AU741725B2 - Inhibitors of prenyl-protein transferase - Google Patents

Inhibitors of prenyl-protein transferase Download PDF

Info

Publication number
AU741725B2
AU741725B2 AU91213/98A AU9121398A AU741725B2 AU 741725 B2 AU741725 B2 AU 741725B2 AU 91213/98 A AU91213/98 A AU 91213/98A AU 9121398 A AU9121398 A AU 9121398A AU 741725 B2 AU741725 B2 AU 741725B2
Authority
AU
Australia
Prior art keywords
compound
pharmaceutical composition
cyanobenzyl
inhibiting
treating
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
AU91213/98A
Other versions
AU9121398A (en
Inventor
Christopher J. Dinsmore
John H. Hutchinson
Theresa M. Williams
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9800975.6A external-priority patent/GB9800975D0/en
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Publication of AU9121398A publication Critical patent/AU9121398A/en
Application granted granted Critical
Publication of AU741725B2 publication Critical patent/AU741725B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/06Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system

Description

1 Inhibitors of Prenyl-Protein Transferase Background of the Invention The present invention relates to certain compounds that are useful for the inhibition of prenyl-protein transferases and the treatment of cancer. In particular, the invention relates to prenyl-protein transferase inhibitors which are efficacious in vivo as inhibitors of geranylgeranyl-protein transferase type I (GGTase-I) and that inhibit the cellular processing of both the H-Ras protein and the K4B-Ras protein.
Prenylation of proteins by prenyl-protein transferases represents a class of posttranslational modification (Glomset, Gelb. and Fransworth, C.C. (1990).
Trends Biochem. Sci. 15, 139-142; Maltese, W.A. (1990). FASEB J. 4, 3319-3328). This modification typically is required for the membrane localisation and function of these proteins. Prenylated proteins share characteristic C-terminal sequences including CAAX Cys; A, an aliphatic amino acid; X, another amino acid), XXCC, or XCXC. Three post-translational processing steps have been described for proteins having a C-terminal .s CAAX sequence: addition of either a 15 carbon (famesyl) or 20 carbon (geranylgeranyl) .**:isoprenoid to the Cys residue, proteolytic cleavage of the last 3 amino acids, and methylation of the new C-terminal carboxylate (Cox, A.D. and Der, C.J. (1992a). Critical i Rev. Oncogenesis 3:365-400; Newman, C. M. H. and Magee, A. I. (1993). Biochim.
Biophys. Acta 1155:79-96). Some proteins may also have a fourth modification: 20 palmitoylation of one or two Cys residues N-terminal to the farnesylated Cys. While some mammalian cell proteins terminating in XCXC are carboxylmethylated, it is not clear whether carboxy methylation follows prenylation of proteins terminat- *e *o [I:\DayLib\LI3AAOS87Ospec.doc:gcc WO 99/09985 PCT/US98/17696 ing with a XXCC motif (Clarke, S. (1992). Annu. Rev. Biochem. 61, 355- 386). For all of the prenylated proteins, addition of the isoprenoid is the first step and is required for the subsequent steps (Cox, A. D. and Der, C.
J. (1992a). Critical Rev. Oncogenesis 3:365-400; Cox, A. D. and Der, C. J.
(1992b) Current Opinion Cell Biol. 4:1008-1016).
Three enzymes have been described that catalyze protein prenylation: farnesyl-protein transferase (FPTase), geranylgeranylprotein transferase type I (GGPTase-I), and geranylgeranyl-protein transferase type-II (GGPTase-II, also called Rab GGPTase). These enzymes are found in both yeast and mammalian cells (Clarke, 1992; Schafer, W. R. and Rine, J. (1992) Annu. Rev. Genet. 30:209-237). Each of these enzymes selectively uses farnesyl diphosphate or geranylgeranyl diphosphate as the isoprenoid donor and selectively recognizes the protein substrate. FPTase farnesylates CaaX-containing proteins that end with Ser, Met, Cys, Gln or Ala. For FPTase, CaaX tetrapeptides comprise the minimum region required for interaction of the protein substrate with the enzyme. The enzymological characterization of these three enzymes has demonstrated that it is possible to selectively inhibit one with little inhibitory effect on the others (Moores, S. Schaber, M.
Mosser, S. Rands, O'Hara, M. Garsky, V. Marshall, M. Pompliano, D. and Gibbs, J. J. Biol. Chem., 266:17438 (1991), U.S. Pat. No. 5,470,832).
The prenylation reactions have been shown genetically to be essential for the function of a variety of proteins (Clarke, 1992; Cox and Der, 1992a; Gibbs, J. B. (1991). Cell 65: 1-4; Newman and Magee, 1993; Schafer and Rine, 1992). This requirement often is demonstrated by mutating the CaaX Cys acceptors so that the proteins can no longer be prenylated. The resulting proteins are devoid of their central biological activity. These studies provide a genetic "proof of principle" indicating that inhibitors of prenylation can alter the physiological responses regulated by prenylated proteins.
The Ras protein is part of a signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein. In the inactive state, WO 99/09985 PCT/US98/17696 Ras is bound to GDP. Upon growth factor receptor activation, Ras is induced to exchange GDP for GTP and undergoes a conformational change. The GTP-bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R.
Lowy and D.M. Willumsen, Ann. Rev. Biochem. 62:851-891 (1993)).
Activation of Ras leads to activation of multiple intracellular signal transduction pathways, including the MAP Kinase pathway and the Rho/Rac pathway (Joneson et al., Science 271:810-812).
Mutated ras genes are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
The Ras protein is one of several proteins that are known to undergo post-translational modification. Farnesyl-protein transferase utilizes farnesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a farnesyl group (Reiss et al., Cell, 62:81-88 (1990); Schaber et al., J. Biol. Chem., 265:14701-14704 (1990); Schafer et al., Science, 249:1133-1139 (1990); Manne et al., Proc. Natl. Acad. Sci USA, 87:7541-7545 (1990)).
Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras. The Ras C-terminus contains a sequence motif termed a "CAAX" or "Cys-Aaal-Aaa 2 -Xaa" box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al., Nature 310:583-586 (1984)). Depending on the specific sequence, this motif serves as a signal sequence for the enzymes farnesyl-protein transferase or geranylgeranyl-protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C15 or C20 isoprenoid, respectively. Clarke., Ann.
Rev. Biochem. 61:355-386 (1992); W.R. Schafer and J. Rine, Ann. Rev.
Genetics 30:209-237 (1992)). Direct inhibition of farnesyl-protein transferase would be more specific and attended by fewer side effects WO 99/09985 PCT/US98/17696 than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
Other farnesylated proteins include the Ras-related GTPbinding proteins such as RhoB, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., J. Biol.
Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also farnesylated. James, et al., have also suggested that there are farnesylated proteins of unknown structure and function in addition to those listed above.
Inhibitors of farnesyl-protein transferase (FPTase) have been described in two general classes. The first class includes analogs of farnesyl diphosphate (FPP), while the second is related to protein substrates Ras) for the enzyme. The peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation. (Schaber et al., ibid; Reiss et. al., ibid; Reiss et al., PNAS, 88:732-736 (1991)). Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the farnesyl-protein transferase enzyme, or may be purely competitive inhibitors Patent 5,141,851, University of Texas; N.E. Kohl et al., Science, 260:1934-1937 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)).
Mammalian cells express four types of Ras proteins K4A-, and K4B-Ras) among which K4B-Ras is the most frequently mutated form of Ras in human cancers. The genes that encode these proteins are abbreviated H-ras, N-ras K4A-ras and K4Bras respectively. H-ras is an abbreviation for Harvey-ras. K4A-ras and K4B-ras are abbreviations for the Kirsten splice variants of ras that contain the 4A and 4B exons, respectively. Inhibition of farnesyl-protein transferase has been shown to block the growth of H-ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype. It has also been demonstrated that certain inhibitors of farnesyl-protein transferase selectively block the processing of the H-Ras oncoprotein intracellularly Kohl et al., Science, 260:1934-1937 (1993) and G.L. James et al., Science, 260:1937-1942 (1993). Recently, it has been shown that an inhibitor of farnesyl-protein transferase blocks the growth k WO 99/09985 PCT/US98/17696 of H-ras-dependent tumors in nude mice Kohl et al., Proc. Natl.
Acad. Sci 91:9141-9145 (1994) and induces regression of mammary and salivary carcinomas in H-ras transgenic mice (N.E.
Kohl et al., Nature Medicine, 1:792-797 (1995).
Indirect inhibition of farnesyl-protein transferase in vivo has been demonstrated with lovastatin (Merck Co., Rahway, NJ) and compactin (Hancock et al., ibid; Casey et al., ibid; Schafer et al., Science 245:379 (1989)). These drugs inhibit HMG-CoA reductase, the rate limiting enzyme for the production of polyisoprenoids including farnesyl pyrophosphate. Inhibition of farnesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks Ras membrane localization in cultured cells.
It has been disclosed that the lysine-rich region and terminal CVIM sequence of the C-terminus of K-RasB confer resistance to inhibition of the cellular processing of that protein by certain selective FPTase inhibitors. James, et al., J. Biol. Chem. 270, 6221 (1995) Those FPTase inhibitors were effective in inhibiting the processing of H- Ras proteins. James et al., suggested that prenylation of the K4B-Ras protein by GGTase contributed to the resistance to the selective FPTase inhibitors.
Several groups of scientists have recently disclosed compounds that are non-selective FPTase/GGTase inhibitors. (Nagasu et al. Cancer Research, 55:5310-5314 (1995); PCT application WO 95/25086).
It is the object of the instant invention to provide a prenyl-protein transferase inhibitor which is efficacious in vivo as an inhibitor of geranylgeranyl-protein transferase type I (GGTase-I), also known as CAAX GGTase.
It is also the object of the present invention to provide a compound which inhibits the cellular processing of both the H-Ras protein and the K4B-Ras protein.
It is also the object of the present invention to provide a compound which is efficacious in vivo as an inhibitor of the growth of cancer cells characterized by a mutated K4B-Ras protein.
A composition which comprises such an inhibitor compound is used in the present invention to treat cancer.
Summary of the Invention The present invention comprises peptidomimetic piperazinone-containing compounds which inhibit the prenyl-protein transferases: famesyl-protein transferase and geranylgeranyl-protein transferase type I. Further contained in this invention are chemotherapeutic compositions containing these prenyl transferase inhibitors and methods for their production.
1 [I:\DayLib\LIBAA]0887Ospec. doc: gcc 7-12
S
I0 0 0* 0 000 This page has intentionally been left blank.
0*00 0* 000* 0000 0000 [1:\DayLi b\L IB AA]0887Ospec.doc:gcc Detailed Description of the Invention The compounds of this invention are useful in the inhibition of prenyl-protein transferases and the prenylation of the oncogene protein Ras.
The compounds of the invention are selected from the group consisting of: 1 -tri fl Uoromethox yphenyl)-4- 1 4 -cyanobenzyl)i1midazol1-5 -ylmethyl] -2 -piperazi none, 1 -(2,5-dirnnethylphenyl)-4-[
I-(
4 -cyanobenzyl)imidazol-5 -ylmethyly2-p perazi none, 1 -nethylphenyl)-4-[I1 4 -c yanobenzyl) ilidazo I -5-ylmrnethyl] -2-p 1perazino ne, 1 -i1odophenyl)-4- [1I-( 4 -c yanobenzyl)ii1dazol-5 -ylmnethyl] 2-piperazi none, 1 -(3-chlorophenyl)-4-[ 1-( 3 -mietlhoxy-4-cyanobenzyl)imidazol-5-yimethyI-2- 0 piperazinone, 1 -trifluoromethoxyphenyl)-4-[ 1-( 3 -methoxy-4-cyanobenzyl)imidazol-5Sylmethylp2piperazinone, (R--[bn1 xymthl-(3-chlorophenyl)-4-[ ylmethyl] -2-piperazinone, 15 1 -chlorophenyl)-4-[ 1-(2-fluoro-4-cyanobenzyl)- 1H-imidazol-5-ylmethyl]piperazin-2one, *4-ti (4-c yanob enzyl)- I H- 1im idazolI- 5 -ylmnethyl] -methylthi1ophen yl)p ip erazin-2 -on e, 4- I cyano benzyl) 1 H -irmn1d azo1- 5 -ylin ethyll 1 3 ,5 -d ichlIo rop henyl)pi1perazi1n -2 -one, 1 -chlorophenyl)-4- -(4-cyanoph enyl)- I -ethyfl 1 H-1 iidazol1-5 -ylm ethyl}I piperazin-2 one, I (3 -chlIoro -4 flUo rop henyl1)- 4 I (4-c yaniob enz yl) I H Im 1d azo 1- 5-yI ineth yl ]p Iperaz In -2 one, 4-ti -(4-cyanobenzyl)- 1 H-imidazol-5-ylinethyl]- 1 3 ,5-dimiethylphenyl)piperazin-2-one, -benizyl [3 -(4-cyanobenzyl 1 -1im idazo 1-5 -yl)prop- Il-yfl-I -phenyl-2-pi1perazi none, 1 (3 -ch lorophenyl) [1 -(4-nitrob enzyl)- I H- 1imidazo1- 5 -ylmethyl ]p Iperazi n-2 -on e, 4- l- (4-cyanob enzyl)- 1 H- imi1dazo l- 5-ylm ethyl] 1 -di fl uorophenyl)p ipeCrazi n-2 -one, and 4- 1 -(4-cyanob enzyl)- 1 H-1imidazolI- 5-ylm ethyl] 1 4 -di fluorophenyl)pip erazi1n-2 -o ne, or a pharmaceutically acceptable salt or optical isomer thereof.
1ADayLibML I BA A108870spec. doc: gc c 14 The preferred compounds of this invention are as follows: 1 -trifluoromethoxyphenyl)-4-[ l-( 4 -cyanobenzyl)imidazolylmethylp2-piperazinone 00F 3 N C N -i
N-
1 -dimethylphenyl)-4-[ I-( 4 -cyanobenzyl)imidazolylmethyly2-piperazinone Me NC-& N0
N-
[1:\DayLib\LIBAA]0887Ospec.doc:gcc 11 WO 99/09985 W09919985PCTIUS98/1 7696 1-(3-Methylphenyl)-4- [l-(4-cyanobenzyl)imidazolylmethyl] -2piperazinone NC
N
1-(3-Iodophenyl)-4- [1-(4-cyanobenzyl)imidazolylmethyl] -2piperazinone
NC
N
N6 0 1-(3-Chlorophenyl)-4-[Il-( 3 -methoxy-4-cyanobenzyl)imidazolylmethyl] 2-piperazinone MeO
N-
1-(3-Trifluoromethoxyphenyl)-4- [1-(3-methoxy-4cyanobenzyl)imidazolylmethyl] -2-piperazinone and 00F 3
NC
7
N
MeO N0\
N
[(Benzyloxy)methyl] -(3-chlorophenyl)-4- [l-(4-cyanobenzyD)imidazolylmethyl] -2-piperazinone WO 99/09985 WO 9909985PCTJIUS98/1 7696 Ph--\ NC N N
N
or the pharmaceutically acceptable salts or optical isomers thereof.
Other specific examples of compounds of this invention are: 1-(3-Chlorophenyl)-4- [1-(2-fluoro-4-cyanobenzyl)- ylmethyl] piperazin-2-one 4-f 1-(4-Cyanobenzyl)- 1H-imidazol-5-ylm ethyl] 13 m ethyl thi ophenyl)piperazin-2 -one 4- [1-(4-Cyanobenzyl)- 1H-imidazol-5-y m ethyl] 1-(3 di chlorophenyl)piperazin-2-one 1-(3-Chlorophenyl)-4-f [1-(4-cyanophenyl 1 -ethyl] ylm ethyl) pi perazin- 2-one 1-(3-Chloro-4-fluorophenyl)-4- 4-cyanobenzyl)- ylmethyl] piperazin-2-one 4- [1-(4-Cyanobenzyl)- 1H-imidazol-5-ylmethyl] dimethylphenyl)piperazin-2-one (S)-5-Benzyl-4- 3 4 -cyanobenzyl- 1-imi dazol-5-yl)prop- 1-yl] 1-phenyl-2piperazinone 1-(3-Chlorophenyl)-4- [1-(4-nitrobenzyl)- ylm ethyl] piperazin-2 -one -16- SWO 99/09985 PCT/US98/17696 4-[1-(4-Cyanobenzyl)-1H-imidazol-5-ylmethyl]-l-(3,5difluorophenyl)piperazin-2-one 4- [-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]-1-(3,4difluorophenyl)piperazin-2-one or the pharmaceutically acceptable salts or optical isomers thereof.
The compounds of the instant invention differ from previously disclosed piperazinone-containing compounds, (PCT Publ.
No. WO 97/30343 October 3, 1996; PCT Publ. No. WO 97/36593 October 9, 1997; PCT Publ. No. WO 97/36592 October 9, 1997) that were described as selective inhibitors of farnesyl-protein transferase, in that the instant compounds are dual inhibitors of farnesyl-protein transferase and geranylgeranyl-protein transferase type I (GGTase-I). Preferably, the compounds of the instant invention inhibit FPTase in vitro (Example at an ICo 0 of less than 1 mM, inhibit GGTase-I in vitro (Example 16) at an IC 5 0 of less than 1 mM and inhibited the cellular processing (farnesylation) of H-Ras (Example 17) at an IC 50 of less than 1 mM.
The compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention. When any variable aryl, heterocycle, R 1
R
2 etc.) occurs more than one time in any constituent, its definition on each occurrence is independent at every other occurrence. Also, combinations of substituents/or variables are permissible only if such combinations result in stable compounds.
As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms; "alkoxy" represents an alkyl group of indicated number of carbon atoms attached through an oxygen bridge.
"Halogen" or "halo" as used herein means fluoro, chloro, bromo and iodo.
As used herein, "aryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic. Examples of such aryl elements -17- WO 99/09985 PCT/US98/17696 include phenyl, naphthyl, tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl or acenaphthyl.
The term heterocycle or heterocyclic, as used herein, represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, 0, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring. The heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure. Examples of such heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, piperidyl, piperazinyl, pyridyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiazolyl, thiazolinyl, thienofuryl, thienothienyl, and thienyl.
As used herein, "heteroaryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, 0, and S. Examples of such heterocyclic elements include, but are not limited to, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolyl, indolinyl, indolyl, -18- WO 99/09985 PCT/US98/17696 isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl, thienothienyl, and thienyl.
As used herein in the definition of R 2 and R 4 the term "the substituted group" intended to mean a substituted C1-8 alkyl, substituted C2-8 alkenyl, substituted C2-8 alkynyl, substituted aryl or substituted heterocycle from which the substituent(s) R 2 and R 3 are selected.
As used herein in the definition ofR 6
R
6 a
R
7 and R 7 a, the substituted C1-8 alkyl, substituted C3-6 cycloalkyl, substituted aroyl, substituted aryl, substituted heteroaroyl, substituted arylsulfonyl, substituted heteroarylsulfonyl and substituted heterocycle include moieties containing from 1 to 3 substituents in addition to the point of attachment to the rest of the compound. Preferably, such substituents are selected from the group which includes but is not limited to F, Cl, Br, CF3, NH2, N(C1-C6 alkyl)2, N02, CN, (C1-C6 alkyl)O-, -OH, (C1-C6 alkyl)S(O)m-, (C1-C6 alkyl)C(O)NH-, H2N-C(NH)-, (C1-C6 alkyl)C(O)-, (C1-C6 alkyl)OC(O)-, N3,(C1-C6 alkyl)OC(O)NH-, phenyl, pyridyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thienyl, furyl, isothiazolyl and C1-C20 alkyl.
Lines drawn into the ring systems from substituents (such as from R 2
R
3
R
4 etc.) indicate that the indicated bond may be attached to any of the substitutable ring carbon atoms.
Preferably, Rla and Rib are independently selected from: hydrogen, -N(R 1 0
R
1 0
C(O)NR
1 0 or unsubstituted or substituted C1-C6 alkyl wherein the substituent on the substituted C1-C6 alkyl is selected from unsubstituted or substituted phenyl, -N(R 1 0
R
1 0 0and R 1 0 Preferably, R 2 is selected from:
H,
R
6
R
7 0 and an unsubstituted or substituted group, the group selected from C1-8 alkyl, C2-8 alkenyl and C2-8 alkynyl; -19- WO 99/09985 PCT/US98/17696 wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, 2) OR 6 3) SR6a, SO2R 6 a Preferably, R4 is hydrogen.
Preferably, R 6 and R 7 are selected from: hydrogen, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted aryl and unsubstituted or substituted C3-C6 cycloalkyl.
Preferably, R6a is unsubstituted or substituted C1-C6.
Preferably, R 9 is hydrogen.
Preferably, R 1 0 is selected from H, C1-C6 alkyl and benzyl.
Preferably, A 1 and A 2 are independently selected from: a bond, -C(O)NR 1 0
-NR
1 0 O, -S(O)2N(R 10 and
-N(R
1 0 Most preferably, A 1 and A 2 are a bond.
Preferably, V is selected from hydrogen, heterocycle and aryl. More preferably, V is phenyl.
Preferably, Z is selected from unsubstituted or substituted phenyl, unsubstituted or substituted naphthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted furanyl and unsubstituted or substituted thienyl. More preferably, Z is unsubstituted or substituted phenyl.
Preferably, n and r are independently 0, 1, or 2.
Preferably p is 1, 2 or 3.
Preferably, the moiety (R8)r R9a V- A(CRla 2 n
A
2 (CR1a 2 )n N
(CR
1 b 2 p is selected from: WO 99/09985 PCT/US98/17696 R9a -N N Nc and
N
S2-- /CH2_-| (R8 )r It is intended that the definition of any substituent or variable Rla, R 9 n, etc.) at a particular location in a molecule be independent of its definitions elsewhere in that molecule. Thus, -N(R10)2 represents -NHH, -NHCH3, -NHC2H5, etc. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
The pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.
The pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
-21- WO 99/09985 PCT/US98/17696 Reactions used to generate the compounds of this invention are prepared by employing reactions as shown in the Schemes 1-11, in addition to other standard manipulations such as ester hydrolysis, cleavage of protecting groups, etc., as may be known in the literature or exemplified in the experimental procedures. Substituent R, as shown in the Schemes, represents the substituents R 2
R
3
R
4 and R 5 however the point of attachment to the ring is illustrative only and is not meant to be limiting.
These reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the reductive alkylation reactions described in the Schemes.
Synopsis of Schemes 1-11: The requisite intermediates are in some cases commercially available, or can be prepared according to literature procedures, for the most part.
can be prepared as shown in Scheme 1.
Thus, the protected suitably substituted amino acid IV can be converted to the corresponding aldehyde V by first forming the amide and then reducing it with LAH. Reductive amination of Boc-protected amino aldehydes V gives rise to compound VI. The intermediate VI can be converted to a piperazinone by acylation with chloroacetyl chloride to give VII, followed by base-induced cyclization to VIII. Deprotection, followed by reductive alkylation with a protected imidazole carboxaldehyde leads to IX, which can be alkylated with an arylmethylhalide to give the imidazolium salt X. Final removal of protecting groups by either solvolysis with a lower alkyl alcohol, such as methanol, or treatment with triethylsilane in methylene chloride in the presence of trifluoroacetic acid gives the final product XI.
The intermediate VIII can be reductively alkylated with a variety of aldehydes, such as XII. The aldehydes can be prepared by standard procedures, such as that described by O. P. Goel, U. Krolls, M. Stier and S. Kesten in Organic Syntheses, 1988, 67, 69-75, from the appropriate amino acid (Scheme The reductive alkylation can -22- I WO 99/09985 PCT/US98/17696 be accomplished at pH 5-7 with a variety of reducing agents, such as sodium triacetoxyborohydride or sodium cyanoborohydride in a solvent such as dichloroethane, methanol or dimethylformamide. The product XIII can be deprotected to give the final compounds XIV with trifluoroacetic acid in methylene chloride. The final product XIV is isolated in the salt form, for example, as a trifluoroacetate, hydrochloride or acetate salt, among others. The product diamine XIV can further be selectively protected to obtain XV, which can subsequently be reductively alkylated with a second aldehyde to obtain XVI. Removal of the protecting group, and conversion to cyclized products such as the dihydroimidazole XVII can be accomplished by literature procedures.
Alternatively, the imidazole acetic acid XVIII can be converted to the acetate XIX by standard procedures, and XIX can be first reacted with an alkyl halide, then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester XX (Scheme Hydrolysis and reaction with piperazinone VIII in the presence of condensing reagents such as 1-(3-dimethylaminopropyl)- 3-ethylcarbodiimide (EDC) leads to acylated products such as XXI.
If the piperazinone VIII is reductively alkylated with an aldehyde which also has a protected hydroxyl group, such as XXII in Scheme 4, the protecting groups can be subsequently removed to unmask the hydroxyl group (Schemes 4, The alcohol can be oxidized under standard conditions to e.g. an aldehyde, which can then be reacted with a variety of organometallic reagents such as Grignard reagents, to obtain secondary alcohols such as XXIV. In addition, the fully deprotected amino alcohol XXV can be reductively alkylated (under conditions described previously) with a variety of aldehydes to obtain secondary amines, such as XXVI (Scheme or tertiary amines.
The Boc protected amino alcohol XXIII can also be utilized to synthesize 2 -aziridinylmethylpiperazinones such as XXVII (Scheme Treating XXIII with 1,1'-sulfonyldiimidazole and sodium hydride in a solvent such as dimethylformamide led to the formation of aziridine XXVII. The aziridine reacted in the presence of a nucleophile, such as a thiol, in the presence of base to yield the ring-opened product XXVIII.
-23- WO 99/09985 PCT/US98/17696 In addition, the piperazinone VIII can be reacted with aldehydes derived from amino acids such as O-alkylated tyrosines, according to standard procedures, to obtain compounds such as XXX (Scheme When R' is an aryl group, XXX can first be hydrogenated to unmask the phenol, and the amine group deprotected with acid to produce XXXI. Alternatively, the amine protecting group in XXX can be removed, and O-alkylated phenolic amines such as XXXII produced.
Scheme 8 illustrates the use of an optionally substituted homoserine lactone XXXIII to prepare a Boc-protected piperazinone XXXVII. Intermediate XXXVII may be deprotected and reductively alkylated or acylated as illustrated in the previous Schemes.
Alternatively, the hydroxyl moiety of intermediate XXXVII may be mesylated and displaced by a suitable nucleophile, such as the sodium salt of ethane thiol, to provide an intermediate XXXVIII. Intermediate XXXVII may also be oxidized to provide the carboxylic acid on intermediate IXL, which can be utilized form an ester or amide moiety.
can be prepared as shown in Scheme 9. Reductive amination of Boc-protected amino aldehydes V (prepared from III as described previously) gives rise to compound XL.
This is then reacted with bromoacetyl bromide under Schotten- Baumann conditions; ring closure is effected with a base such as sodium hydride in a polar aprotic solvent such as dimethylformamide to give XLI. The carbamate protecting group is removed under acidic conditions such as trifluoroacetic acid in methylene chloride, or hydrogen chloride gas in methanol or ethyl acetate, and the resulting piperazine can then be carried on to final products as described in Schemes 1-7.
The isomeric piperazin-3-ones can be prepared as described in Scheme 10. The imine formed from arylcarboxamides XLII and 2-aminoglycinal diethyl acetal (XLIII) can be reduced under a variety of conditions, including sodium triacetoxyborohydride in dichloroethane, to give the amine XLIV. Amino acids I can be coupled to amines XLIV under standard conditions, and the resulting amide XLV when treated with aqueous acid in tetrahydrofuran can cyclize to the unsaturated XLVI. Catalytic hydrogenation under standard conditions gives the -24- WO 99/09985 W099/9985PCT/US98/17696 requisite intermediate X.LVII, which is elaborated to final products as described in Schemes 1-7.
Amino acids of the general formula IL which have a sidechain not found in natural amino acids may be prepared by the reactions illu strated in Scheme 11 starting with the readily prepared imine XLVIII.
SCHEME 1 Ra H 0
IV
CH
3
NHOCH
3
-HCI
EDO. HOI,HOBT DMF, Et 3 N, pH 7
H
Ra YN(0H 3 )00H 3 0 LAH, Et 2 O BocNH 'ilCHO ArNH 2 -BocNH11),N,,A NaBH(OAc) 3 V ClCH 2
CH
2 CI VI
R
0 ci BocNH N- Ar NaH EtOAcI/H 2 0 01 0 DMF NaHCO 3 %l BocN N-Ar 0
HOI
EtOAc Vill WO 99/09985 WO99/0985PCTJUS98/I 7696 SCHEME 1 (continued)
R
HCI-HN N-Ar \-iI
CHO
N
C(Ph) 3 NaBH(OAc) 3 ClCH 2
CH
2
CI
pH 5-6
R
N N-Ar
N
(Ph) 3 C ix ArCH 2
X
CH
3
CN
R
N N-Ar (/NV 0 0 (Ph)iC MeOH
R
Ar-\N N-Ar
N
TEA, CH 2
CI
(C
2
H
5 3 SiH -26wo 99/09985 W09909985PCTIUS98/1 7696 SCHEME 2
R
HCI-HN N-Ar Boo NH I xi Boo NH CHO NaBH(OAc)3 Et 3 N CICH 2
CH
2
CI
Vill
R
Boc NH N N-Ar 0 NHBoc xiII
R
NH-
2 N N-Ar
NH
2 0
R
BocNH N NAr
NH
2
CF
3 00 2
H
CH
2
CI
2
BOC
2 0 0H 2 C1 2
~CHO
NaBH(OAc)3 Et 3 N, CICH 2
CH
2
CI
-27- WO 99/09985 WO 999985PCTIUS98/1 7696 SCHEME 2 (continued)
R
BocNH N N-Ar NH 0 xvi
CF
3 00 2 H, CH 2
CI
2 NaHCO 3
NC
AgCN L
R
NH
2 -N N-Ar NH 0
R
N N-Ar f -0 L XVII -28- WO 99/09985 WO 9909985PCT!US98/1 7696 SCHEME 3 CH 2 00 2
H
N
H
N CH 2 00 2 0H 3
CH
3 0H HOI
N
H
HOI
XIX
N-CH
2 00 2
CH
3 1) ArCH 2 X GH 3
CN
(C
6
H.
5 3 CBr ref lux
(C
2
H
5 3 N N 2) CH 3 OH, reflux DMF Tr
XIX
Ar-'\N-CH 2 00 2
CH
3
N
Ar- N-CH 2 00 2
H
N
x 2.5N HClaq
I
550C -29- WO 99/09985 WO99/0985PCTIUS98II7 696 SCHEME 3 (continued) N CH 2 00 2
H
N
HOI -HN N-Ar EDO HOI HOBt
DMF
Ar R NO N N/ N-Ar N 0
XX'
WO 99/09985 WO 9909985PCTIUS98/17696 SCHEME 4
R
HCI HN N-Ar
R
BnO N N-Ar NHBoc 0 NaBH(OAc) 3 Et 3 N ClCH 2
CH
2
CI_
BnOI BocNHI1CHO
XXII
20% Pd(OH) 2
'H
2
CH
3 0H
CH
3
CO
2
H
R
HO1 N\ N-Ar NHBoc 0
XXIII
CICOCOCI__
DMSO 0H 2 01 2
(C
2
H
5 3
N
R
0 N N- H NHBoc 0 1. R'MgX -Ar (0 2
H
5 2 0 2. TEA, 0H 2 C1 2
.R
HO N\ N-Ar R' NH 2 0
XXIV
-31- WO 99/09985 WO 9909985PCTIUS98/17696 SCHEME
R
H O NHBocO0
XXIII
R
HO N\_N-Ar
NH
2 0 Xxv
R
HO0 N N-Ar NH 0
R'CH
2
XXVI
0F 3 00 2
H
CH
2 C1 2
ROHO
NaBH(OAc) 3
CICH
2
CH
2
CI
-32- WO 99/09985 WO99/0985PCTIUS98/17696 SCHEME 6
R
HO N\ N-Ar NHBoc 0 H H N, N y 02 NaH, DMF 000 xxiII
R
N N-Ar
H
XXVII
R'SH
(0 2
H
5 3 N
A
CH
3 0H
R
R'S N N-Ar
NH
2 0
XXVIII
SCHEME 7 1) Boc 2 O, K 2 C0 3
THF-H
2 0 2) CH 2
N
2 EtOAc BocNH'
'CO
2
CH
3
HO,
LiAIH 4
THF
0-200C B(
R-CH
2 0 BocNH CH 2 0H
R'CH
2
X
CS
2 00 3
DMF
CH
2 0H pyridine -SO 3 R0 2
DMSO
(0 2
H)
3 N BocNH CHO 2000 -33- WO 99/09985 WO 9909985PCTIUS98/1 7696 .q.T4TTMf '7(p ii A' BocNH CHO
XXIX
R
HCI -HN N-Ar 0 Vill NaBH(OAc) 3
CICH
2
CH
2
CI
R
R'HN NN- Ar NHBoc
IXXX
1) 20% Pd(OH) 2
CH
3 OH, CH 3
CO
2
I-
2) HOI, EtOAc *1
HOI
ETOAc
R
N-Ar
NH
2 0
R
HO(: N N-Ar
NH-
2 0
XXXII
XXXI
-34- -WO 99/09985 ~WO 9909985PCT/US98/1 7696 SCHEME 8 sub HOI~e 1. BoC 2 O, i-P r 2 EtN sub BocHN~e
OH
2. DIBAL XXXIII
OH
Ksub
X
7
H
ArNH 2 BoN ,NN Ar NaBH(OAc) 3 BoN
CICH
2
CH
2 CI XXXIV 0 cI.Ac EtOAc!
H
2 0 NaHCO 3 HO sub
A-
BocNH N-Ar CI 0
XXXV
CS
2
CO
3
DMF
HO sub BocN N-Ar 0
XXXVI
WO 99/09985 WO 9/09985PCTJUS98/1 7696 SCHEME 8 (continued) HO sub BocN N-Ar \-1i
XXXV
1. MsCI, iPr 2 NEt 2. NaSEt, DMF EtS /sub BocN N-Ar 0 (COdl) 2 Et 3
N
DMSO
2. NaCIO 2 t-BuOH 2-Me-2-butene NaH 2
PO
4 HO sub BocN N-Ar 0
XXXVIII
IXL
-36- WO 99/09985 WO99/0985PCTIUS98/1 7696 SCHEME 9 0 o N r H 0
V
o'K JNHCHAr
H
XL
ArCH 2
NH
2 NaBH(OAc) 3
CICH
2
CH
2
CI
pH 6 1) BrCH 2 00Br EtOAc, H 2 0, NaHCO 3 2) NaH, THF, DMF 0\ NN--\ 0 1) TEA, CH 2 C1 2 HN
N-
Ar 0 -37- WO 99/09985 "WO 9909985PCTIUS98/1 7696 SCHEME ArCHO
NH
2
CH
2 CH(00 2
H
5 2
XLII
XLIII
NaBH(OAc) 3 O Ra 0 N (OH I H 0 Ar CH 2
NHCH
2 CH(0C 2
H
5 2 XLIV
E
O Ra .r Ar N -1YNl-CH(OC 2
H
5 2
H
0 o
XLV
DC. HOI, HOBT )MF, Et 3 N, pH 7 6N HOI
THF
Ra 0 NN4 0 Ar
XLVI
H
2 1 O%Pd/C
CH
3 0H XL VII -38- WO 99/09985 PCT/US98/17696 SCHEME 11 1. KOtBu, THF R2
/-CO
2 Et R 2 X )-CO 2 Et =N
H
2
N
Ph 2. 5% aqueous HCI
HCI
XLVIII
1. Boc20, NaHCO 3
R
2
)-CO
2
H
BocHN 2. LiAIH 4
IL
The instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer. Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors.
Such tumors may arise by mutations in the ras genes themselves, mutations in the proteins that can regulate Ras activity neurofibromin neu, src, abl, Ick, fyn) or by other mechanisms.
The compounds of the instant invention inhibit prenylprotein transferase and the prenylation of the oncogene protein Ras.
The instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors Rak et al. Cancer Research, 4575-4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
The compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic -39- WO 99/09985 PCT/US98/17696 mutation in other genes the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment. For example, a component of NF-1 is a benign proliferative disorder.
The instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses Glenn et al. Science, 256:1331-1333 (1992).
The compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation Indolfi et al. Nature medicine, 1:541-545(1995).
The instant compounds may also be useful in the treatment and prevention of polycystic kidney disease Schaffner et al.
American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr.
et al.FASEB Journal, 2:A3160 (1988)).
The instant compounds may also be useful for the treatment of fungal infections.
The instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies.
The compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
Compositions intended for oral use may be prepared according to any WO 99/09985 PCT/US98/17696 method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinylpyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a water soluble taste masking material such as hydroxypropylmethylcellulose or hydroxypropylcellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyleneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, -41- WO 99/09985 PCT/US98/17696 or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene-oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
The pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example -42- WO 99/09985 PCT/US98/17696 polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
The pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
The sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
The injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection.
Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUSTM model 5400 intravenous pump.
The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic -43- SWO 99/09985 PCT/US98/17696 mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable nonirritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed.
(For purposes of this application, topical application shall include mouth washes and gargles.) The compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
When a compound according to this invention is administered into a human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms.
In one exemplary application, a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of -44- WO 99/09985 PCT/US98/17696 between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
The compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated. For example, the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant farnesyl-protein transferase inhibitors and an antineoplastic agent.
It is also understood that such a combination of antineoplastic agent and inhibitor of farnesyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery.
Examples of an antineoplastic agent include, in general, microtubule-stabilizing agents such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-disruptor agents; alkylating agents, anti-metabolites; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; hormonal/antihormonal therapeutic agents and haematopoietic growth factors.
Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drugs, diynenes and the podophyllotoxins. Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunorubicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, WO 99/09985 PCT/US98/17696 paclitaxel and the like. Other useful antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins.
The preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel.
Radiation therapy, including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of farnesyl-protein transferase alone to treat cancer.
Additionally, compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incorporated by reference.
The instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Thus, the instant compounds may be utilized in combination with farnesyl pyrophosphate competitive inhibitors of the activity of farnesyl-protein transferase or in combination with a compound which has Raf antagonist activity. The instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase or farnesyl-protein transferase.
In particular, the compounds disclosed in the following patents and publications may be useful as farnesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Ser. Nos. 08/254,228 and 08/435,047. Those patents and publications are incorporated herein by reference.
In practicing methods of this invention, which comprise administering, simultaneously or sequentially or in any order, two or more of a protein substrate-competitive inhibitor and a farnesyl pyrophosphate-competitive inhibitor, such administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, -46- WO 99/09985 PCT/US98/17696 subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously. When the protein substrate-competitive inhibitor and farnesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods.
The instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Ser. No. 09/055,487, filed April 6, 1998, which is incorporated herein by reference.
As used herein the term an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells. In particular, the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the avb3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the avb5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the avb3 integrin and the avb5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells. The term also refers to antagonists of the avb6, avb8, albl, a2bl, a5bl, a6bl and a6b4 integrins. The term also refers to antagonists of any combination of avb3, avb5, avb6, avb8, albl, a2bl, a5bl, a6bl and a6b4 integrins. The instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
Similarly, the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related viruses and fungal infections.
If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described below and the other pharmaceutically active agent(s) within -47- WO 99/09985 PCT/US98/17696 its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
EXAMPLES
Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof.
EXAMPLES 1 1-(3-Chlorophenyl)-4- [1-(4-cyanobenzyl)-5-imidazolylmethyl]-2piperazinone dihvdrochloride (Compound 1) Step A: Preparation of 1-triphenylmethyl-4-(hydroxymethyl)imidazole To a solution of 4-(hydroxymethyl)imidazole hydrochloride (35.0 g, 260 mmol) in 250 mL of dry DMF at room temperature was added triethylamine (90.6 mL, 650 mmol). A white solid precipitated from the solution. Chlorotriphenylmethane (76.1 g, 273 mmol) in 500 mL of DMF was added dropwise. The reaction mixture was stirred for 20 hours, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the titled product as a white solid which was sufficiently pure for use in the next step.
Step B: Preparation of 1-triphenylmethyl-4-(acetoxymethyl)imidazole Alcohol from Step A (260 mmol, prepared above) was suspended in 500 mL of pyridine. Acetic anhydride (74 mL, 780 mmol) was added dropwise, and the reaction was stirred for -48- WO 99/09985 PCT/US98/17696 48 hours during which it became homogeneous. The solution was poured into 2 L of EtOAc, washed with water (3 x 1 5% aq. HC1 soln. (2 x 1 sat. aq. NaHCO3, and brine, then dried (Na2SO4), filtered, and concentrated in vacuo to provide the crude product. The acetate was isolated as a white powder which was sufficiently pure for use in the next reaction.
Step C: Preparation of 1-(4-cyanobenzyl)-5-(acetoxymethyl)imidazole hydrobromide A solution of the product from Step B (85.8 g, 225 mmol) and a-bromo-p-tolunitrile (50.1 g, 232 mmol) in 500 mL of EtOAc was stirred at 60°C for 20 hours, during which a pale yellow precipitate formed. The reaction was cooled to room temperature and filtered to provide the solid imidazolium bromide salt. The filtrate was concentrated in vacuo to a volume 200 mL, reheated at 60°C for two hours, cooled to room temperature, and filtered again. The filtrate was concentrated in vacuo to a volume 100 mL, reheated at 60'C for another two hours, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in 500 mL of methanol, and warmed to 60 0
C.
After two hours, the solution was reconcentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the titled product hydrobromide as a white solid which was used in the next step without further purification.
-49- .WO 99/09985 PCT/US98/17696 Step D: Preparation of 1-(4-cyanobenzyl)-5-(hydroxymethyl)imidazole To a solution of the acetate from Step C (50.4 g, 150 mmol) in 1.5 L of 3:1 THF/water at 0°C was added lithium hydroxide monohydrate (18.9 g, 450 mmol). After one hour, the reaction was concentrated in vacuo, diluted with EtOAc (3 and washed with water, sat. aq. NaHCO3 and brine. The solution was then dried (Na2SO4), filtered, and concentrated in vacuo to provide the crude product as a pale yellow fluffy solid which was sufficiently pure for use in the next step without further purification.
Step E: Preparation of 1-(4-cyanobenzyl)-5imidazolecarboxaldehyde To a solution of the alcohol from Step D (21.5 g, 101 mmol) in 500 mL of DMSO at room temperature was added triethylamine (56 mL, 402 mmol), then SO3-pyridine complex (40.5 g, 254 mmol). After 45 minutes, the reaction was poured into 2.5 L of EtOAc, washed with water (4 x 1 L) and brine, dried (Na2SO4), filtered, and concentrated in vacuo to provide the aldehyde as a white powder which was sufficiently pure for use in the next step without further purification.
Step F: Preparation of N-(3-chlorophenyl)ethylenediamine hydrochloride To a solution of 3-chloroaniline (30.0 mL, 284 mmol) in 500 mL of dichloromethane at o0C was added dropwise a solution of 4 N HC1 in 1,4-dioxane (80 mL, 320 mmol HC1). The solution was warmed to room temperature, then concentrated to dryness in vacuo to provide a white powder. A mixture of this powder with 2-oxazolidinone (24.6 g, 282 mmol) was heated under nitrogen atmosphere at 160°C for 10 hours, during which the solids melted, and gas evolution was observed. The reaction was allowed to cool, forming the crude diamine hydrochloride salt as a pale brown solid.
WO 99/09985 PCT/US98/17696 Step G: Preparation of N-(tert-butoxycarbonyl)-N'-(3chlorophenvl)ethvlenediamine The amine hydrochloride from Step F (ca. 282 mmol, crude material prepared above) was taken up in 500 mL of THF and 500 mL of sat. aq. NaHCO3 soln., cooled to o0C, and di-tertbutylpyrocarbonate (61.6 g, 282 mmol) was added. After 30 h, the reaction was poured into EtOAc, washed with water and brine, dried (Na2SO4), filtered, and concentrated in vacuo to provide the titled carbamate as a brown oil which was used in the next step without further purification.
Step H: Preparation of N-[2-(tert-butoxycarbamoyl)ethyl]-N-(3chlorophenvl)-2-chloroacetamide A solution of the product from Step G (77 g, ca. 282 mmol) and triethylamine (67 mL, 480 mmol) in 500 mL of CH2Cl2 was cooled to 0°C. Chloroacetyl chloride (25.5 mL, 320 mmol) was added dropwise, and the reaction was maintained at 0°C with stirring. After 3 h, another portion of chloroacetyl chloride (3.0 mL) was added dropwise. After 30 min, the reaction was poured into EtOAc (2 L) and washed with water, sat. aq. NH4CI soln, sat.
aq. NaHCO3 soln., and brine. The solution was dried (Na2SO4), filtered, and concentrated in vacuo to provide the chloroacetamide as a brown oil which was used in the next step without further purification.
Step I: Preparation of 4-(tert-butoxycarbonyl)-l-(3-chlorophenvl)- 2-piperazinone To a solution of the chloroacetamide from Step H (ca. 282 mmol) in 700 mL of dry DMF was added K2C03 (88 g, 0.64 mol). The solution was heated in an oil bath at 70-75 C for 20 hrs., cooled to room temperature, and concentrated in vacuo to remove ca. 500 mL of DMF. The remaining material was poured into 33% EtOAc/hexane, washed with water and brine, dried (Na2SO4), filtered, and concentrated in vacuo to provide the product as a brown oil. This material was purified by silica gel chromatography (25-50% -51- WO 99/09985 PCT/US98/17696 EtOAc/hexane) to yield pure product, along with a sample of product (ca. 65% pure by HPLC) containing a less polar impurity.
Step J: Preparation of 1-(3-chlorophenyl)-2-piperazinone Through a solution of Boc-protected piperazinone from Step I (17.19 g, 55.4 mmol) in 500 mL of EtOAc at -78°C was bubbled anhydrous HC1 gas. The saturated solution was warmed to 0°C, and stirred for 12 hours. Nitrogen gas was bubbled through the reaction to remove excess HC1, and the mixture was warmed to room temperature. The solution was concentrated in vacuo to provide the hydrochloride as a white powder. This material was taken up in 300 mL of CH2C12 and treated with dilute aqueous NaHCO3 solution.
The aqueous phase was extracted with CH2C12 (8 x 300 mL) until tlc analysis indicated complete extraction. The combined organic mixture was dried (Na2SO4), filtered, and concentrated in vacuo to provide the titled free amine as a pale brown oil.
Step K: Preparation of 1-(3-chlorophenyl)-4-11-(4-cyanobenzyl)-5imidazolylmethyl]-2-piperazinone dihydrochloride To a solution of the amine from Step J (55.4 mmol, prepared above) in 200 mL of 1,2-dichloroethane at 0°C was added 4A powdered molecular sieves (10 followed by sodium triacetoxyborohydride (17.7 g, 83.3 mmol). The imidazole carboxaldehyde from Step E of Example 1 (11.9 g, 56.4 mmol) was added, and the reaction was stirred at 0°C. After 26 hours, the reaction was poured into EtOAc, washed with dilute aq. NaHC03, and the aqueous layer was back-extracted with EtOAc. The combined organics were washed with brine, dried (Na2SO4), filtered, and concentrated in vacuo. The resulting product was taken up in 500 mL of 5:1 benzene:CH2Cl2, and propylamine (20 mL) was added. The mixture was stirred for 12 hours, then concentrated in vacuo to afford a pale yellow foam. This material was purified by silica gel chromatography (2-7% MeOH/CH2Cl2), and the resultant white foam was taken up in CH2C12 and treated with 2.1 equivalents of 1 M HC1/ether solution.
-52- WO 99/09985 PCT/US98/17696 After concentrated in vacuo, the product dihydrochloride was isolated as a white powder.
Examples 2 and 3 (Table 1) were prepared using the above protocol, which describes the synthesis of the structurally related compound Table 1 lists other compounds of the instant invention that were prepared using the procedure described in Example 1. In Step F, the appropriately substituted aniline was used in place of 3chloroaniline.
Table 1: 1-Aryl-4- [1-(4-cyanobenzyl)imidazolylmethyl] -2piperazinones
NN
0
N
N
FAB mass spectrum (M+1)
CHN
Analysis R-it m l LJ' lC.JLAl nL. 2 3-OCF3 3 2,5-(CH3)2 456 C23H20 F3N502*2.0HCl*0.60H20 calcd; C, 51.24; H, 4.34; N, 12.99.
found; C, 51.31; H, 4.33; N, 12.94.
400 C24H25N50 2.00HC1 0.65H20 calcd; C, 59.54; H, 5.89; N, 14.47 found; C, 59.54; H, 5.95; N, 14.12.
386 C23H23N50*2.0HC1l0.80H20 calcd; C, 58.43; H, 5.67; N, 14.81.
found; C, 58.67; H, 6.00; N, 14.23.
498 C22H20N50I*2.25HC1*0.90H20 calcd; C, 44.36; H, 4.07; N, 11.76.
4 3-CH3 3-I -53- WO 99/09985 PCT/US98/17696 found; C, 44.37; H, 4.06; N, 11.42.
EXAMPLE 6 1-(3-chlorophenyl)-4-[1-(4-cyano-3-methoxybenzyl)-5-imidazolylmethyl]-2piperazinone dihydrochloride Step A: Preparation of Methyl 4-Amino-3-hydroxvbenzoate Through a solution of 4-amino-3-hydroxybenzoic acid g, 0.49 mol) in 2.0 L of dry methanol at room temperature was bubbled anhydrous HC1 gas until the solution was saturated. The solution was stirred for 48 hours, then concentrated in vacuo. The product was partitioned between EtOAc and saturated aq. NaHCO 3 solution, and the organic layer was washed with brine, dried (Na 2
SO
4 and concentrated in vacuo to provide the titled compound.
Step B: Preparation of Methyl 3-Hydroxy-4-iodobenzoate A cloudy, dark solution of the product from Step A (79 g, 0.47 mol), 3N HC1 (750 mL), and THF (250 mL) was cooled to o0C. A solution ofNaNO 2 (35.9 g, 0.52 mol) in 115 mL of water was added over ca. 5 minutes, and the solution was stirred for another minutes. A solution of potassium iodide (312 g, 1.88 mol) in 235 mL of water was added all at once, and the reaction was stirred for an additional 15 minutes. The mixture was poured into EtOAc, shaken, and the layers were separated. The organic phase was washed with water and brine, dried (Na 2
SO
4 and concentrated in vacuo to provide the crude product (148 Purification by column chromatography through silica gel EtOAc/hexane) provided the titled product.
Step C: Preparation of Methyl 4-Cyano-3-hvdroxvbenzoate A mixture of the iodide product from Step B (101 g, 0.36 mol) and zinc(II)cyanide (30 g, 0.25 mol) in 400 mL of dry DMF was degassed by bubbling argon through the solution for 20 minutes.
Tetrakis(triphenylphosphine)palladium (8.5 g, 7.2 mmol) was added, -54- WO 99/09985 PCT/US98/17696 and the solution was heated to 80°C for 4 hours. The solution was cooled to room temperature, then stirred for an additional 36 hours.
The reaction was poured into EtOAc/water, and the organic layer was washed with brine dried (Na 2
SO
4 and concentrated in vacuo to provide the crude product. Purification by column chromatography through silica gel (30%-50% EtOAc/hexane) provided the titled product.
Step D: Preparation of Methyl 4-Cyano-3-methoxvbenzoate Sodium hydride (9 g, 0.24 mol as 60% wt. disp. mineral oil) was aded to a solution of the phenol from Step C (36.1 g, 204 mmol) in 400 mL of dry DMF at room temperature. Iodomethane was added (14 mL. 0.22 mol) was added, and the reaction was stirred for 2 hours.
The mixture was poured into EtOAc/water, and the organic layer was washed with water and brine dried (Na 2
SO
4 and concentrated in vacuo to provide the titled.
Step E: Preparation of 4-Cvano-3-methoxvbenzvl Alcohol To a solution of the ester from Step D (48.8 g, 255 mmol) in 400 mL of dry THF under argon at room temperature was added lithium borohydride (255 mL, 510 mmol, 2M THF) over 5 minutes.
After 1.5 hours, the reaction was warmed to reflux for 0.5 hours, then cooled to room temperature. The solution was poured into EtOAc/1N HCI soln. [CAUTION], and the layers were separated. The organic layer was washed with water, sat Na 2
CO
3 soln. and brine dried (Na 2
SO
4 and concentrated in vacuo to provide the titled product.
Step F: Preparation of 4-Cyano-3-methoxybenzvl Bromide A solution of the alcohol from Step E (35.5 g, 218 mmol) in 500 mL of dry THF was cooled to 0°C. Triphenylphosphine was added (85.7 g, 327 mmol), followed by carbontetrabromide (108.5 g, 327 mmol). The reaction was stirred at o0C for 30 minutes, then at room temperature for 21 hours. Silica gel was added (ca. 300 and the suspension was concentrated in vacuo. The resulting solid was WO 99/09985 PCT/US98/17696 loaded onto a silica gel chromatography column. Purification by flash chromatography (30%-50% EtOAc/hexane) provided the titled.
Step G: Preparation of 1-(4-cyano-3-methoxybenzyl)-5- (acetoxvmethyl)-imidazole hydrobromide The titled product was prepared by reacting the bromide from Step F (21.7 g, 96 mmol) with the imidazole product from Step B of Example 1 (34.9 g, 91 mmol) using the procedure outlined in Step C of Example 1. The crude product was triturated with hexane to provide the titled product hydrobromide.
Step H: Preparation of 1-(4-cyano-3-methoxybenzyl)-5- (hydroxvmethyl)-imidazole The titled product was prepared by hydrolysis of the acetate from Step G (19.43 g, 68.1 mmol) using the procedure outlined in Step D of Example 1. The crude titled product was isolated in modest yield (11 g, 66% yield). Concentration of the aqueous extracts provided solid material (ca. 100 g) which contained a significant quantity of the titled product as judged by 1H NMR spectroscopy.
Step I: Preparation of 1-(4-cyano-3-methoxybenzyl)-5imidazolecarboxaldehyde The titled product was prepared by oxidizing the alcohol from Step H (11 g, 45 mmol) using the procedure outlined in Step E of Example 1. The titled aldehyde was isolated as a white powder which was sufficiently pure for use in the next step without further purification.
Step J: Preparation of 1-(3-chlorophenyl)-4-[1-(4-cyano-3methoxybenzyl)-5-imidazolylmethyl]-2-piperazinone dihydrochloride The titled product was prepared by reductive alkylation of the aldehyde from Step I (859 mg, 3.56 mmol) and the amine (hydrochloride) from Step K of Example 1 (800 mg, 3.24 mmol) using -56- 1. WO 99/09985 PCT/US98/17696 the procedure outlined in Step H of Example 1. Purification by flash column chromatography through silica gel (50%-75% acetone
CH
2 Cl 2 and conversion of the resulting white foam to its dihydrochloride salt provided the titled product as a white powder.
FAB ms 437.
Anal. Calc. for C23H23C1N502*2.OHCl *0.35CH2C12: C, 51.97; H, 4.80; N, 12.98.
Found: C, 52.11; H, 4.80; N, 12.21.
EXAMPLE 7 1-(3-trifluoromethoxyphenyl)-4- l-(4-cyano-3-methoxybenzyl)- imidazolvl methvyll-2-piperazinone dihvdrochloride 1-(3-trifluoromethoxy-phenyl)-2-piperazinone hydrochloride was prepared from 3-trifluoromethoxyaniline using Steps F-J of Example 1. This amine (1.75 g, 5.93 mmol) was coupled to the aldehyde from Step I of Example 6 (1.57 g, 6.52 mmol) using the procedure outlined in Step H of Example 1. Purification by flash column chromatography through silica gel (60%-100% acetone
CH
2 Cl 2 and conversion of the resulting white foam to its dihydrochloride salt provided the titled product as a white powder.
FAB ms 486.
Anal. Calc. for C24H23F3N503*2.OHClO.60H 2 0: C, 50.64; H, 4.46; N, 12.30.
Found: C, 50.69; H, 4.52; N, 12.13.
EXAMPLE 8 -1-(3-chlorophenyl)-4-1-(4-cyanobenzyl)- imidazolvlmethyll-2-piperazinone dihvdrochloride Steps A-E: Preparation of [(benzyloxy)methyll chlorophenvl)-2-piperazinone hydrochloride: -57- WO 99/09985 PCT/US98/17696 The titled compound was prepared using an adaptation of the following protocol, which describes the synthesis of the structurally related compound 5(S)-n-butyl-l-(2,3-dimethylphenyl)- 2-piperazinone hydrochloride. In Step A, N-Boc-Ser(OBn)-OH was used instead of 2(S)-(butoxycarbonylamino)hexanoic acid.
Step A: N-Methoxy-N-methyl 2(S)-(tert-butoxycarbonylamino)hexanamide 2(S)-(Butoxycarbonylamino)hexanoic acid (24.6 g, 0.106 mol), N,O-dimethylhydroxylamine hydrochloride (15.5 g, 0.15 mol), EDC hydrochloride 22.3 g, 0.117 mol) and HOBT (14.3 g, 0.106 mol) were stirred in dry, degassed DMF (300 mL) at 20 0 C under nitrogen.
N-Methylmorpholine was added to obtain pH 7. The reaction was stirred overnight, the DMF distilled under high vacuum, and the residue partitioned between ethyl acetate and 2% potassium hydrogen sulfate. The organic phase was washed with saturated sodium bicarbonate, water, and saturated brine, and dried with magnesium sulfate. The solvent was removed in vacuo to give the title compound.
Step B: 2(S)-(tert-Butoxvcarbonylamino)hexanal A mechanically stirred suspension of lithium aluminum hydride (5.00 g, 0.131 mol) in ether (250 mL) was cooled to -45 0 C under nitrogen. A solution of the product from Step A (28.3 g, 0.103 mol) in ether (125 mL) was added, maintaining the temperature below -35°C. When the addition was complete, the reaction was warmed to 5°C, then recooled to -45°C. A solution of potassium hydrogen sulfate (27.3 g, 0.200 mol) in water was slowly added, maintaining the temperature below -5 0 C. After quenching, the reaction was stirred at room temperature for lh. The mixture was filtered through Celite, the ether evaporated, and the remainder partitioned between ethyl acetate and 2% potassium hydrogen sulfate.
After washing with saturated brine, drying over magnesium sulfate and solvent removal, the title compound was obtained.
-58- WO 99/09985 PCT/US98/17696 Step C: N-(2,3-Dimethylphenyl)-2(S)-(tert-butoxycarbonylamino)hexanamine 2,3-Dimethylaniline (8.32 mL, 68.3 mmol) was dissolved in dichloroethane under nitrogen. Acetic acid was added to obtain pH 5, and sodium triacetoxyborohydride (17.2 g, 80.8 mmol) and crushed molecular sieves (4 g) were added. A solution of the product from Step B (13.3 g, 62.1 mmol) in dichloroethane (80 mL) was added slowly dropwise at 20°C. The reaction was stirred overnight, then quenched with saturated sodium bicarbonate solution. The aqueous layer was removed, the organic phase washed with saturated brine and dried over magnesium sulfate. Crystallization from hexane gave the title compound.
Step D: 4-tert-Butoxycarbonyl-5(S)-n-butyl-l-(2,3dimethylphenyl)-2-piperazinone A solution of the product from Step C (8.50 g, 26.5 mmol) in ethyl acetate (250 mL) was vigorously stirred at o0C with saturated sodium bicarbonate (150 mL). Chloroacetyl chloride (2.33 mL, 29.1 mmol) was added, and the reaction stirred at 0°C for lh. The layers were separated, and the ethyl acetate phase was washed with saturated brine, and dried over magnesium sulfate. The crude product was dissolved in DMF (300 mL) and cooled to 0°C under nitrogen. Sodium hydride (1.79 g, 60% dispersion in oil, 44.9 mmol) was added portionwise to maintain moderate hydrogen evolution.
After 30 min, an additional amount of sodium hydride was added (0.8 The reaction was stirred another 30 min, then quenched with saturated ammonium chloride. The DMF was distilled in vacuo, and the residue partitioned between ethyl acetate and water. The organic phase was washed with water, saturated brine, and dried over magnesium sulfate. The crude product was chromatographed on silica gel with 20-30% ethyl acetate in hexane to obtain the title compound.
Step E: 5(S)-n-Butvl-l-( 2 .3-dimethylphenvl)-2-piperazinone -59- WO 99/09985 PCT/US98/17696 A solution of the product from Step D (0.570 g, 1.58 mmol) in ethyl acetate (50 mL) was cooled to -15 0 C under nitrogen. HC1 gas was bubbled through for 15 min, and the reaction solution warmed to 0°C for 2h. The solvent was removed in vacuo to provide the titled product.
Step F: Preparation of(R)-5-[(Benzyloxy)methyl]-1-(3chlorophenyl)-4-[1-(4-cyanobenzyl)-5-imidazolylmethyl] 2-piperazinone dihvdrochloride The titled product was prepared by reductive alkylation of the aldehyde from Step E of Example 1 (181 mg, 0.858 mmol) and (R)-5-[(benzyloxy)methyl]-l-(3-chlorophenyl)-2-piperazinone hydrochloride from the present Example (205 mg, 0.558 mmol) using the procedure outlined in Step K of Example 1. Purification by flash column chromatography through silica gel (acetone/CH 2 C1 2 and conversion to the dihydrochloride salt provided the titled product as a white powder. FAB ms 526.
Anal. Calc. for C30H28C1N502*2.15HC1 0.55H20: C, 58.65; H, 5.13; N, 11.40.
Found: C, 58.63; H, 5.13; N, 11.18.
EXAMPLE 9 1-(3-Chlorophenyl)-4-[1-(4-cyano-3-(trifluoromethoxy)benzyl)-5imidazolylmethvll-2-piperazinone dihydrochloride Step A: Preparation of 4-bromo-2-(trifluoromethoxy) benzonitrile To a solution of 4-bromo-2-(trifluoromethoxy)iodobenzene g, 68 mmol) and zinc(II) cyanide (4.0 g, 34 mmol) in 150 mL of degassed dimethylformamide was added tetrakis(triphenylphosphine)palladium (3.1 g, 4 mole The solution was stirred at 80 OC for one hour, then cooled to room temperature. Additional portions of zinc(II) cyanide (800 mg) and tetrakis(triphenylphosphine)palladium (700 mg) were added, and the solution was heated a t 80 oC for 3 hours. The mixture was diluted with EtOAc and extracted with saturated NaHCO, solution and WO 99/09985 PCTIUS98/17696 brine, dried over sodium sulfate, filtered, and concentrated in vacuo.
Purification by silica gel column chromatography ether/hexane) gave the titled product.
Step B: Preparation of methyl 4-cyano-3-(trifluoromethoxy) benzoate Through a solution of the product from Step A (3.82 g, 14.4 mmol), palladium(II) acetate (150 mg, 0.4 wt 1,3-bis(diphenylphosphino)propane (300 mg), and triethylamine (3.5 mL) in 30 mL of MeOH and 15 mL of DMSO was bubbled carbon monoxide gas for 6 hours. The reaction was heated to 80°C and stirred under a baloon of carbon monoxide. After ca. 16 hours, another aditional portions of palladium(II) acetate (100 mg) and 1,3-bis(diphenylphosphino)propane (200 mg) were added, and the solution was stirred for an additional hours. The mixture was diluted with EtOAc and extracted with water and brine, dried over sodium sulfate, filtered, and concentrated in vacuo. Purification by silica gel column chromatography EtOAc/hexane) gave the titled product.
Step C: Preparation of 4-cyano-3-(trifluoromethoxy) benzyl alcohol To a solution of the product from Step B (4.29 g, 17.5 mmol) in 100 mL of methanol at 0 OC was added sodium borohydride (1.3 g, mmol). The solution was allowed to warm to room temperature over 2 hours. An additional portion of sodium borohydried was added (500 mg), and the solution stirred for 30 minutes. The mixture was diluted with EtOAc and extracted with saturated NaHCO 3 solution and brine, dried over sodium sulfate, filtered, and concentrated in vacuo to give the titled product.
Step D: Preparation of 1-[4-cyano-3-(trifluoromethoxy)benzyl]-5- (acetoxymethyl)-imidazole To a solution of the product from Step C (1.5 g, 6.9 mmol) and the product from Step B of Example 1 (2.6 g, 6.9 mmol) in 10 mL of dichloromethane at -78 °C was added diisopropylethylamine (2.4 mL, 14 -61- SWO 99/09985 PCT/US98/17696 mmol), followed by slow addition of trifluoromethanesulfonic anhydride (1.26 mL, 7.5 mmol). The solution was stirred for 15 minutes, then allowed to warm to room temperature. After 2 hours, methanol was added (10 mL), and the solution was stirred for 48 hours. The reaction was concentrated in vacuo, diluted with EtOAc and extracted with saturated NaHCO 3 solution and brine, dried over sodium sulfate, filtered, and concentrated in vacuo. Purification by silica gel column chromatography (5-10% MeOH/EtOAc) gave the titled product.
Step E: Preparation of 1-[4-cyano-3-(trifluoromethoxy)benzyl]-5- (hydroxvmethyl)-imidazole The titled compound was prepared from the product of Step D (1.94 g, 5.72 mmol) using the procedure described in Step D of Example 1. This provided the titled product.
Step F: Preparation of 1-[4-cyano-3-(trifluoromethoxy)benzyl] The titled compound was prepared from the product of Step E (1.31 g, 4.41 mmol) using the procedure described in Step E of Example 1. This provided the titled product.
Step G: Preparation of 1-(3-Chlorophenyl)-4-[1-(4-cyano-3- (trifluoromethoxy)benzyl)-5-imidazolylmethyl]-2piperazinone dihydrochloride The titled compound was prepared from the product of Step F (264 mg, 0.89 mmol) and the product of Step J of Example 1 using the procedure described in Step K of Example 1. Purification by silica gel column chromatography (50-65% acetone/dichloro methane) and conversion to the dihydrochloride salt using excess ethereal HC1 solution gave the titled product as a white powder.
FAB ms 490.1.
Anal. Calc. for C23H19C1F3N50 2 2.00 HC1 *1.0 C, 47.56; H, 3.99; N, 12.06.
Found: C, 47.58; H, 4.02; N, 11.91.
EXAMPLE -62- '.WO 99/09985 PCT/US98/17696 4-11-(4-Cyano-3-(trifluoromethoxy)benzyl)-5-imidazolylmethyl] -1-13- (trifluoromethoxv)phenll-2-piperazinone dihydrochloride Step A: Preparation of 1-[3-(trifluoromethoxy)phenyl]-2piperazinone hydrochloride The titled compound was prepared from 3- (trifluoromethoxy)aniline using the procedures described in Steps F-J of Example 1.
Step B: Preparation of 4-11-(4-cyano-3-(trifluoromethoxy)benzyl)- -1-13-(trifluoromethoxy)phenyl] -2piperazinone dihydrochloride The titled compound was prepared from the product of Step A and the product of Step F of Example 9 using the procedure described in Step K of Example 1. Purification by silica gel column chromatography (50-65% acetone/dichloro methane) and conversion to the dihydrochloride salt using excess ethereal HCI solution gave the titled product as a white powder.
FAB ms 540.2.
Anal. Cale. for C24H19F6N502 *2.00 HCI 1.15 H20 *0.50 CH2Cl2: C, 44.61; H, 3.71; N, 10.62.
Found: C, 44.63; H, 3.70; N, 10.56.
EXAMPLE 11 1-(3-Chlorophenyl)-4- [1-(4-cyano-3-fluorobenzyl)-5-imidazolylmethyl 2-piperazinone dihvdrochloride Step A: Preparation of 4-cvano-3-fluorotoluene To a degassed solution of 4 -bromo-3-fluorotoluene (50.0 g, 264 mmol) in 500 mL of DMF was added Zn(CN) 2 (18.6 g, 159 mmol) and Pd(PPh,) 4 (6.1 g, 5.3 mmol). The reaction was stirred at 80 0 C for 6 hours, then cooled to room temperature. The solution was poured into EtOAc, washed with water, sat. aq. NaHCO3, and brine, then dried (Na2SO4), -63- SWO 99/09985 PCT/US98/17696 filtered, and concentrated in vacuo to provide the crude product.
Purification by silica gel chromatography EtOAc/hexane) provided the titled product.
Step B: Preparation of 4-cvano-3-fluorobenzvlbromide To a solution of the product from Step A (22.2 g, 165 mmol) in 220 mL of carbontetrachloride was added N-bromosuccinimide (29.2 g, 164 mmol) and benzoylperoxide The reaction was heated to reflux for 30 minutes, then cooled to room temperature. The solution was concentrated in vacuo to one-third the original volume, poured into EtOAc, washed with water, sat. aq. NaHCO3, and brine, then dried (Na2SO4), filtered, and concentrated in vacuo to provide the crude product. Analysis by 1H NMR indicated only partial conversion, so the crude material was resubjected to the same reaction conditions for hours, using 18 g (102 mmol) of N-bromosuccinimide. After workup, the crude material was purified by silica gel chromatography (0-10% EtOAc/hexane) to provide the desired product.
Step C: Preparation of 1-( 4 imidazole hydrobromide A solution of the product from Step B (20.67 g, 96.14 mmol) and the product from Step B of Example 1 (36.72 g, 96.14 mmol) in 250 mL of EtOAc was stirred at 60 OC for 20 hours, during which a white precipitate formed. The reaction was cooled to room temperature and filtered to provide the solid imidazolium bromide salt. The filtrate was concentrated in vacuo to a volume of 100 mL, reheated at 60 °C for two hours, cooled to room temperature, and filtered again. The filtrate was concentrated in vacuo to a volume 40 mL, reheated at 60 °C for another two hours, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in 300 mL of methanol, and warmed to 60 After two hours, the solution was reconcentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the titled product hydrobromide as a white solid which was used in the next step without further purification.
-64- WO 99/09985 PCT/US98/17696 Step D: Preparation of 1-(4-cyano-3-fluorobenzyl)-5- (hydroxvmethyl)imidazole To a solution of the product from Step C (31.87 g, 89.77 mmol) in 300 mL of 2:1 THF/water at 0°C was added lithium hydroxide monohydrate (7.53 g, 179 mmol). After two hours, the reaction was concentrated in vacuo to a 100 mL volume, stored at 0°C for 30 minutes, then filtered and washed with 700 mL of cold water to provide a brown solid. This material was dried in vacuo next to P 2 0, to provide the titled product as a pale brown powder which was sufficiently pure for use in the next step without further purification.
Step E: Preparation of 1-(4-cyano-3-fluorobenzyl)-5imidazolecarboxaldehyde To a solution of the alcohol from Step D (2.31 g, 10.0 mmol) in 20 mL of DMSO at 0 °C was added triethylamine (5.6 mL, 40 mmol), then S03-pyridine complex (3.89 g, 25 mmol). After 30 minutes, the reaction was poured into EtOAc, washed with water and brine, dried (Na2SO4), filtered, and concentrated in vacuo to provide the aldehyde as a pale yellow powder which was sufficiently pure for use in the next step without further purification.
Step F: Preparation of 1-(3-Chlorophenyl)-4-[1-(4-cyano-3- 2-piperazinone dihydrochloride The titled compound was prepared from the product of Step A and the product of Step F of Example 9 using the procedure described in Step K of Example 1. Purification by silica gel column chromatography (50-60% acetone/dichloromethane) and conversion to the dihydrochloride salt using excess ethereal HCI solution gave the titled product as a white powder.
FAB ms 424.2.
Anal. Calc. for C22H19C1FN 5 0 2 *2.00 HC1 *1.15 C, 51.05; H, 4.54; N, 13.53.
Found: C, 51.08; H, 4.62; N, 13.44.
WO 99/09985 PCTIUS98/17696 EXAMPLE 12 1-(3-Chlorophenyl)-4-[l-(4-cyano-3-(methylthio)benzyl)-5imidazolvlmethyll- 2-piperazinone dihydrochloride To a solution of the Example 11 product (52 mg, 0.12 mmol) in 1 mL of DMF was added sodium thiomethoxide (17 mg, 0.24 mmol). After ca. 16 hours, the reaction was diluted with EtOAc and extracted with saturated NaHCO 3 solution and brine, dried over sodium sulfate, filtered, and concentrated in vacuo. Purification by silica gel preparative thin-layer chromatography (2 x 0.5 mm, CHC1 3 /methanol) and conversion to the dihydrochloride salt using excess ethereal HCI solution gave the titled product as a white powder.
HPLC: 100% purity at 220 nm; retention time 8.24 min; 5-95% gradient: acetonitrile/0.1% TFA-water over 15 min.
Anal. Calc. for C23H22C1N50S *2.00 HC1 *0.15 H20 *0.30 CH2Cl2: C, 50.59; H, 4.54; N, 12.66.
Found: C, 51.21; H, 5.08; N, 11.88.
EXAMPLE 13 1-(3-Chlorophenyl)-4-[l-(4-cyano-3-(phenoxy)benzyl)-5imidazolvlmethyll- 2-piperazinone dihydrochloride To a solution of the Example 11 product (50 mg, 0.12 mmol) in 1 mL of DMSO was added phenol (33 mg, 0.35 mmol), followed by cesium carbonate (114 mg, 0.35 mmol). After ca. 16 hours, the reaction was diluted with EtOAc and extracted with water and brine, dried over sodium sulfate, filtered, and concentrated in vacuo. Purification by silica gel preparative thinlayer chromatography (2 x 0.5 mm, 90:10:1 CHCl 3 /methanol/NH 4
OH)
and conversion to the dihydrochloride salt using excess ethereal HC1 solution gave the titled product as a white powder.
-66- WO 99/09985 WO 9909985PCTfUS98/I 7696 FAB ms 498.2.
Anal. Gale. for C28H24C1N502 92.00 HCI *0.50 H20 90.10 CH2Cl2: C, 57.35; H, 4.66; N, 11.90.
Found: C, 57.37; H, 4.67; N, 11.13.
EXAMPLE 14 The following compounds were also prepared by procedures analogous to those described in Examples 1-13: 14(3-Chlorophenyl)-4- 1-(2-fluoro-4-cyan oben zyl) 1 H-imidazol-5 ylm ethyl] piperazin- 2-one dihydrochioride Anal. C 22
H
19 C1FN 5 0 2 HCl 1H 2 0 Gale: C, 51.33; H, 4.50; N, 13.60 Found: C, 51.41; H, 4.49; N, 13.16 4 4 -Cyanobenzyl)- 1H-imidazol- 5-ylm ethyl] 1-(3methylthiophenyl)piperazin-2-one dihyd rochioride Anal. C 23
H
23
N
5 0S -2.5 HCl Gale: C, 54.33; H, 5.06; N, 13.77 Found: C, 54.37; H, 4.75; N, 13.13 4- [1-(4-Cyanobenzyl)- 1H-imidazol-5-ylmethyl dichlorophenyl) piperazin-2 -one dihydrochioride Anal. C 2 2
H
1 ,C1 2
N
5 0 -2.55 HCl -1 Calc: C, 47.92; H, 4.31; N, 12.70 Found: C, 47.95; H, 4.31; N, 12.65 1-(3-Chlorophenyl)-4- ([1-(4-cyanophenyl 1-ethyl] ylmethyl }piperazin-2-one dihydrochioride Anal. C 2
,H
22 C1N 5 0 HCl 1.3 Gale: C, 53.51; H, 5.19; N, 13.57 -67- WO 99/09985 WO 9909985PCTIUS98/1 7696 Found: C, 53.59; H, 5.39; N, 13.44 1-(3-Chloro-4-fluorophenyl)-4- [1-(4-cyanobenzyl)- ylmethyl] piperazin-2-one dihydrochioride, Anal. C 22
H
19 C1FN 5 0 -2 HCl Gale: C, 53.19; H, 4.26; N, 14.10 Found: C, 52.84; H, 4.37; N, 13.76 4-tl-(4-Cyanobenzyl)-1H-imidazol-5-ylmethyl dimethylphenyl)piperazin-2 -one dihydrochioride Anal. C 2 4
H
2 5
N
5 0 -2 HCl 0. 1 H.,0 Gale: C, 60.79; H, 5.78; N, 14.77 Found: C, 60.79; H, 6.32; N, 14.34 (S)-5-Benzyl-4- [3-(4-cyanobenzyl- 1-imidazol-5-yl)prop- l-yl] -1-phenyl-2piperazinone dihydrochioride FAB ms m/e 490 Anal. C 31
H
3 ,N 5 0 HCl 1.45 Caic: C, 63.25; H, 6.15; N, 11.90 Found: C, 63.22; H, 5.98; N,11.64 1-(3-Chlorophenyl)-4- [1-(4-nitrobenzyl)- ylmethyl] piperazin-2-one Anal. C 21
H
20
CIN
5 0 3 0.15 Caic: C, 58.85; H, 4.77; N, 16.34 Found: C, 58.82; H, 4.55; N, 16.35 4- [1-(4-Cyanobenzyl)- 1H-imidazol-5-ylmethyl] difluorophenyl)piperazin- 2-one dihydrochioride 3 0 Anal. C 22
H
19
F
2
N
5 0- 2 HCl 0.25 EtOAc Gale: C, 54.98; H, 4.61; N, 13.94 -68- WO 99/09985 PCT/US98/17696 Found: C, 54.72; H, 4.68; N, 13.80 4-[1-(4-Cyanobenzyl)-1H-imidazol-5-ylmethyl]-1-(3,4difluorophenyl)piperazin-2-one ditrifluoroacetic acid salt Anal. C 22
H
19
F
2
N
5 O 2 TFA 0.35 H 2 0 Calc: C, 48.66; H, 3.41; N, 10.91 Found: C, 48.29; H, 3.44; N, 11.30 EXAMPLE In vitro inhibition of ras farnesvl transferase Transferase Assays. Isoprenyl-protein transferase activity assays are carried out at 30 oC unless noted otherwise. A typical reaction contains (in a final volume of 50 mL): 3 H]farnesyl diphosphate, Ras protein 50 mM HEPES, pH 7.5, 5 mM MgC1 2 5 mM dithiothreitol, 10 mM ZnC1 2 0.1% polyethyleneglycol (PEG) (15,000-20,000 mw) and isoprenyl-protein transferase. The FPTase employed in the assay is prepared by recombinant expression as described in Omer, Kral, Diehl, Prendergast, Powers, Allen, Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl-protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HC1 in ethanol (1 mL). The quenched reactions are allowed to stand for m (to complete the precipitation process). After adding 2 mL of 100% ethanol, the reactions are vacuum-filtered through Whatman GF/C filters. Filters are washed four times with 2 mL aliquots of 100% ethanol, mixed with scintillation fluid (10 mL) and then counted in a Beckman LS3801 scintillation counter.
For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20-fold into the enzyme assay mixture. Substrate concentrations for inhibitor IC50 determinations are -69- WO 99/09985 PCT/US98/17696 as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 100 nM farnesyl diphosphate.
The compounds of the instant invention described in the above Examples 1-14 were tested for inhibitory activity against human FPTase by the assay described above and were found to have IC50 of 50 mM.
EXAMPLE 16 ModifiedIn vitro GGTase inhibition assay The modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature. A typical reaction contains (in a final volume of 50 mL): 3 H]geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example mM glycerophosphate or 5mM ATP), 5 mM MgC1 2 10 mM ZnC12, 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol, and geranylgeranylprotein transferase type I(GGTase). The GGTase-type I enzyme employed in the assay is prepared as described in U.S. Pat. No. 5,470,832, incorporated by reference. The Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 mL of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 25-fold into the enzyme assay mixture. IC50 values are determined with Ras peptide near KM concentrations. Enzyme and substrate concentrations for inhibitor
IC
5 0 determinations are as follows: 75 pM GGTase-I, 1.6 mM Ras peptide, 100 nM geranylgeranyl diphosphate.
WO 99/09985 PCT/US98/17696 EXAMPLE 17 Cell-basedin vitro ras farnesvlation assay The cell line used in this assay is a v-ras line derived from either Ratl or NIH3T3 cells, which expressed viral Ha-ras p21.
The assay is performed essentially as described in DeClue, J.E. et al.
Cancer Research 51:712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is After 4 hours at 37°C, the cells are labeled in 3 ml methionine-free DMEM supple-mented with regular DMEM, 2% fetal bovine serum and 400 mCi[ 3 (1000 Ci/mmol). After an additional 20 hours, the cells are lysed in 1 ml lysis buffer NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/1mM mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min.
Aliquots of lysates containing equal numbers of acid-precipitable counts are bought to 1 ml with IP buffer (lysis buffer lacking DTT) and immunoprecipitated with the ras-specific monoclonal antibody Y13-259 (Furth, M.E. et al., J. Virol. 43:294-304, (1982)). Following a 2 hour antibody incubation at 4°C, 200 ml of a 25% suspension of protein A-Sepharose coated with rabbit anti rat IgG is added for 45 min. The immunoprecipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-100.0.5% deoxycholate/0.1%/SDS/0.1 M NaC1) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands corresponding to farnesylated and nonfarnesylated ras proteins are compared to determine the percent inhibition of farnesyl transfer to protein.
EXAMPLE 18 Cell-basedin vitro growth inhibition assay -71- WO 99/09985 PCT/US98/17696 To determine the biological consequences of FPTase inhibition, the effect of the compounds of the instant invention on the anchorage-independent growth of Ratl cells transformed with either a v-ras, v-raf, or v-mos oncogene is tested. Cells transformed by v-Raf and v-Mos maybe included in the analysis to evaluate the specificity of instant compounds for Ras-induced cell transformation.
Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 104 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum) over a bottom agarose layer Both layers contain 0.1% methanol or an appropriate concentration of the instant compound (dissolved in methanol at 1000 times the final concentration used in the assay).
The cells are fed twice weekly with 0.5 ml of medium A containing 0.1% methanol or the concentration of the instant compound.
Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made.
EXAMPLE 19 Construction of SEAP reporter plasmid pDSE100 The SEAP reporter plasmid, pDSE100 was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI. The SEAP gene is derived from the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA). The plasmid pCMV- RE-AKI was constructed by Deborah Jones (Merck) and contains sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus immediate early promoter. The plasmid also contains a bovine growth hormone poly-A sequence.
The plasmid, pDSE100 was constructed as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2-Basic using the restriction enzymes EcoR1 and HpaI. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA -72- WO 99/09985 PCT/US98/17696 containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl- II and the ends filled in with Klenow DNA Polymerase I. The SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the ligation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
Alternative Construction of SEAP reporter plasmid, pDSE101 The SEAP repotrer plasmid, pDSE101 is also constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI. The SEAP gene is derived from plasmid pGEM7zf(-)/SEAP.
The plasmid pDSE101 was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf(-)/SEAP using the restriction enzymes Apa I and KpnI. The ends of the linear DNA fragments were chewed back with the Klenow fragment of E. coli DNA Polymerase I.
The "blunt ended" DNA containing the truncated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMV-RE-AKI which had been cut with Bgl-II and filled in with E. coli Klenow fragment DNA polymerase. Recombinant plasmids were screened for insert orientation and sequenced through the ligated junctions. The plasmid pCMV-RE-AKI is derived from plasmid pCMVIE-AKI-DHFR (Whang Silberklang, Morgan, Munshi, Lenny, Ellis, and Kieff, E. (1987) J. Virol., 61, 1796-1807) by removing an EcoRI fragment containing the DHFR and -73- WO 99/09985 PCT/US98/17696 Neomycin markers. Five copies of the fos promoter serum response element were inserted as described previously (Jones, Defeo-Jones, McAvoy, Vuocolo, Wegrzyn, Haskell, K.M. and Oliff, A. (1991) Oncogene, 6, 745-751) to create plasmid pCMV-RE-AKI.
The plasmid pGEM7zf(-)/SEAP was constructed as follows. The SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos.
Sense strand N-terminal SEAP
GAGAGGGAATTCGGGCCCTTCCTGCAT
GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.NO.:3) Antisense strand N-terminal SEAP:
GAGAGAGCTCGAGGTTAACCCGGGT
GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO.:4) Sense strand C-terminal SEAP:
GAGAGAGTCTAGAGTTAACCCGTGGTCC
CCGCGTTGCTTCCT 3' Antisense strand C-terminal SEAP:
GAAGAGGAAGCTTGGTACCGCCACTG
GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO.:6) The N-terminal oligos (SEQ.ID.NO.: 4 and SEQ.ID.NO.: 5) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and HpaI restriction sites at the ends. The Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon within the SEAP gene along with the HpaI site. The C-terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp Cterminal PCR product containing HpaI and HindIII restriction sites.
The sense strand C-terminal oligo (SEQ.ID.NO.: 5) introduces the internal STOP codon as well as the HpaI site. Next, the N-terminal amplicon was digested with EcoRI and HpaI while the C-terminal -74- WO 99/09985 PCTIUS98/17696 amplicon was digested with HpaI and HindIII. The two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf(-) (Promega) which had been restriction digested with EcoRI and HindIII and isolated on an agarose gel. The resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids.
Construction of a constitutively expressing SEAP plasmid pCMV-SEAP An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a truncated SEAP gene downstream of the cytomegalovirus (CMV) IE-1 promoter. The expression plasmid also includes the CMV intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
The plasmid pCMVIE-AKI-DHFR (Whang et al, 1987) containing the CMV immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV- AKI. Next, the cytomegalovirus intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI. The intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286. The intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, Thayer, Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a SacI restriction site using site directed mutagenesis. The mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
Sense strand: 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7) WO 99/09985 PCT/US98/17696 Antisense strand: 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 8) These two oligos generate a 991 base pair fragment with a SacI site incorporated by the sense oligo and a Bgl-II fragment incorporated by the antisense oligo. The PCR fragment is trimmed with SacI and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI is cut with SacI and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis. The two gel isolated fragments are ligated at their respective SacI and Bgl-II sites to create plasmid pCMV-AKI- InA.
The DNA sequence encoding the truncated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector.
The SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and HindIII. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis. The pCMV-AKI-InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the pCMV-AKI-InA vector. Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constructs were sequenced across the cloning junctions to verify the correct sequence.
The resulting plasmid, named pCMV-SEAP, contains a modified SEAP sequence downstream of the cytomegalovirus immediately early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence. The plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
Cloning of a Mvristvlated viral-H-ras expression plasmid A DNA fragment containing viral-H-ras can be PCRed from plasmid (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited -76- WO 99/09985 PCT/US98/17696 in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
Sense strand:
GGACCCCAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTG
G (SEQ.ID.NO.: 9) Antisense: 5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3'.
(SEQ.ID.NO.: A sequence encoding the first 15 aminoacids of the v-src gene, containing a myristylation site, is incorporated into the sense strand oligo. The sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5' to the ATG start site.
To prevent prenylation at the viral-ras C-terminus, cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo. The PCR primer oligos introduce an XhoI site at the 5' end and a Xbal site at the 3'end. The XhoI-XbaI fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with XhoI and XbaI. This results in a plasmid in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of a viral-H-ras-CVLL expression plasmid A viral-H-ras clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid (Ellis R.
et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) by PCR using the following oligos.
Sense strand: 5'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3' (SEQ.ID.NO.: 11) Antisense strand: -77- WO 99/09985 PCT/US98/17696 5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ.ID.NO.: 12) The sense strand oligo optimizes the 'Kozak' sequence and adds an XhoI site. The antisense strand mutates serine 189 to leucine and adds an XbaI site. The PCR fragment can be trimmed with XhoI and XbaI and ligated into the XhoI-XbaI cut vector pCI (Promega). This results in a plasmid in which the mutated viral-H-ras-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of c-H-ras-Leu61 expression plasmid The human c-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand: 5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3' (SEQ.ID.NO.: 13) Antisense strand: 5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3' (SEQ.ID.NO.: 14) The primers will amplify a c-H-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.NO.: After selection and sequencing for the correct nucleotide substitution, the mutated c-H-ras-Leu61 can be excised from the pAlter-1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI -78- WO 99/09985 PCT/US98/17696 (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from the CMV promoter of the pCI vector.
Cloning of a c-N-ras-Val-12 expression plasmid The human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand: 5'-GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3' (SEQ.ID.NO.: 16) Antisense strand: 5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3'
(SEQ.ID.NO.:
17) The primers will amplify a c-N-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 18) After selection and sequencing for the correct nucleotide substitution, the mutated c-N-ras-Val-12 can be excised from the pAlter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid will constitutively transcribe c-N-ras-Val-12 from the CMV promoter of the pCI vector.
Cloning of a c-K-ras-Val-12 expression plasmid -79- WO 99/09985 PCTIUS98/17696 The human c-K-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand: 5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3' (SEQ.ID.NO.: 19) Antisense strand: 5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3' (SEQ.ID.NO.: The primers will amplify a c-K-ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a KpnI site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with Kpn I and Sal I, the c-K-ras fragment can be ligated into a KpnI Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide: 5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.NO.: 21) After selection and sequencing for the correct nucleotide substitution, the mutated c-K-ras-Val-12 can be excised from the pAlter- 1 vector, using KpnI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with KpnI and Sal I. The new recombinant plasmid will constitutively transcribe c-K-ras-Val-12 from the CMV promoter of the pCI vector.
SEAP assay Human C33A cells (human epitheial carcenoma ATTC collection) are seeded in 10cm tissue culture plates in DMEM 10% fetal calf serum IX Pen/Strep 1X glutamine 1X NEAA. Cells are grown at 370C in a 5% C02 atmosphere until they reach 50 -80% of confluency.
The transient transfection is performed by the CaPO4 method (Sambrook et al., 1989). Thus, expression plasmids for H-ras, WO99/09985 PCT/US98/17696 N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE- SEAP reporter construct. For 10cm plates 600ml of CaC12 -DNA solution is added dropwise while vortexing to 600ml of 2X HBS buffer to give 1.2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red; Gibco cat. 31053-028)+ 0.5% charcoal stripped calf serum 1X (Pen/Strep, Glutamine and nonessential aminoacids). The CaPO4-DNA precipitate is added dropwise to the cells and the plate rocked gently to distribute. DNA uptake is allowed to proceed for 5-6 hrs at 37 0 C under a 5% C02 atmosphere.
Following the DNA incubation period, the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin. The 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM 0.2% charcoal stripped calf serum 1X (Pen/Strep, Glutamine and NEAA Transfected cells are plated in a 96 well microtiter plate (100ml/well) to which drug, diluted in media, has already been added in a volume of 100ml. The final volume per well is 200ml with each drug concentration repeated in triplicate over a range of half-log steps.
Incubation of cells and drugs is for 36 hrs at 37 0
C
under C02. At the end of the incubation period, cells are examined microscopically for evidence of cell distress. Next, 100ml of media containing the secreted alkaline phosphatase is removed from each well and transferred to a microtube array for heat treatment at 65 0 C for 1 hr to inactivate endogenous alkaline phosphatases (but not the heat stable secreted phosphatase).
The heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD® (Tropix, Bedford, Mass.). A volume of 50 ml media is combined with 200 ml of CSPD cocktail and incubated for 60 minutes at room temperature.
Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter construct stimulated by the transiently expressed protein.
DNA-CaPO4 precipitate for 10cm. plate of cells -81- WO 99/09985 PCT/US98/17696 Ras expression plasmid (Img/ml) DSE-SEAP Plasmid (Img/ml) 2ml Sheared Calf Thymus DNA (1mg/ml) 8ml 2M CaC12 74ml dH20 506ml 2X HBS Buffer 280mM NaCl KC1 1.5mM Na2HPO4 2H20 12mM dextrose
HEPES
Final pH 7.05 Luminesence Buffer (26ml) Assay Buffer Emerald ReagentTM (Tropix) 100mM homoarginine CSPD Reagent® (Tropix) Assay Buffer Add 0.05M Na2CO3 to 0.05M NaHCO3 to obtain pH Make ImM in MgC12 EXAMPLE The processing assays employed are modifications of that described by DeClue et al [Cancer Research 51, 712-717, 1991].
K4B-Ras processing inhibition assay PSN-1 (human pancreatic carcinoma) or viral-K4B-rastransformed Ratl cells are used for analysis of protein processing.
Subconfluent cells in 100 mm dishes are fed with 3.5 ml of media (methionine-free RPMI supplemented with 2% fetal bovine serum or cysteine-free/methionine-free DMEM supplemented with 0.035 ml of 200 -82- WO 99/09985 PCT/US98/17696 mM glutamine (Gibco), 2% fetal bovine serum, respectively) containing the desired concentration of test compound, lovastatin or solvent alone.
Cells treated with lovastatin (5-10 gM), a compound that blocks Ras processing in cells by inhibiting a rate-limiting step in the isoprenoid biosynthetic pathway, serve as a positive control. Test compounds are prepared as 1000x concentrated solutions in DMSO to yield a final solvent concentration of Following incubation at 37 0 C for two hours 204 gCi/ml 3 5 S]Pro-Mix (Amersham, cell labeling grade) is added.
After introducing the label amino acid mixture, the cells are incubated at 37 0 C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS. The cells are scraped into 1 ml of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 ml of lysis buffer Nonidet P-40, 20 mM HEPES, pH 150 mM NaC1, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, gg/ml AEBSF, 10 gg/ml aprotinin, 2 pg/ml leupeptin and 2 gpg/ml antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4 0
C
and the supernatant saved.
For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 8 jg of the pan Ras monoclonal antibody, Y13-259, added. The protein/antibody mixture is incubated on ice at 4 0 C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 40C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS). The Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec.
at room temperature).
The supernatant is added to 1 ml of Dilution Buffer 0.1% Triton X-100, 5 mM EDTA, 50 mM NaC1, 10 mM Tris pH 7.4) with 2 mg Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem).
-83- "WO 99/09985 PCT/US98/17696 The second protein/antibody mixture is incubated on ice at 40C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by tumbling at 4 0 C for minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Ras is eluted from the beads by heating at 95 0 C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bisacrylamide:acrylamide, 1:100), and the Ras visualized by fluorography.
EXAMPLE 21 Rapl processing inhibition assay Protocol A: Cells are labeled, incubated and lysed as described in Example For immunoprecipitation of Rapl, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine serum albumin as a standard. The appropriate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 2 gg of the Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech), is added. The protein/antibody mixture is incubated on ice at 4 0 C for 1 hour. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4 0 C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS). The Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
The supernatant is added to 1 ml of Dilution Buffer (0.1% Triton X-100, 5 mM EDTA, 50 mM NaC1, 10 mM Tris pH 7.4) with 2 mg Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech). The second protein/antibody mixture is incubated on ice at 40C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) by tumbling -84- WO 99/09985 PCT/US98/17696 at 4 0 C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Rapl is eluted from the beads by heating at 95 0 C for minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bisacrylamide:acrylamide, 1:100), and the Rapl visualized by fluorography.
Protocol B: PSN-1 cells are passaged every 3-4 days in 10cm plates, splitting near-confluent plates 1:20 and 1:40. The day before the assay is set up, 5x 106 cells are plated on 15cm plates to ensure the same stage of confluency in each assay. The media for these cells is RPM1 1640 (Gibco), with 15% fetal bovine serum and lx Pen/Strep antibiotic mix.
The day of the assay, cells are collected from the 15cm plates by trypsinization and diluted to 400,000 cells/ml in media. 0.5ml of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37 0 C overnight.
The compounds to be assayed are diluted in DMSO in 1/2-log dilutions. The range of final concentrations to be assayed is generally 0.1-100gM. Four concentrations per compound is typical. The compounds are diluted so that each concentration is 1000x of the final concentration for a 10gM data point, a 10mM stock of the compound is needed).
2pL of each 1000x compound stock is diluted into 1ml media to produce a 2X stock of compound. A vehicle control solution (2pL DMSO to 1ml media), is utilized. 0.5 ml of the 2X stocks of compound are added to the cells.
After 24 hours, the media is aspirated from the assay plates. Each well is rinsed with 1ml PBS, and the PBS is aspirated.
180gL SDS-PAGE sample buffer (Novex) containing 5% 2-mercaptoethanol is added to each well. The plates are heated to 100"C for minutes using a heat block containing an adapter for assay plates.
The plates are placed on ice. After 10 minutes, 20gL of an RNAse/ WO 99/09985 PCT/US98/17696 DNase mix is added per well. This mix is Img/ml DNaseI (Worthington Enzymes), 0.25mg/ml Rnase A (Worthington Enzymes), 0.5M Tris-HCl and 50mM MgCl 2 The plate is left on ice for 10 minutes. Samples are then either loaded on the gel, or stored at -70C until use.
Each assay plate (usually 3 compounds, each in 4point titrations, plus controls) requires one 15-well 14% Novex gel. of each sample is loaded onto the gel. The gel is run at 15mA for about hours. It is important to run the gel far enough so that there will be adequate separation between 21kd (Rapl) and 29kd (Rab6).
The gels are then transferred to Novex pre-cut PVDF membranes for 1.5 hours at 30V (constant voltage). Immediately after transferring, the membranes are blocked overnight in 20ml Western blocking buffer nonfat dry milk in Western wash buffer (PBS 0.1% If blocked over the weekend, 0.02% sodium azide is added.
The membranes are blocked at 4°C with slow rocking.
The blocking solution is discarded and 20ml fresh blocking solution containing the anti Rapla antibody (Santa Cruz Biochemical SC1482) at 1:1000 (diluted in Western blocking buffer) and the anti Rab6 antibody (Santa Cruz Biochemical SC310) at 1:5000 (diluted in Western blocking buffer) are added. The membranes are incubated at room temperature for 1 hour with mild rocking. The blocking solution is then discarded and the membrane is washed 3 times with Western wash buffer for 15 minutes per wash. 20ml blocking solution containing 1:1000 (diluted in Western blocking buffer) each of two alkaline phosphatase conjugated antibodies (Alkaline phosphatase conjugated Anti-goat IgG and Alkaline phosphatase conjugated anti-rabbit IgG [Santa Cruz Biochemical]) is then added. The membrane is incubated for one hour and washed 3x as above.
About 2ml per gel of the Amersham ECF detection reagent is placed on an overhead transparency (ECF) and the PVDF membranes are placed face-down onto the detection reagent. This is incubated for one minute, then the membrane is placed onto a fresh transparency sheet.
The developed transparency sheet is scanned on a phosphorimager and the Rapla Minimum Inhibitory Concentration is -86- WO 99/09985 PCT/US98/17696 determined from the lowest concentration of compound that produces a detectable Rapla Western signal. The Rapla antibody used recognizes only unprenylated/unprocessed Rapla, so that the precence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation.
EXAMPLE 22 In vivo tumor growth inhibition assay (nude mouse) In vivo efficacy as an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art. Examples of such in vivo efficacy studies are described by N. E. Kohl et al. (Nature Medicine, 1:792-797 (1995)) and N. E. Kohl et al. (Proc. Nat. Acad. Sci.
91:9141-9145 (1994)).
Rodent fibroblasts transformed with oncogenically mutated human Ha-ras or Ki-ras (106 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0. The mice in each oncogene group are randomly assigned to a vehicle, compound or combination treatment group.
Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment. Alternatively, the farnesyl-protein transferase inhibitor may be administered by a continuous infusion pump. Compound, compound combination or vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5 1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.
-87- EDITORIAL NOTE -NO. 91213/98 The following Sequence Listing pages 1 to 4 are part of the Description, and are followed by Claim pages 88 to 91.
vWO 99/09985 PCTIUS98/17696 SEQUENCE LISTING <110> Merck Co., Inc.
Dinsmore, Christopher J.
Hutchinson, John H.
Williams, theresa M.
<120> INHIBITORS OF PRENYL-PROTEIN TRANSFERASE <130> 20040Y <150> 60/057,080 <151> 1997-08-27 <160> 21 <170> FastSEQ for Windows Version <210> 1 <211> 4 <212> PRT <213> Artificial Sequence <400> 1 Cys Val Leu Ser 1 <210> 2 <211> <212> PRT <213> Artificial Sequence <400> 2 Gly Lys Lys Lys Lys Lys Lys Ser Lys Thr Lys Cys Val Ile Met 1 5 10 <210> 3 <211> 52 <212> DNA <213> Artificial Sequence <400> 3 gagagggaat tcgggccctt cctgcatgct gctgctgctg ctgctgctgg gc 52 <210> 4 <211> 41 <212> DNA <213> Artificial Sequence <400> 4 gagagagctc gaggttaacc cgggtgcgcg gcgtcggtgg t 41
K)
SWO 99/09985 PCT/US98/17696- <210> <211> 42 <212> DNA <213> Artificial Sequence <400> gagagagtct agagttaacc cgtggtcccc gcgttgcttc ct <210> 6 <211> 43 <212> DNA <213> Artificial Sequence <400> 6 gaagaggaag cttggtaccg ccactgggct gtaggtggtg get <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <400> 7 ggcagagctc gtttagtgaa ccgtcag <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <400> 8 gagagatctc aaggacggtg actgcag <210> 9 <211> 86 <212> DNA <213> Artificial Sequence <400> 9 tctcctcgag gccaccatgg ggagtagcaa gagcaagcct aaggacccca gccagcgccg gatgacagaa tacaagcttg tggtgg <210> <211> 33 <212> DNA <213> Artificial Sequence <400> cacatctaga tcaggacagc acagacttgc age <210> 11 <211> 41 <212> DNA 42 43 27 27 86 33 "'WO 99/09985 PCTIUS98/17696 <213> Artificial Sequence 1k <400> 11 tctcctcgag gccaccatga cagaatacaa gcttgtggtg g 41 <210> 12 <211> 38 <212> DNA <213> Artificial Sequence <400> 12 cactctagac tggtgtcaga gcagcacaca cttgcagc 38 <210> 13 <211> 38 <212> DNA <213> Artificial Sequence <400> 13 gagagaattc gccaccatga cggaatataa gctggtgg 38 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <400> 14 gagagtcgac gcgtcaggag agcacacact tgc 33 <210> <211> 22 <212> DNA <213> Artificial Sequence <400> ccgccggcct ggaggagtac ag 22 <210> 16 <211> 38 <212> DNA <213> Artificial Sequence <400> 16 gagagaattc gccaccatga ctgagtacaa actggtgg 38 <210> 1~7 <211> 32 <212> DNA <213> Artificial Sequence <400> 17 gagagtcgac ttgttacatc accacacatg gc 32 WO 99/09985 PCT[US98/17696 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <400> 18 gttggagcag ttggtgttgg g 21 <210> 19 <211> 38 <212> DNA <213> Artificial Sequence <400> 19 gagaggtacc gccaccatga ctgaatataa acttgtgg 38 <210> <211> 36 <212> DNA <213> Artificial Sequence <400> ctctgtcgac gtatttacat aattacacac tttgtc 36 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <400> 21 gtagttggag ctgttggcgt aggc 24

Claims (23)

1- -(-methylphenyl)-4- [1 -(4-cyanobenzyl)irnidazol- 5 -yl methyl] 2 -pi1peraz inone, I -(3-iodophenyl)-4-[ I-( 4 -cyanobenzyl)inildazol-5-ylrnethyl-2-piperaziiione, I -(3-chlorophenyl)-4-[ I-( 3 -nethoxy-4-cyanobenzyl)imidazol5ylmethyll-2 piperazi none, 1 -(3-trifluioromethoxyphenyl).4.4 1-( 3 -methoxy-4-cyanobenizyl)imidazoI5-yliethyl-2- 0 piperazinone, 1-(3 -chlorophenyl)-4-[ 1-( 4 -cyanobenzyl)imidazol-5 ylmethyl]-2-piperazinone, I -(3-chlorophenyl)-4-[ 1-(2-fluoro-4-cyanobenzyl)- 1H-imidazol-5-ylmethyl]piperazin-2- one, 15 1-(4-cyanobenzyl)- 1H-imidazol-5-ylmethyl]- 1-(3 -methylthiophenyl)piperazin2one,
4- [1I-(4-cyanobenzyl)- I H-imidazol-5 -ylmethyl] 1 5 -dichlorophenyl)pi perazin-2-one, 1 I-(3 -chlorophenyl)-4- {[1-(4-cyanophenyl)-1I -ethyl] IlH-imidazol1-5 -yl methyl Ipiperazi n-2 one, 1 -ch loro-4- fl Uorophenyl)-4- [1I-(4-cyanobenzyl)- I H- 1imidazol1-5 -ylmnethyl Ip Iperazi n-2 20 one, I-(4-cyanobenzyl)- I H-imidazol-5-ylmnethyl]- 1 3 5 -di1rnethylph en yl)p Iperaz in-2 -one,
5-benzyl [3 -(4-cyanobenzyl- I Iin idazo1- 5 -yl)p rop- I -yl]-I -phenyl -2-p iperaz inone, 1 -ch lorophenyl)-4- [1I-(4-nitrobenzyl)- 1 H -i1midazol1-5 -yl methyl] p Iperazin2-one, an [1 -(4-cyanobenzyl)- I H-imidazol-5 -ylmethyl] 1 ,4-di fluorophenyl)pi1perazi n-2 -one, or a pharmaceutically acceptable salt or optical isomer thereof. 2. A compound which is a dual inhibitor of farnesyl-protein transferase and geranylgeranyl-protein transferase type 1, the compound being substantially as hereinbefore described with reference to the title compound of any one of the Examples. 3. A process of preparing a compound which is a dual inhibitor of farnesyl- protein transferase and geranyl geranyl -protein transferase type 1, the process being substantially as hereinbefore described with reference to the Schemes. [1:\DayLib\IIBAA]0887Ospec.doc:gcc 89 4. A process of preparing a compound which is a dual inhibitor of farnesyl- protein transferase and geranylgeranyl-protein transferase type I, the process being substantially as hereinbefore described with reference to any one of the Examples. A compound prepared by the process of claim 4.
6. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of any one of claims 1 to 2 or
7. A method for inhibiting farnesyl-protein transferase and geranylgeranyl- protein transferase type I, which method comprises administering to a mammal a therapeutically effective amount of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6.
8. A method for treating cancer which method comprises administering to a mammal a therapeutically effective amount of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6. S 15 9. A method according to claim 8 wherein the cancer is characterised by a mutated K4B-Ras protein.
10. A method for treating neurofibromin benign proliferative disorder which method comprises administering to a mammal a therapeutically effective amount of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6. 20 11. A method for treating blindness related to retinal vascularisation which method comprises administering to a mammal a therapeutically effective amount of a Scompound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6.
12. A method for treating infections from hepatitis delta and related viruses which method comprises administering to a mammal a therapeutically effective amount of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6.
13. A method for preventing restenosis which method comprises administering to a mammal a therapeutically effective amount of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6.
14. A method for treating polycystic kidney disease which method comprises administering to a mammal a therapeutically effective amount of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6. A pharmaceutical composition made by combining the compound of claim I and a pharmaceutically acceptable carrier.
16. A process for making a pharmaceutical composition comprising combining a Rcompound of claim 1 and a pharmaceutically acceptable carrier. [1:\DayLib\LIBAA 0870spec.doc:gcc
17. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting farnesyl-protein transferase and geranylgeranyl- protein transferase type I.
18. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting and treating cancer.
19. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting and treating neurofibromin benign proliferative disorder. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting and treating blindness related to retinal vascularisation.
21. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting and treating infections from hepatitis delta and related viruses. s 22. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting and treating and preventing restenosis.
23. A compound of any one of claims 1 to 2 or 5 or a pharmaceutical composition of claim 6 when used for inhibiting and treating polycystic kidney disease.
24. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical 20 composition of claim 6 in the manufacture of a medicament for inhibiting farnesyl-protein transferase and geranylgeranyl-protein transferase type I. c*
25. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6 in the manufacture of a medicament for inhibiting and treating cancer.
26. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6 in the manufacture of a medicament for inhibiting and treating neurofibromin benign proliferative disorder.
27. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6 in the manufacture of a medicament for inhibiting and treating blindness related to retinal vascularisation.
28. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6 in the manufacture of a medicament for inhibiting and treating infections from hepatitis delta and related viruses. [I:\DayLib\LIBAA]08870spec.doc :gcc 91
29. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6 in the manufacture of a medicament for inhibiting and treating and preventing restenosis. Use of a compound of any one of claims 1 to 2 or 5 or of a pharmaceutical composition of claim 6 in the manufacture of a medicament for inhibiting and treating polycystic kidney disease. Dated 20 September, 2001 Merck Co., Inc. Patent Attorneys for the Applicant/Nominated Person 1o SPRUSON FERGUSON 6O OS SO S 0 55 50 0 Se S C 0 00 *00 S S 0
55.. 5500 S S OOSO ID• o• [I :\DayLib\LIBAA]08870spec.doc:gcc
AU91213/98A 1997-08-27 1998-08-26 Inhibitors of prenyl-protein transferase Ceased AU741725B2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US5708097P 1997-08-27 1997-08-27
US60/057080 1997-08-27
GB9800975 1998-01-16
GBGB9800975.6A GB9800975D0 (en) 1998-01-16 1998-01-16 Inhibitors of prenyl-protein transferase
PCT/US1998/017696 WO1999009985A1 (en) 1997-08-27 1998-08-26 Inhibitors of prenyl-protein transferase

Publications (2)

Publication Number Publication Date
AU9121398A AU9121398A (en) 1999-03-16
AU741725B2 true AU741725B2 (en) 2001-12-06

Family

ID=26312960

Family Applications (1)

Application Number Title Priority Date Filing Date
AU91213/98A Ceased AU741725B2 (en) 1997-08-27 1998-08-26 Inhibitors of prenyl-protein transferase

Country Status (5)

Country Link
EP (1) EP1014984A1 (en)
JP (1) JP2001513561A (en)
AU (1) AU741725B2 (en)
CA (1) CA2301770A1 (en)
WO (1) WO1999009985A1 (en)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1090012A4 (en) 1998-07-02 2005-04-06 Merck & Co Inc Inhibitors of prenyl-protein transferase
JP2002528504A (en) * 1998-10-29 2002-09-03 メルク エンド カムパニー インコーポレーテッド Prenyl protein transferase inhibitors
AU3386600A (en) 1999-03-03 2000-09-21 Merck & Co., Inc. Inhibitors of prenyl-protein transferase
JP2002542155A (en) 1999-03-03 2002-12-10 メルク エンド カムパニー インコーポレーテッド Inhibitors of prenyl protein transferase
EP1165082A4 (en) 1999-03-03 2002-06-12 Merck & Co Inc Inhibitors of prenyl-protein transferase
CA2362494A1 (en) 1999-03-03 2000-09-08 Merck & Co., Inc. Inhibitors of prenyl-protein transferase
USRE39921E1 (en) 1999-10-07 2007-11-13 Smithkline Beecham Corporation Chemical compounds
GB9923748D0 (en) 1999-10-07 1999-12-08 Glaxo Group Ltd Chemical compounds
AU2001227755A1 (en) 2000-01-12 2001-07-24 Merck And Co., Inc. Inhibitors of prenyl-protein transferase
US20020052380A1 (en) * 2000-02-18 2002-05-02 Dinsmore Christopher J. Inhibitors of prenyl-protein transferase
AU2001253246A1 (en) 2000-04-10 2001-10-23 Merck And Co., Inc. Inhibitors of prenyl-protein transferase
GB0025354D0 (en) 2000-10-17 2000-11-29 Glaxo Group Ltd Chemical compounds
US6593455B2 (en) 2001-08-24 2003-07-15 Tripep Ab Tripeptide amides that block viral infectivity and methods of use thereof
CA2458009C (en) * 2001-08-24 2011-08-16 Yale University Piperazinone compounds as anti-tumor and anti-cancer agents and methods of treatment
AU2007229363B2 (en) * 2001-08-24 2009-06-04 University Of South Florida Piperazinone Compounds as Anti-Tumor and Anti-Cancer Agents and the Methods of Treatment
WO2003024995A1 (en) 2001-09-19 2003-03-27 Tripep Ab Molecules that block viral infectivity and methods of use thereof
GB0203020D0 (en) 2002-02-08 2002-03-27 Glaxo Group Ltd Chemical compounds
GB0203022D0 (en) 2002-02-08 2002-03-27 Glaxo Group Ltd Chemical compounds
AU2003244455A1 (en) 2002-02-08 2003-09-02 Glaxo Group Limited Piperidylcarboxamide derivatives and their use in the treatment of tachykinim-mediated diseases
JP4965130B2 (en) * 2006-01-26 2012-07-04 日本臓器製薬株式会社 Dry type quick-disintegrating tablet
WO2015070367A1 (en) * 2013-11-12 2015-05-21 Merck Sharp & Dohme Corp. Piperidine or piperazine linked imidazole and triazole derivatives and methods of use thereof for improving the pharmacokinetics of a drug

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2000507582A (en) * 1996-04-03 2000-06-20 メルク エンド カンパニー インコーポレーテッド Inhibitors of farnesyl protein transferase

Also Published As

Publication number Publication date
AU9121398A (en) 1999-03-16
JP2001513561A (en) 2001-09-04
EP1014984A1 (en) 2000-07-05
CA2301770A1 (en) 1999-03-04
WO1999009985A1 (en) 1999-03-04

Similar Documents

Publication Publication Date Title
US6387903B1 (en) Inhibitors of prenyl-protein transferase
AU741725B2 (en) Inhibitors of prenyl-protein transferase
US20020052363A1 (en) Inhibitors of prenyl-protein transferase
US6562823B1 (en) Inhibitors of prenyl-protein transferase
US6358956B1 (en) Inhibitors of prenyl-protein transferase
US6358985B1 (en) Inhibitors of prenyl-protein transferase
AU3248600A (en) Inhibitors of prenyl-protein transferases
US20020052380A1 (en) Inhibitors of prenyl-protein transferase
US20020010184A1 (en) Inhibitors of prenyl-protein transferase
US20020037888A1 (en) Inhibitors of prenyl-protein transferase
US6410534B1 (en) Inhibitors of prenyl-protein transferase
US6376496B1 (en) Inhibitors of prenyl-protein transferase
US6329376B1 (en) Inhibitors of prenyl-protein transferase
US20020193283A1 (en) Inhibitors of prenyl-protein transferase
US6525074B2 (en) Inhibitors of prenyl-protein transferase
US6335343B1 (en) Inhibitors of prenyl-protein transferase
US6566385B2 (en) Inhibitors of prenyl-protein transferase
US6355643B1 (en) Inhibitors of prenyl-protein transferase
US6413964B1 (en) Inhibitors of prenyl-protein transferase
AU762440B2 (en) Inhibitors of prenyl-protein transferase
US20040110764A1 (en) Inhibitors of prenyl-protein transferase
US20020022633A1 (en) Inhibitors of prenyl-protein transferase
US6534506B2 (en) Inhibitors of prenyl-protein transferase
WO1999010329A1 (en) Inhibitors of prenyl-protein transferase
AU8921398A (en) A method of treating cancer

Legal Events

Date Code Title Description
FGA Letters patent sealed or granted (standard patent)
MK14 Patent ceased section 143(a) (annual fees not paid) or expired