is competitive with the binding of the CAAX-containing 10 protein substrate of farnesyl-protein transferase or may be farnesyl pyrophosphate competitive inhibitors. In particular, the compounds disclosed in the following patents and publications may be useful as farnesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Ser. Nos. 08/254,228 and 08/435,047. 15 Those patents and publications are incorporated herein by reference. In practicing methods of this invention, which comprise administering, simultaneously or sequentially or in any order, two or more of a protein substrate competitive inhibitor and a prenyl pyrophosphate-competitive inhibitor, such administration can be orally or parenterally, including intravenous, intramuscular, 20 intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously. When the protein substrate-competitive inhibitor and a prenyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different 25 methods. The instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Ser. No. 09/055,487, filed April 6, 1998, which is incorporated herein by reference. As used herein the term an integrin antagonist refers to compounds 30 which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells. In particular, the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the av53 integrin, which selectively antagonize, inhibit or counteract binding of a 35 physiological ligand to the avB5 integrin, which antagonize, inhibit or counteract -53- WO 00/51614 PCTIUSOO/05354 binding of a physiological ligand to both the av$3 integrin and the avp5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells. The term also refers to antagonists of the av56, uv8, clol, a21, a5$1, a*661 and a604 integrins. The term also refers to 5 antagonists of any combination of uv$3, av05, cvI6, av8, all, a2Bl, a.501, u6B1 and a634 integrins. The instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin. Similarly, the instant compounds may be useful in combination with 10 agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections. If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described below and the other 15 pharmaceutically active agent(s) within its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate. 20 EXAMPLES Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope 25 thereof. EXAMPLE 1 Preparation of 1-(4-cyanobenzyl)-5-chloromethyl imidazole HC salt 30 Step 1: Preparation of 4-Cyanobenzylamine Method 1 (Hydrochloride salt): A 72 liter vessel was charged with 190 proof ethanol (14.4 L) followed by the addition of 4-cyanobenzylbromide (2.98 kg) and HMTA (2.18 kg) at ambient temperature. The mixture was heated to about 72 -54- WO 00/51614 PCT/USOO/05354 75'C over about 60 min. On warming, the solution thickens and additional ethanol (1.0 liter) was added to facilitate stirring. The batch was aged at about 72-75'C for about 30 min. The mixture was allowed to cool to about 20'C over about 60 min, and 5 HCl gas (2.20 kg) was sparged into the slurry over about 4 hours during which time the temperature rose to about 65'C. The mixture was heated to about 70-72'C and aged for about 1 hour. The slurry was cooled to about 30'C and ethyl acetate (22.3 L) added over about 30 min. The slurry was cooled to about -5'C over about 40 min and aged at about -3 to about -5'C for about 30 min. The mixture was filtered and the 10 crystalline solid was washed with chilled ethyl acetate (3 x 3 L). The solid was dried under a N2 stream for about 1 hour before charging to a 50 liter vessel containing water (5.5 L). The pH was adjusted to about 10-10.5 with 50% NaOH (4.0 kg) maintaining the internal temperature below about 30'C. At about 25'C, methylene chloride (2.8 L) was added and stirring continued for about 15 min. The layers were 15 allowed to settle and the lower organic layer was removed. The aqueous layer was extracted with methylene chloride (2 x 2.2 L). The combined organic layers were dried over potassium carbonate (650 g). The carbonate was removed via filtration and the filtrate concentrated in vacuo at about 25*C to give a free base as a yellow oil. The oil was transferred to a 50 liter vessel with the aid of ethanol (1.8 20 L). Ethyl acetate (4.1 L) was added at about 25'C. The solution was cooled to about 15'C and HCI gas (600 g) was sparged in over about 3 hours, while keeping batch temperature below about 40'C. At about 20-25 'C, ethyl acetate (5.8 L) was added to the slurry, followed by cooling to about -5'C over about 1 hour. The slurry was aged at about -5'C for about 1 hour and the solids isolated via filtration. The cake was 25 washed with a chilled mixture of EtOAc/EtOH (9:1 v/v) (1 x 3.8 L), then the cake was washed with chilled EtOAc (2 x 3.8 L). The solids were dried in vacuo at about 25'C to provide the above-titled compound. 1H NMR (250 MHz, CDCl3): 8 7.83-7.79 (d, 2H), 7.60-7.57 (d, 2H), 4.79 (s, 2H), 30 4.25 (s, 2H); 13 C NMR (62.9 MHz, CDCl3): 8 149.9, 139.8, 134.2, 131.2, 119.7, 113.4, 49.9, 49.5, 49.2, 48.8, 48.5, 48.2, 43.8. Method 2 (phosphate salt): A slurry of HMTA in 2.5 L EtOH was added gradually over about 30 min to about 60 min to a stirred slurry of cyanobenzyl -55- WO 00/51614 PCT/USOO/05354 bromide in 3.5 L EtOH and maintained at about 48-53'C with heating & cooling in a 22L neck flask (small exotherm). Then the transfer of HMTA to the reaction mixture was completed with the use of 1.0 L EtOH. The reaction mixture was heated to about 68-73'C and aged at about 68-73'C for about 90 min. The reaction mixture was a 5 slurry containing a granular precipitate which quickly settled when stirring stopped. The mixture was cooled to a temperature of about 50'C to about 55'C. Propionic acid was added to the mixture and the mixture was heated and maintained at a temperature of about 50'C to about 55'C. Phosphoric acid was gradually added over about 5 min to about 10 min, maintaining the reaction mixture below about 65 10 'C to form a precipitate-containing mixture. Then the mixture was gradually warmed to about 65'C to about 70'C over about 30 min and aged at about 65 0 C to about 70'C for about 30 min. The mixture was then gradually cooled to about 20-25'C over about 1 hour and aged at about 20-25'C for about 1 hour. The reaction slurry was then filtered. The filter cake was washed four 15 times with EtOH, using the following sequence, 2.5 L each time. The filter cake was then washed with water five times, using 300 mL each time. Finally, the filter cake was washed twice with MeCN (1.0 L each time) and the above identified compound was obtained. 20 Step 2: Preparation of 1-(4-Cyanobenzyl)-2-Mercapto-5 Hydroxymethylimidazole 7% water in acetonitrile (50 mL) was added to a 250 mL roundbottom flask. Next, an amine phosphate salt (12.49 g), prepared as described in Step 1, was added to the flask. Next potassium thiocyanate (6.04 g) and dihydroxyacetone (5.61 25 g) was added. Lastly, propionic acid (10.0 mL) was added. Acetonitrile/water 93:7 (25 mL) was used to rinse down the sides of the flask. This mixture was then heated to 60'C, aged for about 30 minutes and seeded with 1% thioimidazole. The mixture was then aged for about 1.5 to about 2 hours at 60'C. Next, the mixture was heated to 70'C, and aged for 2 hours. The temperature of the mixture was then cooled to room 30 temperature and was aged overnight. The thioimidazole product was obtained by vacuum filtration. The filter cake was washed four times acetonitrile (25 mL each time) until the filtrates became nearly colorless. Then the filter cake was washed three times with water (approximately 25-50 mL each time) and dried in vacuo to obtain the above-identified compound. 35 -56- WO 00/51614 PCTIUSOO/05354 Step 3: Preparation of 1-(4-Cyanobenzyl)-5-Hydroxymethylimidazole A IL flask with cooling/heating jacket and glass stirrer (Lab-Max) was charged with water (200 mL) at 25 0 C. The thioimidazole (90.27 g), prepared as described in Step 2, was added, followed by acetic acid (120 mL) and water (50 mL) 5 to form a pale pink slurry. The reaction was warmed to 40'C over 10 minutes. Hydrogen peroxide (90.0 g) was added slowly over 2 hours by automatic pump maintaining a temperature of 35-45 0 C. The temperature was lowered to 25 0 C and the solution aged for 1 hour. The solution was cooled to 20'C and quenched by slowly adding 20% 10 aqueous NaSO 3 (25 mL) maintaining the temperature at less than 25'C. The solution was filtered through a bed of DARCO G-60 (9.0 g) over a bed of SolkaFlok (1.9 g) in a sintered glass funnel. The bed was washed with 25 mL of 10% acetic acid in water. The combined filtrates were cooled to 15'C and a 25% aqueous ammonia was added over a 30 minute period, maintaining the temperature below 15 25'C, to a pH of 9.3. The yellowish slurry was aged overnight at 23'C (room temperature). The solids were isolated via vacuum filtration. The cake (100 mL wet volume) was washed with 2 x 250 mL 5% ammonia (25%) in water, followed by 100 mL of ethyl acetate. The wet cake was dried with vacuum/N 2 flow and the above titled compound was obtained. 20 1 H NMR (250 MHz, CDCl3): 8 7.84-7.72 (d, 2H), 7.31-7.28 (d, 2H), 6.85 (s, 1H), 5.34 (s, 2H), 5.14-5.11 (t, 1H), 4.30-4.28 (d, 2H), 3.35 (s, 1H). Step 4: Preparation of 1-(4-cyanobenzyl)-5-chloromethyl imidazole HCl salt 25 Method 1: 1-(4-Cyanobenzyl)-5-hydroxymethylimidazole (1.0 kg), prepared as described above in Step 3, was slurried with DMF (4.8 L) at 22'C and then cooled to -5'C. Thionyl chloride (390 mL) was added dropwise over 60 min during which time the reaction temperature rose to a maximum of 9'C. The solution became nearly homogeneous before the product began to precipitate from solution. 30 The slurry was warmed to 26'C and aged for 1 h. The slurry was then cooled to 5C and 2-propanol (120 mL) was added dropwise, followed by the addition of ethyl acetate (4.8 L). The slurry was aged at 5'C for 1 h before the solids were isolated and washed with chilled ethyl acetate (3 x -57- WO 00/51614 PCT/USOO/05354 1 L). The product was dried in vacuo at 40'C overnight to provide the above-titled compound. 1H NMR (250 MHz DMSO-d6): 6 9.44 (s, 1H), 7.89 (d, 2H, 8.3 Hz), 7.89 (s, 1H), 5 7.55 (d, 2H, 8.3 Hz), 5.70 (s, 2H), 4.93 (s, 2H). 13C NMR (75.5 MHz DMSO-d6): 8c 139.7, 137.7, 132.7, 130.1, 128.8, 120.7, 118.4, 111.2, 48.9, 33.1. Method 2: To an ice cold solution of dry acetonitrile (3.2 L, 15 L/Kg hydroxymethylimidazole) was added 99% oxalyl chloride (101 mL, 1.15 mol, 10 1.15 equiv.), followed by dry DMF (178 mL, 2.30 mol, 2.30 equiv.), at which time vigorous evolution of gas was observed. After stirring for about 5 to 10 min following the addition of DMF, solid hydroxymethylimidazole (213 g, 1.00 mol), prepared as described above in Step 3, was added gradually. After the addition, the internal temperature was allowed to warm to a temperature of about 23'C to about 15 25'C and stirred for about 1 to 3 hours. The mixture was filtered, then washed with dry acetonitrile (400 mL displacement wash, 550 mL slurry wash, and a 400 mL displacement wash). The solid was maintained under a N2 atmosphere during the filtration and washing to prevent hydrolysis of the chloride by adventitious H20. This yielded the crystalline form of the chloromethylimidazole hydrochloride. 20 1H NMR (250 MHz DMSO-d6): 8 9.44 (s, 1H), 7.89 (d, 2H, 8.3 Hz), 7.89 (s, 1H), 7.55 (d, 2H, 8.3 Hz), 5.70 (s, 2H), 4.93 (s, 2H). 13C NMR (75.5 MHz DMSO-d6): 8c 139.7, 137.7, 132.7, 130.1, 128.8, 120.7, 118.4, 111.2, 48.9, 33.1. 25 Method 3: To an ice cold solution of dry DMF (178 mL, 2.30 mol, 2.30 equiv.) in dry acetonitrile (2.56 L, 12 L/Kg Hydroxymethylimidazole) was added oxalyl chloride (101 mL, 1.15 mol, 1.15 equiv). The heterogeneous mixture in the reagent vessel was then transferred to a mixture of hydroxymethylimidazole (213 g, 1.00 mol), prepared as described in Step 3 above, in dry acetonitrile (1.7 L, 8 L/Kg 30 hydroxymethylimidazole). Additional dry acetonitrile (1.1 - 2.3 L, 5 - 11 L/Kg hydroxymethylimidazole) was added to the remaining solid Vilsmeier reagent in the reagent vessel. This, now nearly homogenous, solution was transferred to the reaction vessel at Ti +6 C. The reaction vessel temperature was warmed to a temperature of about 23'C to about 25'C and stirred for about 1 to 3 hours. The mixture was then -58- WO 00/51614 PCT/USOO/05354 cooled to 0 0 C and aged 1 h. The solid was filtered and washed with dry, ice cold acetonitrile (400 mL displacement wash, 550 mL slurry wash, and a 400 mL displacement wash). The solid was maintained under a N2 atmosphere during the filtration and washing to prevent hydrolysis of the chloride by adventitious H20. This 5 yielded the crystalline form of the chloromethylimidazole hydrochloride. EXAMPLE 2 Preparation Of 1-(4'-Cyanobenzyl) imidazol-5-ylmethyl piperazine 10 Step 1: Preparation of 1-(4'-Cyanobenzyl) imidazol-5-ylmethyl piperazine-4 carboxylic acid benzyl ester To an acetonitrile solution of 1-(4'-cyanobenzyl)-5 chloromethylimidazole (7.45 mmol), prepared as described in Example 1, Step 4, and 15 diisopropylethylamine (22.4 mmol) was added 1-benzyl 1-piperazine carboxylate (10.4mmol). This solution was stirred for 4.0 hours at 80'C. The product was isolated after silica column purification. 'H-NMR (CDCI,): 8 7.65 (d, 2H); 7.55 (s, 1H); 7.38 (m, 5H); 7.15 (d, 2H); 7.0 (s, 20 1H); 5.3 (s, 2H); 5.1 (s, 1H); 3.4 (m, 4H); 3.3 (s, 2H); 2.3 (m, 4H). Step 2: Preparation of 1-(4'-Cyanobenzyl) imidazol-5-ylmethyl piperazine The product from Step 1 (6.17 mmol) was dissolved in absolute ethanol followed by the introduction of 10% Pd/C catalyst then hydrogen under 25 atmospheric pressure. The catalyst was removed via filtration through filter-aid and the product was isolated by removing the solvent under reduced pressure. 'H-NMR (CD 3 OD): 6 7.8 (s, 1H); 7.75 (d, 2H); 7.3 (d, 2H); 6.9 (s, 1H); 5.45 (s, 2H); 3.3 (in, 4H); 2.6 (s, 2H); 2.3 (m, 4H). -59- WO 00/51614 PCT/USOO/05354 EXAMPLE 3 0 N N NC N N / OCH3 N 8N 5 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-methoxyquinolin-4 oyl)piperazine trihydrochloride Step 1: Preparation of 2-methoxyquinoline-4-carboxylic acid methyl ester To a solution of 2-hydroxyquinoline-4-carboxylic acid (125 mg, 0.661 10 mmol) and silver carbonate (456 mg, 1.65 mmol) in chloroform (10 mL) was added methyl iodide (411 [tL, 6.61 mmol). The reaction mixture was stirred for 48 hours, filtered, and partitioned between methylene chloride (10 mL) and water (10 mL). The layers were separated and the aqueous layer was extracted with methylene chloride (2 x 10 mL). The combined organic layers were dried (Na 2

SO

4 ), filtered, and 15 concentrated in vacuo to provide the title compound as a yellow oil. Step 2: Preparation of 2-methoxyquinoline-4-carboxylic acid A solution of the ester from Step 1 (144 mg, 0.661 mmol) in THF (3 mL)/water (1 mL) and lithium hydroxide hydrate (41.7 mg, 0.994 mmol) was stirred 20 for 2.5 hours, poured onto 10% HCl, and extracted with ethyl acetate (2 x 10 mL). The combined organic layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo to provide the title product as a white solid. Step 3: Preparation of 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2 25 methoxyquinolin-4-oyl)piperazine trihydrochloride 1-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 21.7 mg, 0.0556 mmol), the acid from Step 2 (13.6 mg, 0.0667 mmol), EDC hydrochloride (11.7 mg, 0.0612 mmol), HOBT (8.27 mg, 0.0612 mmol), and N,N-diisopropylethylamine (48.4 gL, 0.278 mmol) were stirred in dry, degassed 30 DMF (500 gL) at 20'C under nitrogen. The reaction was stirred overnight and then -60- WO 00/51614 PCT/USOO/05354 injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 5 ES ms (m+1) 467. Anal. Calc. for C27H26N602 - 3.0 HCl - 1.10 H20: C, 54.43; H, 5.28; N, 14.11. Found: C, 54.49; H, 5.43; N, 13.71. EXAMPLE 4 10 0 N N NC N

C

2

H

5 0 N(C2H5)2 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-diethylamino-3 ethoxypyrid-5-oyl)piperazine trihydrochloride 15 Step 1: Preparation of 6-chloro-5-hydroxy nicotinic acid methyl ester A solution of 5-hydroxy nicotinic acid methyl ester(1.00 g, 6.53 mmol) and N-chlorosuccinimide (1.74 g, 13.1 mmol) in DMF (20 mL) was heated at 90 0 C for 20 hours. The solvent was removed in vacuo and the residue partitioned between methylene chloride (50 mL) and 10% HCI (50 mL). The layers were separated and 20 the aqueous layer was extracted with methylene chloride (3 x 20 mL). The combined organic layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo. The titled product was isolated as a brown solid after recrystallization from methylene chloride. Step 2: Preparation of 6-chloro-5-ethoxy nicotinic acid 25 To a solution of product from Step 1 (188 mg, 1.00 mmol) and potassium hydroxide (112 mg, 2.00 mmol) in DMSO (2 mL) was added ethyl iodide (71.5 tL, 1.20 mmol). The solution was stirred for 16 hours, poured onto 10% HCl (10 mL), and extracted with methylene chloride (3 x 10 mL). The combined organic -61- WO 00/51614 PCT/USOO/05354 layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo to yield the titled product as a white solid. Step 3: Preparation of 6-diethylamino-5-ethoxy nicotinic acid 5 A solution of the product from Step 2 (100 mg, 0.496 mmol) in diethylamine (2.5 mL)/ ethanol (2.5 mL) was heated in a sealed pressure tube at 145'C for 72 hours. The rection slurry was filtered and concentrated in vacuo. The crude product was purified on a C18 preparative HPLC column using a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min 10 to provide the titled product as a white solid. Step 4: Preparation of 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2 diethyl amino-3-ethoxypyri d-5-oyl)piperazine trihydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride 15 (Example 2, Step 2, 21.6 mg, 0.0554 mmol), the acid from Step 2 (15.0 mg, 0.0426 mmol), EDC hydrochloride (12.2 mg, 0.0639 mmol), HOBT (8.63 mg, 0.0639 mmol), and N,N-diisopropylethylamine (37.1 tL, 0.213 mmol) were stirred in dry, degassed DMF (500 gL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 20 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 502. Anal. Calc. for C28H35N702 - 4.4 HC - 0.80 EtOAc: C, 51.15; H, 6.30; N, 13.39. Found: C, 51.12; H, 6.08; N, 13.37. -62- WO 00/51614 PCT/USOO/05354 EXAMPLE 5 0 NC N N N NHC 2

H

5 NCN N_ 5 L-452,958 Preparation of 4-[1- (4-Cyanobenzyl)imidazol-5-ylmethyl] -1 -(3-ethylamino-4 isoquinolinovl)piperazine trihydrochloride Step 1: Preparation of 3-(ethylamino)isoquinoline-4-carboxylic acid ethyl ester 10 To a solution of 3-aminoisoquinoline-4-carboxylic acid ethyl ester (166 mg, 0.768 mmol), prepared by the method of Suzuki et al (Synthesis, 1995, 763), in THF (2 mL)/DMPU (1 mL) at 0 0 C was added lithium bis(trimethylsilyl)amide (1.OM in THF, 2.30 mL). The solution was stirred for 1 hour and then ethyl iodide (137 gL, 2.30 mmol) was added. The solution was stirred for 16 hours, poured onto 15 brine (20 mL), and extracted with ethyl acetate (3 x 20 mL). The combined organic layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo. The crude product was purified on a C18 preparative HPLC column using a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min to yield the titled product as a white solid. 20 Step 2: Preparation of 3 -(ethylamino)isoquinoline-4-carboxylic acid hydrochloride To a solution of product from Step 1 (49.5 mg, 0.203 mmol) in ethanol (3 mL) was added sodium hydroxide (16.2 mg, 0.405 mmol). The solution was 25 heated at reflux for 2 hours, quenched by the addition of HCl (IM in ether, 1 mL), and concentrated in vacuo to yield the titled product as a yellow solid. Step 3: Preparation of 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3 ethylamino-4-isoquinolinoyl)piperazine trihydrochloride -63- WO 00/51614 PCT/USOO/05354 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 51.0 mg, 0.131 mmol), the acid from Step 2 (49.5 mg, 0.196 mmol), EDC hydrochloride (27.5 mg, 0.144 mmol), HOBT (19.4 mg, 0.144 mmol), and N,N-diisopropylethylamine (114 tL, 0.653 mmol) were stirred in dry, degassed 5 DMF (1 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 10 ES ms (m+1) 480. Anal. Calc. for C28H29N701 - 5.1 HCl - 0.30 Et20: C, 50.99; H, 5.44; N, 14.26. Found: C, 51.04; H, 5.47; N, 14.28. EXAMPLE 6 0 N \-/N NC N 15 Br Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-bromo-1 naphthoyl)piperazine bishydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 190 mg, 0.486 mmol), 5-bromo-1-napthoic acid (122 mg, 0.486 20 mmol, prepared as described in Journal of the Chemical Society, 1927, 3098), EDC hydrochloride (102 mg, 0.535 mmol), HOBT (72.2 mg, 0.535 mmol), and N,N diisopropylethylamine (423 iL, 2.43 mmol) were stirred in dry, degassed DMF (2 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% 25 acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 515. Anal. Calc. for C27H24Br1N501 - 2.2 HCl: C, 54.70; H, 4.45; N, 11.81. Found: C, 54.71; H, 4.69; N, 11.42. -64- WO 00/51614 PCT/USOO/05354 EXAMPLE 7 0 N N NC N N

CH

3 5 Preparation of 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -[5-(pent- 1 -ynyl)- 1 naphthoyllpiperazine bishydrochloride Bromide from Example 6 (30.8 mg, 0.0524 mmol), 1-pentyne (20.7 tL, 0.210 mmol), dichlorobis(triphenylphosphine)palladium (3.68 mg, 0.00524 mmol), copper (I) iodide (2.00 mg, 0.0149 mmol), and triethylamine (36.5 gL, 0.262 10 mmol) were heated in dry, degassed DMF (0.5 mL) at 100 0 C in a sealed tube. The reaction was heated overnight, filtered, and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 15 ES ms (m+1) 502. Anal. Calc. for C32H31N501 - 2.3 HCl - 2.5 THF: C, 65.87; H, 7.02; N, 9.15. Found: C, 65.81; H, 6.71; N, 8.68. -65- WO 00/51614 PCT/USOO/05354 EXAMPLE 8 0 -N \-/N NC N N

CH

3 5 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1 -[5-(prop- 1 -ynyl)- 1 naphthoyllpiperazine bishydrochloride Bromide from Example 6 (33.9 mg, 0.0577 mmol), tributyl(propynyl)tin (69.7 tL, 0.231 mmol), potassium carbonate (39.9 mg, 0.289 mmol), and tetrakis(triphenylphosphine)palladium (6.67 mg, 0.00577 mmol) were 10 heated in dry, degassed DMF (0.5 mL) at 100'C in a sealed tube. The reaction was heated overnight, filtered, and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 15 ES ms (m+1) 474. Anal. Calc. for C30H27N501 - 3.0 HCl - 0.55 Et20: C, 62.18; H, 5.75; N, 11.26. Found: C, 62.13; H, 5.56; N, 11.24. -66- WO 00/51614 PCT/USOO/05354 EXAMPLE 9 0 NCN N N

CH

3 5 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-propyl-1 naphthoyl)piperazine bishydrochloride Product from Example 8 (10.0 mg, 0.0211 mmol), and 10% palladium on carbon (10 mg) were suspended in methanol (2 mL) and placed under a hydrogen atmosphere for 1.5 hours. The reaction solution was filtered and concentrated in 10 vacuo. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 478. Anal. Calc. for C30H31N501 - 2.0 HCI - 0.75 CH2Cl2: C, 60.12; H, 5.66; N, 11.40. Found: C, 60.16; H, 5.45; N, 11.31. 15 EXAMPLE 10 0 NCN N N N CH3 N Br Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(4-bromo-3 methylbenzoyl)piperazine bishydrochloride 20 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 172 mg, 0.441 mmol), 4-bromo-3-methylbenzoic acid (94.8 mg, 0.441 mmol), EDC hydrochloride (92.9 mg, 0.485 mmol), HOBT (65.5 mg, 0.485 mmol), and N,N-diisopropylethylamine (384 jtL, 2.20 mmol) were stirred in dry, -67- WO 00/51614 PCTIUSOO/05354 degassed DMF (1 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 5 ES ms (m+1) 478. Anal. Calc. for C24H24Br1N501 - 2.4 HCI- 0.45 Et20: C, 51.86; H, 5.21; N, 11.72. Found: C, 51.82; H, 5.32; N, 11.73. EXAMPLE 11 10 0 NC N N N N CH 3

CH

3 Preparation of 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-[3-methyl -4-(prop-1 ynyl)benzoyllpiperazine bishydrochloride Bromide from Example 10 (34.0 mg, 0.0599 mmol), 15 tributyl(propynyl)tin (78.9 mg, 0.240 mmol), potassium carbonate (41.4 mg, 0.300 mmol), and terakis(triphenylphosphine)palladium (6.67 mg, 0.00577 mmol) were heated in dry, degassed DMF (1 mL) at 100 0 C in a sealed tube. The reaction was heated for 2 hours, filtered, and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% 20 aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 438. Anal. Calc. for C27H27N501 - 2.1 HCl - 1.9 EtOAc: C, 61.02; H, 6.54; N, 10.34. Found: C, 60.96; H, 6.53; N, 10.35. -68- WO 00/51614 PCT/USOO/05354 EXAMPLE 12 0 NC N\ N N CH 3

CH

3 5 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-methyl-4 pentylbenzoyl)piperazine bishydrochloride Step 1: Preparation of 4-[l1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-[3 methyl-4-(pent- 1 -ynyl)benzoyllpiperazine bishydrochloride 10 Bromide from Example 10 (34.9 mg, 0.0615 mmol), 1-pentyne (30.3 gL, 0.308 mmol), dichlorobis(triphenylphosphine)palladium (4.30 mg, 0.00615 mmol), copper (I) iodide (2.30 mg, 0.0123 mmol), and triethylamine (42.9 gL, 0.308 mmol) were heated in dry, degassed DMF (1 mL) at 100 0 C in a sealed tube. The reaction was heated for 48 hours, filtered, and then injected onto a C18 preparative 15 HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. Step 2: Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3 20 methyl-4-pentylbenzoyl)piperazine bishydrochloride Product from Step 1 (10.0 mg, 0.0215 mmol), and 10% palladium on carbon (10 mg) were suspended in methanol (1 mL) and placed under a hydrogen atmosphere for 4.5 hours. The reaction solution was filtered and concentrated in vacuo. The title compound was isolated after conversion to the hydrochloride salt. 25 ES ms (m+1) 470. Anal. Calc. for C29H35N501 - 3.1 HCI - 1.7 EtOAc: C, 58.73; H, 7.10; N, 9.62. Found: C, 58.77; H, 6.99; N, 9.58. -69- WO 00/51614 PCT/USOO/05354 EXAMPLE 13 /\ 0/ N N NC N N

H

3 CO Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-cyclopropyleth-ynyl 5 5-methoxybenzoyl)piperazine bishydrochloride Step 1: Preparation of 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-bromo 5-methoxybenzoyl)piperazine bishydrochloride 1-[L-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride 10 (Example 2, Step 2, 1.50 g, 3.84 mmol), 2-bromo-5-methoxybenzoic acid (887 mg, 3.84 mmol), EDC hydrochloride (810 mg, 4.22 mmol), HOBT (571 mg, 4.22 mmol), and N,N-diisopropylethylamine (3.34 mL, 19.2 mmol) were stirred in dry, degassed DMF (10 mL) at 20'C under nitrogen. The solution was stirred for 48 hours, poured onto sat. aq. NaHCO, (50 mL), and extracted with methylene chloride (3 x 50 mL). 15 The combined organic layers were dried (Na2SO 4 ), filtered, and concentrated in vacuo to provide a yellow oil. The crude product was purified by column chromatography (5 -> 10% MeOH/CHCl,) and converted to the HCI salt to provide the title compound as a white solid. 20 Step 2: Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2 cyclopropylethynyl-5-methoxybenzoyl)piperazine bishydrochloride Bromide from Step 1 (118 mg, 0.209 mmol), tributyl (cyclopropylethynyl)tin (148 mg, 0.417 mmol), terakis(triphenylphosphine)palladium (12.0 mg, 0.0104 mmol), and potassium carbonate (144 mg, 1.04 mmol) were heated 25 in dry, degassed DMF (2 mL) at 100 0 C in a sealed tube. The reaction was heated for 2 hours, filtered, and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous -70- WO 00/51614 PCT/USOO/05354 TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 480. Anal. Calc. for C29H29N502 - 1.5 HCl - 1.8 CH2Cl2: C, 54.08; 5 H, 5,02; N, 10.26. Found: C, 54.08; H, 5.13; N, 10.26. EXAMPLE 14

CH

3 NC--\N NN- / NC N

H

3 CO 10 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-methoxy-2-pent-1 ynylbenzoyl)piperazine bishydrochloride Step 1: Preparation of 5-methoxy-2-pent-1-ynylbenzoic acid methyl ester 5-methoxy-2-bromobenzoic acid methyl ester (528 mg, 2.15 mmol), 1 15 pentyne (424 pL, 4.31 mmol), triphenylphosphine (141 mg, 0.538 mmol), dichlorobis(triphenylphosphine)palladium (75.5 mg, 0.108 mmol), and copper (I) iodide (102 mg, 0.538 mmol) were heated in triethylamine (10 mL) at 100 0 C in a sealed tube. The reaction was heated for 24 hours, poured onto sat. aq. NaHCO 3 (50 mL), and extracted with methylene chloride (3 x 50 mL). The combined organic 20 layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo to provide a yellow oil. The crude product was injected on a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min to provide the title compound as a white solid.. 25 Step 2: Preparation of 5-methoxy-2-(pent-1-ynyl)benzoic acid methyl ester A solution of the ester from Step 1 (150 mg, 0.646 mmol) and potassiumium hydroxide (54.4 mg, 0.969 mmol) in dioxane (2 mL)/water (1 mL) was stirred for 3.5 hours, poured onto 10% HCl (10 mL), and extracted with ethyl acetate -71- WO 00/51614 PCT/USOO/05354 (3 x 10 mL). The combined organic layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo to provide the title product as an off-white solid which was sufficiently pure for use in the next step. 5 Step 3: Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-[5 methoxy-2-(pent- 1 -ynyl)benzoyllpiperazine bishydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 81.1 mg, 0.208 mmol), the acid from Step 2 (45.3 mg, 0.208 mmol), EDC hydrochloride (43.8 mg, 0.228 mmol), HOBT (30.9 mg, 0.228 mmol), 10 and N,N-diisopropylethylamine (181 jtL, 1.04 mmol) were stirred in dry, degassed DMF (2 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 15 ES ms (m+1) 482. Anal. Calc. for C29H31N502 - 3.8 HCl - 0.70 EtOAc: C, 56.16; H, 5.98; N, 10.30. Found: C, 56.19; H, 6.37; N, 10.60. EXAMPLE 15 20

CH

3 /- 0/ N N NC NN_ N

H

3 CO Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro-2 cyclohexylethynylbenzoyl)piperazine bishydrochloride 25 Step 1: Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro 2-iodobenzoyl)piperazine bishydrochloride 1-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 716 mg, 1.83 mmol), 5-chloro-2-iodobenzoic acid (518 mg, 1.83 -72- WO 00/51614 PCT/USOO/05354 mmol), EDC hydrochloride (386 mg, 2.02 mmol), HOBT (272 mg, 2.02 mmol), and N,N-diisopropylethylamine (1.60 mL, 9.16 mmol) were stirred in dry, degassed DMF (10 mL) at 20 'C under nitrogen. The solution was stirred for 16 hours, poured onto sat. aq. NaHCO 3 (50 mL), and extracted with methylene chloride (3 x 50 mL). The 5 combined organic layers were dried (Na 2

SO

4 ), filtered, and concentrated in vacuo to provide a yellow oil. The crude product was purified by column chromatography (0 -> 5% MeOWCH 2

C

2 ) and converted to the HCI salt to provide the title compound as a white solid. 10 Step 2: Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro 2-cyclohexylethynylbenzoyl)piperazine bishydrochloride Iodide from Step 1 (118 mg, 0.190 mmol), cyclohexylacetylene (51.0 tL, 0.381 mmol), dichlorobis(triphenylphosphine)palladium (13.4 mg, 0.0190 mmol), copper (I) iodide (7.20 mg, 0.0380 mmol), and triethylamine (132 tL, 0.950 mmol) 15 were heated in DMF (3 mL) at 100 0 C in a sealed tube. The reaction was heated for 4 hours, filtered, injected on a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 20 ES ms (m+1) 526. Anal. Calc. for C31H32C11N501 - 2.9 HCl - 0.50 EtOAc: C, 58.64; H, 5.80; N, 10.36. Found: C, 58.69; H, 5.73; N, 10.34. -73- WO 00/51614 PCTIUSOO/05354 EXAMPLE 16 0 NC N N N N CI Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro-2 5 cyclohexylethylbenzoyl)piperazine bishydrochloride Product from Example 15, Step 2 (10.0 mg, 0.0190 mmol), and 10% palladium on carbon (10 mg) were suspended in methanol (2 mL) and placed under a hydrogen atmosphere for 8 hours. The reaction solution was filtered and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% 10 acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 530. Anal. Calc. for C31H36Cl1N501 - 2.1 HCI - 1.45 EtOAc: C, 60.33; H, 6.83; N, 9.56. Found: C, 60.32; H, 6.89; N, 9.57. 15 EXAMPLE 17 0 NC- N NH \/\NH

N-

Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(4-indoloyl)piperazine 20 bishydrochloride 1-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 22.0 mg, 0.0562 mmol), indole-4-carboxylic acid (9.06 mg, 0.0562 mmol), EDC hydrochloride (11.8 mg, 0.0618 mmol), HOBT (8.35 mg, 0.0618 mmol), and N,N-diisopropylethylamine (48.9 iL, 0.281 mmol) were stirred in dry, -74- WO 00/51614 PCT/USOO/05354 degassed DMF (0.5 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 5 ES ms (m+1) 425. Anal. Calc. for C25H24N601 - 3.0 HCl- 1.15 Et20: C, 57.42; H, 6.27; N, 13.58. Found: C, 57.74; H, 6.28; N, 13.61. EXAMPLE 18 10 0 NC N N

OH

3 N

H

3 C Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3,5 dimethylbenzoyl)piperazine bishydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride 15 (Example 2, Step 2, 20.1 mg, 0.0514 mmol), 3,5-dimethylbenzoic acid (7.72 mg, 0.0514 mmol), EDC hydrochloride (10.8 mg, 0.0565 mmol), HOBT (7.64 mg, 0.0565 mmol), and N,N-diisopropylethylamine (44.8 gL, 0.257 mmol) were stirred in dry, degassed DMF (0.5 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed 20 gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 414. Anal. Calc. for C25H27N501 - 2.5 HCl 1.05 H20: C, 57.34; H, 6.08; N, 13.38. Found: C, 57.34; H, 6.03; N, 13.11. -75- WO 00/51614 PCT/USOO/05354 EXAMPLE 19 0 N N NC N N N Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(8 5 quinolinoyl)piperazine trihydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 44.8 mg, 0.115 mmol), 8-quinoline carboxylic acid (19.8 mg, 0.115 mmol), EDC hydrochloride (24.2 mg, 0.126 mmol), HOBT (17.0 mg, 0.126 mmol), and N,N-diisopropylethylamine (99.8 pL, 0.573 mmol) were stirred in dry, 10 degassed DMF (1 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 15 ES ms (m+1) 437. Anal. Calc. for C26H24N601 - 4.5 HCl- 0.10 H20: C, 51.84; H, 4.80; N, 13.95. Found: C, 51.83; H, 4.81; N, 13.73. EXAMPLE 20 0 NC N N N OC 2

H

5 N 20 Preparation of 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-ethoxy-1 naphthoyl)piperazine bishydrochloride 1-[I1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 40.7 mg, 0.104 mmol), 2-ethoxy-1-naphthoic acid (22.5 mg, 25 0.104 mmol), EDC hydrochloride (22.0 mg, 0.115 mmol), HOBT (15.5 mg, 0.115 mmol), and N,N-diisopropylethylamine (90.8 [tL, 0.521 mmol) were stirred in dry, -76- WO 00/51614 PCT/USOO/05354 degassed DMF (1 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 5 ES ms (m+1) 480. Anal. Calc. for C29H29N502 - 2.5 HCl- 1.0 H20: C, 59.16; H, 5.74; N, 11.90. Found: C, 59.14; H, 5.39; N, 11.80. 10 EXAMPLE 21 0 N NI NC N -N N Preparation of 4-[l-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2 quinolinoyl)piperazine trihydrochloride 15 1-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 21.5 mg, 0.0550 mmol), 2-quinoline carboxylic acid (9.52 mg, 0.0550 mmol), EDC hydrochloride (11.6 mg, 0.0605 mmol), HOBT (8.17 mg, 0.0605 mmol), and N,N-diisopropylethylamine (47.9 gL, 0.275 mmol) were stirred in dry, degassed DMF (0.5 mL) at 20'C under nitrogen. The reaction was stirred overnight 20 and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 437. Anal. Calc. for C26H24N601 e 3.9 HCI 1.1 Et20: C, 55.30; H, 25 5.94; N, 12.73. Found: C, 55.30; H, 6.05; N, 12.72. -77- WO 00/51614 PCT/USOO/05354 EXAMPLE 22 0 NCN N N N CH 3

CH

3 5 Preparation of 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-methoxy-4 methylbenzoyl)piperazine bishydrochloride 1-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (Example 2, Step 2, 23.3 mg, 0.0597 mmol), 3-methoxy-4-methylbenzoic acid (9.92 10 mg, 0.0597 mmol), EDC hydrochloride (12.6 mg, 0.0657 mmol), HOBT (8.88 mg, 0.0657 mmol), and N,N-diisopropylethylamine (52.0 gL, 0.299 mmol) were stirred in dry, degassed DMF (0.5 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 430. Anal. Calc. for C25H27N502 - 2.7 HCle 1.9 H20: C, 53.67; H, 6.01; N, 12.52. Found: C, 53.64; H, 6.00; N, 12.37. 20 EXAMPLE 23 0 NC N N N -N N / N(C 2

H

5 ) Preparation of 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(6-diethylamino-pyrid-2 25 oyl)piperazine trihydrochloride -78- WO 00/51614 PCT/USOO/05354 Step 1: Preparation of 6-diethylaminopyridine-2-ethyl ester A solution of 6-chlorpyridine-2-carboxylic acid (2.5 g, 15.9 mmol) and diethylamine (25ml , 64.8 mmol) in ethanol (25ml) was placed and shaked well in a steal bomb reaction vessel at 200'C for 4 hrs. The solvent was removed in vacuo and 5 the residue was treated with triethyl amine (3 x 10ml) and concentrated in vacuo to yield the title compound which was sufficiently pure for use in the next step. Step 2: Preparation of 6-diethylaminopyridine-2-carboxylic acid 10 The ester from step 1 (2g, 9.0 mmol) and NaOH (IM, 50ml) were stirred in MeOH (50ml) at reflux for 3hrs. The reaction was concentrated in vacuo. The residue was dissolved in methylene chloride (15ml) and HCI (1M in ether, 5ml) was added. The solvent was removed in vacuo. The crude product was purified by a C18 preparative HPLC column with a mixed gradient of 5%-95% acetonitrile/0.1% 15 TFA; 95%-5%/0.1% aqueous TFA over 15 min and the title compound was isolated. Step 3: Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(6 diethylamino-pyrid-2-oyl)piperazine trihydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride 20 (Example 2, Step 2, 150 mg, 0.38 mmol), the acid from Step 2 (200 mg, 0.769 mmol), EDC hydrochloride (150 mg, 0.0.769 mmol), HOBT (0.350 mg, 0.38 mmol), and triethyl amine (264 gL, 1.9 mmol) were stirred in dry DMF (4 ml) at 20'C under Argon. Another portion of the piperazine (Example 2, Step 2, 80mg, 0.205 mmol) was added after 5 min and the reaction was stirred at 20'C for 1 hr. The reaction was 25 concentrated in vacuo and then worked up with ethyl acetate and H20. The crude product was purified by a C18 preparative HPLC column with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 30 ES ms (m+1) 458. Anal. Calc. for C26H31N70 - 3.0 HCI - 0.55 H20: C, 54.13; H, 6.13; N, 17.00. Found: C, 54.12; H, 6.62; N, 15.05. EXAMPLE 24 -79- WO 00/51614 PCT/USOO/05354 0 N N NC N -N Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(1 isoquinolinoyl)piperazine trihydrochloride 5 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (21.5 mg, 0.0550 mmol), prepared as described in Example 2, Step 2, 1 isoquinolinecarboxylic acid (9.52 mg, 0.0550 mmol), EDC hydrochloride (11.6 mg, 0.0605 mmol), HOBT (8.17 mg, 0.0605 mmol), and N,N-diisopropylethylamine (47.9 10 mL, 0.275 mmol) were stirred in dry, degassed DMF (500 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. 15 ES ms (m+1) 437. Anal. Calc. for C26H24N601 - 4.5 HCl - 0.45 Et20: C, 52.82; H, 5.25; N, 13.30. Found: C, 52.78; H, 5.42; N, 13.30. EXAMPLE 25 20 0 NC-- N N-- N N N Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyll-1-(2,3-dihydrobenzofuran 7-oyl)piperazine dihydrochloride 25 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (23.4 mg, 0.0600 mmol), prepared as described in Example 2, Step 2, 2,3 dihydrobenzofuran-7-carboxylic acid (9.84 mg, 0.0600 mmol), EDC hydrochloride -80- WO 00/51614 PCT/US0O/05354 (12.6 mg, 0.0659 mmol), HOBT (8.91 mg, 0.0659 mmol), and N,N diisopropylethylamine (52.2 mL, 0.300 mmol) were stirred in dry, degassed DMF (500 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 428. Anal. Calc. for C25H25N502 - 3.2 HCl e 0.40 Et20: C, 55.50; H, 5.65; N, 12.17. Found: C, 55.49; H, 5.80; N, 12.34. 10 EXAMPLE 26 0 NCN N N CH 3

CH

3 15 Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3,4-dimethylbenzoyl) piperazine dihydrochloride 1-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (20.1 mg, 0.0514 mmol), prepared as described in Example 2, Step 2, 3,4 20 dimethylbenzoic acid (7.72 mg, 0.0514 mmol), EDC hydrochloride (10.8 mg, 0.0565 mmol), HOBT (7.64 mg, 0.0565 mmol), and N,N-diisopropylethylamine (44.8 mL, 0.257 mmol) were stirred in dry, degassed DMF (500 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95% 25 5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the hydrochloride salt. ES ms (m+1) 414. Anal. Calc. for C25H27N501 - 2.5 HCl - 1.35 H20: C, 56.76; H, 6.14; N, 13.24. Found: C, 56.81; H, 5.87; N, 13.04. 30 -81- WO 00/51614 PCTIUSOO/05354 EXAMPLE 27 0 N N NC N N Preparation of 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(1-naphthoyl)piperazine 5 dihydrochloride 1-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]piperazine trihydrochloride (26.9 mg, 0.0688 mmol), prepared as described in Example 2, Step 2, 1-naphthoic acid (11.9 mg, 0.0688 mmol), EDC hydrochloride (14.5 mg, 0.0758 mmol), HOBT 10 (10.2 mg, 0.0758 mmol), and N,N-diisopropylethylamine (60.0 mL, 0.344 mmol) were stirred in dry, degassed DMF (500 mL) at 20'C under nitrogen. The reaction was stirred overnight and then injected onto a C18 preparative HPLC column and purified with a mixed gradient of 5%-95% acetonitrile/0.1% TFA; 95%-5%/0.1% aqueous TFA over 15 min. The title compound was isolated after conversion to the 15 hydrochloride salt. ES ms (m+1) 436. Anal. Calc. for C27H25N501 - 2.8 HCl: C, 60.11; H, 5.20; N, 12.98. Found: C, 60.06; H, 5.15; N, 13.06. 20 EXAMPLE 28 In vitro inhibition of ras farnesyl transferase Transferase Assays. Isoprenyl-protein transferase activity assays are carried out at 30 0 C unless noted otherwise. A typical reaction contains (in a final 25 volume of 50 iL): [ 3 H]famesyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgC 2 , 5 mM dithiothreitol, 10 jtM ZnCI2, 0.1% polyethyleneglycol (PEG) (15,000-20,000 mw) and isoprenyl-protein transferase. The FPTase employed in the assay is prepared by recombinant expression as described in Omer, C.A., Kral, A.M., Diehl, R.E., Prendergast, G.C., Powers, S., Allen, C.M., Gibbs, J.B. and Kohl, N.E. 30 (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl -82- WO 00/51614 PCT/USOO/05354 protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HCl in ethanol (1 mL). The quenched reactions are allowed to stand for 15 m (to complete the precipitation process). After adding 2 mL of 100% ethanol, the reactions are vacuum-filtered through Whatman GF/C filters. Filters are washed four 5 times with 2 mL aliquots of 100% ethanol, mixed with scintillation fluid (10 mL) and then counted in a Beckman LS3801 scintillation counter. For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20-fold into the enzyme assay mixture. Substrate concentrations for inhibitor 10 IC50 determinations are as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 1), 100 nM farnesyl diphosphate. The compounds of the instant invention described in the above Examples 3-27 were tested for inhibitory activity against human FPTase by the assay described above and were found to have an IC50 of 5 pM. 15 EXAMPLE 29 Modified In vitro GGTase inhibition assay The modified geranylgeranyl-protein transferase inhibition assay is 20 carried out at room temperature. A typical reaction contains (in a final volume of 50 pL): [ 3 H]geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl 2 , 10 FM ZnCl2, 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol, and geranylgeranyl-protein transferase type I(GGTase). The GGTase-type I enzyme 25 employed in the assay is prepared as described in U.S. Pat. No. 5,470,$32, incorporated by reference. The Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: 2). Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 tL of a 3 mg/mL 30 suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter. -83- WO 00/51614 PCT/USOO/05354 For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 25-fold into the enzyme assay mixture. IC50 values are determined with Ras peptide near KM concentrations. Enzyme and substrate concentrations for inhibitor 5 IC50 determinations are as follows: 75 pM GGTase-I, 1.6 tM Ras peptide, 100 nM geranylgeranyl diphosphate. The compounds of the instant invention described in the above Examples 3-27 were tested for inhibitory activity against human GGTase-type I by the assay described above and were found to have an IC50 of 500 nM. 10 EXAMPLE 30 Cell-based in vitro ras farnesylation assay The cell line used in this assay is a v-ras line derived from either Ratl 15 or NIH3T3 cells, which expressed viral Ha-ras p21. The assay is performed essentially as described in DeClue, J.E. et al., Cancer Research 51:712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%). After 4 hours at 37'C, the cells are labeled in 3 ml methionine-free DMEM supple-mented with 10% 20 regular DMEM, 2% fetal bovine serum and 400 tCi[35S]methionine (1000 Ci/mmol). After an additional 20 hours, the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/1mM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min. Aliquots of lysates containing equal numbers of acid 25 precipitable counts are bought to 1 ml with IP buffer (lysis buffer lacking DTT) and immunoprecipitated with the ras-specific monoclonal antibody Y13-259 (Furth, M.E. et al., J. Virol. 43:294-304, (1982)). Following a 2 hour antibody incubation at 4'C, 200 tl of a 25% suspension of protein A-Sepharose coated with rabbit anti rat IgG is added for 45 min. The immunoprecipitates are washed four times with IP buffer (20 30 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-100.0.5% eoxycholate/0.1%/SDS/0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to farnesylated and nonfarnesylated ras proteins are compared to determine the percent inhibition of 35 farnesyl transfer to protein. -84- WO 00/51614 PCT/USOO/05354 EXAMPLE 31 Cell-based in vitro growth inhibition assay 5 To determine the biological consequences of FPTase inhibition, the effect of the compounds of the instant invention on the anchorage-independent growth of Ratl cells transformed with either a v-ras, v-raf, or v-mos oncogene is tested. Cells transformed by v-Raf and v-Mos maybe included in the analysis to evaluate the specificity of instant compounds for Ras-induced cell transformation. 10 Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 104 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) over a bottom agarose layer (0.6%). Both layers contain 0.1% methanol or an appropriate concentration of the instant compound (dissolved in 15 methanol at 1000 times the final concentration used in the assay). The cells are fed twice weekly with 0.5 ml of medium A containing 0.1% methanol or the concentration of the instant compound. Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made. 20 EXAMPLE 32 Construction of SEAP reporter plasmid pDSE100 The SEAP reporter plasmid, pDSE100 was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV 25 RE-AKI. The SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA). The plasmid pCMV-RE-AKI was constructed by Deborah Jones (Merck) and contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter. The plasmid also contains a bovine growth hormone poly 30 A sequence. The plasmid, pDSE100 was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2 Basic using the restriction enzymes EcoR1 and HpaI. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The -85- WO 00/51614 PCT/USOO/05354 'blunt ended' DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II and the ends filled in with Klenow DNA Polymerase I. The SEAP DNA fragment was blunt 5 end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence 10 downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence. Alternative Construction of SEAP reporter plasmid, pDSE101 The SEAP repotrer plasmid, pDSE101 is also constructed by ligating a 15 restriction fragment containing the SEAP coding sequence into the plasmid pCMV RE-AKI. The SEAP gene is derived from plasmid pGEM7zf(-)/SEAP. The plasmid pDSE101 was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the 20 plasmid pGEM7zf(-)/SEAP using the restriction enzymes Apa I and KpnI. The ends of the linear DNA fragments were chewed back with the Klenow fragment of E. coli DNA Polymerase I. The "blunt ended" DNA containing the truncated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid 25 pCMV-RE-AKI which had been cut with Bgl-II and filled in with E. coli Klenow fragment DNA polymerase. Recombinant plasmids were screened for insert orientation and sequenced through the ligated junctions. The plasmid pCMV-RE-AKI is derived from plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796 30 1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers. Five copies of the fos promoter serum response element were inserted as described previously (Jones, R.E., Defeo-Jones, D., McAvoy, E.M., Vuocolo, G.A., Wegrzyn, R.J., Haskell, K.M. and Oliff, A. (1991) Oncogene, 6, 745-75 1) to create plasmid pCMV-RE-AKI. 35 -86- WO 00/51614 PCT/USOO/05354 The plasmid pGEM7zf(-)/SEAP was constructed as follows. The SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos. 5 Sense strand N-terminal SEAP: 5' GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.NO.:3) Antisense strand N-terminal SEAP: 5' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.:4) 10 Sense strand C-terminal SEAP: 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.:5) Antisense strand C-terminal SEAP: 5' GAAGAGGAAGCTTGGTACCGCCACTG 15 GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO.:6) The N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and HpaI restriction sites at the ends. The Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal 20 translation STOP codon within the SEAP gene along with the HpaI site. The C terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp C-terminal PCR product containing HpaI and HindIII restriction sites. The sense strand C-terminal oligo (SEQ.ID.NO.: 5) introduces the internal STOP codon as well as the HpaI site. Next, the N-terminal amplicon was digested with EcoRI and HpaI 25 while the C-terminal amplicon was digested with HpaI and HindIl. The two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf(-) (Promega) which had been restriction digested with EcoRI and HindIll and isolated on an 30 agarose gel. The resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids. Construction of a constitutively expressing SEAP plasmid pCMV-SEAP -87- WO 00/51614 PCT/USOO/05354 An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE-1 promoter. The expression plasmid also includes the CMV intron A region 5' to the SEAP gene as well as the 3' untranslated region of the 5 bovine growth hormone gene 3' to the SEAP gene. The plasmid pCMVIE-AKI-DHFR (Whang et al, 1987) containing the CMV immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting 10 plasmid is named pCMV-AKI. Next, the cytomegalovirus intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI. The intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid p16T-286. The intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, 15 K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a SacI restriction site using site directed mutagenesis. The mutated intron A sequence was PCRed from the plasmid p16T-287 using the following oligos. Sense strand: 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7) 20 Antisense strand: 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 8) These two oligos generate a 991 base pair fragment with 25 a Sac site incorporated by the sense oligo and a Bgl-II fragment incorporated by the antisense oligo. The PCR fragment is trimmed with Sac and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI is cut with Sac and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis. The two gel isolated fragments are ligated at their respective Sac and Bgl-II sites to create plasmid 30 pCMV-AKI-InA. The DNA sequence encoding the truncated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector. The SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and HindIII. The 35 fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment -88- WO 00/51614 PCTIUSOO/05354 isolated from the vector fragment by agarose gel electrophoresis. The pCMV-AKI InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMV-AKI-InA vector. Transformants were screened for the 5 proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid, named pCMV-SEAP, contains a modified SEAP sequence downstream of the cytomegalovirus immediately early promoter IE-I and intron A sequence and upstream of the bovine growth hormone poly-A sequence. 10 The plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells. Cloning of a Myristylated viral-H-ras expression plasmid 15 A DNA fragment containing viral-H-ras can be PCRed from plasmid "H-1" (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos. 20 Sense strand: 5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAAGGACCC CAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTGG 3'. (SEQ.ID.NO.: 9) 25 Antisense: 5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3'. (SEQ.ID.NO.: 10) A sequence encoding the first 15 aminoacids of the v-src gene, 30 containing a myristylation site, is incorporated into the sense strand oligo. The sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.To prevent prenylation at the viral-ras C-terminus, cysteine 186 would be mutated to a seine by substituting a G residue for a C residue in the C -89- WO 00/51614 PCT/USOO/05354 terminal antisense oligo. The PCR primer oligos introduce an XhoI site at the 5' end and a XbaI site at the 3'end. The XhoI-XbaI fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with XhoI and XbaI. This results in a plasmid in which the recombinant myr-viral-H-ras gene is constitutively 5 transcribed from the CMV promoter of the pCI vector. Cloning of a viral-H-ras-CVLL expression plasmid A viral-H-ras clone with a C-terminal sequence encoding the amino 10 acids CVLL can be cloned from the plasmid "H-i" (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-Il (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) by PCR using the following oligos. Sense strand: 15 5'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3' (SEQ.ID.NO.: 11) Antisense strand: 5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ.ID.NO.: 20 12) The sense strand oligo optimizes the 'Kozak' sequence and adds an XhoI site. The antisense strand mutates serine 189 to leucine and adds an XbaI site. The PCR fragment can be trimmed with XhoI and XbaI and ligated into the XhoI 25 XbaI cut vector pCI (Promega). This results in a plasmid in which the mutated viral H-ras-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector. Cloning of c-H-ras-Leu61 expression plasmid 30 The human c-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers. -90- WO 00/51614 PCT/US0O/05354 Sense strand: 5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3' (SEQ.ID.NO.: 13) 5 Antisense strand: 5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3' (SEQ.ID.NO.: 14) The primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at 10 the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 15 5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.NO.: 15) After selection and sequencing for the correct nucleotide substitution, the mutated c-H-ras-Leu6l can be excised from the pAlter-1 vector, using EcoRI and 20 Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c H-ras-Leu61 from the CMV promoter of the pCI vector. Cloning of a c-N-ras-Val-12 expression plasmid 25 The human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers. Sense strand: 30 5'-GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3' (SEQ.ID.NO.: 16) -91- WO 00/51614 PCT/USOO/05354 Antisense strand: 5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3' (SEQ.ID.NO.: 17) The primers will amplify a c-N-ras encoding DNA fragment with the 5 primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to a valine can be accomplished using the manufacturer's protocols and the following 10 oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 18) After selection and sequencing for the correct nucleotide substitution, 15 the mutated c-N-ras-Val-12 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c N-ras-Val-12 from the CMV promoter of the pCI vector. 20 Cloning of a c-K-ras-Val-12 expression plasmid The human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers. 25 Sense strand: 5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3' (SEQ.ID.NO.: 19) Antisense strand: 30 5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3' (SEQ.ID.NO.: 20) -92- WO 00/51614 PCT/USOO/05354 The primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a KpnI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with Kpn I and Sal I, the c-K-ras fragment can be ligated into a KpnI 5 Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of cysteine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.NO.: 21) 10 After selection and sequencing for the correct nucleotide substitution, the mutated c-K-ras-Val-12 can be excised from the pAlter-1 vector, using KpnI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with KpnI and Sal I. The new recombinant plasmid will constitutively transcribe c-K 15 ras-Val-12 from the CMV promoter of the pCI vector. SEAP assay Human C33A cells (human epitheial carcenoma - ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf serum + 1X 20 Pen/Strep + 1X glutamine + IX NEAA. Cells are grown at 37 0 C in a 5% C02 atmosphere until they reach 50 -80% of confluency. The transient transfection is performed by the CaPO4 method (Sambrook et al., 1989). Thus, expression plasmids for H-ras, N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE-SEAP reporter construct. For 10cm 25 plates 600gl of CaCl2 -DNA solution is added dropwise while vortexing to 600 tl of 2X HBS buffer to give 1.2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red; Gibco cat. # 31053-028)+ 0.5% charcoal stripped calf serum + 1X (Pen/Strep, 30 Glutamine and nonessential aminoacids). The CaPO4-DNA precipitate is added dropwise to the cells and the plate rocked gently to distribute. DNA uptake is allowed to proceed for 5-6 hrs at 37 0 C under a 5% C02 atmosphere. Following the DNA incubation period, the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin. The 1 ml of trypsinized cells is diluted -93- WO 00/51614 PCTIUSOO/05354 into 10ml of phenol red free DMEM + 0.2% charcoal stripped calf serum + 1X (Pen/Strep, Glutamine and NEAA ). Transfected cells are plated in a 96 well microtiter plate (100tl/well) to which drug, diluted in media, has already been added in a volume of 100tl. The final volume per well is 200 tl with each drug 5 concentration repeated in triplicate over a range of half-log steps. Incubation of cells and drugs is for 36 hrs at 37 0 Cunder C02. At the end of the incubation period, cells are examined microscopically for evidence of cell distress. Next, 100 tl of media containing the secreted alkaline phosphatase is removed from each well and transferred to a microtube array for heat treatment at 10 65 0 C for 1 hr to inactivate endogenous alkaline phosphatases (but not the heat stable secreted phosphatase). The heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD@(Tropix, Bedford, Mass.). A volume of 50 1d media is combined with 200 gl of CSPD cocktail and incubated 15 for 60 minutes at room temperature. Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter construct stimulated by the transiently expressed protein. DNA-CaPO4 precipitate for 10cm. plate of cells 20 Ras expression plasmid (1gg/[d) 10 1 DSE-SEAP Plasmid (1tg/gl) 2gl Sheared Calf Thymus DNA (1tg/ tl) 8gl 2M CaCl2 74pl dH20 506 1 25 2X HBS Buffer 280mM NaCl 10mM KCl 1.5mM Na2HPO4 2H20 30 12mM dextrose 50mM HEPES Final pH = 7.05 Luminesence Buffer (26ml) -94- WO 00/51614 PCTUSOO/05354 Assay Buffer 20ml Emerald Reagent TM (Tropix) 2.5ml 100mM homoarginine 2.5ml CSPD Reagent@ (Tropix) 1.0m] 5 Assay Buffer Add 0.05M Na2CO3 to 0.05M NaHCO3 to obtain pH 9.5. Make 1mM in MgCl2 10 EXAMPLE 33 The processing assays employed are modifications of that described by DeClue et al [Cancer Research 51, 712-717, 1991]. 15 K4B-Ras processing inhibition assay PSN-1 (human pancreatic carcinoma) or viral-K4B-ras-transformed Ratl cells are used for analysis of protein processing. Subconfluent cells in 100 mm dishes are fed with 3.5 ml of media (methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine-free/methionine-free DMEM supplemented with 0.035 20 ml of 200 mM glutamine (Gibco), 2% fetal bovine serum, respectively) containing the desired concentration of test compound, lovastatin or solvent alone. Cells treated with lovastatin (5-10 yM), a compound that blocks Ras processing in cells by inhibiting a rate-limiting step in the isoprenoid biosynthetic pathway, serve as a positive control. Test compounds are prepared as 1000x concentrated solutions in DMSO to yield a 25 final solvent concentration of 0.1%. Following incubation at 37 0 C for two hours 204 pCi/ml [ 3 5 S]Pro-Mix (Amersham, cell labeling grade) is added. After introducing the label amino acid mixture, the cells are incubated at 37 0 C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS. The cells are scraped into 1 30 ml of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 ml of lysis buffer (1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 gg/ml AEBSF, 10 yg/ml aprotinin, 2 pg/ml leupeptin and 2 tg/ml -95- WO 00/51614 PCT/USOO/05354 antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4 0 C and the supernatant saved. For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined 5 by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 8 p/g of the pan Ras monoclonal antibody, Y13-259, added. The protein/antibody mixture is incubated on ice at 4 0 C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling 10 at 40C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 pA elution buffer (10 mM Tris pH 7.4, 1% SDS). The Ras is eluted from the beads by heating at 95'C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature). 15 The supernatant is added to 1 ml of Dilution Buffer 0.1% Triton X 100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 tg Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem). The second protein/antibody mixture is incubated on ice at 4 0 C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by 20 tumbling at 4 0 C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Ras is eluted from the beads by heating at 95'C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS PAGE on a 12% acrylamide gel (bis-acrylamide:acrylamide, 1:100), and the Ras 25 visualized by fluorography. hDJ processing inhibition assay PSN-1 cells are seeded in 24-well assay plates. For each compound to be tested, the cells are treated with a minimum of seven 30 concentrations in half-log steps. The final solvent (DMSO) concentration is 0.1%. A vehicle-only control is included on each assay plate. The cells are treated for 24 hours at 37-C / 5% Co 2 . The growth media is then aspirated and the samples are washed with PBS. The cells are lysed with SDS-PAGE sample buffer containing 5% 2 -96- WO 00/51614 PCTIUSOO/05354 mercaptoethanol and heated to 95-C for 5 minutes. After cooling on ice for 10 minutes, a mixture of nucleases is added to reduce viscosity of the samples. The plates are incubated on ice for another 10 minutes. The samples are loaded onto pre-cast 8% acrylamide gels and electrophoresed at 15 mA/gel for 3-4 5 hours. The samples are then transferred from the gels to PVDF membranes by Western blotting. The membranes are blocked for at least 1 hour in buffer containing 2% nonfat dry milk. The membranes are then treated with a monoclonal antibody to hDJ 2 (Neomarkers Cat. # MS-225), washed, and treated with an alkaline phosphatase 10 conjugated secondary antibody. The membranes are then treated with a fluorescent detection reagent and scanned on a phosphorimager. For each sample, the percent of total signal corresponding to the unprenylated species of hDJ (the slower-migrating species) is calculated by densitometry. Dose-response curves and EC 50 values are generated using 4-parameter 15 curve fits in SigmaPlot software. EXAMPLE 34 Rap1 processing inhibition assay 20 Protocol A: Cells are labeled, incubated and lysed as described in Example 33. For immunoprecipitation of Rap1, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of 25 lysate is brought to 1 ml with lysis buffer lacking DTT and 2 tg of the Rap1 antibody, Rapl/Krevl (121) (Santa Cruz Biotech) is added. The protein/antibody mixture is incubated on ice at 4 0 C for 1 hour. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4 0 C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 l 30 elution buffer (10 mM Tris pH 7.4, 1% SDS). The Rap1 is eluted from the beads by heating at 95'C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature). The supernatant is added to 1 ml of Dilution Buffer (0.1%. Triton X 100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 .g RapI antibody, -97- WO 00/51614 PCT/USOO/05354 Rapl/Krevl (121) (Santa Cruz Biotech). The second protein/antibody mixture is incubated on ice at 4 0 C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4 0 C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended 5 in Laemmli sample buffer. The RapI is eluted from the beads by heating at 95'C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide:acrylamide, 1:100), and the RapI visualized by fluorography. 10 Protocol B: PSN-1 cells are passaged every 3-4 days in 10cm plates, splitting near confluent plates 1:20 and 1:40. The day before the assay is set up, 5x 10 cells are plated on 15cm plates to ensure the same stage of confluency in each assay. The media for these cells is RPM1 1640 (Gibco), with 15% fetal bovine serum and lx 15 Pen/Strep antibiotic mix. The day of the assay, cells are collected from the 15cm plates by trypsinization and diluted to 400,000 cells/ml in media. 0.5ml of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37'C overnight. 20 The compounds to be assayed are diluted in DMSO in 1/2-log dilutions. The range of final concentrations to be assayed is generally 0.1-100pM. Four concentrations per compound is typical. The compounds are diluted so that each concentration is 1000x of the final concentration (i.e., for a 10pM data point, a 10mM stock of the compound is needed). 25 2pL of each 1000x compound stock is diluted into 1ml media to produce a 2X stock of compound. A vehicle control solution (2pL DMSO to lml media), is utilized. 0.5 ml of the 2X stocks of compound are added to the cells. After 24 hours, the media is aspirated from the assay plates. Each well is rinsed with Iml PBS, and the PBS is aspirated. 180pL SDS-PAGE sample buffer 30 (Novex) containing 5% 2-mercapto-ethanol is added to each well. The plates are heated to 100-C for 5 minutes using a heat block containing an adapter for assay plates. The plates are placed on ice. After 10 minutes, 20pL of an RNAse/DNase mix is added per well. This mix is 1mg/ml DNaseI (Worthington Enzymes), 0.25mg/ml Rnase A (Worthington Enzymes), 0.5M Tris-HCl pH8.0 and 50mM -98- WO 00/51614 PCT/USOO/05354 MgCl 2 . The plate is left on ice for 10 minutes. Samples are then either loaded on the gel, or stored at -70-C until use. Each assay plate (usually 3 compounds, each in 4-point titrations, plus controls) requires one 15-well 14% Novex gel. 25pl of each sample is 5 loaded onto the gel. The gel is run at 15mA for about 3.5 hours. It is important to run the gel far enough so that there will be adequate separation between 21kd (Rap 1) and 29kd (Rab6). The gels are then transferred to Novex pre-cut PVDF membranes for 1.5 hours at 30V (constant voltage). Immediately after transferring, 10 the membranes are blocked overnight in 20ml Western blocking buffer (2% nonfat dry milk in Western wash buffer (PBS + 0.1% Tween-20). If blocked over the weekend, 0.02% sodium azide is added. The membranes are blocked at 4-C with slow rocking. The blocking solution is discarded and 20ml fresh blocking 15 solution containing the anti Rapla antibody (Santa Cruz Biochemical SC1482) at 1:1000 (diluted in Western blocking buffer) and the anti Rab6 antibody (Santa Cruz Biochemical SC310) at 1:5000 (diluted in Western blocking buffer) are added. The membranes are incubated at room temperature for 1 hour with mild rocking. The blocking solution is then discarded and the membrane is washed 3 times with Western 20 wash buffer for 15 minutes per wash. 20ml blocking solution containing 1:1000 (diluted in Western blocking buffer) each of two alkaline phosphatase conjugated antibodies (Alkaline phosphatase conjugated Anti-goat IgG and Alkaline phosphatase conjugated anti-rabbit IgG [Santa Cruz Biochemical]) is then added. The membrane is incubated for one hour and washed 3x as above. 25 About 2ml per gel of the Amersham ECF detection reagent is placed on an overhead transparency (ECF) and the PVDF membranes are placed face down onto the detection reagent. This is incubated for one minute, then the membrane is placed onto a fresh transparency sheet. The developed transparency sheet is scanned on a 30 phosphorimager and the Rapla Minimum Inhibitory Concentration is determined from the lowest concentration of compound that produces a detectable Rapla Western signal. The Rapla antibody used recognizes only unprenylated/unprocessed Rapla, so that the precence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation. -99- WO 00/51614 PCT/USOO/05354 Protocol C This protocol allows the determination of an EC 50 for inhibition of processing of Rapla. The assay is run as described in Protocol B with the following 5 modifications. 20 [l of sample is run on pre-cast 10-20% gradient acrylamide mini gels (Novex Inc.) at 15 mA/gel for 2.5-3 hours. Prenylated and unprenylated forms of Rapla are detected by blotting with a polyclonal antibody (Rapl/Krev-1 b#121;Santa Cruz Research Products #sc-65), followed by an alkaline phosphatase-conjugated anti-rabbit IgG antibody. The percentage of unprenylated Rapla relative to the total 10 amount of Rap la is determined by peak integration using Imagequant7 software (Molecular Dynamics). Unprenylated Rapla is distinguished from prenylated protein by virtue of the greater apparent molecular weight of the prenylated protein. Dose response curves and EC 50 values are generated using 4-parameter curve fits in SigmaPlot software. 15 EXAMPLE 35 In vivo tumor growth inhibition assay (nude mouse) In vivo efficacy as an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art. Examples of such in vivo 20 efficacy studies are described by N. E. Kohl et al. (Nature Medicine, 1:792-797 (1995)) and N. E. Kohl et al. (Proc. Nat. Acad. Sci. U.S.A., 91:9141-9145 (1994)). Rodent fibroblasts transformed with oncogenically mutated human Ha ras or Ki-ras (106 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0. The mice in 25 each oncogene group are randomly assigned to a vehicle, compound or combination treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment. Alternatively, the farnesyl-protein transferase inhibitor may be administered by a continuous infusion pump. Compound, compound combination or vehicle is delivered in a total volume of 0.1 ml. Tumors 30 are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated. -100-

Claims (28)

1. A compound which is: 5 (R )r (R 9 )q V - Al(CR a 2 )nA 2 (CROa 2 )n -W - (CRb 2 )p-N -As-Z S A wherein: RIa and RIb are independently selected from: 10 a) hydrogen, b) aryl, heterocycle, C3-C1O cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R 100-, R 11 S(O)m-, R 10 C(O)NR10-, (R 10)2NC(O)-, R 10 2N C(NR 1 0)-, CN, N02, R 1 0 C(O)-, N3, -N(R 10 )2, or R 1 1 OC(O)NR1 0 -, c) unsubstituted or substituted CI-C6 alkyl wherein the substituent on the 15 substituted C1-C6 alkyl is selected from unsubstituted or substituted aryl, heterocyclic, C3-C10 cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, R 1 0 0-, R 1 IS(O)m-, R 1 0 C(O)NR1 0 -, (R' 0 )2NC(O)-, R 10 2N C(NR 1 )-, CN, R 10 C(O)-, N3, -N(R'0)2, and R 1 IOC(O)-NR 10 -; 20 R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C1O cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, R 10 0-, RilS(O)m-, 25 R 1 0 C(O)NR 10 -, (R' 0 )2NC(O)-, R 10 2N-C(NR 10 )-, CN, N02, R 10 C(O)-, N3, -N(R' 0 )2, or R 1 lOC(O)NR1 0 -, -C(O)ORIO and -101- WO 00/51614 PCT/USOO/05354 c) C1-C6 alkyl unsubstituted or substituted by aryl, cyanophenyl, heterocycle, C3-C1O cycloalkyl, C2-C6 alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br, R 1 0 0-, R 11 S(O)m-, R 1 0 C(O)NH-, (R'0)2NC(O)-, R 10 2N-C(NR10)-, CN, R 10 C(O)-, N3, -N(R'0)2, or 5 R 10 0C(O)NH-; R 9 is selected from: a) hydrogen, b) alkenyl, alkynyl, perfluoroalkyl, F, Cl, Br, R 10 0-, RilS(O)m-, 10 R 1 OC(O)NR 10 -, (R' 0 )2NC(O)-, R 10 2N-C(NR1 0 )-, CN, N02, R 10 C(O)-, N3, -N(R 1 0 )2, or R1IOC(O)NR1 0 -, and c) C1-C6 alkyl unsubstituted or substituted by perfluoroalkyl, F, Cl, Br, R 1 0 0-, RI IS(O)m-, R 10 C(O)NR 1 0 -, (R 1 0)2NC(O)-, R 10 2N C(NR 1 0 )-, CN, R 1 OC(O)-, N3, -N(R 1 0 )2, or R 1 IOC(O)NR 10 -; 15 R 10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; R 1 1 is independently selected from C1-C6 alkyl and aryl; 20 Al and A 2 are independently selected from: a bond, -CH=CH-, -C=C-, -C(O)-, -C(O)NR 1 0 -, -NR 10 C(O)-, 0, -N(R10)-, -S(0)2N(R 10 )-, -N(R' 0 )S(O)2-, or S(O)m; A 3 is selected from: -C(O)- or S(O)m; 25 V is selected from: a) hydrogen, b) heterocycle, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a 30 heteroatom selected from 0, S, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if Al is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; W is a heterocycle; -102- WO 00/51614 PCTIUSOO/05354 Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; mis 0, 1 or 2; 5 nis 0,1,2,3 or4; pis 0,1,2,3 or4; q is 1 or 2; r is 0 to 5, provided that r is 0 when V is hydrogen; and s is 0 or 1, 10 or the pharmaceutically acceptable salts thereof.

2. The compound according to Claim 1 of the formula B: (R 8 )r Rea V - A1(CR1a 2 )nA2(CR1a 2 -NV N N-A 3 Z (CRb 2 ) p B 15 wherein: Ria and Rib are independently selected from: a) hydrogen, 20 b) aryl, heterocycle, cycloalkyl, R 10 0-, -N(R 1 0 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2; R 8 is independently selected from: 25 a) hydrogen, b) unsubstituted or substituted aryl, Cl-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R 10 C(O)NR 10 -, CN, -103- WO 00/51614 PCT/USOO/05354 N02, (R 10 )2N-C(NR1 0 )-, R 10 C(O)-, -N(R 1 0 )2, or R 1 IOC(O)NR 10 -, -C(O)OR 10 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-, R 10 C(O)NR10-, (R 10 )2N-C(NR1 0 )-, R 10 C(O)-, -N(R 1 0)2, or 5 R 1 0OC(O)NR1 0 -; R 9 a is hydrogen, CI-C6 alkyl or chloro; R 10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; 10 Ril is independently selected from C1-C6 alkyl and aryl; A I and A 2 are independently selected from: a bond, -CH=CH-, -C=C-, -C(O)-, -C(O)NR 10 -, 0, -N(R1 0 )-, or S(O)m; 15 A 3 is selected from: -C(O)- or S(O)m; V is selected from: a) hydrogen, 20 b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) CI-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a 25 heteroatom selected from 0, S, and N, and e) C2-C20 alkenyl, and provided that V is not hydrogen if Al is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; 30 mis 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; and r is 0 to 5, provided that r is 0 when V is hydrogen; -104- WO 00/51614 PCT/USOO/05354 or the pharmaceutically acceptable salts thereof.

3. The compound according to Claim 1 of the formula 5 C: (R 8 )r (R )r N R 9a V - Al(CRla 2 )nA2(CR1a 2 N \43 N N-A 3 -Z (CRi 2)p C wherein: RIa and RIb are independently selected from: 10 a) hydrogen, b) aryl, heterocycle, cycloalkyl, R1 0 0-, -N(R 1 0)2 or C2-C6 alkenyl, c) CI-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2; 15 R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, Cl-C6 perfluoroalkyl, F, Cl, R 10 0-, R 1 0 C(O)NR 1 0 -, CN, N02, (R'0)2N-C(NR 1 %)-, R 10 C(O)-, -N(R 1 0 )2, or RI 1 OC(O)NR10, 20 -C(O)ORIO and c) C1-C6 alkyl substituted by Cl-C6 perfluoroalkyl, R 10 0-, R 1 0 C(O)NR 10 -, (R' 0 )2N-C(NR 1 0)-, R 10 C(O)-, -N(R'0)2, or R 1 lOC(O)NR 1 0 -; 25 R 9 a is hydrogen, C1-C6 alkyl or chloro; R 10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; -105- WO 00/51614 PCT/USOO/05354 R 11 is independently selected from C1-C6 alkyl and aryl; Al and A 2 are independently selected from: a bond, -CH=CH-, -C=C-, -C(O)-, -C(O)NR1 0 -, 0, -N(R 1 0)-, or S(O)m; 5 A 3 is selected from: -C(O)- or S(O)m; V is selected from: a) hydrogen, 10 b) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl, c) aryl, d) C1-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a 15 heteroatom selected from 0, S, and N, and e) C2-C20 alkenyl, and provided that V is not hydrogen if Al is S(O)m and V is not hydrogen if Al is a bond, n is 0 and A 2 is S(O)m; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; 20 m is 0, 1 or 2; nis 0,1,2,3 or4; pis 2,3 or4;and r is 0 to 5, provided that r is 0 when V is hydrogen; 25 or the pharmaceutically acceptable salts thereof.

4. The compound according to Claim 2 of the formula D: 30 -106- WO 00/51614 PCT/US00/05354 (R )r R9-N I1aX /- \N-A 3-Z V - Al(CRa 2 )n (CR'b 2 D wherein: Ria and Rib are independently selected from: 5 a) hydrogen, b) aryl, heterocycle, cycloalkyl, R1 0 0-, -N(R 1 0)2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2; 10 R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 10 0-, R 10 C(O)NR 10 -, CN, N02, (R 1 0)2N-C(NR10)-, R 10 C(O)-, -N(R10)2, or R 1 lOC(O)NR 10 -, 15 -C(O)OR 10 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-, R1OC(O)NR 10 -, (R'0)2N-C(NR 10 )-, R 10 C(O)-, -N(R 1 0)2, or R 1 IOC(O)NR 10 -; 20 R 9 a is hydrogen, C1-C6 alkyl or chloro; R 10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; RI I is independently selected from Cl-C6 alkyl and aryl; 25 Al is selected from: a bond, -CH=CH-, -C-~C-, -C(O)-, -C(O)NR1 0 -, 0, -N(R 1 %)-, or S(O)m; A 3 is selected from: -C(O)- or S(O)m; -107- WO 00/51614 PCT/USOO/05354 V is selected from: a) heterocycle selected from pyridinyl and quinolinyl, and b) aryl;

5 Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; mis 0, 1 or 2; nis 0,1,2,3 or4; 10 pis 0,1,2,3 or4;and r is 0 to 5, or the pharmaceutically acceptable salts thereof. 15 5. The compound according to Claim 3 of the formula E: (R 8 )r N e |N /--a \ N N-A 3 -Z V - A(CRa 2 )n (CR'b2 E wherein: 20 RIa and Rib are independently selected from: a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 10 0-, -N(R10)2 or C2-C6 alkenyl, c) Cl-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2; 25 R 8 is independently selected from: a) hydrogen, -108- WO 00/51614 PCT/USOO/05354 b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 10 0-, R1 0 C(O)NR1 0 -, CN, N02, (R'0)2N-C(NR 10 )-, R1 0 C(O)-, -N(R 1 0 )2, or R 1 1 OC(O)NR 10 -, -C(O)OR 10 and 5 c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-, R 10 C(O)NR 1 0-, (R 1 0)2N-C(NR10)-, R 10 C(O)-, -N(R10)2, or R 1 IOC(O)NR 10 -; R 9 a is hydrogen, C1-C6 alkyl or chloro; 10 R 10 is independently selected from hydrogen, CI-C6 alkyl, benzyl and aryl; R Il is independently selected from C1-C6 alkyl and aryl; 15 A 1 is selected from: a bond, -CH=CH-, -C=C-, -C(O)-, -C(O)NR 10 -, 0, -N(R 1 0)-, or S(O)m; A 3 is selected from: -C(O)- or S(O)m; 20 V is selected from: a) heterocycle selected from pyridinyl and quinolinyl, and b) aryl; Z is unsubstituted or substituted aryl or unsubstituted or substituted heteroaryl; 25 mis 0, 1 or 2; nis 0,1,2,3 or4; pis 2,3 or4;and r is 0 to 5, 30 or the pharmaceutically acceptable salts thereof.

6. The compound according to Claim 4 of the formula F: -109- WO 00/51614 PCT/US00/05354 (R 8 ) /< N (R'b2)p N-A3-Z F wherein: Rib is independently selected from: 5 a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 10 0-, -N(R 10 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R1 0 0-, or -N(R10)2; 10 R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R 10 C(O)NR 10 -, CN, N02, (R 10 )2N-C(NR1 0 )-, R 10 C(O)-, -N(R 10 )2, or R 1 1 OC(O)NR 10 -, 15 -C(O)OR 10 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 10 0-, R 1 0 C(O)NR 10 -, (R'0)2N-C(NR 1 0 )-, R 10 C(O)-, -N(R 1 0)2, or RI IOC(O)NR 10 -; 20 R 9 a is hydrogen, C1-C6 alkyl or chloro; R1 0 is independently selected from hydrogen, C1-C6 alkyl, benzyl and aryl; R 11 is independently selected from C1-C6 alkyl and aryl; 25 A 3 is -C(O)-; Z is unsubstituted or substituted phenyl, unsubstituted or substituted napthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted 2,3 -110- WO 00/51614 PCT/USOO/05354 dihydrobenzofuran, unsubstituted or substituted quinoline or unsubstituted or substituted isoquinoline; pis 1,2or3;and 5 r is 0 to 5, or the pharmaceutically acceptable salts thereof.

7. The compound according to Claim 5 of the formula 10 G: (R8) N R 9 a N N-A 3 -Z (C~2)p G wherein: Rib is independently selected from: 15 a) hydrogen, b) aryl, heterocycle, cycloalkyl, R 1 0 0-, -N(R' 0 )2 or C2-C6 alkenyl, c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle, cycloalkyl, alkenyl, R 10 0-, or -N(R10)2; 20 R 8 is independently selected from: a) hydrogen, b) unsubstituted or substituted aryl, CI-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R 1 0 0-, R1OC(O)NR 10 -, CN, N02, (R10)2N-C(NR 1 0)-, R 1 0 C(O)-, -N(R 1 0 )2, or R 1 IOC(O)NR 10 -, 25 -C(O)OR1 0 and c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, R 1 0 0-, R1 0 C(O)NR1 0 -, (R 10 )2N-C(NR 10 )-, R 1 0 C(O)-, -N(R'0)2, or R 1 IOC(O)NR 10 -; -111- WO 00/51614 PCT/USOO/05354 R 9 a is hydrogen, C1-C6 alkyl or chloro; R 10 is independently selected from hydrogen, Cl-C6 alkyl, benzyl and aryl; 5 R I 1 is independently selected from C1-C6 alkyl and aryl; A 3 is -C(O)-; 10 Z is unsubstituted or substituted phenyl, unsubstituted or substituted napthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted 2,3 dihydrobenzofuran, unsubstituted or substituted quinoline or unsubstituted or substituted isoquinoline; 15 p is 2 or 3; and r is 0 to 5, or the pharmaceutically acceptable salts thereof. 20

8. A compound which is selected from: 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-methoxyquinolin-4-oyl)piperazine 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-diethylamino-3-ethoxypyrid-5 25 oyl)piperazine 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl] -1-(3-ethylamino-4 isoquinolinoyl)piperazine 30 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-bromo-1-naphthoyl)piperazine 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1 -f[5-(pent- 1 -ynyl)- 1 naphthoyl]piperazine -112- WO 00/51614 PCT/USOO/05354 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1-[5-(prop- 1 -ynyl)- 1 naphthoyl]piperazine 5 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1-(5-propyl- 1 -naphthoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(4-bromo-3-methylbenzoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-i-[3-methyl -4-(prop-1 10 ynyl)benzoyl]piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-methyl-4-pentylbenzoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(2-cyclopropyleth-ynyl-5 15 methoxybenzoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-methoxy-2-pent-1 ynylbenzoyl)piperazine 20 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro-2 cyclohexylethynylbenzoyl)piperazine 4-[L-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(5-chloro-2 cyclohexylethylbenzoyl)piperazine 25 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(4-indoloyl)piperazine 4-[i-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3,5-dimethylbenzoyl)piperazine 30 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(8-quinolinoyl)piperazine -113- WO 00/51614 PCT/USOO/05354 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(2-ethoxy- 1 -naphthoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1-(2-quinolinoyl)piperazine 5 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3-methoxy-4 methylbenzoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(6-diethylamino-pyrid-2-oyl)piperazine 10 4-[I1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(1 -isoquinolinoyl)piperazine 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(2,3-dihydrobenzofuran-7 oyl)piperazine 15 4-[I1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(3,4-dimethylbenzoyl) piperazine and 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-(1-naphthoyl)piperazine or a pharmaceutically acceptable salt or optical isomer thereof. 20

9. The compound according to Claim 8 which is 4-[I-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1-[3-methyl -4-(prop-1 ynyl)benzoyl]piperazine 25 0 NC N\ CH 3 N CH 3 -114- WO 00/51614 PCT/USOO/05354 4- [1-(4-Cyanobenzyl)imidazol-5-ylmethyl]- 1 -(6-diethylamino-pyrid-2-oyl)piperazine 0 N N NC N N -N N / N(C 2 H 5 ) 5 4-[1-(4-Cyanobenzyl)imidazol-5-ylmethyl]-1 -(1 -naphthoyl)piperazine 0 NC N N\- N- or a pharmaceutically acceptable salt or optical isomer thereof. 10

10. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 1. 15

11. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 4.

12. A pharmaceutical composition comprising a pharmaceutical 20 carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 5.

13. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of 25 Claim 8. -115- WO 00/51614 PCT/USOO/05354

14. A method for inhibiting farnesyl-protein transferase and geranylgeranyl-protein transferase type I which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 10. 5

15. A method for inhibiting farnesyl-protein transferase and geranylgeranyl-protein transferase type I which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 11.

16. A method for inhibiting farnesyl-protein transferase and 10 geranylgeranyl-protein transferase type I which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 12.

17. A method for inhibiting farnesyl-protein transferase and geranylgeranyl-protein transferase type I which comprises administering to a mammal 15 in need thereof a therapeutically effective amount of a composition of Claim 13.

18. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 10. 20

19. A method according to Claim 18 wherein the cancer is characterized by a mutated K4B-Ras protein.

20. A method for treating cancer which comprises administering to 25 a mammal in need thereof a therapeutically effective amount of a composition of Claim 13.

21. A method according to Claim 20 wherein the cancer is characterized by a mutated K4B-Ras protein. 30

22. A method for treating neurofibromin benign proliferative disorder which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 10. -116- WO 00/51614 PCT/USOO/05354

23. A method for treating blindness related to retinal vascularization which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 10. 5

24. A method for treating infections from hepatitis delta and related viruses which comprises administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 10.

25. A method for preventing restenosis which comprises 10 administering to a mammal in need thereof a therapeutically effective amount of a composition of Claim 10.

26. A method for treating polycystic kidney disease which comprises administering to a mammal in need thereof a therapeutically effective 15 amount of a composition of Claim 10.

27. A pharmaceutical composition made by combining the compound of Claim 1 and a pharmaceutically acceptable carrier. 20

28. A process for making a pharmaceutical composition comprising combining a compound of Claim 1 and a pharmaceutically acceptable carter. -117-