JP2002528504A - Prenyl protein transferase inhibitors - Google Patents

Abstract

  (57) [Summary] The present invention relates to a peptide-like piperazine-containing macrocyclic compound that inhibits prenylation of prenyl protein transferase (FTase) and oncogene protein Ras. The present invention further relates to chemotherapeutic compositions comprising the compounds of the present invention and methods for inhibiting prenylation of prenyl protein transferase and oncogene protein Ras.

Description

DETAILED DESCRIPTION OF THE INVENTION

TECHNICAL FIELD [0002] Ras proteins (Ha-Ras, Ki4a-Ras, Ki4b-Ras and N-
Ras) is part of the signal pathway that links the cell surface growth factor receptor to the cell proliferation initiation nuclear signal. From biological and biochemical studies on the action of Ras,
as has been shown to have functions like G regulatory proteins. Inactive Ras
Is bound to GDP. Ras converts from GDP to GT during growth factor receptor activation.
Induced exchange to P and undergo a conformational change. GTP-bound Ras transmits a growth stimulatory signal until the signal is terminated by Ras' intrinsic GTPase activity and returns to an inactive GDP-bound form (DRLowy and DMWillumsen, Ann. Rev. Biochem. 62: 851-891 ). (1993)). In many human cancers such as colorectal cancer, exocrine pancreatic cancer and myeloid leukemia, the mutant ras gene (Ha-ras, Ki4a-ra
s, Ki4b-ras and N-ras). The protein products of these genes are defective in their GTPase activity and constitutively transmit growth stimulus signals.

[0002] Ras is localized to the plasma membrane in both normal and tumorigenic functions.
Must be there. Ras membrane localization involves at least three post-translational modifications
All three modifications occur at the C-terminus of Ras. "CA" appears at the C-terminal of Ras.
AX "or" Cys-Aaa¹-Aaa^Two-Xaa "box (Cys is cysteine, Aaa is fat
Group units, Xaa is an amino acid).
t al.,Nature 310: 583-586 (1984)). Depending on the specific arrangement this unit
Each C_FifteenOr C₂₀Of cysteine residues in CAAX units by isoprenoids
Farnesyl protein transferase or geranyl, an enzyme that catalyzes alkylation
Functions as a signal sequence for geranyl protein transferase (S. Clarke, Ann.Rev.Biochem. 61: 355-386 (1992); W.R.Schafer and J.Rine,Ann.Rev. Gene tics 30209-237 (1992)). Transferring the isoprenoid moiety to cysteine sulfur in proteins
Such enzymes are commonly referred to as prenyl protein transferases.
it can. Ras protein is known to undergo farnesylation after translation
It is one of several proteins. Other farnesylated proteins include Rho, fungal mating factor
Ras-related GTs, such as γ-subunit of nuclear lamin and transjusin
P-binding protein and the like. James et al.,J. Biol. Chem. 269, 14182
(1994)) identified a farnesylated peroxisome-associated protein Pxf.
Yes. James et al. Furthermore, in addition to the above, unknown structures and features
It also suggests that there is a functional farnesylated protein.

[0003] Inhibition of farnesyl protein transferase has been shown to block the growth of Ras-transformed cells on soft agar and alter other aspects of their transformed phenotype. Furthermore, certain farnesyl protein transferase inhibitors have also been shown to selectively block the processing of Ras oncoprotein in cells (NEKohl et al ., Science , 260 : 1934-1937 (1993)). And GL James et al . , Science , 260 : 1937-1942 (1993)). Recently, farnesyl protein transferase inhibitors block the growth of ras-dependent tumors in nude mice (NEKo
hl et al, Proc Natl Acad Sci USA, 91:...... 9141-9145 (1994)), inducing remission of breast and salivary carcinomas in ras transgenic mice (NEKohl
et al ., Nature Medicine , 1 : 792-797 (1995)).

[0004]in vivoInhibition of farnesyl protein transferase in
Indicated by lovastatin (Merck & Co., Rahway, NJ) and compactin
(Hancocket al.,ibid; Caseyet al.,ibid; Schaferet al.,Science  twenty five : 379 (1989)). These drugs are available from polyisoprene such as farnesyl pyrophosphate.
Inhibits HMG-CoA reductase, a rate limiting enzyme in the production of noids
You. Farnesyl protein transferase utilizes farnesyl pyrophosphate.
The Cys thiol group of the Ras CAAX box is covalently linked to a farnesyl group.
(Reisset al.,Cell,62: 81-88 (1990); Schaberet al.,J.Biol.C hem .,265: 14701-14704 (1990); Schaferet al.,Science,249: 1133-1139 (1990
); Manneet al.,Proc.Natl.Acad.Sci.USA, 87: 7541-7545 (1990)). HMG-
Inhibition of Farnesyl Pyrophosphate Biosynthesis by Inhibition of CoA Reductase
Blocks membrane localization of Ras in cells. However, farnesyl protein tiger
Direct inhibition of transferase occurs at the required doses of common isoprene biosynthesis inhibitors.
Compared to this, it is considered to be more specific and have fewer side effects.

[0005] Farnesyl protein transferase (FPTase) inhibitors are roughly classified into 2
Types have been reported. The first class is analogs of farnesyl diphosphate (FPP), and the second class of inhibitors is related to the protein substrate of the enzyme (eg, Ras). The peptide-derived inhibitors reported so far are cysteines with molecules related to the CAAX unit which is a signal of protein prenylation (Schaber et al. , Ibid ; Reiss et al ., Ibid ; Reiss et al . , PNAS , 88 : 732-736 (1991)).
Such inhibitors may inhibit protein prenylation while acting as an alternative substrate for the farnesyl protein transferase enzyme, or may be purely competitive inhibitors (US Pat. No. 5,141,851; Texas State University; NE Kohl et al.). al. , Science , 260 : 1934-1937 (1993); Graham et al ., J. Med.Chem. , 37 : 725 (1
994)). In general, it has been shown that removing thiols from CAAX derivatives significantly reduces the inhibitory power of the compounds. However, due to the thiol group,
Therapeutic uses of FPTase inhibitors with regard to pharmacokinetics, pharmacodynamics and toxicity can be limited. Therefore, a functional alternative to thiol is desirable.

[0006] It has recently been reported that farnesyl protein transferase inhibitors are inhibitors of vascular smooth muscle cell proliferation and are therefore useful in the prevention and treatment of arteriosclerosis and diabetic vascular disorders (JP H7-112930).

Recently, certain tricyclic compounds, which may have a piperidine moiety, have been identified as FPTa
It is disclosed that it is a se inhibitor (WO 95/10514, WO 95 /
10515 and WO 95/10516). Also disclosed are imidazole-containing farnesyl protein transferase inhibitors (WO 95/09001 and EP 0675112 A1).

Accordingly, it is an object of the present invention to develop peptidomimetic compounds that inhibit prenyl protein transferase and thus post-translational prenylation of the protein. It is another object of the present invention to develop chemotherapeutic compositions containing the compounds of the present invention and methods for making the compounds of the present invention.

(Disclosure of the Invention) The present invention includes a peptide-like piperazine-containing macrocyclic compound that inhibits prenyl protein transferase. The invention further includes chemotherapeutic compositions comprising the prenyl protein transferase inhibitors and methods for their manufacture.

The compound of the present invention is represented by the following formula A.

[0011]

Embedded image

BEST MODE FOR CARRYING OUT THE INVENTION The compound of the present invention comprises prenyl protein transferase and oncogene protein R
Useful in inhibiting prenylation of as. In a first embodiment of the present invention, the prenyl protein transferase inhibitor is a compound represented by Formula A or a pharmaceutically acceptable salt or stereoisomer of the compound.

[0013]

Embedded image Where R^1a, R^1b, R^1cAnd R^1dIs independently a) hydrogen b) aryl, heterocycle, C₃~ C₁₀Cycloalkyl, C₂~ C₆Alkenyl
, C₂~ C₆Alkynyl, halogen, perfluoro C₁~ C₆Alkyl, R¹⁰ O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (
O)-, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-
, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; C) unsubstituted or substituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl
When the above substituent is unsubstituted or substituted aryl, heterocyclic, C₃~ C₁₀Cycloal
Kill, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, halogen, perfluoro
C₁~ C₆Alkyl, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O) NR^{1 0} −, (R¹⁰)₂NC (O)-, CN, (R¹⁰)₂NC (NR¹⁰)-
, R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂And R^{1 1} OC (O) NR¹⁰Selected from those selected from: R^2a, R^2bAnd R^3aIs independently H; unsubstituted or substituted C_1-8Al
Kill, unsubstituted or substituted C_2-8Alkenyl, unsubstituted or substituted C_2-8A
Rukinyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -C (=
O) -NR⁶R⁷Or -C (= O) -OR⁶Selected from the above;
The substituents are: 1) unsubstituted or a) C_1-4Alkyl, b) (CH₂)_pOR⁶C) (CH₂)_pNR⁶R⁷D) halogen, e) aryl or heterocyclic ring substituted with CN, 2) C_3-6Cycloalkyl, 3) OR⁶4) SR⁴, S (O) R⁴, SO₂R⁴, 5) -NR⁶R⁷, 6) -NR⁶-C (= O) -R⁷, 7) -NR⁶-C (= O) -NR⁵R⁷8) -OC (= O) -NR⁶R⁷, 9) -OC (= O) -OR⁶, 10) -C (= O) -NR⁶R⁷, 11) -SO₂-NR⁶R⁷, 12) -NR⁶-SO₂-R⁴, 13) -C (= O) -R⁶, 14) -C (= O) -OR⁶, 15) N₃Or 16) substituted with one or more of F;^2aAnd R^3aAre bonded to the same C atom to be united, and-(CH₂)_u-
Formed; one of the carbon atoms is O, S (O)_m, -NC (O)-and
-N (COR¹⁰R) may be replaced by a moiety selected from:^2aAnd R^3aMay be bound to the same carbon atom; R⁴Is unsubstituted or a) C_1-4Alkoxy, b) aryl or heterocycle, c) halogen, d) HO, e) -C (= O) -R¹¹, F) -SO₂R¹¹Or g) N (R¹⁰)₂  C substituted with_1-4Alkyl, C_3-6Cycloalkyl, heterocycle, aryl
R; R⁵, R⁶And R⁷Is independently H or unsubstituted a) C_1-4Alkoxy, b) aryl or heterocycle, c) halogen, d) HO, e) -C (= O) -R¹⁰, F) -SO₂R¹¹Or g) N (R¹⁰)₂  C substituted with_1-4Alkyl, C_3-6Cycloalkyl, heterocycle, aryl,
Aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl
Selected from; R⁶And R⁷May together form a ring; and independently, R⁵And R⁷May together form a ring; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C₃~ C₁₀ Cycloalkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, perfluoro
Alkyl, F, Cl, Br, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O)
NR¹⁰−, (R¹⁰)₂NC (O)-, R¹⁰ ₂NC (NR¹⁰)-, CN
, NO₂, R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂Ma
Or R¹¹OC (O) NR¹⁰-; And c) unsubstituted or unsubstituted or substituted aryl, unsubstituted or
Substituted heterocycle, C₃~ C₁₀Cycloalkyl, C₂~ C₆Alkenyl, C₂~ C₆ Alkynyl, perfluoroalkyl, F, Cl, Br, R¹⁰O-, R¹¹S (
O)_m-, R¹⁰C (O) NH-, (R¹⁰)₂NC (O)-, R¹⁰ ₂N-C
(NR¹⁰)-, CN, R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (
R¹⁰)₂Or R¹⁰C substituted by OC (O) NH—₁~ C₆Archi
R; R⁹Is a) hydrogen; b) C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, perfluoroalkyl,
F, Cl, Br, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−
, (R¹⁰)₂NC (O)-, R¹⁰ ₂NC (NR¹⁰)-, CN, NO₂,
R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂Or R¹¹ OC (O) NR¹⁰And c) unsubstituted or perfluoroalkyl, F, Cl, Br, R¹⁰ O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (O
)-, R¹⁰ ₂NC (NR¹⁰)-, CN, R¹⁰C (O)-, R¹⁰OC (
O)-, N₃, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰By-
Transformed C₁~ C₆Selected from alkyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl, unsubstituted or substituted
Selected from aryl and unsubstituted or substituted heterocycles; R¹¹Is independently C₁~ C₆Alkyl, unsubstituted or substituted aryl and unsubstituted
Selected from substituted or substituted heterocycles; A¹Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-And S (O)_mSelected from; A²Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-, S (O)_mAnd -C (R^1d)₂-Selected from; G¹, G²And G³Is independently H₂W is a heterocycle; V is selected from a) a heterocycle and b) aryl; X and Y are independently a bond, -C (= O)-or -S (= O )_mSelect from-
Done; Z¹Is selected from unsubstituted or substituted aryl and unsubstituted or substituted heterocycle.
Selected from the group consisting of one or more 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;²Is a bond, unsubstituted or substituted aryl and unsubstituted or substituted heterocycle
Wherein the substituted aryl or substituted heterocycle is selected from one or more of 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. Or 2) unsubstituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl, unsubstituted C₃~ C₆ Cycloalkyl or substituted C₃~ C₆Cycloalkyl (substituted C₁~ C₆Al
Kill and Replace C₃~ C₆Cycloalkyl has one or two a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) -NR⁶C (O) R⁷, E) HO, f) -S (O)_mR⁴G) halogen or h) perfluoroalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; q is 1 or 2 R is 0-5; s is independently 0, 1, 2 or 3; u is 4 or 5;

In a second embodiment of the present invention, the compound is a compound represented by Formula A or a pharmaceutically acceptable salt or stereoisomer of the compound.

[0015]

Embedded image Where R^1aAnd R^1dIs independently hydrogen and C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or substituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl
The above substituent is unsubstituted or substituted aryl, heterocyclic, cycloalkyl,
Nil, R¹⁰O- and -N (R¹⁰)₂R is selected from; R^2bAnd R^3aIs independently H and CH₃Selected from; R^2aIs independently H; -C (= O) -NR⁶R⁷Or unbranched or branched
1) aryl, 2) heterocyclic, 3) OR⁶4) SR⁴, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;^2aAnd R^3aMay be bound to the same carbon atom; R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Is independently H; unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl, C_3-6Cycloalkyl, aryl and compound
Selected from elementary rings; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C₁~ C₆A
Luquil, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C₁~ C₆Perfluo
Loalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR¹⁰-, CN, NO₂ , (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, -N (R¹⁰)₂Ma
Or R¹¹OC (O) NR¹⁰And c) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C₁~ C₆Pa
-Fluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂N
−C (NR¹⁰)-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (
O) NR¹⁰C replaced by-₁~ C₆Selected from alkyl; R⁹Is a) hydrogen; b) C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C₁~ C₆Perfluoro
Alkyl, F, Cl, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
−N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-; And c) unsubstituted or C₁~ C₆Perfluoroalkyl, F, Cl, R ¹⁰ O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−, CN, (R¹⁰) ₂ NC (NR¹⁰)-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹O
C (O) NR¹⁰C replaced by-₁~ C₆Selected from alkyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl, unsubstituted or substituted
Selected from aryl and unsubstituted or substituted heterocycles; R¹¹Is independently C₁~ C₆Alkyl, unsubstituted or substituted aryl and unsubstituted
Selected from substituted or substituted heterocycles; A¹Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-And S (O)_mSelected from; A²Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-, S (O)_mAnd -C (R^1d)₂-Selected from; G¹, G²And G³Is independently H₂V is selected from: a) pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2
Oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl and thienyl
W is selected from the group consisting of pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, oxazolyl
, Pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl or iso
A heterocyclic ring selected from quinolinyl; X is a bond or —C (＝ O) —; Y is a bond or —C (＝ O) —; Z¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
The substituted aryl or substituted heterocycle is independently selected from one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;²Is a bond, unsubstituted or substituted aryl and unsubstituted or substituted heterocycle
Wherein the substituted aryl or substituted heterocycle is independently one or two
1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. Or 2) unsubstituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl, unsubstituted C₃~ C₆ Cycloalkyl or substituted C₃~ C₆Cycloalkyl (substituted C₁~ C₆Al
Kill and Replace C₃~ C₆Cycloalkyl has one or two a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) -NR⁶C (O) R⁷, E) HO, f) -S (O)_mR⁴G) halogen or h) perfluoroalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; q is 1 or 2 R is 0-5; s is independently 0, 1, 2 or 3; u is 4 or 5;

In a third embodiment of the present invention, the compound is a compound represented by Formula B or a pharmaceutically acceptable salt or stereoisomer of the compound.

[0017]

Embedded image Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;^2aAnd R^3aAny two of which are bonded to the same carbon atom
Well; R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O;¹, G²And G³Is independently H₂V is selected from: a) pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2
Oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl and thienyl
X is a bond or —C (＝ O) —; Y is a bond or —C (＝ O) —; Z¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
The substituted aryl or substituted heterocycle is independently selected from one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. Or 2) unsubstituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl, unsubstituted C₃~ C₆ Cycloalkyl or substituted C₃~ C₆Cycloalkyl (substituted C₁~ C₆Al
Kill and Replace C₃~ C₆Cycloalkyl has one or two a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) -NR⁶C (O) R⁷, E) HO, f) -S (O)_mR⁴G) halogen or h) perfluoroalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3;

A preferred embodiment of the compound of the present invention is a compound represented by the following formula C or a pharmaceutically acceptable salt or stereoisomer of the compound.

[0019]

Embedded image Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;^2aAnd R^3aAny two of which are bonded to the same carbon atom
Well; R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O;¹And G³Is independently H₂And O; with the proviso that G¹And G³ At least one and only one is O; X is a bond or -C (= O)-; Y is a bond or -C (= O)-; Z¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
Selected from the group consisting of one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3;

Another preferred embodiment of the compound of the present invention is a compound represented by Formula D below, or a pharmaceutically acceptable salt or stereoisomer of the compound:

[0021]

Embedded image Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;²And R³Any two of which may be bonded to the same carbon atom
R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O; X is a bond; Y is a bond;¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
Selected from the group consisting of one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3;

Another preferred embodiment of the compounds of the present invention is a compound represented by Formula E: or a pharmaceutically acceptable salt or stereoisomer of the compound.

[0023]

Embedded image Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;²And R³Any two of which may be bonded to the same carbon atom
R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O; X is a bond; Y is a bond;¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
Selected from the group consisting of one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3;

Specific examples of the compound of the present invention include (±) 18- (3-chlorophenyl) -16,16a, 17,18,19,2
0-Hexahydro-17-oxo-5H-6,10-metheno-22H-benzo [
b] Pyrazino [2,1-e] imidazo [4,3-h] [1,6,9] oxadiazacyclopentadecyne-9-carbonitrile:

[0025]

Embedded image (±) 16,16a, 17,18,19,20-Hexahydro-17-oxo-18-phenyl-5H-6,10-metheno-22H-benzo [b] pyrazino [
2,1-e] imidazo [4,3-h] [1,6,9] oxadiazacyclopentadecyne-9-carbonitrile:

[0026]

Embedded image Or their pharmaceutically acceptable salts or stereoisomers.

The compounds of the present invention have asymmetric centers and may be obtained as racemates, racemic mixtures, or as individual enantiomers, together with all possible isomers (such as optical isomers). Are included in the present invention. When any variable (eg, aryl, heterocycle, R ¹ , R ^2, etc.) occurs more than one time in any constituent, its definition for each occurrence is independent of any others. .
Moreover, combinations of substituents and / or variables are permissible only if such combinations result in stable compounds.

As used herein, “alkyl” is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the specified number of carbon atoms, and “alkoxy” is defined as an oxygen bridge Represents an alkyl group having the specified number of carbon atoms bonded through. "Halogen" or "halo" as used herein refers to fluorine, chlorine, bromine and iodine.

As used herein, “aryl” is intended to mean a stable monocyclic or bicyclic carbocyclic ring of up to 7 members in each ring where at least one ring is an aromatic ring. .
Examples of such aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl, biphenyl, phenanthryl, anthryl or acenaphthyl and the like.

The term heterocycle, as used herein, is a stable 5-7 membered monocyclic heterocycle or a stable 8-11 membered bicyclic heterocycle, saturated or unsaturated, A bicyclic ring comprising a carbon atom and from 1 to 4 heteroatoms selected from the group consisting of N, O and S, wherein any of the heterocycles defined above is fused to a benzene ring It contains a group of the formula The heterocycle can be attached at any heteroatom or carbon atom to yield a stable structure. The term heterocycle as used herein includes heteroaryl moieties. Examples of such heterocyclic elements include azepinyl, benzimidazolyl, benzoisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzooxazolyl, chromanyl, sinolinyl, dihydro Benzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, isothiazolidinyl , Morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 2-oxopiperazinyl, 2-oxopiperidinyl , 2-
Oxopyrrolidinyl, piperidyl, piperazinyl, pyridyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thimorpholinylthia Thiazolyl, thiazolinyl, thienofuryl, thienothienyl and thienyl, but are not limited thereto.

As used herein, “heteroaryl” is selected from the group consisting of N, O, and S in which at least one ring is an aromatic ring and 1-4 carbon atoms are N, O, and S. It is intended to mean a stable monocyclic or bicyclic carbocyclic ring of up to 7 members in each ring replaced by a heteroatom. Examples of such heteroaryl elements include benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, chromanyl, sinolinyl, dihydrobenzofuryl , Dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl,
Oxdiazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl, thienothienyl and the like, but are not limited thereto. Absent.

As used in the definition of R ² and R ³ , the term “substituted group” refers to a substituted C _1-8 alkyl, substituted C _2-8 alkenyl, wherein the substituents R ² and R ³ are selected. A substituted C _2-8 alkynyl, substituted aryl or substituted heterocycle shall be meant.

As used herein in the definition of R ⁶ , R ⁷ and R ^7a , substituted C _1-8 alkyl, substituted C _3-6 alkenyl, substituted aroyl, substituted aryl, substituted heteroaroyl, substituted arylsulfonyl, Substituted heteroarylsulfonyl and substituted heterocycle include moieties having one to three substituents, in addition to the point of attachment to the rest of the compound.

When R ² and R ³ together form — (CH ₂ ) _u —, a cyclic portion is formed. In such an annular part,

[0035]

Embedded image And the like, but are not limited to these.

Further, such a cyclic moiety may have a hetero atom. Examples of such a heteroatom-containing cyclic moiety include:

[0037]

Embedded image And the like, but are not limited to these.

The lines drawn into the ring systems from substituents (from R ² , R ³ , R ^4, etc.) indicate that the indicated bond may be attached to any of the substitutable ring carbon atoms. Is shown.

Preferably, R ^1a and R ^1b are independently hydrogen, —N (R ¹⁰ ) ₂ , R ¹⁰ C
(O) ^{NR 10} - or is selected from unsubstituted or substituted _C 1 -C ₆ alkyl,
In that case, the substituent on the substituted C ₁ -C ₆ alkyl is unsubstituted or substituted phenyl,
_{^{-N (R 10) 2, R}} 10 O- and ^{R 10 C (O) NR 10} - is selected from.

Preferably, R ^1c is independently selected from hydrogen or unsubstituted or substituted C ₁ -C ₆ alkyl, wherein the substituents on the substituted C ₁ -C ₆ alkyl are unsubstituted or substituted phenyl, —N _{^{(R 10) 2, R 10}} O- and ^{R 10 C (O) NR 10} - is selected from.

Preferably, R ^2a is H, —C (＝ O) —NR ⁶ R ⁷ , —C (＝ O) —OR ⁶ and C _1-8 alkyl, C _2-8 alkenyl and C _2-8 alkynyl is selected from unsubstituted or substituted groups selected from; the substituted group is, 1) unsubstituted in either _{a) C 1-4 ^{alkyl, b) (CH 2) p}} oR 6, c) ( _{^{CH 2) p NR 6 R 7}} , d) aryl or heterocyclic substituted by halogen, _{2) C 3-6} ^{cycloalkyl, 3) oR 6, 4)} SR 6a, S (O) R 6a, SO 2 R ^6a , 5) —NR ⁶ R ⁷ , 6) —NR ⁶ —C (＝ O) —R ⁷ , 7) —NR ⁶ —C (＝ O) —NR ⁷ R ^7a , 8) —OC (= ^{O) -NR 6 R 7, 9} ) -O-C (= O) -OR 6, 10) -C (= O _{^{-NR 6 R 7, 11) -SO}} 2 -NR 6 R 7, 12) -NR 6 -SO 2 -R 6a, 13) -C (= O) -R 6, 14) -C (= O) - OR ⁶ , 15) N ₃ or 16) F.

Preferably, R ^2b , R ^3a and R ^3b are independently selected from hydrogen and C ₁ -C ₆ alkyl.

Preferably, R ⁴ and R ⁵ are hydrogen.

Preferably, R ⁶ , R ⁷ and R ^7a are selected from hydrogen, unsubstituted or substituted C ₁ -C ₆ alkyl, unsubstituted or substituted aryl and unsubstituted or substituted cycloalkyl.

Preferably, R ^6a is unsubstituted or substituted C ₁ -C ₆ alkyl, unsubstituted or substituted aryl and unsubstituted or substituted cycloalkyl.

Preferably, R ⁹ is hydrogen or methyl. Most preferably, R ⁹ is hydrogen.

Preferably, R ¹⁰ is selected from H, C ₁ -C ₆ alkyl and benzyl.

[0048] Preferably independently ^{A 1} and ^{A 2, bond, -C (O) NR 10 -} , - NR 1 0 C (O) -, O, -N (R 10) -, - S (O) ₂ N (R ¹⁰ )-and -N
(R ¹⁰ ) S (O) ₂ —.

Preferably one of G ¹ and G ² is O and the other is H ₂ . Preferably G ³ is H ₂ .

Preferably V is selected from heteroaryl and aryl. More preferably, V is phenyl.

Preferably, X and Y are independently selected from a bond and —C (＝ O) —.
More preferably, X and Y are a bond.

Preferably, Z ¹ and Z ² are independently selected from unsubstituted or substituted phenyl, unsubstituted or substituted naphthyl, unsubstituted or substituted pyridyl, unsubstituted or substituted furanyl and unsubstituted or substituted thienyl. More preferably, Z ¹ is
It is selected from unsubstituted or substituted phenyl and unsubstituted or substituted naphthyl. More preferably Z ² is selected from a bond and unsubstituted or substituted phenyl.

Preferably W is selected from imidazolinyl, imidazolyl, oxazolyl, pyrazolyl, pyrrolidinyl, thiazolyl and pyridyl. More preferably, W is selected from imidazolyl and pyridyl.

Preferably, n is 0, 1 or 2.

Preferably, r is 1 or 2.

Preferably p is 1, 2 or 3.

Preferably, s is 0 or 1.

[0058] Preferably part

[0059]

Embedded image Is

[0060]

Embedded image Wherein R ^9a and R ^9b are independently selected from R ⁹ .

A substituent or variable at a specific position in a molecule (eg, R^1a, R⁹, N, etc.)
Is independent of its definition elsewhere in the molecule. Therefore, N (R¹⁰) ₂ Is -NHH, -NHCH₃, -NHC₂H₅And so on. If you are skilled in the art,
Chemically stable by choosing substituents and substitution patterns on compounds of the invention
A method known in the art or a method described below from readily available raw materials
It is clear that compounds can be provided which can be synthesized by

The pharmaceutically acceptable salts of the compounds of the present invention include the conventional non-toxic salts of the compounds of the present invention, for example, formed from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid; acetic acid, propionic acid, succinic acid, glycolic acid, stearin Acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid And salts prepared from organic acids such as methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isethionic acid and trifluoroacetic acid.

[0063] Pharmaceutically acceptable salts of the compounds of the present invention can be synthesized from compounds of the present invention that have a basic moiety by conventional chemical methods. Generally, these salts are prepared by ion exchange chromatography or by reacting the free base with a stoichiometric or excess amount of an inorganic or organic acid that forms the desired salt in a suitable solvent or various solvent mixtures. Manufactured.

The reactants used to obtain the compounds of the invention are known in the literature or
In addition to other standard procedures such as ester hydrolysis, cleavage of protecting groups, and the like,
It is obtained using the reactions shown in Schemes 1-16. Substituents R, R shown in the scheme^a, R ^b And R^subIs a substituent R², R³, R⁴And R⁵And Z¹And Z ² Represents the above substituent. However, their point of attachment to the ring is shown as an example.
Is not limited thereto.

These reactions can be performed sequentially to give a compound of the present invention, or the reactions can be used to synthesize fragments and subsequently linked by an alkylation reaction as shown in the scheme. .

[0066]Description of Schemes 1-16  The required intermediates are optionally commercially available or can be obtained by procedures described in the literature.
Therefore, it can be manufactured. For example, in Scheme 1, the suitably substituted piperazine
Of Macrocycles of the Invention Containing Classes and Preferred Benzimidazolyl Moieties
Is shown. The preparation of the substituted piperazine intermediate was substantially described in the report by Keely et al.
(J. S. Kiely and S. R. Priebe, Organic Preparations a
nd Proceedings Int., 1990, 22, 761-768). Commercially available procedures known to those skilled in the art
Boc-protected amino acids, such as I, available from
DCC (dicyclohexane) in a solvent such as
Rohexylcarbodiimide) or EDC.HCl (1-ethyl-3- (3-di
Using various dehydrating agents such as methylaminopropyl) carbodiimide hydrochloride),
It can be coupled to arylmethyl acetal amines. next,
The product II is deprotected and hydrogen chloride in chloroform or ethyl acetate or
Cyclized with an acid such as trifluoroacetic acid in methylene chloride to give 5,6-unsaturated
Obtain piperazinone III. Pi by catalytic hydrogenation of III on palladium carbon
Perazinone IV is obtained, which is then substituted in the presence of a strong base with a suitably substituted benzyl
Reaction with xybenzyl bromide can provide intermediate VI. next,
Reduction of the ring carbonyl of intermediate VI with lithium aluminum hydride and benzyl protection
The protecting group can be removed with a catalyst to give intermediate VII. Activates piperidine nitrogen
To give naphthylamide VIII, which is then reacted under acidic conditions
To afford intermediate IX. The piperidine nitrogen is then placed appropriately.
Alkylation with the substituted fluorobenzyl-imidazolyl aldehyde X
Thus, XI can be obtained. Cesium carbonate nucleophilic aromatic substitution
Intramolecular cyclization gives compound XII of the present invention. The cyclization reaction and carbonic acid
The other cyclization reactions described below mediated by calcium are ortho or to the fluorine atom.
Determined by the presence of the electron-withdrawing portion of para (nitro, cyano, etc.).

Scheme 2 illustrates the synthesis of the macrocyclic compounds of the invention having piperazinone in the ring. The protected piperazinone XIII is alkylated with naphthylmethyl bromide having a suitably arranged benzyloxy moiety. Removal of the Boc protecting group gives intermediate XIV, which can be coupled to a suitably substituted 1-benzylimidazole aldehyde XV to give intermediate XVI. Removal of the benzyl protecting group followed by intramolecular cyclization as described above using cesium carbonate conditions provides compounds XVII of the present invention.

In Scheme 3, there is a piperazinone moiety in the macrocycle, and the macrocycle is the piperazinone 4
3 illustrates the preparation of a compound of the invention incorporated at the 5- and 5-positions. The N-protected m-tyrosine XVIII is converted to the corresponding aldehyde XIX. The aldehyde XIX is reacted with a suitably substituted amine to give intermediate XX, which is then treated with bromoacetyl bromide to give, after base-mediated cyclization, piperazinone XXI
Get. Removal of the Boc protecting group followed by reductive N-alkylation of intermediate XXII with a suitably substituted 1-benzylimidazole aldehyde XV affords intermediate XXIII and after removal of the benzyl protecting group It can be intramolecularly cyclized under cesium carbonate conditions to give compound XXIV of the present invention.

The synthesis of a compound of Formula A featuring “X” as the carbonyl moiety is shown in Scheme 4. Reaction of a suitably substituted 3-fluorobenzylimidazol-4-ylacetic acid XXV prepared from imidazol-4-ylacetic acid with piperazinone XXVI gives intermediate XXVII. Deprotection followed by intramolecular cyclization gives compound XXVIII of the present invention.

[0070] Scheme 5 illustrates the incorporation of the indole moiety into the macrocycle. The synthesis starts from the commercially available 5-hydroxytyrosine XXIX, which is converted to the corresponding suitably protected aldehyde XXX. Then the above aldehyde 3
Is performed to obtain the compound XXXI of the present invention.

The expansion of the macrocycle by incorporation of a phenoxy moiety is shown in Scheme 6.

Scheme 7 shows the synthetic strategy used when the R ⁸ substituent is not an ortho or para electron withdrawing moiety to the fluorine atom. In the absence of an electron-withdrawing moiety, intramolecular cyclization is performed by the Woolman reaction. Treatment of the protected imidazolylmethyl acetate with a suitably substituted halobenzyl bromide gives the 1-benzylimidazolyl intermediate XXXII. The acetate function of intermediate XXXII was converted to an aldehyde and then reductively coupled to compound XXXIII obtained by hydrogenation of intermediate XXVI (R ^a = H) shown in Scheme 4. Coupling under standard Woolman conditions provided compound XXXIV of the present invention.

Scheme 8 illustrates the incorporation of sulfur-containing side chains into the piperazinone ring component of the macrocycles of the present invention.

An example of the preparation of a compound of the invention incorporating a 2,5-diketopiperazine moiety is shown in Scheme 9
It is shown in The intermediate XXXVI shown in Scheme 9 can also be used to synthesize many other macrocyclic compounds incorporating other heterocyclic "W" moieties as shown in Scheme 10.

Scheme 11 illustrates the preparation of a macrocycle of the invention incorporating a 2,3-diketopiperazine moiety.

An amino acid of general formula XXXVII having a side chain not found in natural amino acids is
It can be produced by using the easily produced imine XLVI as a raw material by the reaction shown in Scheme 12.

Schemes 13-16 illustrate the synthesis of suitably substituted aldehydes useful in the synthesis of compounds of the present invention where the variable W is present as a pyridyl moiety. Similar synthetic strategies for the production of alkanols incorporating other heterocyclic moieties for the variable W are known in the art.

[0078]

Embedded image

[0079]

Embedded image

[0080]

Embedded image

[0081]

Embedded image

[0082]

Embedded image

[0083]

Embedded image

[0084]

Embedded image

[0085]

Embedded image

[0086]

Embedded image

[0087]

Embedded image

[0088]

Embedded image

[0089]

Embedded image

[0090]

Embedded image

[0091]

Embedded image

[0092]

Embedded image

[0093]

Embedded image

In a preferred embodiment of the invention, the compounds according to the invention are selective inhibitors of farnesyl protein transferase. For example, the in vitro farnesyl protein transferase inhibitory activity of the compound evaluated in the assay described in Example 3 is:
If the in vitro activity of the same compound on geranylgeranyl protein transferase type I in the assay described in Example 4 is more than 100 times higher, the compound is:
It is thought to be a selective inhibitor of farnesyl protein transferase. Preferably, the selective compound exhibits 1000 times or more the activity of one enzyme when comparing geranylgeranyl protein transferase type I inhibition with farnesyl protein transferase inhibition.

A selective inhibitor of farnesyl protein transferase further comprises: b) an IC ₅₀ for inhibition of prenylation of newly synthesized K-Ras protein (
Evaluation criteria for in vitro inhibitory activity) are
It is also preferred which is characterized in that approximately 100 times that of C _50.

In measuring such IC ₅₀ and EC ₅₀ , the assays described in Examples 8 and 9 can be used.

The selective inhibitors of farnesyl protein transferase further include: c) an IC ₅₀ for inhibiting K4B-Ras dependent activation of MAP kinases in cells (a measure of in vitro inhibitory activity), It is also preferable that the present invention is characterized by being at least 100 times the IC ₅₀ relating to hDJ farnesylation inhibition.

A selective inhibitor of farnesyl protein transferase further comprises: d) an IC ₅₀ for H-Ras dependent activation of MAP kinases in cells (
Evaluation criteria for in vitro inhibitory activity) were determined by the H-ras-C of MAP kinases in cells.
It is also preferred that the inhibitory activity (IC ₅₀ ) on VLL (SEQ ID NO: 1) dependent activation is at least 1000 times lower.

When measuring Ras-dependent activation of MAP kinases in cells, the assay described in Example 7 can be used.

In another preferred embodiment of the invention, the compounds of the invention are dual inhibitors of farnesyl protein transferase and geranylgeranyl protein transferase type I. Such dual inhibitors are termed class II prenyl protein transferase inhibitors and exhibit certain properties when evaluated in in vitro assays, which depend on the type of assay used.

In a SEAP assay as described in Example 7, the dual inhibitor compound has an in vitro inhibitory activity (IC _{50) of} less than about 12 μM against K4B-Ras dependent activation of MAP kinases in cells. ) Is preferable.

Class II prenyl protein transferase inhibitors include: a) an IC ₅₀ for inhibiting K4B-Ras-dependent activation of MAP kinases in cells (a measure of in vitro inhibitory activity), a 0.1 to 100 times the _{IC 50} for farnesylation inhibitors; Moreover, b) criteria _{an IC 50} (in vitro inhibitory activity for inhibition of K4b-Ras dependent activation of MAP kinases in cells), It can also be characterized by an inhibitory activity (IC ₅₀ ) on SEAP protein expression in cells transfected with the pCMV-SEAP plasmid that constitutively expresses SEAP protein, which is slightly more than 5-fold.

Class II prenyl protein transferase inhibitors further comprise: a) an IC ₅₀ for H-Ras-dependent activation of MAP kinases in cells (
Evaluation criteria for in vitro inhibitory activity) were determined by the H-ras-C of MAP kinases in cells.
Inhibitory activity (IC ₅₀ ) on VLL (SEQ ID NO: 1) -dependent activation is slightly more than 2 times and less than 20,000-fold lower. B) IC ₅₀ on H-ras-CVLL-dependent activation of MAP kinases in cells (in (in vitro inhibitory activity evaluation criteria) is also characterized by being more than 5-fold lower than the inhibitory activity (IC ₅₀ ) on SEAP protein expression in cells transfected with the pCMV-SEAP plasmid constitutively expressing SEAP protein. it can.

Class II prenyl protein transferase inhibitors further include: a) an IC ₅₀ for H-Ras dependent activation of MAP kinases in cells (
Evaluation criteria for in vitro inhibitory activity) were determined by the H-ras-C of MAP kinases in cells.
10-fold and less than 2500-fold less inhibitory activity (IC ₅₀ ) on VLL (SEQ ID NO: 1) dependent activation; b) IC ₅₀ on H-ras-CVLL dependent activation of MAP kinases in cells (in (in vitro inhibitory activity evaluation criteria) is also characterized by a 5-fold lower inhibitory activity (IC ₅₀ ) on SEAP protein expression in cells transfected with the pCMV-SEAP plasmid constitutively expressing SEAP protein. it can.

A method for measuring the activation of a prenyl protein transferase inhibitor and the combination composition of the present invention utilized in the method of the present invention for Ras-dependent activation of MAP kinases in cells are described in Example 7. Have been.

The compounds of the present invention are useful as medicines for mammals, especially humans. These compounds can be administered to a patient and used to treat cancer. Examples of the types of cancer that can be treated by the compounds of the present invention include, but are not limited to, colorectal cancer, exocrine pancreatic cancer, myeloid leukemia, and neuronal tumors. Such tumors are mutated in the ras gene itself, a protein that can regulate Ras activity (ie, neurofibromin (NF-1)).
, Neu, scr, abl, lck, fyn), or by other mechanisms.

The compounds of the present invention may comprise prenyl protein transferase and oncogene protein R
Inhibits prenylation of as. Compounds of the invention may also affect tumor growth by inhibiting tumor angiogenesis (J. Rak et al., Cancer Research, 55: 4575-4580 (1995)). Such anti-angiogenic properties of the compounds of the present invention may also be useful in treating some forms of visual loss associated with retinal neovascularization.

The compounds of the present invention may further comprise RＲ as a result of oncogenic mutations in other genes.
as protein is abnormally activated (ie, the Ras gene itself is not activated by mutation to an oncogenic form), and is also useful in inhibiting other proliferative diseases, both benign and malignant; Such inhibition is effected by administering to a mammal in need of such treatment an effective amount of a compound of the present invention. For example,
One type of NF-1 is a benign proliferative disorder.

The compounds of the present invention, certain viral infections, in particular may also be useful in the treatment of hepatitis delta virus and related viral infections (JSGlenn et al, Scie nce, 256:. 1331-1333 (1992) ).

The compounds of the present invention are also useful in preventing restenosis following percutaneous transluminal coronary angioplasty by inhibiting new intimal formation (C. Indolfi et al. .
, Nature medicine , 1: 541-545 (1995)).

The compounds of the present invention may also be useful in treating and preventing polycystic kidney disease (DL Schaffner et al., American Journal of Pathology, 1
42: 1051-1060 (1993) and B. Cowley, Jr. et al., FASEB Journal, 2: A3160 (198
8)).

The compounds of the present invention may also be useful for treating fungal infections.

The compounds of the present invention are further useful as inhibitors of vascular smooth muscle proliferation, and thus may be useful in the prevention and treatment of arteriosclerosis and diabetic vascular disease.

The compounds of the present invention can be administered to a mammal, preferably a human, alone or preferably in combination with a pharmaceutically acceptable carrier, excipient or diluent, according to standard pharmaceutical practice. It can be administered in a composition. The compounds of the present invention can be administered orally or parenterally, such as intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical.

Pharmaceutical compositions containing the active ingredient are, for example, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules or syrups or elixirs Such a dosage form suitable for oral use can be obtained. Compositions for oral administration can be prepared according to any method known in the art for the manufacture of pharmaceutical compositions, which include sweetening, flavoring, coloring and preserving agents. One or more agents selected from the group can be included to provide a pharmaceutically pleasing and savory formulation. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents such as microcrystalline cellulose, croscarmellose sodium, corn starch or alginic acid; Binders such as starch, gelatin, polyvinylpyrrolidone or acacia; lubricants such as magnesium stearate, stearic acid or talc, and the like. The tablets may be uncoated or they may be coated by known methods to mask the unpleasant taste of the drug or to delay disintegration and absorption in the gastrointestinal tract, thereby resulting in a relatively long lasting dose. To provide an objective effect. For example, a water-soluble taste-masking material such as hydroxypropylmethylcellulose or hydroxypropylcellulose, or a time-delay material such as ethyl cellulose or cellulose acetate butyrate can be used.

The preparation for oral administration may be a hard gelatin capsule in which the active ingredient is mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, or the active ingredient may be a water-soluble carrier such as polyethylene glycol or And soft gelatin capsules mixed with an oil medium such as liquid paraffin or olive oil.

Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients include suspending agents such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia.
Dispersants or wetting agents include natural phosphatides such as lecithin, or condensation products of alkylene oxides such as polyoxyethylene stearate with fatty acids, or ethylene oxide such as heptadecaethyleneoxycetanol and long-chain aliphatic alcohols. Or a condensation product of ethylene oxide such as polyoxyethylene sorbitol monooleate with a partial ester derived from a fatty acid and hexitol, or an ethylene oxide such as polyethylene sorbitan monooleate with a fatty acid and hexitol anhydride. There can be condensation products with partial esters derived from the product. In aqueous suspensions, for example, p-
One or more preservatives, such as the ethyl or n-propyl ester of hydroxybenzoic acid, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame, may also be included.

Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to give a palatable oral preparation. These compositions can be preserved by the addition of an anti-oxidant such as butylated hydroxyanisole or α-tocopherol.

In dispersible powders and granules suitable for preparing an aqueous suspension by adding water, the active ingredient is mixed with a dispersing or wetting agent, suspending agent and one or more preservatives. I do. Examples of suitable dispersing or wetting agents and suspending agents include those mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.

The pharmaceutical compositions of the invention may also be in the form of oil-in-water emulsions. The oil phase may be a vegetable oil such as olive oil or peanut oil or a mineral oil such as liquid paraffin,
Alternatively, it can be a mixture thereof. Suitable emulsifiers include, for example, natural phosphatides such as soy lecithin; and esters or partial esters derived from fatty acids such as sorbitan monooleate and hexitol anhydride, and ethylene oxide such as polyoxyethylene sorbitan monooleate. There may be condensation products with said partial esters. Emulsions may also contain sweeteners,
Flavoring, preservative and antioxidant agents can also be included.

Syrups and elixirs include, for example, glycerin, propylene glycol,
The preparation can be formulated with a sweetening agent such as sorbitol or sucrose. Such formulations may also contain demulcents, preservatives, flavoring and coloring agents and antioxidants.

The pharmaceutical compositions may be in the form of a sterile injectable aqueous solution. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.

The sterile injectable preparation may also be a sterile injectable oil-in-water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient can first be dissolved in a mixture of soybean oil and lecithin. The oil solution is then placed in a mixture of water and glycerin and processed to form a fine emulsion.

Injectable solutions or microemulsions can be introduced into a patient's blood stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a manner as to maintain a constant circulating concentration of the compound of the invention. In order to maintain such a constant concentration, a continuous intravenous device may be utilized. An example of such a device is the Deltec CADD-PLUS® 54
There is a type 00 venous pump.

The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension for intramuscular and subcutaneous administration. The suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butanediol. . In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. In that regard, any type of fixed oil may be employed, such as synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.

The compounds of formula A can also be administered in the form of suppositories for rectal administration of the drug. Such compositions are formulated by mixing the drug with a suitable nonirritating excipient that melts in the rectum and releases the drug, since it is solid at room temperature but liquid at rectal temperature. be able to. Such materials include cocoa butter, glycerinated gelatin, hardened vegetable oils, and mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.

For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed (for this mode of administration, topical administration includes mouthwashes and gargles).

The compounds of the present invention may be administered in a nasal formulation via topical use of suitable nasal vehicles and administration devices, or may be administered in the form of a transdermal plaster known to those skilled in the art. It can be administered via the transdermal route. Of course, when administered in the form of a transdermal route, the dosage administration will be continuous rather than intermittent throughout the dosage regimen.

As used herein, the term “composition” includes those that contain a given component in a given amount, as well as those obtained directly or indirectly by the combination of the given component in a given amount. Is what you do.

When administering a compound according to the present invention to a human patient, the daily dose will usually be determined by the prescribing physician, and the dose will usually be determined by the age, weight, sex and response of the individual patient and the patient's It depends on the severity of the condition.

In one administration example, a suitable amount of a compound is administered to a mammal to be treated for cancer. Administration is in an amount of about 0.1 mg / kg to about 60 mg / kg per day, preferably 0.5 mg / kg to about 40 mg / kg per day.

The compounds of the present invention may also be administered in combination with other known therapeutic agents selected for being particularly useful for the condition being treated. For example, the compounds of the present invention can be administered in combination with other known cancer therapeutics selected for being particularly useful for the condition being treated. An example of such a therapeutic combination is a combination of a prenyl protein transferase inhibitor of the present invention with an anti-neoplastic agent. It is also clear that the combination of such an antineoplastic agent with a prenyl protein transferase inhibitor can be used in combination with other cancer and / or tumor treatment methods such as radiation therapy and surgery.

Examples of anti-neoplastic agents include microtubule stabilizers (eg, paclitaxel (paclit)
axel; also referred to as Taxol®), docetaxel (docetaxel;
Taxotere (registered trademark)), epothilone
A, epothilone B, desoxyepothilone A, desoxyepothilone B or derivatives thereof); microtubule disrupting agents; alkylating agents, antimetabolites; epidophyllotoxin; anti-neoplastic enzymes; topoisomerase inhibitors; Procarbazine; mitoxantrone; platinum coordination complex; physiological response regulator and growth inhibitor;
Hormonal / antihormonal therapeutics and hematopoietic growth factors.

Examples of the type of antineoplastic drug include anthracycline drugs, vinca drugs, mitomycins, bleomycins, cytotoxic nucleosides, taxanes, epothilones, discodermolide, and prellidin drugs , Diynenes and podophyllotoxins. Particularly useful among these types are, for example, doxorubicin, carminomycin,
Daunorubicin, aminopterin, methotrexate, metopterin, dichloromethotrexate, mitomycin C, porphyromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or etoposide, etoposide or teposide or teposide Such as podophyllotoxin derivatives, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosin, paclitaxel. Other useful antineoplastic agents include estramustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosfamide, melphalan, hexamethylmelphalan, thiotepa, cytarabine, idatrexate, trimetrexate , Dacarbazine, L-asparaginase, camptothecin, CPT-11, topotecan, ara-C, bicalutamide,
Examples include flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins.

A preferred class of antineoplastic agents is taxanes, and a preferred antineoplastic agent is paclitaxel.

Radiotherapy, such as X-rays or γ-rays, applied from external irradiation light or by implantation of a small radioactive source, can also be used to treat cancer in combination with the prenyl protein transferase inhibitor alone of the present invention.

In addition, the compounds of the invention are described in WO 97/38 published October 23, 1997.
No. 697, which is hereby incorporated by reference, may be useful as a radiosensitizer.

The compounds of the present invention may also be useful in combination with inhibitors of some of the signaling pathways that link cell surface growth factor receptors to nuclear signals and initiate cell proliferation. Therefore, the compound of the present invention can be used in combination with a farnesyl pyrophosphate antagonistic inhibitor of farnesyl protein transferase activity, or in combination with a compound having a Raf antagonist activity. The compounds of the present invention can also be used in combination with compounds that are selective inhibitors of geranylgeranyl protein transferase.
In particular, when the compound of the present invention is a selective inhibitor of farnesyl protein transferase, the therapeutic effect can be improved by using it in combination with a compound that is a selective inhibitor of geranylgeranyl protein transferase.

In particular, the compounds disclosed in patents and publications such as US Patent Application Nos. 08/254228 and 08/435047 may be useful as farnesyl pyrophosphate antagonist components of the compositions of the present invention. . These patents and publications are incorporated herein by reference.

In practicing the method of the present invention comprising administering two or more protein substrate antagonists and one farnesyl pyrophosphate antagonist at the same time or sequentially or in any order, Suitable administration can be oral administration or parenteral administration such as intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical administration. Such administration is preferably oral. More preferably, such administration is oral administration and simultaneous administration. When sequentially administering a protein substrate antagonist and a farnesyl pyrophosphate antagonist,
It can be done in the same way or in different ways.

The compounds of the present invention are also disclosed in US patent application Ser. No. 09/055, filed Apr. 6, 1998.
No. 487, which is incorporated herein by reference, may be useful in combination with integrin antagonists for treating cancer.

As used herein, the term integrin antagonist refers to the ability to selectively antagonize, inhibit or prevent the binding of a physiological ligand to integrins involved in regulating angiogenesis or in tumor cell growth and invasiveness. Refers to a compound that In particular, the term includes compounds that selectively antagonize, inhibit or block the binding of a physiological ligand to αvβ3 integrin; compounds that selectively antagonize, inhibit or block the binding of a physiological ligand to αvβ5 integrin; αvβ5
Refers to a compound that antagonizes, inhibits or prevents the binding of a physiological ligand to both integrins; or a compound that antagonizes, inhibits or prevents the activity of a particular integrin expressed on capillary endothelial cells. The terms also include α1β1, α2β1,
Also refers to antagonists of α5β1, α6β1 and α6β4 integrins. The terms also include αvβ3 integrin, αvβ5 integrin, α1β1, α2β1, α5
Also refers to antagonists of any combination of β1, α6β1 and α6β4 integrins. The compounds of the invention also inhibit tumor cell growth and invasiveness by inhibiting angiogenesis, such as, but not limited to, angiostatin and endostatin. It may be useful in combination with other drugs.

The compounds of the present invention may also include 3-hydroxy-3-methylglutaryl- for the treatment of cancer.
CoA reductase (HMG-CoA reductase) inhibitors may also be useful in combination. A compound having an inhibitory activity on HMG-CoA reductase can be easily identified using an assay known in the art. See, for example, the assays described or cited in U.S. Pat. No. 4,231,938, column 6, and WO 84/02131, pages 30-33. The terms "HMG-CoA reductase inhibitor" and "inhibitor of HMG-CoA reductase" have the same meaning as used herein.

Examples of HMG-CoA reductase inhibitors that can be used include lovastatin (
MEVACOR®; U.S. Patent Nos. 4,231,938, 4,294,926;
4319039), simvastatin (simvastatin; ZOCOR®; see US Pat. Nos. 4,444,784, 4,820,850, 4,916,239).
Pravastatin (PRAVACHOL®; see U.S. Pat. Nos. 4,346,227, 4537859, 4,410,629, 5030447 and 5180589), fluvastatin; LESCOL (
U.S. Pat. 5342952
Cerivastatin (also referred to as rivastatin and BAYCHOL®); see US Pat. No. 5,177,080), but are not limited thereto. The structural formulas of these and other HMG-CoA reductase inhibitors that can be used in the methods of the present invention are described in the report of M. Yalpani, "Cholesterol Lowering Drugs", Chemistry & Indu.
stry, pp. 85-89 (February 5, 1996)) at page 87 and U.S. Pat.
Nos. 84 and 4885314. HMG as used herein
The term -CoA reductase inhibitor refers to all pharmaceutically acceptable lactone and open acid forms of the compound having HMG-CoA reductase inhibitory activity (i.e., the lactone ring is opened to form the free acid) ) And the use of such salt, ester, ring-opening acid and lactone forms within the scope of the present invention. A diagram of the lactone moiety and its corresponding open-acid form is shown below as structural formulas I and II.

[0145]

Embedded image

For HMG-CoA reductase inhibitors in which the open acid form may exist, the salt and ester forms may preferably be formed from the open acid, and all such forms are used herein. The term "HMG-CoA reductase inhibitor". Preferably, the HMG-CoA reductase inhibitor is selected from lovastatin and simvastatin, most preferably simvastatin. As used herein, "pharmaceutically acceptable salts" with respect to HMG-CoA reductase inhibitors
The term is meant to mean non-toxic salts of the compounds used in the present invention prepared by reacting a suitable organic or inorganic base with said free acid, especially sodium, potassium, aluminum, calcium Formed from cations such as lithium, magnesium, zinc and tetramethylammonium, as well as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, ornithine, choline, N, N'-dibenzylethylenediamine, chloroprocaine; Diethanolamine, procaine, N-benzylphenethylamine,
There are salts formed from amines such as 1-p-chlorobenzyl-2-pyrrolidin-1′-yl-methylbenzimidazole, diethylamine, piperazine and tris (hydroxymethyl) aminomethane. Still other examples of HMG-CoA reductase inhibitors in the form of salts include acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, edetate Calcium salt, camsylate, carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estrate, esylate, fumarate, gluceptate, gluconate, glutamic acid Salt, glycolyllarsanilate, hexylresorcinate, hydravamin, hydrobromide, hydrochloride, hydroxynaphthoate, iodide, isothionate, lactate, lactobionate, laurate, apple Acid salts, maleates, mandelates, mesilates, methyl sulfates, mucilates, napsylates, nitrates, Oleate, oxalate, pamoate, palmitate, pantothenate, phosphate / diphosphate, polygalacturonate, salicylate, stearate, basic acetate, succinate, Examples include, but are not limited to, tannate, tartrate, teoclate, tosylate, triethiodide and valerate.

The ester derivatives of the HMG-CoA reductase inhibitor compounds described above, when absorbed into the bloodstream of a warm-blooded animal, may release a drug form that renders the drug an improved therapeutic efficacy. May act as a prodrug that can be cleaved as possible.

Similarly, compounds of the present invention can be used in combination with agents that are effective in treating and preventing NF-1, restenosis, polycystic kidney disease, hepatitis delta virus and related virus infections, and fungal infections. It can be useful.

When formulated as a fixed dose, in such combination preparations, the combinations of the invention are employed within the dosage ranges described above and the other pharmaceutically active agent is employed within its approved dosage range. If the multiple drug combination formulation is inappropriate, the combination of the present invention can alternatively be used sequentially with known pharmaceutically acceptable drugs.

The compounds of the present invention may further comprise a farnesyl protein transferase (
It is also useful as a component in an assay for quickly determining the presence or absence and amount of (FPTAse). Therefore, the test composition was subdivided, and two partial samples were combined with a known FPTase substrate (eg, a tetrapeptide having a cysteine at the amine terminal) and farnesyl pyrophosphate of the present invention (included in one of the mixtures). Contact with the mixture containing the compound. After incubating the assay mixture for a sufficient period of time for farnesylation of the substrate by FPTase as is known in the art, the chemical content of the assay mixture is determined by immunological, radiochemical or chromatographic methods known in the art. It can be measured by the method. The compound of the present invention is FPT
As a selective inhibitor of ase, the absence or amount of substrate in the assay mixture without the compound of the invention, as compared to the presence of the unaltered substrate in assays containing the compound of the invention. A decrease indicates the presence of FPTase in the test composition.

It will be readily apparent to those of skill in the art that assays such as those described above would be useful in validating tissue samples containing farnesyl protein transferase and quantifying enzymes. Thus, the potent inhibitor compounds of the present invention can be used in an active site titer assay to determine the amount of enzyme in a sample.
A series of samples consisting of an aliquot of a tissue extract containing an unknown amount of farnesyl protein transferase, an excess amount of a known FPTase substrate (eg, a tetrapeptide having a cysteine at the amine terminus), and a farnesyl pyrophosphate was prepared by subjecting a series of samples to various concentrations of the book. Incubate for an appropriate period of time in the presence of the compound of the invention.
The concentration of an inhibitor that is strong enough to inhibit the enzymatic activity of a sample by 50% (ie, that has a Ki significantly less than the enzyme concentration in the assay vessel) will be approximately Equal to half.

(Examples) The following examples are for further understanding of the present invention. The specific materials, species, and conditions used are intended to explain the invention in more detail, but not to limit the reasonable scope of the invention.

[0153]Example 1  (±) 18- (3-chlorophenyl) -16,16a, 17,18,19,2
0-Hexahydro-17-oxo-5H-6,10-metheno-22H-benzo [
b] pyrazino [2,1-e] imidazo [4,3-h] [1,6,9] oxadia
Zacyclopentadecine-9-carbonitrile dihydrochloride.

[0154]Step A: 1-triphenylmethyl-4- (hydroxymethyl) imidazole Manufacture  4- (hydroxymethyl) imidazole hydrochloride (35.0 g, 260 mmol
) In dry DMF (250 mL) at room temperature in triethylamine (90.6 mL)
, 650 mmol). A white solid precipitated from the solution. Chlorotrifeni
Methane (76.1 g, 273 mmol) in DMF (500 mL) was added dropwise.
Was. The reaction mixture was stirred for 20 hours, poured on ice, filtered and washed with ice water. Get
The product was slurried with cold dioxane, filtered and dried in vacuo to give the title product.
Was obtained as a white solid. It is pure enough to be used in the next step
there were.

[0155]Step B: 1-triphenylmethyl-4- (acetoxymethyl) imidazole Manufacture  The alcohol from Step A (260 mmol, prepared above) was converted to pyridine 500m
L. Acetic anhydride (74 mL, 780 mmol) was added dropwise, and the reaction mixture was diluted with 4 parts.
Stirring was continued for 8 hours, during which time it became homogeneous. Solution to 2 liters of EtOAc
Water (3 times with 1 liter), 5% HCl aqueous solution (2 times with 1 liter),
NaHCO₃Wash with aqueous solution and brine, dry (Na₂SO₄),filtration
And concentrated under reduced pressure to obtain a crude product. The obtained acetate is simply used as a white powder.
But it was of sufficient purity to be used in the next reaction.

[0156]Step C: Preparation of 4-cyano-3-fluorotoluene  DMF of 4-bromo-3-fluorotoluene (50.0 g, 264 mmol)
(500 mL) degas the solution and add Zn (CN)₂(18.6 g, 159 mm
ol) and Pd (PPh₃)₄(6.1 g, 5.3 mmol) were added. reaction
The liquid was stirred at 80 ° C. for 6 hours and cooled to room temperature. Pour the solution into EtOAc,
Water, saturated NaHCO₃Wash with aqueous solution and brine, dry (Na₂SO₄)
, Filtered and concentrated under reduced pressure to give the crude product. Silica gel chromatography (
Purification by 0% to 5% EtOAc / hexane) provided the title product.

[0157]Step D: Preparation of 4-cyano-3-fluorobenzyl bromide  The product from Step C (22.2 g, 165 mmol) of carbon tetrachloride (220 m
L) In a solution, N-bromosuccinimide (29.2 g, 164 mmol) and
Benzoyl peroxide (1.1 g) was added. Heat and stir the reaction for 30 minutes, cool
To room temperature. The solution was concentrated under reduced pressure to the first one-third volume, and extracted with EtOAc.
Charge, water, saturated NaHCO₃Wash with aqueous solution and brine, dry (Na₂ SO₄), Filtered and concentrated under reduced pressure to give the crude product.¹Part by H NMR analysis
Since the conversion was found to have progressed only in a specific manner, the crude product was converted to N-bromoco
The same reaction was carried out for 2.5 hours using 18 g (102 mmol) of succinimide.
Processed again under conditions. After work-up, the crude product was purified by silica gel chromatography (0
(% To 10% EtOAc / hexane) to give the desired product.

[0158]Step E: 1- (4-cyano-3-fluorobenzyl) -5- (acetoxymethyl R) -Imidazole hydrobromide production  Product from Step B (36.72 g, 96.14 mmol) and from Step D
(20.67 g, 96.14 mmol) in EtOAc (250 mL)
The liquid was stirred at 60 ° C. for 20 hours. During that time a white precipitate formed. Cool the reaction
Room temperature and filtration gave a solid imidazolium bromide salt. Filtrate under reduced pressure
Concentrate to 100 mL volume, heat again at 60 ° C. for 2 hours, cool to room temperature
And filtered again. The filtrate was concentrated under reduced pressure to a volume of 40 mL and again at 60 ° C.
And then cooled to room temperature and concentrated under reduced pressure to give a pale yellow solid. Solid
Combine all the body materials, dissolve in 300 mL of methanol and raise the temperature to
Was. After 2 hours, the solution was concentrated again under reduced pressure to give a white solid. It with hexane
Grinding removed the soluble components. Removal of the residual solvent under reduced pressure affords the title product.
Was obtained as a white solid. Use it in the next step without further purification
Was.

[0159]Step F: 1- (4-cyano-3-fluorobenzyl) -5- (hydroxymethyl Le) Production of imidazole  The product from Step E (31.87 g, 89.77 mmol) in 2: 1 THF /
Lithium hydroxide monohydrate (7.53 g, 17
9 mmol) was added. After 2 hours, the reaction was concentrated under reduced pressure to 100 mL,
Stored at 0 ° C. for 30 minutes, filtered and washed with 700 mL of cold water to give a brown solid. This
The acquisition of P₂O₅Followed by dehydration under reduced pressure to afford the title product as a light brown powder.
Obtained. It is pure enough to be used in the next step without further purification
Met.

[0160]Step G: 1- (4-cyano-3-fluorobenzyl) -5-imidazolecar Production of boxyaldehyde  The alcohol from step F (2.31 g, 10.0 mmol) in DMSO (20
Triethylamine (5.6 mL, 40 mmol) was added to the solution at 0 ° C.
Next, SO₃-Pyridine complex (3.89 g, 25 mmol) was added. 30 minutes later,
The reaction was poured into EtOAc, washed with water and brine, dried (Na₂SO ₄ ), Filtered and concentrated under reduced pressure to give the title aldehyde as a pale yellow powder. So
It is pure enough to be used in the next step without further purification.
Was.

[0161]Step H: Preparation of N- (3-chlorophenyl) ethylenediamine hydrochloride  3-Chloroaniline (30.0 mL, 284 mmol) in methylene chloride (50
HCI in 4N 1,4-dioxane (80 mL, 3 mL).
2 mmol HCl) was added dropwise. The solution was warmed to room temperature and concentrated under reduced pressure.
And dried to give a white powder. The powder and 2-oxazolidinone (24.6 g,
282 mmol) was heated at 160 ° C. for 10 hours under a nitrogen atmosphere.
In the meantime, during that time, the solid melted and gas generation was observed. After allowing the reaction solution to cool
, A crude diamine hydrochloride was produced as a light brown solid.

[0162]Step I: N- (tert-butoxycarbonyl) -N '-(3-chlorophenyl B) Production of ethylenediamine  The amine hydrochloride from Step H (about 282 mmol, crude obtained above) was
500 mL of THF and saturated NaHCO₃Take up to 500 mL of aqueous solution and cool to 0
° C, and di-tert-butyl pyrocarbonate (61.6 g, 282 mmol
) Was added. After 30 hours, pour the reaction into EtOAc and wash with water and brine.
Clean and dehydrate (Na₂SO₄), Filter and concentrate under reduced pressure to give the title
Was obtained as a brown oil. It was used in the next step without further purification.

[0163]Step J: N- [2- (tert-butoxycarbamoyl) ethyl] -N- (3 -Chlorophenyl) -2-chloroacetamide  The product from Step I (77 g, about 282 mmol) and triethylamine (
67 mL, 480 mmol) CH₂Cl₂(500 mL) Cool the solution to 0 ° C
And Chloroacetyl chloride (25.5 mL, 320 mmol) was added dropwise.
The reaction was maintained at 0 ° C. with stirring. After 3 hours, additional chloroacetyl chloride
A ride (3.0 mL) was added dropwise. After 30 minutes, the reaction was washed with EtOAc (2 liters).
), Water, saturated NH₄Cl aqueous solution, saturated NaHCO₃Aqueous solution and brie
Washed with The solution is dehydrated (Na₂SO₄), Filter and concentrate under reduced pressure to give
Loloacetamide was obtained as a brown oil. The next step without further purification
Used in

[0164]Step K: 4- (tert-butoxycarbonyl) -1- (3-chlorophenyl ) Preparation of 2-piperazinone  Dehydrated chloroacetamide (about 282 mmol) from Step J in DMF (700
mL) solution to K₂CO₃(88 g, 0.64 mol) was added. 70 to 7 of solution
Heat in a 5 ° C. oil bath for 20 hours, cool to room temperature, and concentrate under reduced pressure to approximately 5 DMF.
00 mL was removed. The residue was taken up in 33% EtOAc / hexane and water and
Wash with brine, dehydrate (Na₂SO₄), Filtered and concentrated under reduced pressure to give
Was obtained as a brown oil. The obtained material was subjected to silica gel chromatography (25
% To 50% EtOAc / hexanes) to afford relatively less polar impurities.
Pure product with pure product sample (about 65% purity by HPLC)
I got something.

[0165]Step L: Preparation of 2- (benzyloxy) benzyl alcohol  Ethano of 2- (benzyloxy) benzaldehyde (10 g, 47 mmol)
(100 mL) solution is stirred while NaBH₄A little at a time
Added. The reaction temperature was controlled using a room temperature water bath. After stirring for 30 minutes, 3N H
The reaction was quenched by slow addition of Cl. The solution was extracted with EtOAc and
Water layer, saturated Na₂CO₃And washed with brine. The solution is dehydrated (Na₂ SO₄), Filtered and concentrated under reduced pressure to give benzyl alcohol. Any more
Used in the next step without purification.

[0166]Step M: Preparation of 2- (benzyloxy) benzyl bromide  CH of N-bromosuccinimide (1.84 g, 10.36 mmol)₂Cl ₂ (50 mL) The solution was cooled in an aqueous ice / acetone bath. Dimethyl sulfide (0
. 91 mL, 12.44 mmol) was added and the reaction was stirred for 10 minutes. Stage L
From product (1.48 g, 6.91 mmol) in CH₂Cl₂(25 mL)
The solution was added and the reaction was stirred at 0 ° C. for 4.5 hours. Pour the reaction solution into water / ice and separate
did. The organic layer was washed with brine, dried (Na₂SO₄), Filtered and under reduced pressure
Concentration gave benzyl bromide.

[0167]Step N: 4- (tert-butylcarbonyl) -3- (2- (benzyloxy ) Preparation of benzyl) -1- (3-chlorophenyl) -2-piperazinone  The dry THF solution of the product from Step K was cooled to -78 ° C. sodium
Bis (trimethylsilyl) amide in THF solution (1 M, 3.2 mL, 3.2 mm
ol) was added slowly and the reaction was stirred for 45 minutes. The product from Step M (85
9 mg, 3.2 mmol) in THF (1 mL) was added slowly, and the reaction solution was added to 2 mL.
. Stir for 5 hours. H₂The reaction was stopped at −78 ° C. by adding O, and the temperature was raised.
Room temperature and diluted with EtOAc. Separate and separate the organic layer with saturated NaHCO₃solution
And brine and dried (Na₂SO₄), Filter and concentrate under reduced pressure
An alkylated piperazinone was obtained.

[0168]Step O: 3- (2- (benzyloxy) benzyl) -1- (3-chlorophenyl L) Production of 2-piperazinone hydrochloride  Ethyl acetate (25 mL) of the product from Step N (1.0 g, 2.0 mmol)
The solution was bubbled with anhydrous HCl gas at 0 ° C. for 5 minutes. After 30 minutes, the solution was
Concentration provided the title salt as a white foam. The next reaction without further purification
It was used in response.

[0169]Step P: 3- [2- (benzyloxy) benzyl] -1- (3-chlorophenyl ) -4- [1- (4-cyano-3-fluorobenzyl) -5-imidazole Production of [Midazolylmethyl] -2-piperazinone  1,2-diamine of amine hydrochloride from Step O (581 mg, 1.31 mmol)
Add 4 ロ molecular sieves (500mg) to the loroethane (8mL) solution
And then sodium borohydride triacetoxy (416 mg, 1.96 mmol
) Was added. Add the aldehyde from Step G (300 mg, 1.31 mmol)
The reaction was stirred for 16 hours. The reaction was poured into EtOAc and saturated NaHCO₃ Wash with aqueous solution and brine, dry (Na₂SO₄), Filter and concentrate under reduced pressure
Shrank. Silica gel chromatography (0% to 10% MeOH / EtOAc
Purification according to) gave the title product.

[0170]Step Q: 1- (3-chlorophenyl) -4- [1- (4-cyano-3-fluoro Robenzyl) -5-imidazoleimidazolylmethyl] -3- [2- (hydroxy Production of cis) benzyl] -2-piperazinone  1: 1 M of benzyl ether from step P (300 mg, 0.48 mmol)
Add trifluoroacetic acid (0.10 mL) and OH / EtOAc (5 mL) solution.
And 10% palladium on carbon (150 mg). Solution in a hydrogen balloon atmosphere at room temperature
Stir underneath. After 18 hours, the solution was filtered through celite and the filter layer was washed with 1: 1 Me
Washed with OH / EtOAc. After concentration under reduced pressure, the developing solution was₃: MeOH
: NH₄Purified on 6 1 mm preparative TLC plates with OH (90: 10: 1)
This gave 80 mg of a 2: 1 mixture of the title compound with the dechlorinated compound. That blend
The compound was used as is in the next step.

[0171]Step R: (±) 18- (3-chlorophenyl) -16,16a, 17,18, 19,20-hexahydro-17-oxo-5H-6,10-metheno-22H- Benzo [b] pyrazino [2,1-e] imidazo [4,3-h] [1,6,9] Preparation of Xiadiazacyclopentadecine-9-carbonitrile dihydrochloride  The product from Step Q (80 mg, ca. 0.15 mmol) in DMSO (5 mL)
Cesium carbonate (106 mg, 0.30 mmol) was added to the solution. Reaction mixture
Raise the temperature to 50 ° C under a gon for 1 hour, then heat to 80 ° C for 1.5 hours
The mixture was allowed to cool to 50 ° C., and was further stirred for 2 hours. Cool the reaction to room temperature
And The solution was poured into EtOAc, washed with water and brine, dried (Na ₂ SO₄), Filtered and concentrated under reduced pressure. The obtained product was washed with CHCl ₃ : MeOH: NH₄0.5mm preparative TLC plate with OH (90: 10: 1)
Purification was performed on four plates. Minimum amount of CH₂Cl₂Dissolved in excess saturated HCl / A
The compound was converted to the HCl salt by treatment with tel solution and concentration under reduced pressure to give the title
The product was obtained.

FAB mass spectrometry spectrum m / e 510 (M + 1); Elemental analysis: C ₂₉ H ₂₄ ClN ₅ O ₂ · 2.00 HCl · 0.10H ₂ O Calculated: C, 59.56; H, 4.52; N, 11.98; Found: C, 59.60; H, 4.84; N, 11.71.

[0173]Example 2  (±) 16,16a, 17,18,19,20-Hexahydro-17-oxo
-5H-18-phenyl-6,10-metheno-22H-benzo [b] pyrazino [
2,1-e] imidazo [4,3-h] [1,6,9] oxadiazacyclopenta
Decin-9-carbonitrile dihydrochloride.

The title compound was isolated as the product of Step R of Example 1 as a white powder.

FAB mass spectrometry spectrum m / e 476 (M + 1); Elemental analysis: C ₂₉ H ₂₅ N ₅ O ₂ .2.00HCl 1.15H ₂ O Calculated: C, 65.38; H, 5.35; N, 13.15; Found: C, 65.35; H, 5.42; N, 12.75.

[0176]Example 3  In vitro inhibition of ras farnesyltransferase  Transferase assay.

[0177] Unless otherwise specified, isoprenyl protein transferase activity assays are performed at 30 ° C. Representative reactions (in a final volume of 50 μL) include [ ³ H] -farnesyl diphosphate, Ras protein, 50 mM HEPES (pH 7.5), 5 m
M MgCl ₂ , 5 mM dithiothreitol, 10 μM ZnCl ₂ , 0.1
% Polyethylene glycol (PEG) (15000-20,000 mw) and isoprenyl protein transferase. F used in this assay
PTase was reported by Omar et al. (Omer, CA, Kral, AM, Diehl, RE, Prend
ergast, GC, Powers, S., Allen, CM, Gibbs, JB and Kohl, NE (1993).
Biochemistry 32: 5167-5176). After thermal pre-equilibration of the assay mixture in the absence of the enzyme, the reaction is started by adding isoprenyl protein transferase, and at predetermined time intervals (typically 15 minutes), a 1 M HCl solution in ethanol ( The reaction is stopped by adding 1 mL).
The stopped reaction solution is allowed to stand for 15 m (to complete the precipitation process). 10
After addition of 2 mL of 0% ethanol, the reaction is vacuum filtered through a Whatman GF / C filter. The filter is washed four times with 2 mL each of 100% ethanol, mixed with scintillation fluid (10 mL), and counted on a Beckman LS3801 scintillation counter.

In the case of the inhibition test, the inhibitor is prepared according to the method described above, except that the inhibitor is prepared as a concentrated solution of 100% dimethyl sulfoxide and diluted 20-fold to obtain an enzyme assay mixture. Substrate concentrations in _{IC 50} measurement of the composition or inhibitor, FTase, 65
0 nM Ras-CVLS (SEQ ID NO: 1), 100 nM farnesyl diphosphate.

[0179] The compounds useful in the present invention described in Examples 1-2 were examined for inhibitory activity against human FPTase by the assay described above, _{IC 50} is ≦ 10 [mu]
M was found.

[0180]Example 4  Modified in vitro GGTase inhibition assay  Modified geranylgeranyl protein transferase inhibition assay performed at room temperature
. Typical reactions include [³H] geranylgeranyl diphosphate, biotinylated
Ras peptide, 50 mM HEPES (pH 7.5), regulating anion (eg,
For example, 10 mM glycerophosphate or 5 mM ATP), 5 mM MgCl₂, 1
0 μM ZnCl₂, 0.1% PEG (molecular weight 15,000 to 20,000), 2 m
M dithiothreitol and geranylgeranyl protein transferase type I (G
GTase) (in a final volume of 50 mL). GGTas used in the assay
Type eI enzymes are described in U.S. Pat. No. 5,470,832, which is incorporated herein by reference.
). Ras peptide is K4B-Ras
Biotinyl-GKKKKKKSKTKCVIM (single amino acid code) derived from protein
(SEQ ID NO: 2). The reaction is started by adding GGTase,
3 mg / mL streptoa with 50 mM EDTA and 0.5% BSA
Vidin SPA beads (Scintillation Proximity Assay beads, Amersham)
. By adding 200 μL of a 2M sodium phosphate (pH 4) suspension, a predetermined time
(Typically 15 minutes). Let the reaction solution that has stopped reacting stand for 2 hours,
And analysis with a scintillation counter (Packard TopCount).

For the inhibition test, the assay is performed according to the method described above, except that the composition or inhibitor is prepared as a concentrated solution in 100% dimethyl sulfoxide and then diluted 25-fold in the enzyme assay mixture. The IC ₅₀ values measured using the Ras peptide near the _{K M} concentration. Enzyme and substrate concentration for inhibitor IC ₅₀ measurements,
75 pM GGTase-I, 1.6 μM Ras peptide, 100 nM geranylgeranyl diphosphate.

[0182]Example 5  Cell-based in vitro ras farnesylation assay  The cell line used in this assay was Ra-expressing the virus Ha-rasp21.
A v-ras system derived from either t1 cells or NIH3T3. Assay
Was reported by Declue et al. (DeClue, J.E. et al., Cancer Research 51: 712-7
17 (1991)). 10cm shear at 50 ~ 75% confluency
Cells contained in the test compound or composition (solvent (methanol or
(Dimethylsulfoxide) at a final concentration of 0.1%). After 4 hours at 37 ° C
10% normal DMEM, 2% fetal calf serum and 400 mCi [³⁵S] Methio
Methionine-free DMEM supplemented with nin (1000 Ci / mmol) (3
Label the cells in mL). After an additional 20 hours, cell lysis buffer (1% NP40
/ 20 mM HEPES (pH 7.5) / 5 mM MgCl₂/ 1mM DTT /
10mg / mL aprotinen / 2mg / mL leupeptin / 2m
g / mL antipine / 0.5 mM PMSF).
The lysate is clarified by centrifugation at 100,000 xg for 45 minutes. Acid precipitation
The lysate aliquoted so as to have the same number of unds was added to an IP buffer (a fine powder containing no DTT).
Vesicle lysis buffer) in 1 mL, ras-specific monoclonal antibody Y13-259
(Furth, M.E. et al.,J.Virol., 43: 294-304 (1982)). 4
After 2 hours of antibody incubation at 0 ° C., the cells were coated with rabbit anti-rat IgG.
200 ml of a 25% suspension of protein A-Sepharose was added for 45 minutes.
Let The immunoprecipitate was treated with IP buffer (20 nM HEPES (pH 7.5) / 1 mM
EDTA / 1% Triton X-100.0.5% deoxycholic acid / 0.1%
(SDS / 0.1 M NaCl) 4 times, and then wash with SDS-PAGE sample buffer.
Boil in and load on a 13% acrylamide gel. When the dye tip reaches the bottom
At this point, the gel is fixed, dipped in Enlightening, dried,
Perform autoradiography. Farnesylated ras protein and non-farnesyl
Inhibition of farnesyl transcription to protein by comparing the intensity of the band corresponding to
Find percent.

[0183]Example 6  Cell-based in vitro growth inhibition assay  To determine the biological consequences of FPTase inhibition, v-ras, v-raf or
Is anchorage-independent of Rat1 cells transformed with any of the v-mos oncogenes
The effect of a compound or composition of the invention on growth is determined. v-Raf and v
-Mos-transformed cells were included in the analysis to allow Ras-induced cell transformation.
The specificity of the compound or composition of the invention to be replaced can be evaluated.

Rat1 cells transformed with either v-ras, v-raf or v-mos were plated on Medium A (Dulbecco supplemented with 10% fetal bovine serum) on the bottom agarose layer (0.6%). The upper layer of 0.3% agarose in conditioned Eagle's medium) is inoculated at a density of 1 × 10 ⁴ cells per plate (35 mm diameter). 0.1% methanol or appropriate concentration of compound or composition of the present invention (in methanol at 1000 times the final concentration used in the assay) in each layer
Is contained. Cells are fed twice weekly with 0.5 mL of medium A containing 0.1% methanol or a compound concentrate of the present invention. Micrographs are taken 16 days after inoculation of the medium and comparisons are made.

[0185]Example 7  Construction of SEAP Reporter Plasmid pDSE100  The restriction fragment having the sequence encoding SEAP was transformed into plasmid pCMV-RE-A.
By ligating to KI, a SEAP reporter plasmid pDSE100 was constructed.
Was. The SEAP gene was obtained from plasmid pSEAP2-Basic (Clontech, Palo
 Alto, CA). Plasmid pCMV-RE-AKI is
Built by Deborah Jones; Merck, Cytomegalo
"CAT-TATA" derived from the immediate early promoter of the virus
5 consecutive copies of the "dyad symmetric response element" cloned upstream of the sequence
Have The plasmid also has a bovine growth hormone poly A sequence.

The plasmid pDSE100 was constructed as follows. A restriction fragment encoding the SEAP coding sequence was excised from plasmid pSEAP2-Basic using restriction enzymes EcoR1 and HpaI. The ends of the linear DNA fragment were filled in with the Klenow fragment of E. coli DNA polymerase I. The digest was subjected to electrophoresis in agarose gel and the "blunt-ended" DNA carrying the SEAP gene was isolated by cutting off the 1694 base pair fragment. Vector plasmid pCMV-RE-
AKI was linearized with restriction enzyme Bgl-II, and the ends were filled in with Klenow DNA polymerase I. The SEAP DNA fragment was blunt-ended to the pCMV-RE-AKI vector, and the ligation product was transformed into DH5-α E. coli cells (Gibco-BRL).
Transformants were screened for appropriate inserts and mapped for restriction fragment placement. At the cloning junction, the properly placed recombinant construct was sequenced to confirm the correct sequence. The resulting plasmid has the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH polyA sequence.

[0187]Separate construction of SEAP reporter plasmid pDSE101  SEAP reporter plasmid pDSE101 contains the SEAP coding sequence
It is also constructed by ligating the restriction part to the plasmid pCMV-RE-AKI.
The SEAP gene is derived from pGEM7zf (-) / SEAP.

The plasmid pDSE101 was constructed as follows. A restriction fragment containing a portion of the SEAP gene coding sequence was excised from plasmid pGEM7zf (-) / SEAP using restriction enzymes ApaI and KpnI. The ends of the linear DNA fragment were chewed back with the Klenow fragment of E. coli DNA polymerase I.
"Blunt-ended" DNA containing the truncated SEAP gene was isolated by electrophoresis of the digest on an agarose gel and excision of the 1910 base pair fragment. Bgl-II
This 1910 base pair fragment was ligated to plasmid pCMV-RE-AKI which had been cut with E. coli Klenow fragment DNA polymerase. Recombinant plasmids were screened for insertion direction and sequenced from the junction. Plasmid pCMV-RE-AKI was obtained by removing the EcoRI fragment having the DHFR marker and the neomycin marker, thereby obtaining plasmid pCMVIE-AKI.
−DHFR (Whang, Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A
.B., Ellis, RW, and Kieff, E. (1987) J. Virol., 61, 1796-1807). Five copies of the serum response element of the fos promoter were obtained by the method described previously (Jones, R
.E., Defeo-Jones, D., McAvoy, EM, Vuocolo, GA, Wegrzyn, RJ, Haskel
1, KM and Oliff, A. (1991) Oncogene, 6, 745-751) to form the plasmid pCMV-RE-AKI.

The plasmid pGEM7zf (−) / SEAP was constructed as follows. SEAP gene PCR was performed on two parts from a human placenta cDNA library (Clontech) using the following oligos.

Sense strand N-terminal SEAP: 5 ′ GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3 ′ (SEQ ID NO: 3).

Antisense strand N-terminal SEAP: 5 ′ GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3 ′ (SEQ ID NO: 4).

Sense strand C-terminal SEAP: 5 ′ GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3 ′ (SEQ ID NO: 5).

Antisense strand C-terminal SEAP: 5 ′ GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3 ′ (SEQ ID NO: 6).

The N-terminal oligos (SEQ ID NO: 4 and SEQ ID NO: 5) were used to terminate EcoR
A 1560 bp N-terminal PCR product with I and HpaI restriction sites was obtained. The antisense N-terminal oligo (SEQ ID NO: 4) was
An internal translation stop codon is introduced into the AP gene. C-terminal oligos (SEQ ID NO: 5
And SEQ ID NO: 6) were used to amplify a 412 bp C-terminal PCR product containing an HpaI and a HindIII restriction site. Sense strand C-terminal oligo (
SEQ ID NO: 5) introduces an internal stop codon and an HpaI site. next,
The N-terminal amplicon was digested with EcoRI and HpaI, and the C-terminal amplicon was digested with HpaI and HindIII. These two fragments containing each end of the SEAP gene were isolated by electrophoresis of the digest in an agarose gel and isolation of the 1560 and 412 base pair fragments. Next, EcoRI and HindI
Vector pGEM7zf, restriction digested with II and isolated on an agarose gel
These two fragments were co-ligated to (-) (Promega). Obtained clone p
GEM7zf (-) / SEAP contains the coding sequence for the SEAP gene from amino acids.

[0195]Construction of plasmid pCMV-SEAP constitutively expressing SEAP  The sequence encoding the truncated SEAP gene was replaced with the cytomegalovirus (CMV) IE
By placing it downstream of the -1 promoter, a gene that expresses the SEAP protein constitutively
The current plasmid was formed. The expression plasmid additionally contains a SEAP gene.
Bovine Growth Hormone for the Infecting CMV Intron A Region 5 'and SEAP Gene
It also includes the 3 'untranslated region of the mon gene 3'.

Plasmid pCMVIE- containing the CMV immediate early promoter
AKI-DHFR (Whang et al, 1987) was cut with EcoRI to give two fragments. Vector fragments were isolated by agarose electrophoresis and religated. The resulting plasmid is called pCMV-AKI. Next, the cytomegalovirus intron A nucleotide sequence was inserted downstream of the CMV IE1 promoter in pCMV-AKI. The intron A sequence was isolated from a genomic clone bank and
Plasmid p16T-286 was obtained by subcloning into BR322. Using site-directed mutagenesis, the intron A sequence was modified at nucleotide 1856 (
Chapman, BS, Thayer, RM, Vincent, KA and Haigwood, NL, Nuc. Acid
s Res., 19, 3979-3986) to remove the SacI restriction site. For the mutant intron A sequence, the plasmid p16T
PCR was performed from -287.

Sense strand: 5 ′ GGCAGAGCTCGTTTAGTGAACCGTCAG 3 ′ (SEQ ID NO: 7).

Antisense strand: 5 ′ GAGAGATCTCAAGGACGGTGACTGCAG 3 ′ (SEQ ID NO: 8).

These two oligos have a SacI site integrated by the sense oligo and a Bgl-II fragment integrated by the antisense oligo.
A one base pair fragment is obtained. The PCR fragment is trimmed with SacI and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI was replaced with Sac
Cut with I and Bgl-II and isolate the larger vector fragment by agarose gel electrophoresis. By ligating the two gel isolated fragments to their individual SacI and Bgl-II sites, the plasmid pCMV-AKI-InA
Get.

[0200] The DNA sequence encoding the truncated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector. EcoRI and Hind
III, the SEAP gene was transformed into plasmid pGEM7zf (-) / SEAP
Cut out from above. The resulting fragment is filled with Klenow DNA polymerase and a 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis. The pCMV-AKI-InA vector is formed by digesting with Bgl-II and filling the ends with Klenow DNA polymerase. SEAP fragment to pCM
The final construct is obtained by blunt-end ligation to the V-AKI-InA vector. Transformants were screened for appropriate inserts and mapped for restriction fragment orientation. Sequencing across the cloning junction for a properly oriented recombinant construct confirmed the correct sequence. pCMV-SEA
The resulting plasmid, designated P, has a modified SEAP sequence downstream of the cytomegalovirus immediate early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone polyA sequence. This plasmid constitutively expresses SEAP when transfected into mammalian cells.

[0201]Cloning of myristylated virus-H-ras expression plasmid  The DNA fragment having the virus-H-ras was isolated from the "HB
-1 "(Ellis R. et al. J. Virol. 36, 408, 1980) or" HB-11 "(
Deposited at the ATCC under the Budapest Treaty on August 27, 1997,
ATCC209218).

Sense strand: 5 ′ TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAA GGACCCCAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTGG 3 ′ (SEQ ID NO: 9).

Antisense strand: 5 'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3' (SEQ ID NO: 10).

[0204] The sequence encoding the first 15 amino acids of the v-src gene including the myristylation site is incorporated into the sense strand oligo. The sense strand oligo also optimizes the "Kozak" translation initiation sequence directly 5 'to the ATG start site. In order to prevent prenylation at the C-terminal of the virus-ras, cysteine 186 may be mutated to serine by replacing the C residue with a G residue in the C-terminal antisense oligo. The PCR primer oligo is Xho at the 5 'end.
The I site introduces an XbaI site at the 3 'end. The XhoI-XbaI fragment was digested with the XhoI and XbaI digested mammalian expression plasmid pCI (Promega
). Thereby, a plasmid is obtained in which the recombinant myr-virus-H-ras gene is transcribed constitutively from the CMV promoter of the pCI vector.

[0205]Cloning of virus-H-ras-CVLL expression plasmid  Virus-H-ras clone having a C-terminal sequence encoding amino acid CVLL
"HB-1" (Ellis R. et al.) By PCR using the following oligos:
J. Virol. 36, 408, 1980) or "HB-11" (August 27, 1997)
Deposited at the ATCC under the Budapest Treaty, ATCC209218)
Can be cloned from

The sense strand: 5 ′ TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3 ′ (SEQ ID NO: 11).

Antisense strand: 5 'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ ID NO: 12).

The sense strand oligo optimizes the “Kozak” sequence and adds an XhoI site. The antisense strand mutates serine 189 to leucine and adds an XbaI site. The PCR fragment was trimmed with XhoI and XbaI, and
It can be ligated to the I-Xbal cut vector pCI (Promega). Thereby, from the CMV promoter of the pCI vector, the mutant virus-Hr
A plasmid constitutively transcribing the as-CVLL gene is obtained.

[0209]Cloning of cH-ras-Leu61 expression plasmid  Using the following oligonucleotide primers, live human cerebral cortex cDNA
PCR from human C-H-ras gene can be performed from Lari (Clontech).
.

Sense strand: 5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3 '(SEQ ID NO: 13).

Antisense strand: 5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3 '(SEQ ID NO: 14).

[0212] These primers are optimized "Kozak" translation initiation sequence, N-terminal EcoR
Using primers that contribute to the I site and the C-terminal SalI site, c-H-r
This is for amplifying a DNA fragment encoding as. EcoRI and SalI
After trimming the ends of the PCR product by PCR, the cH-ras fragment can be ligated to the EcoRI-SalI cleavage mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to leucine can be performed using the manufacturer's recommendations and the following oligonucleotides.

5'-CCGCCGGCCTGGAGGAGTACAG-3 '(SEQ ID NO: 15).

After selection and sequencing of the exact nucleotide substitution, the mutated cH-ras-Leu61 was excised from the pAlter-1 vector using EcoRI and SalI and digested with EcoRI and SalI. Vector pC
I (Promega) can be directly linked. The new recombinant plasmid is pC
It constitutively transcribes cH-ras-Leu61 from the CMV promoter of the I vector.

[0215]Cloning of cN-ras-Val-12 expression plasmid  Using the following oligonucleotide primers, live human cerebral cortex cDNA
Lari (Clontech) can perform PCR of the human cN-ras gene
.

Sense strand: 5'-GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3 '(SEQ ID NO: 16).

Antisense strand: 5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3 '(SEQ ID NO: 17).

[0218] These primers are optimized "Kozak" translation initiation sequence, N-terminal EcoR
Using primers that contribute to the I site and the C-terminal SalI site, cNr
This is for amplifying a DNA fragment encoding as. EcoRI and SalI
After trimming the ends of the PCR product, the cN-ras fragment can be ligated to the EcoRI-SalI cleavage mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to valine can be performed using the manufacturer's recommendations and the following oligonucleotides.

5'-GTTGGAGCAGTTGGTGTTGGG-3 '(SEQ ID NO: 18).

After selection and sequencing of the exact nucleotide substitution, the mutated cN-ras-Val-12 was replaced with pAlter-1 using EcoRI and SalI.
Vector p which has been cut from the vector and digested with EcoRI and SalI
It can be directly linked to CI (Promega). The new recombinant plasmid is p
It constitutively transcribes cN-ras-Val-12 from the CMV promoter of the CI vector.

[0221]Cloning of CK-ras-Val-12 expression plasmid  Using the following oligonucleotide primers, live human cerebral cortex cDNA
PCR from human CK-ras gene can be performed from Lari (Clontech).
.

Sense strand: 5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3 '(SEQ ID NO: 19).

Antisense strand: 5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3 '(SEQ ID NO: 20).

These primers are optimized "Kozak" translation initiation sequence, N-terminal KpnI
Using primers that contribute to the site and the C-terminal SalI site, c-K-ra
It amplifies a DNA fragment encoding s. After trimming the ends of the PCR product with KpnI and SalI, the c-K-ras fragment can be ligated to the KpnI-SalI cleavage mutagenesis vector pAlter-1 (Promega). Mutation of cysteine-12 to valine can be performed using the manufacturer's recommendations and the following oligonucleotides.

5'-GTAGTTGGAGCTGTTGGCGTAGGC-3 '(SEQ ID NO: 21).

After the selection and sequencing of the exact nucleotide substitution, KpnI and S
Using all, the mutant cK-ras-Val-12 was excised from the pAlter-1 vector and the vector pCI digested with KpnI and SalI.
(Promega). The new recombinant plasmid is pCI
It constitutively transcribes cK-ras-Val-12 from the CMV promoter of the vector.

[0227]SEAP assay  Human C33A cells (Human epithelial carcinoma-ATTC collection) were plated on 10 cm tissue culture plates
And DMEM + 10% fetal calf serum + 1X Pen / Strep + 1X glutamine
Inoculate + 1X NEAA. 5% CO₂Grow cells at 37 ° C in an atmosphere
, And the confluence is 50 to 80%.

Transient transfections are performed by the CaPO ₄ method (Sambrook et al., 1989). Then, H-ras, N-ras, K-ras, Myr-ras
Alternatively, the expression plasmid for H-ras-CVLL is co-precipitated with the DSE-SEAP reporter construct. For a 10 cm plate, 2X HBS buffer 6
While vortexing 00 μL, 600 μL of a CaCl ₂ -DNA solution is added dropwise to obtain 1.2 mL of a precipitate (see the following formulation). This is left at room temperature for 20-30 minutes. The medium in C33A cells was added to DMEM (without phenol red; Gibco Cat ## 31053-028) + 0.5% charcoal stripping bovine serum + 1X (Pen / Strep, glutamine and essential amino acids) while forming a precipitate. Substitute. The CaPO _4-DNA precipitate was added dropwise to the cells, dispersed gently shaking the plates. DNA incorporation at 37 ° C. under 5% CO ₂ atmosphere
Proceed for 6 hours.

After the DNA incubation period, cells are washed with PBS and trypsinized with 1 mL of 0.05% trypsin. 1 mL of trypsin-treated cells was combined with phenol red-free DMEM + 0.2% charcoal stripped bovine serum + 1 × (Pe
n / Strep, Glutamine and NEAA) Dilute with 10 mL. 96-well microtiter plate (100 μL) containing drug diluted in medium in a volume of 100 μL
(L / well). The final volume per well is 200 μL, and each drug concentration is repeated in triplicate over a range of 1/2 log interval.

Incubation of cells with test compound or composition is performed at 37 ° C. under CO _2.
For 36 hours. After the incubation period, the cells are examined microscopically for evidence of cell damage. Next, the medium 10 containing the secreted alkaline phosphatase was used.
0 μL is taken from each well, transferred to a microtubule array, and heat-treated at 65 ° C. for 1 hour to inactivate endogenous alkaline phosphatase (however, thermostable secretory phosphatase is not inactivated).

The heat-treated medium is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD® (Tropix, Bedford, Mass.). Mix 50 μL of medium with 200 μL of CSPD cocktail and incubate at room temperature for 60 minutes. ML2200 microplate photometer (Dynate
Monitor luminescence using ch). Luminescence reflects the level of activation of the fos reporter construct stimulated by transiently expressed proteins.

[0232]DNA-CaPO ₄ precipitates for cells of 10cm flat  Ras expression plasmid (1 μg / μL): 10 μL DSE-SEAP plasmid (1 μg / μL): 2 μL sheared bovine thymus DNA (1 μg / μL): 8 μL 2MCaCl₂: 74 μL dH₂O: 506 μL.

[0233]2X HBS buffer  280 mM NaCl 10 mM KCl 1.5 mM Na₂HPO₄・ 2H₂O 12 mM glucose 50 mM HEPES final pH = 7.05.

[0234]Luminescence buffer (26 mL)  Assay buffer: 20 mL Emerald reagent (registered trademark) (Tropix): 2.5 mL 100 mM homoarginine: 2.5 mL CSPD reagent (registered trademark) (Tropix): 1.0 mL.

[0235]Assay buffer  0.05M NaHCO₃0.05M Na₂CO₃To pH 9.5
I do. MgCl₂To 1 mM.

[0236]Example 8  The processing assay used in this example and Example 9 was performed by
Assay described in the report (DeClue et al., Cancer Research 51, 712-717, 1991)
This is a variant of

[0237]K4B-Ras processing inhibition assay  Analysis of protein processing is performed using PSN-1 (human pancreatic cancer) cells. 1
A desired concentration of the test compound, lovastatin or
Or medium containing only solvent (methionine-free R supplemented with 2% fetal calf serum).
PMI or 200 mM glutamine (Gibco) each, 2% fetal calf serum
Cysteine-free / methionine-free DME supplemented with 0.035 mL
M) Add 3.5 mL. Inhibiting the rate-limiting step in the isoprenoid biosynthesis pathway
Lovastatin (5), a compound that blocks Ras processing in cells
-10 μM) are used as a positive control. Test compound is 1000 times
Prepare as a concentrated DMSO solution to give a final solvent concentration of 0.1%. 3
After incubation at 7 ° C. for 2 hours, 204 μCi / mL [³⁵S] Pro
Add Mix (Amersham, for cell labeling).

After the introduction of the labeled amino acid mixture, the cells are further (typically 6-24 hours)
Incubate at 37 ° C. The medium is removed and the cells are washed once with cold PBS.
Cells were scraped into 1 mL of cold PBS and harvested by centrifugation (10000 × at room temperature).
g for 10 seconds), cell lysis buffer (1% Nonidet P-40, 20 mM
HEPES (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.5
% Deoxycholate, 0.1% SDS, 1 mM DTT, 10 μg / mL AE
BSF, 10 μg / mL aprotinin, 2 μg / mL leupeptin and 2 μg
/ ML antipine) Dissolve by vortexing in 1 mL. The lysate is centrifuged at 15000 × g for 10 minutes at 4 ° C. and the supernatant is saved.

[0239] Immunoprecipitation of Ki4B-Ras utilizes a sample of lysate supernatant containing an equal amount of protein. Protein concentration is determined by the Bradford method using bovine serum albumin as a standard. An appropriate volume of lysate was made up to 1m with lysis buffer without DTT.
And add 8 μg of panRas monoclonal antibody Y13-259. The protein / antibody mixture is incubated on ice at 4 ° C. for 24 hours. The immunoconjugate is recovered on pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by spinning at 4 ° C. for 45 minutes.
The pellet is washed 3 times with 1 mL of lysis buffer without DTT and protease inhibitors.
Wash twice and elute buffer (10 mM Tris pH 7.4, 1% SDS) 100 μl
Resuspend in L. Ras is eluted from the beads by heating at 95 ° C. for 5 minutes, after which the beads are pelleted by brief centrifugation (15000 × g at room temperature for 30 seconds).

[0240] Kirsten-ras specific monoclonal antibody c-K-ras
A dilution buffer (0.1% Triton X-1) containing 2 μg of Ab-1 (Calbiochem)
00, 5 mM EDTA, 50 mM NaCl, 10 mM Tris (pH 7.
4)) Add supernatant to 1 mL. This second protein / antibody mixture is placed on ice at 4 ° C. for 1 hour.
Incubate for ~ 2 hours. Rat IgG was rotated for 45 minutes at 4 ° C.
Pansorbin (Calbiochem) coated with rabbit antiserum (Cappel) against
) Recover the immune complex. The pellet is washed three times with 1 mL of lysis buffer without DTT and protease inhibitors and resuspended in Laemmli sample buffer. Ras is eluted from the beads by heating at 95 ° C. for 5 minutes, after which the beads are pelleted by simple centrifugation. The supernatant was subjected to SD on a 12% acrylamide gel (bisacrylamide: acrylamide, 1: 100).
Perform S-PAGE and allow Ras to be visually observed by fluorography.

[0241]hDJ processing inhibition assay  The PSN-1 cells are seeded into a 24-well assay plate. For each test compound
And treating the cells at a minimum of seven concentrations in 1/2 log steps, the final solvent (DMS
O) The concentration is 0.1%. A vehicle only control is included in each assay plate. Fine
Cells at 37 ° C / 5% CO₂For 24 hours.

Next, the growth medium is aspirated and the sample is washed with PBS. Cells are lysed in SDS-PAGE sample buffer containing 5% 2-mercaptoethanol and placed at 95 ° C.
And heat for 5 minutes. After cooling on ice for 10 minutes, the nuclease mixture was added,
Reduce the viscosity of the sample.

The plate is incubated on ice for another 10 minutes. The sample is loaded on a preformed 8% acrylamide gel and subjected to electrophoresis at 15 mA / gel for 3 to 4 hours. Samples were then removed from the gel by Western blotting
Transfer to F membrane.

Block membranes in buffer containing 2% nonfat dry milk for 1 hour or more. Next, the membrane is HDJ-
Treat with a monoclonal antibody against 2 (Neomarkers Cat # MS-225), wash and treat with an alkaline phosphatase conjugated secondary antibody. Next, the membrane is treated with a fluorescence detection reagent and scanned with a fluorescence imager.

For each sample, the percent of total signal corresponding to the unprenyl species of HDJ (the relatively slow-moving species) is calculated by densitometry. Dose - response curves and _{IC 50} values obtained using the 4 parameter curve fit in SigmaPlot software.

[0246]Example 9  K4B-Ras processing inhibition assay  Analysis of protein processing is performed using PSN-1 (human pancreatic cancer) cells. 1
A semi-confluent cell in a 50 mm Petri dish is treated with a test composition at a desired concentration, prenyl protein.
A transferase inhibitor, an HMG-CoA reductase inhibitor or a solvent alone.
Add 20 mL of medium (RPMI supplemented with 15% fetal calf serum). Isop
Ras processing in cells by inhibiting the rate-limiting step in the renoid biosynthetic pathway
Cells treated with lovastatin (5-10 μM), a blocking compound,
Used as a sex control. Test compound or composition is 1000 times concentrated DMSO solution
So that the final solvent concentration is 0.1%.

The cells were incubated at 37 ° C. for 24 hours, the medium was removed, and the cells were
Wash twice with S. Cells are scraped into 2 mL cold PBS and collected by centrifugation (
(10000 × g at 4 ° C. for 5 minutes) and freeze at −70 ° C. Thaw and cell lysis buffer (50 mM HEPES (pH 7.2), 50 mM NaCl, 1% CH
APS, 0.7 μg / mL aprotinin, 0.7 μg / mL leupeptin, 30
The cells are lysed by the addition of 0 μg / mL pefabloc and 0.3 mM EDTA. Next, the lysate was quenched at 100,000 × g at 4 ° C. for 60 hours.
Centrifuge for minutes and remove the supernatant. The supernatant can be subjected to SDS-PAGE, HPLC analysis and / or chemical cleavage.

The lysate was purified with HiTra in buffer A (50 mM HEPES (pH 7.2)).
Load on p-SP (Pharmacia Biotech) column and split by gradient with buffer A + 1M NaCl. The peak fraction containing Ki4B-Ras was collected, diluted with an equal volume of water, and the panRas monoclonal antibody Y13- linked to agarose.
Immunoprecipitate at 259. The resulting protein / antibody mixture is incubated at 4 ° C. for 12 hours. The immune complex is washed three times with PBS and then three times with water. High pH conditions (
The Ras is eluted from the beads by pH> 10) or by heating at 95 ° C. for 5 minutes, after which the beads are pelleted by simple centrifugation. The supernatant can be subjected to SDS-PAGE, HPLC analysis and / or chemical cleavage.

[0249]Example 10  Rap1 processing inhibition assay  Procedure A:  Label, incubate and lyse cells according to the method described in Example 9.
.

A sample of lysate supernatant containing an equal amount of protein is used for Rap1 immunoprecipitation. Protein concentration is determined by the Bradford method using bovine serum albumin as a standard. Bring the appropriate volume of lysate to 1 mL with DTT-free lysis buffer,
Add 2 μg of Rap1 antibody Rap1 / Krev1 (121) (Santa Cruz Biotech). The protein / antibody mixture is incubated on ice at 4 ° C. for 1 hour. 4 ℃
The immune complexes are collected on pansorbin (Calbiochem) by spinning for 45 min. The pellet is dissolved in lysis buffer 1 without DTT and protease inhibitors.
Wash 3 times with mL, elution buffer (10 mM Tris pH 7.4, 1% SDS)
Resuspend in 100 μL. By heating at 95 ° C for 5 minutes, Rap1 was removed from the beads.
And then briefly centrifuge the beads (15000 × g for 30 seconds at room temperature)
Into pellets.

2 μg of Rap1 antibody Rap1 / Krev1 (121) (Santa Cruz Biotech)
Dilution buffer containing 0.1% Triton X-100, 5 mM EDTA, 50 mM
The supernatant is added to 1 mL of mM NaCl, 10 mM Tris (pH 7.4).
This second protein / antibody mixture is incubated on ice at 4 ° C. for 1-2 hours.
The immune complex is recovered on pansorbin (Calbiochem) by spinning at 4 ° C. for 45 minutes. The pellet is washed three times with 1 mL of lysis buffer without DTT and protease inhibitors and resuspended in Laemmli sample buffer. Rap1 is eluted from the beads by heating at 95 ° C. for 5 minutes, after which the beads are pelleted by simple centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bisacrylamide: acrylamide, 1: 100) so that Rap1 can be visually observed by fluorescence photography.

[0252]Procedure B:  The PSN-1 cells were subcultured on a 10 cm plate every 3 to 4 days and almost collected.
Divide into dense plates 1:20 and 1:40. The day before performing the assay, 5 × 1
0⁶Individual cells are plated on 15 cm plates and confluence at the same stage in each assay
Is ensured. The medium for these cells is 15% fetal bovine serum and
RPM1 1640 (Gibc) plus 1 × Pen / Strep antibiotic mixture
o).

On the day of the assay, cells were harvested from the 15 cm plate by trypsinization,
Dilute to 400,000 cells / mL with medium. 0.5 mL of these diluted cells,
Add 20,000 cells per well to each well of a 24-well plate.
It is assumed to be zero. The cells are then grown overnight at 37 ° C.

The compounds to be assayed are diluted in DMSO at 1/2 log dilution. The final concentration range to be assayed is 0.1-100 μM. Four concentrations per compound are typical. The compounds are diluted so that each concentration is 1000 times the final concentration (ie, 10 μM data points require 10 mM compound stock).

Dilute 2 μL of each 1000 × compound stock solution with 1 mL of medium to obtain a 2 × compound stock solution. A medium control solution (2 μL of DMSO per 1 mL of medium) is used. Add 0.5 mL of 2 × compound stock to cells.

After 24 hours, the medium is aspirated from the assay plate. 1 mL of PBS in each well
And then aspirate the PBS. SDS-P containing 5% 2-mercaptoethanol
Add 180 μL of AGE sample buffer (Novex) to each well. Using a heat block containing an assay plate adapter, plate
Heat at 0 ° C. for 5 minutes. Place plate on ice. 10 minutes later, RNA per well
Add 20 μL of the se / DNase mixture. This mixture is 1 mg / mL DNa
seI (Worthington Enzymes), 0.25 mg / mL Rnase A (Worthin
gton Enzymes), 0.5 M Tris-HCl (pH 8.0) and 50 mM
MgCl ₂ . Leave the plate on ice for 10 minutes. Samples are loaded onto gels or stored at -70 ° C until use.

Each assay plate (usually 3 compounds (each with 4-point titration) and control)
Require 15-well 14% Novex gel. Load 25 μL of each sample onto the gel. Run the gel at 15 mA for about 3.5 hours. It is important that the gel move sufficiently far to obtain sufficient separation between 21 kd (Rap1) and 29 kd (Rab6).

Next, the gel is transferred to a Novex precut PVDF membrane at 30 V (constant voltage) for 1.5 hours. Immediately after transfer, block overnight in 20 mL of Western Blocking Buffer (Western Washing Buffer (PBS + 0.1% Tween-20) containing 2% non-fat dry milk). If blocking over the weekend, add 0.02% sodium azide.
Block at 4 ° C. with gentle rocking of the membrane.

The blocking solution was discarded, and anti-Rap1 antibody (Santa Cruz Biochemical SC1482) was added:
Anti-Rab6 antibody (Santa Cruz) at 1000 (diluted in Western blocking buffer)
Biochemical SC310) (1: 5000) (diluted in Western Blocking Buffer) is added with 20 mL of fresh blocking solution. Incubate the membrane for 1 hour at room temperature with gentle rocking. Discard the blocking solution and wash the membrane three times with Western Wash Buffer for 15 minutes each wash. Two types of alkaline phosphatase conjugated antibodies (alkaline phosphatase conjugated anti-goat IgG and alkaline phosphatase conjugated anti-rabbit IgG [
Santa Cruz Biochemical]) at 1: 1000 (diluted with Western Blocking Buffer). The membrane is incubated for one hour and washed three times as described above.

Approximately 2 mL of Amersham ECF detection reagent per gel is loaded on an overhead transparent sheet (ECF) and a PVDF membrane is placed on the detection reagent with the PVDF membrane facing down. Incubate it for 1 minute and then place the membrane on a fresh transparent sheet.

The developed transparent sheet is scanned with a fluorescent imager to determine the minimum Rap1a inhibitory concentration from the lowest concentration of the compound or composition that produces a detectable Rap1a western signal. The Rap1a antibody used is an unprenylated / unprocessed Ra
The presence of a detectable Rap1a Western signal indicates inhibition of Rap1a prenylation, since it only identifies p1a.

[0262]Example 11  In vivo tumor growth inhibition assay (nude mouse)  In vivo potency as an inhibitor of cancer cell growth is determined by several known in the art.
It can be confirmed by the method. Examples of such in vivo efficacy tests are
(N.E.Kohl et al.,Nature Medicine, 1: 792-797
 (1995) and N.E.Kohl et al.,Proc.Nat.Acad.Sci., USA., 91: 9141-9145
(1994)).

[0263] Rodent fibroblasts (in DMEM salt 1 mL, ¹⁰⁶ cells / animal) transformed with oncogenes human mutated in Ha-ras or Ki-ras, and on day 0, 8 Inject subcutaneously into the left flank of -12 week old female nude mice (Harlan). The mice of each tumor gene group are randomly assigned to a vehicle administration group, a compound administration group or a combination administration group. Animals are dosed subcutaneously starting on day 1 and every day of the experiment.
Alternatively, the test combination composition or prenyl protein transferase inhibitor can be administered by a continuous infusion pump. The compound, compound combination or vehicle is administered in a total volume of 0.1 mL. All animals receiving vehicle have a diameter of 0.5-1
. The tumor is excised and weighed at the time of showing a 0 cm lesion, typically 11-15 days after cell injection. The average tumor weight in each treatment group for each cell line is calculated.

[Sequence list]

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 27/02 A61P 27/02 31/12 31/12 35/00 35/00 43/00 111 43/00 111 // A61K 31/4985 A61K 31/4985 (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL , PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, G, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN , IS, JP, KE, KG, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZWF terms (reference) 4C072 AA03 AA06 BB03 BB07 CC04 CC11 EE09 FF05 GG07 HH02 UU01 4C086 AA01 AA02 AA03 CB22 MA01 MA04 NA14 ZA01 ZA33 ZA36 ZA39 ZA75 ZA81 ZB26 ZB33 ZC20

Claims (26)

[Claims] 1. A compound of the following formula A or a pharmaceutically acceptable salt of said compound:
Or stereoisomers. Embedded image [Where R^1a, R^1b, R^1cAnd R^1dIs independently a) hydrogen b) aryl, heterocycle, C₃~ C₁₀Cycloalkyl, C₂~ C₆Alkenyl
, C₂~ C₆Alkynyl, halogen, perfluoro C₁~ C₆Alkyl, R¹⁰ O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (
O)-, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-
, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; C) unsubstituted or substituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl
When the above substituent is unsubstituted or substituted aryl, heterocyclic, C₃~ C₁₀Cycloal
Kill, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, halogen, perfluoro
C₁~ C₆Alkyl, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O) NR^{1 0} −, (R¹⁰)₂NC (O)-, CN, (R¹⁰)₂NC (NR¹⁰)-
, R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂And R^{1 1} OC (O) NR¹⁰Selected from those selected from: R^2a, R^2bAnd R^3aIs independently H; unsubstituted or substituted C_1-8Al
Kill, unsubstituted or substituted C_2-8Alkenyl, unsubstituted or substituted C_2-8A
Rukinyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, -C (=
O) -NR⁶R⁷Or -C (= O) -OR⁶Selected from the above;
The substituents are: 1) unsubstituted or a) C_1-4Alkyl, b) (CH₂)_pOR⁶C) (CH₂)_pNR⁶R⁷D) halogen, e) aryl or heterocyclic ring substituted with CN, 2) C_3-6Cycloalkyl, 3) OR⁶4) SR⁴, S (O) R⁴, SO₂R⁴, 5) -NR⁶R⁷, 6) -NR⁶-C (= O) -R⁷, 7) -NR⁶-C (= O) -NR⁵R⁷8) -OC (= O) -NR⁶R⁷, 9) -OC (= O) -OR⁶, 10) -C (= O) -NR⁶R⁷, 11) -SO₂-NR⁶R⁷, 12) -NR⁶-SO₂-R⁴, 13) -C (= O) -R⁶, 14) -C (= O) -OR⁶, 15) N₃Or 16) substituted with one or more of F;^2aAnd R^3aAre bonded to the same C atom to be united, and-(CH₂)_u-
Formed; one of the carbon atoms is O, S (O)_m, -NC (O)-and
-N (COR¹⁰R) may be replaced by a moiety selected from:^2aAnd R^3aMay be bound to the same carbon atom; R⁴Is unsubstituted or a) C_1-4Alkoxy, b) aryl or heterocycle, c) halogen, d) HO, e) -C (= O) -R¹¹, F) -SO₂R¹¹Or g) N (R¹⁰)₂  C substituted with_1-4Alkyl, C_3-6Cycloalkyl, heterocycle, aryl
R; R⁵, R⁶And R⁷Is independently H or unsubstituted a) C_1-4Alkoxy, b) aryl or heterocycle, c) halogen, d) HO, e) -C (= O) -R¹⁰, F) -SO₂R¹¹Or g) N (R¹⁰)₂  C substituted with_1-4Alkyl, C_3-6Cycloalkyl, heterocycle, aryl,
Aroyl, heteroaroyl, arylsulfonyl, heteroarylsulfonyl
Selected from; R⁶And R⁷May together form a ring; and independently, R⁵And R⁷May together form a ring; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C₃~ C₁₀ Cycloalkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, perfluoro
Alkyl, F, Cl, Br, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O)
NR¹⁰−, (R¹⁰)₂NC (O)-, R¹⁰ ₂NC (NR¹⁰)-, CN
, NO₂, R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂Ma
Or R¹¹OC (O) NR¹⁰-; And c) unsubstituted or unsubstituted or substituted aryl, unsubstituted or
Substituted heterocycle, C₃~ C₁₀Cycloalkyl, C₂~ C₆Alkenyl, C₂~ C₆ Alkynyl, perfluoroalkyl, F, Cl, Br, R¹⁰O-, R¹¹S (
O)_m-, R¹⁰C (O) NH-, (R¹⁰)₂NC (O)-, R¹⁰ ₂N-C
(NR¹⁰)-, CN, R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (
R¹⁰)₂Or R¹⁰C substituted by OC (O) NH—₁~ C₆Archi
R; R⁹Is a) hydrogen; b) C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, perfluoroalkyl,
F, Cl, Br, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−
, (R¹⁰)₂NC (O)-, R¹⁰ ₂NC (NR¹⁰)-, CN, NO₂,
R¹⁰C (O)-, R¹⁰OC (O)-, N₃, -N (R¹⁰)₂Or R¹¹ OC (O) NR¹⁰And c) unsubstituted or perfluoroalkyl, F, Cl, Br, R¹⁰ O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (O
)-, R¹⁰ ₂NC (NR¹⁰)-, CN, R¹⁰C (O)-, R¹⁰OC (
O)-, N₃, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰By-
Transformed C₁~ C₆Selected from alkyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl, unsubstituted or substituted
Selected from aryl and unsubstituted or substituted heterocycles; R¹¹Is independently C₁~ C₆Alkyl, unsubstituted or substituted aryl and unsubstituted
Selected from substituted or substituted heterocycles; A¹Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-And S (O)_mSelected from; A²Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-, S (O)_mAnd -C (R^1d)₂-Selected from; G¹, G²And G³Is independently H₂W is a heterocycle; V is selected from a) a heterocycle and b) aryl; X and Y are independently a bond, -C (= O)-or -S (= O )_mSelect from-
Done; Z¹Is selected from unsubstituted or substituted aryl and unsubstituted or substituted heterocycle.
Selected from the group consisting of one or more 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;²Is a bond, unsubstituted or substituted aryl and unsubstituted or substituted heterocycle
Wherein the substituted aryl or substituted heterocycle is selected from one or more of 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. Or 2) unsubstituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl, unsubstituted C₃~ C₆ Cycloalkyl or substituted C₃~ C₆Cycloalkyl (substituted C₁~ C₆Al
Kill and Replace C₃~ C₆Cycloalkyl has one or two a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) -NR⁶C (O) R⁷, E) HO, f) -S (O)_mR⁴G) halogen or h) perfluoroalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; q is 1 or 2 R is 0-5; s is independently 0, 1, 2 or 3; u is 4 or 5; ] 2. The compound according to claim 1 of the following formula A, or a medicament of the compound:
Pharmaceutically acceptable salts or stereoisomers. Embedded image [Where R^1aAnd R^1dIs independently hydrogen and C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or substituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl
The above substituent is unsubstituted or substituted aryl, heterocyclic, cycloalkyl,
Nil, R¹⁰O- and -N (R¹⁰)₂R is selected from; R^2bAnd R^3aIs independently H and CH₃Selected from; R^2aIs independently H; -C (= O) -NR⁶R⁷Or unbranched or branched
1) aryl, 2) heterocyclic, 3) OR⁶4) SR⁴, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;^2aAnd R^3aMay be bound to the same carbon atom; R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Is independently H; unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl, C_3-6Cycloalkyl, aryl and compound
Selected from elementary rings; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C₁~ C₆A
Luquil, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C₁~ C₆Perfluo
Loalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR¹⁰-, CN, NO₂ , (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, -N (R¹⁰)₂Ma
Or R¹¹OC (O) NR¹⁰And c) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, C₁~ C₆Pa
-Fluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂N
−C (NR¹⁰)-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (
O) NR¹⁰C replaced by-₁~ C₆Selected from alkyl; R⁹Is a) hydrogen; b) C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C₁~ C₆Perfluoro
Alkyl, F, Cl, R¹⁰O-, R¹¹S (O)_m-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
−N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-; And c) unsubstituted or C₁~ C₆Perfluoroalkyl, F, Cl, R ¹⁰ O-, R¹¹S (O)_m-, R¹⁰C (O) NR¹⁰−, CN, (R¹⁰) ₂ NC (NR¹⁰)-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹O
C (O) NR¹⁰C replaced by-₁~ C₆Selected from alkyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl, unsubstituted or substituted
Selected from aryl and unsubstituted or substituted heterocycles; R¹¹Is independently C₁~ C₆Alkyl, unsubstituted or substituted aryl and unsubstituted
Selected from substituted or substituted heterocycles; A¹Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-And S (O)_mSelected from; A²Is a bond, -C (O)-, -C (O) NR¹⁰-, -NR¹⁰C (O)-
, O, -N (R¹⁰)-, -S (O)₂N (R¹⁰)-, -N (R¹⁰) S (O
)₂-, S (O)_mAnd -C (R^1d)₂-Selected from; G¹, G²And G³Is independently H₂V is selected from: a) pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2
Oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl and thienyl
W is selected from the group consisting of pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, oxazolyl
, Pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl or iso
A heterocyclic ring selected from quinolinyl; X is a bond or —C (＝ O) —; Y is a bond or —C (＝ O) —; Z¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
The substituted aryl or substituted heterocycle is independently selected from one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;²Is a bond, unsubstituted or substituted aryl and unsubstituted or substituted heterocycle
Wherein the substituted aryl or substituted heterocycle is independently one or two
1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. Or 2) unsubstituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl, unsubstituted C₃~ C₆ Cycloalkyl or substituted C₃~ C₆Cycloalkyl (substituted C₁~ C₆Al
Kill and Replace C₃~ C₆Cycloalkyl has one or two a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) -NR⁶C (O) R⁷, E) HO, f) -S (O)_mR⁴G) halogen or h) perfluoroalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; q is 1 or 2 R is 0-5; s is independently 0, 1, 2 or 3; u is 4 or 5; ] 3. A compound according to claim 1 of the following formula B or a medicament of the compound:
Pharmaceutically acceptable salts or stereoisomers. Embedded image [Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;^2aAnd R^3aAny two of which are bonded to the same carbon atom
Well; R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O;¹, G²And G³Is independently H₂V is selected from: a) pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2
Oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl and thienyl
X is a bond or —C (＝ O) —; Y is a bond or —C (＝ O) —; Z¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
The substituted aryl or substituted heterocycle is independently selected from one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. Or 2) unsubstituted C₁~ C₆Alkyl, substituted C₁~ C₆Alkyl, unsubstituted C₃~ C₆ Cycloalkyl or substituted C₃~ C₆Cycloalkyl (substituted C₁~ C₆Al
Kill and Replace C₃~ C₆Cycloalkyl has one or two a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) -NR⁶C (O) R⁷, E) HO, f) -S (O)_mR⁴G) halogen or h) perfluoroalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3; ] 4. The compound according to claim 4 of the formula C or a medicament of the compound
Pharmaceutically acceptable salts or stereoisomers. Embedded image [Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;^2aAnd R^3aAny two of which are bonded to the same carbon atom
Well; R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O;¹And G³Is independently H₂And O; with the proviso that G¹And G³ At least one and only one is O; X is a bond or -C (= O)-; Y is a bond or -C (= O)-; Z¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
Selected from the group consisting of one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3; ] 5. A compound according to claim 4 of the following formula D or a pharmaceutically acceptable salt thereof.
Salts or stereoisomers acceptable for Embedded image [Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;²And R³Any two of which may be bonded to the same carbon atom
R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O; X is a bond; Y is a bond;¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
Selected from the group consisting of one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3; ] 6. A compound according to claim 5 of the following formula E or a medicament of said compound:
Pharmaceutically acceptable salts or stereoisomers. Embedded image [Where R^1aIs hydrogen or C₁~ C₆R selected from alkyl;^1bAnd R^1cIs independently a) hydrogen; b) aryl, heterocycle, cycloalkyl, R¹⁰O-, -N (R¹⁰)₂Also
Is C₂~ C₆Alkenyl; c) unsubstituted or aryl, heterocyclic, cycloalkyl, alkenyl, R¹⁰O
-Or -N (R¹⁰)₂C substituted with₁~ C₆Selected from alkyl; R^3aIs H and CH₃Selected from; R^2aIs H; -C (= O) -NR⁶R⁷And unbranched or unbranched
Or 1 or more of 1) aryl, 2) heterocyclic, 3) OR⁶4) SR^6a, SO₂R⁴Or 5) -C (= O) -NR⁶R⁷  C substituted with_1-5R selected from alkyl;²And R³Any two of which may be bonded to the same carbon atom
R⁴Is unsubstituted or a) C_1-4C substituted by alkoxy, b) halogen or c) aryl or heterocycle_1-4Alkyl and C_3-6Selected from cycloalkyl
R⁶And R⁷Are independently a) hydrogen, b) C₁~ C₆Alkyl, C₂~ C₆Alkenyl, C₂~ C₆Alkynyl, C ₁ ~ C₆Perfluoroalkyl, F, Cl, R¹⁰O-, R¹⁰C (O) NR^{1 0} -, CN, NO₂, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-,
R¹⁰OC (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰-;
And c) C₁~ C₆Perfluoroalkyl, R¹⁰O-, R¹⁰C (O) NR¹⁰ −, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰C (O)-, R¹⁰OC (O)
-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰C replaced by- ₁ ~ C₆Selected from alkyl; R⁸Is independently a) hydrogen; b) unsubstituted or substituted aryl, C₁~ C₆Alkyl, C₂~ C₆Alkene
Le, C₂~ C₆Alkynyl, C₁~ C₆Perfluoroalkyl, F, Cl, R^{1 0} O-, R¹⁰C (O) NR¹⁰-, CN, NO₂, (R¹⁰)₂NC (NR ¹⁰ )-, R¹⁰C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR^{1 0} -; And c) unsubstituted or substituted aryl, C₁~ C₆Perfluoroalkyl, R¹⁰ O-, R¹⁰C (O) NR¹⁰−, (R¹⁰)₂NC (NR¹⁰)-, R¹⁰ C (O)-, -N (R¹⁰)₂Or R¹¹OC (O) NR¹⁰Replaced by-
Done C₁~ C₆Selected from alkyl; R⁹Is hydrogen or methyl; R¹⁰Is independently hydrogen, C₁~ C₆Alkyl, benzyl and unsubstituted or
Selected from substituted aryl; R¹¹Is independently C₁~ C₆From alkyl and unsubstituted or substituted aryl
Selected; A¹Is selected from a bond, -C (O)-and O; X is a bond; Y is a bond;¹Is selected from unsubstituted or substituted aryl or unsubstituted or substituted heterocycle.
Selected from the group consisting of one or two 1) unsubstituted or a) C_1-4Alkoxy, b) NR⁶R⁷C) C_3-6Cycloalkyl, d) aryl or heterocycle, e) HO, f) -S (O)_mR⁴Or g) -C (O) NR⁶R⁷  C substituted with_1-4Alkyl, 2) aryl or heterocyclic, 3) halogen, 4) OR⁶, 5) NR⁶R⁷, 6) CN, 7) NO₂8) CF₃, 9) -S (O)_mR⁴, 10) -C (O) NR⁶R⁷Or 11) C₃~ C₆Z is substituted with cycloalkyl;³1) aryl, heteroaryl, arylmethyl, heteroarylmethyl, a
Unsubstituted or substituted selected from reelsulfonyl and heteroarylsulfonyl
Substituted group (the substituted group is one or more a) unsubstituted or C_1-4Alkoxy, NR⁶R⁷, C_3-6Cycloal
Killed, unsubstituted or substituted aryl, heterocycle, HO, -S (O)_mR^6aOr
-C (O) NR⁶R⁷C substituted with_1-4Alkyl, b) aryl or heterocycle, c) halogen, d) OR⁶, E) NR⁶R⁷, F) CN, g) NO₂H) CF₃, I) -S (O)_mR⁴, J) -C (O) NR⁶R⁷Or k) C₃~ C₆Substituted with cycloalkyl. M is 0, 1 or 2; n is 0, 1, 2, 3 or 4; p is 0, 1, 2, 3 or 4; r is 0-5 S is independently 0, 1, 2, or 3; ] 7. (±) 18- (3-chlorophenyl) -16,16a, 17,18,19,2
0-Hexahydro-17-oxo-5H-6,10-metheno-22H-benzo [
b] Pyrazino [2,1-e] imidazo [4,3-h] [1,6,9] oxadiazacyclopentadecyne-9-carbonitrile: (±) 16,16a, 17,18,19,20-Hexahydro-17-oxo-18-phenyl-5H-6,10-metheno-22H-benzo [b] pyrazino [
2,1-e] imidazo [4,3-h] [1,6,9] oxadiazacyclopentadecyne-9-carbonitrile: Or a pharmaceutically acceptable salt or stereoisomer of said compound. 8. A pharmaceutical composition comprising a pharmaceutical carrier and a therapeutically effective amount of a compound according to claim 1 dispersed in the carrier. 9. A pharmaceutical composition comprising a pharmaceutical carrier and a therapeutically effective amount of a compound according to claim 3 dispersed in said carrier. 10. A pharmaceutical composition comprising a pharmaceutical carrier and a therapeutically effective amount of the compound of claim 4 dispersed in said carrier. 11. A pharmaceutical composition comprising a pharmaceutical carrier and a therapeutically effective amount of a compound according to claim 7 dispersed in said carrier. 12. A method for inhibiting farnesyl protein transferase comprising the step of administering a therapeutically effective amount of the composition of claim 8 to a mammal in need of treatment. 13. A method of inhibiting farnesyl protein transferase comprising the step of administering a therapeutically effective amount of the composition of claim 9 to a mammal in need of treatment. 14. A method of inhibiting farnesyl protein transferase, comprising administering a therapeutically effective amount of the composition of claim 10 to a mammal in need of treatment. 15. A method of inhibiting farnesyl protein transferase, comprising the step of administering a therapeutically effective amount of the composition of claim 11 to a mammal in need of treatment. 16. A method for treating cancer comprising administering a therapeutically effective amount of the composition of claim 8 to a mammal in need of such treatment. 17. A method for treating cancer comprising administering a therapeutically effective amount of the composition of claim 9 to a mammal in need of such treatment. 18. A method for treating cancer comprising administering to a mammal in need of such treatment a therapeutically effective amount of the composition of claim 10. 19. A method for treating cancer comprising administering a therapeutically effective amount of the composition of claim 11 to a mammal in need of such treatment. 20. A method of treating a benign proliferative neurofibromatosis comprising administering to a mammal in need thereof a therapeutically effective amount of the composition of claim 8. 21. A method for treating vision loss associated with retinal neovascularization, comprising administering to a mammal in need of treatment a therapeutically effective amount of the composition of claim 8. 22. A method for treating hepatitis delta virus and related virus infections, comprising administering to a mammal in need of treatment a therapeutically effective amount of the composition of claim 8. 23. A method for preventing restenosis, comprising the step of administering a therapeutically effective amount of the composition of claim 8 to a mammal in need of treatment. 24. A method for treating polycystic kidney disease, comprising administering to a mammal in need of treatment a therapeutically effective amount of the composition of claim 8. 25. A pharmaceutical composition produced by combining the compound of claim 1 with a pharmaceutically acceptable carrier. 26. A method for producing a pharmaceutical composition comprising the step of combining the compound of claim 1 with a pharmaceutically acceptable carrier.