Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/10—Plasmid DNA
  • C12N2800/108—Plasmid DNA episomal vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2840/00—Vectors comprising a special translation-regulating system
  • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron

Definitions

• the invention relates to the field of recombinant DNA. In particular, it relates to the field of DNA libraries.
• high quality cDNA libraries is essential for gene identification strategies based on high throughput sequencing, on phenotypic expression in bacteria, yeast, or mammalian cells, on identification of interaction partners through the yeast two-hybrid system; or on recovery of cDNAs cognate to rare mRNAs. All of the varieties of expression cloning, for example, depend on the creation of, or access to, high quality cDNA libraries. Some of the key features of a high quality library include, a large number of independent clones (preferably greater than 10 7 ), a high percentage of inserts, oriented insertion of the genes, a high percentage of full length gene sequences and a population of clones which is representative of the starting population of RNAs.
• a typical strategy is to reverse transcribe the target RNA using an oligo-dT primer which comprises at its 5' end a restriction endonuclease recognition site. After preparing the complementary strand, adaptors are ligated onto the double stranded cDNA. These adaptors generate ends which are not complementary to the ends resulting from restriction of the site incorporated in the 5' end of the primer.
• the cDNA is then cut with this enzyme, purified to remove fragments and ligated into a suitably cleaved vector.
• the enzymes used in this strategy (most commonly Not I) restrict DNA with low frequency.
• this enzyme is known to restrict DNA within coding elements and several important genes have been identified (from non-oriented libraries) that contain Not I restriction sites.
• the vector is cut with one restriction enzyme, dephosphorylated, then cut with two additional restriction enzymes to produce a phosphorylated vector with non-complementary ends which can then be used in high-efficiency ligations with phosphorylated inserts.
• this technique leads to ends which can still ligate to one another to produce vector dimers or insert dimers.
• the most efficient incorporation of cDNA is by methods that produce non self-complementary ends on both cDNA and vector. However, methods described to date do not allow directional insertion of cDNA. In yet another method to reduce background, toxic elements have been incorporated into vectors.
• vectors are designed so that the cDNA insertion site resides within the promoter or coding elements of inducible genes which express products toxic to the host cell in the presence of an inducing agent. If cDNA is inserted in the vector, then the toxic gene will be interrupted and the host containing this plasmid will survive in the presence of inducer whereas host cells containing plasmid vector without insert will die. However, the toxicity may be incomplete, resulting in a number of slow growing clones without insert. In addition, traces of nuclease activity can contribute substantially to background by changing the reading frame of restricted plasmid prior to ligation. Thus there is a need in the art for better methods of preparing oriented, representational cDNA libraries with very low backgrounds.
• One aspect of this invention is a nucleotide polymer comprising two elements, one that binds to the nucleotide elements of another nucleic acid polymer and an element that comprises the recognition and cleavage site for an endonuclease.
• the binding elements include by way of example, but without limitation, random hexamers, random nanomers, homopolymers (deoxythymidine homopolymers in particular), sequence-specific nucleotides which bind to specific nucleic acid polymers, sequence-specific nucleotides which bind to known types or classes of nucleic acid polymers, and combinations of the above.
• the polymer of the invention is prepared by standard chemical or biological methods (Itakura, et al. 53 Ann. Rev. Biochem.
• this nucleotide polymer element is variable and is dependent on conditions affecting the specificity of the binding and is typically between 4 and 200 nucleotides in length, with a preferred length between 6 and 30 nucleotides.
• the element of the nucleotide polymer of the invention that comprises the recognition and cleavage site for an endonuclease is comprised of a nucleotide sequence that forms one complementary strand of a double stranded DNA sequence that is bound by an endonuclease and is cleaved by it.
• This nucleotide sequence is recognized only by endonucleases that cleave the coding elements of target genomes with a frequency less than 100 times per genome or by endonucleases which do not cleave cDNA.
• the target genome is the DNA which comprises the source of the nucleic acid polymer to which the nucleotide polymer of the invention binds.
• intron endonucleases An example of endonucleases that cleave the coding elements of target genomes with a frequency of less than 100 times per genome are the intron endonucleases. These endonucleases are intron-encoded enzymes that, under optimal conditions, recognize and cleave asymmetric DNA sequences of unusual length (14 - 31 bp). Intron endonucleases include by way of example, but without limitation, Pl-Sce I (VDE), I-Ceu I, I-Tli I and I-Ppo I. Optimum conditions are those which are known to provide maximum specificity and enzyme activity. The preferred intron endonuclease of the invention is VDE.
• This enzyme has an unusually long asymmetric recognition and cleavage site, with only 1 known recognition and cleavage site in S. cerevisiae, and none in E. coli.
• the wildtype recognition and cleavage sequence for this enzyme is 5'-TATGTCGGGTGCGGAGAAAGAGGTAAT GAAA-3' (Gimble and Wang, 263 J. Mol. Biol. 163-180 (1996)). It is known that this sequence is somewhat degenerate, i.e. base changes at certain locations enhance, decrease or have no impact on binding or cleavage. For example, substitutions of T for C at position -1 and G for C at position 6 generate a site which is more readily cleaved by VDE than the wild type.
• substitutions can be introduced at sites with known degeneracy to facilitate cleavage of the sequence, increase the GC content of the 3' overhang or introduce other changes as may be deemed valuable by those of skill in the art.
• substitution of Mn for Mg decreases the specificity of the enzyme. Consequently, changes to this sequence or to enzyme reaction conditions that preserve the functionality of the endonuclease (binding and cleavage) and that do not increase the frequency of cleavage to greater than 100 times per genome are within the scope of this invention.
• methylation-specific endonucleases methylation-specific endonucleases. These enzymes recognize only methylated DNA, and because cDNA or in vitro amplified DNA is not normally methylated (unless methyl nucleotides are deliberately introduced), it will not cleave these DNAs.
• the nucleotide sequence of the invention is methylated by chemical or enzymatic methods to produce a site which is cleaved by the methylation-specific endonuclease to produce a unique end.
• a nucleotide sequence comprising overlapping Cla I sites can be methylated with Cla I methylase to produce a Dpn I recognition and cleavage site. Because this enzyme recognizes only methylated DNA, it will not cleave cDNA or in vitro amplified DNA.
• This example is provided only to illustrate the means by which those of skill in the art may identify and modify nucleotide sequences which serve as unique binding sites for endonucleases which recognize and cleave only modified nucleotides.
• nucleotide polymer of the invention may be added to the nucleotide polymer of the invention as may be considered useful by those of skill in the art. These include by way of example, but without limitation, recognition and cleavage sites for other restriction endonucleases, sequences complementary to nucleotide polymers commonly used for sequencing, and recognition sites for DNA binding proteins.
• restriction and cleavage site for an endonuclease can be added to an existing DNA or RNA by techniques such as ligation of a double stranded oligonucleotide comprising the sequence for the restriction site, or by priming with a single stranded oligonucleotide comprising the sequence for the restriction site followed by extension of the first strand and synthesis of second strand, to create a duplex DNA which can be recognized and cleaved by the enzyme.
• the principle advantage of this invention is that it allows insertion of DNA into vectors without risk of cleaving the DNA which is being inserted. It is particularly useful in orienting
• adaptors are ligated to the inserted DNA before ligating the inserted DNA to the DNA sequence within which the DNA is to be inserted (vector).
• the vector comprises within the DNA insertion site one or more recognition and cleavage sites for an endonuclease which has less than 100 recognition and cleavage sites within the genome of the insert (rare endonuclease).
• the adaptors that are ligated to the insert DNA comprise either the full sequence of the recognition and cleavage site for the rare endonuclease of the invention, which must then be cleaved prior to insertion into the vector, or part of the recognition and cleavage site of the rare endonuclease which when ligated with the vector reconstitutes the full recognition and cleavage site for the rare endonuclease of the invention.
• the recognition and cleavage site for the rare endonuclease of the invention if not already present, may be added to the vector using the same strategies as described for the insert DNA. When the insert of the method is ligated to the vector of the method, one or more recognition and cleavage sites for the rare endonuclease of the invention are regenerated.
• This vector has an element located between two polylinker sites which comprises a conditionally lethal gene. The region between the two polylinker sites also constitutes the cDNA insertion site. If the lethal gene is not removed during the process of vector preparation, host cells which are susceptible to the lethal gene product will be killed when transformed with this construct.
• the conditionally lethal gene is the kilA gene from the broad host range plasmid RK2. In host strains lacking the repressor genes korA and korB, the kilA gene is expressed and kills the host (Kornacki et al.,
• vector DNA containing the MIA gene segment is prepared in good yield by standard methods from E. coli strains which constitutively express korA and korB.
• E. coli strains which constitutively express korA and korB.
• a normal transformation frequency ⁇ 10 9 colonies per ug DNA using electrocompetent cells
• the transformation frequency of kor " bacteria is between 1 and 10 colonies per ug DNA. This provides extremely powerful selection against vector.
• the CMV promoter of commonly used expression vectors is replaced with the more powerful and stable broad host range promoter from EFl ⁇ .
• the polylinker region of the vector is flanked by endonuclease sites which when cleaved, yield non-complementary ends.
• One of these ends is complementary to the cleavage product of an endonuclease that does not cleave cDNA.
• the ends are complementary to the cleavage product of an intron endonuclease.
• the preferred endonuclease is VDE.
• Other sites downstream of the insertion site are provided to confer properties of improved stability and expression in transfected mammalian cells. These include the EBNA-1 transcription unit, SV40 and human growth hormone polyadenylation signal sequences, human IgGl H/CH2 splice site, the Epstein-Barr virus OriP, puromycin acetyl transferase gene and transcription terminators.
• These preferred transcription termination sites are bidirectional, e.g. those from circular viral genome, such as those of the papova virus family, or synthetic bidirectional polyadenylation and termination signals (Figure 1)
• Such libraries are prepared without the use of bacteriophage or bacteriophage vectors.
• the vector of this method is a plasmid with two or more endonuclease recognition and cleavage sites which when cleaved by one or more endonucleases, give noncomplementary ends.
• these sites are recognized by a single endonuclease with a degenerate cleavage site which can provide an overhang of 4 or more bases with two or more deoxyguanidines and/or deoxycytidines.
• the preferred site in this method is recognized and cleaved by Bst XI.
• first strand synthesis is initiated with a nucleotide primer which binds to the target nucleic acid.
• a nucleotide primer which binds to the target nucleic acid.
• a nucleotide primer which binds to the target nucleic acid.
• these include, by way of example, but without limitation, random hexamers, random nanomers, homopolymers (deoxythymidine homopolymers in particular), sequence-specific nucleotides which bind to specific nucleic acid polymers, sequence-specific nucleotides which bind to known types or classes of nucleic acid polymers, and combinations of the above.
• Another element of the primer is the recognition and cleavage site for an endonuclease which is either not found in cDNA or found in very low frequency in target genomes.
• endonuclease recognition and cleavage sites that are not found in cDNA include by way of example but without limitation, the sites for intron endonucleases VDE, I-Ceu I, I-Tli I and I-Ppo I as well as for the methylation specific enzyme Dpn I.
• the preferred site is recognized and cleaved by the intron endonuclease VDE (Gimble and Stephens, 1995; Gimble and Thorner, 1992; Gimble and Thorner, 1993; Gimble and Wang, 1996). Cleavage of this site leaves a 4 base, 3 1 overhang that is rich in GC content but not palindromic (GTGC).
• First strand cDNA is synthesized by these or related enzymes according to standard procedures. This step is followed by second strand synthesis and ligation of phosphorylated, non-selfcomplementary adaptors.
• Second strand synthesis is performed using a suitable DNA polymerase such as T4 DNA polymerase or E. coli DNA polymerase I, and priming strategies such as RNase H treatment.
• Other enzymes such as thermostable polymerases, and/or other priming strategies may be used which are known to those of skill in the art.
• Phosphorylated adaptors are selected, annealed and ligated to the cDNA essentially as described previously (Seed and Aruffo, 1987; Aruffo and Seed, 1987a).
• the key feature of this method is that the adaptors are non-selfcomplementary, i.e. annealing of the two strands of the adaptor generates an overhang which is not complementary to itself.
• the endonuclease site (introduced through the primer) is then cleaved, leaving nonidentical, noncomplementary ends. It is preferred that the endonuclease not cleave the cDNA or that it cleave with very low frequency.
• the cDNA is fractionated and DNA greater than 0.5 - 1 kb in length is ligated to the vector and transformed into a suitable host.
• the preferred method of fractionation is potassium acetate gradients, although size exclusion chromatography, other density gradients or other techniques known to those of skill in the art may be used.
• the preferred vector of the method has a cDNA insertion site which comprises a toxic stuffer gene, preferably the kilA gene of the invention, and two flanking restriction sites, cleavage of which leaves non-selfcomplementary overhangs that are complementary to those of the adaptor and the cleaved intron endonuclease site on the cDNA.
• the overhang which is complementary to the adaptor will be located at the 5* end of the cDNA in the preferred version.
• vector-based strategies for producing low background may be coupled with the intron endonuclease/non-self complementary adaptor strategy for producing large unbiased libraries.
• such vectors must have phosphorylated, non- selfcomplementary ends which are complementary to the ends of the cDNA.
• a preferred enzyme for restriction of the preferred vector is Bst XI. This enzyme has a degenerate cleavage site which facilitates the selection of overhangs which are complementary to more than one restriction site and which may be manipulated to have other useful features such as high GC content.
• a single restriction digest can generate ends which are complementary to both the adaptor and the cleaved VDE site.
• Other enzymes with degenerate cleavage sites known to those of skill in the art may be used to leave overhangs on the vector that are capable of annealing and ligating to the non-selfcomplementary adaptors described above and to the overhang generated by the intron endonuclease.
• more than one enzyme may be used to generate the appropriate vector configuration. It is generally advantageous, but not essential, that the overhang created by the adaptor is complementary to the overhang generated by the enzyme used to cleave the insertion site of the vector.
• the vector must be treated in such a way that non-selfcomplementary overhangs are created on the vector which are complementary to the non-selfcomplementary overhangs on the cDNA. This can be achieved by ligating adaptors to appropriate restriction cleavage site of the vector or by similar techniques known to those of skill in the art.
• Alternative strategies which require the use of two enzymes or multiple manipulations of the vector are not preferred because they increase cost and the extra manipulations tend to reduce efficiency of library preparation.
• the plasmid vector containing the kilA gene is amplified in a korA, korB strain such as MC1061/p3 and isolated by standard methods.
• the purified plasmid is then digested with restriction enzymes that flank the MIA gene fragment.
• the MIA gene fragment is then separated from the vector by methods such as gel electrophoresis, size exclusion chromatography, density gradient centrifugation and other techniques known to those of skill in the art.
• the vector is then ready for further manipulations or immediate ligation of cDNA .
• this method the same approach used to prepared oriented cDNA inserts is used genetically to orient DNA in plasmids and other DNA vectors used in the cloning and manipulation of DNA, with little or no risk of cleaving the inserted DNA.
• a cDNA library with 1.1 x 10 8 recombinant clones was prepared from human small intestine.
• the cDNA was prepared from 2.5 ug of poly(A)+ RNA using an oligo-dT-VDE primer comprising 18 bases of dT and 66 bases including 31 bases of the original VDE recognition site (underlined).
• the sequence of the primer is : 5'-CGACGTTGTAAAACGACGGCCAGTGAATTCTC TATGTCGGGTGCGGAGAAAGAGG TAATGAAA TACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3 '
• the poly(A)RNA was diluted with DEPC-H 2 0 to 22 ul and mix with 2 ul of the primer (1 ug/ul). The mixture was incubated at 70°C for 10 minutes and transferred to ice for 5 minutes. The following components were added to the sample for the first strand cDNA synthesis: 8 ul of 5x 1" strand buffer [ 250mM Tris-HCl(pH 8.3), 375mM KC1, 15mM MgCl 2 ], 4 ul of 10 mM dNTP, 2 ul of 0.1 MDTT, 1 ul (40U) of RNase inhibitor ( Life Technologies, Inc., Gaithersburg, MD) and 1 ul (36 TJ) of AMV RT-XL (Life Science Research Products, Orlando,
• the sample was incubated at 42 °C for 1 hr and 70 °C for 10 minutes.
• the second strand cDNA was prepared by adding the following reagents to the first strand cDNA sample: 70 ul of H 2 O, 30 ul of 5x 2 nd strand Buffer [100 mM Tris-HCl (pH 6.9), 450 mM KC1, 23 mM MgCl 2 , 0.75 mM ⁇ -NAD + , 50 mM (NH 4 ) 2 SO 4 ], 2 ul of 0.1 M DTT, 3 ul of 10 mM dNTP, 0.5 ul (2TJ) of RNase H ( Life
• E. coli DNA polymerase I Life Technologies, Inc., Gaithersburg, MD
• E. coli DNA ligase Life Technologies, Inc., Gaithersburg, MD
• the sample was incubated 2 hours at 16°C, then added 5 ul (5TJ) of T4 DNA polymerase (Boehringer Mannheim, Indianapolis, IN ) and incubated 5 minutes at 16°C.
• the reaction was terminated by adding 10 ul of 0.5 M EDTA.
• the cDNA was purified by phenol extraction and ethanol precipitation.
• the ligation of the Bst XI adaptor to the cDNA was performed by adding the following reagents to 20 ul of the cDNA sample in H 2 O: 10 ul of phosphorylated Bst XI adaptors (5'-CTGGCTCA-3'; 5'- TGAGCCAGCCCC-3') ( 10 ug ), 10 ul of ligation buffer [330mM Tris-HCl, 50 mM MgC12, 5 mM ATP], 7 ul of 0.1 M DTT and 5 ul (5U)of T4 DNA ligase ( Life Technologies, Inc., Gaithersburg, MD ) and incubating overnight at 16°C.
• the cDNA was purified by phenol extraction and ethanol precipitation, then digested with 20 units of VDE (New England Biolabs, Beverly, MA) at 37°C for 6 hours.
• the cDNA was fractionated on a potassium acetate gradient (5 - 20%) for 3 hours at 50,000 rpm in a Beckman L5-50 centrifuge using an SW-50 rotor.
• the cDNA fragments greater than 700 bases were collected, concentrated by ethanol precipitation and dissolved in 50 ul of TE (10 mM Tris-HCl, pH 8.0, 1 mMEDTA).
• the pEAK8 vector was digested with Bst XI using manufacturer's recommended procedures (New England Biolabs, Beverly, MA) and purified on a potassium acetate gradient as above to remove the MIA stuffer. After ethanol precipitation, the vector was dissolved in TE at 50 ng/ul. Mix 47 ul of the vector with 47 ul of the fractionated cDNA , 258 ul of H 2 0, 94 ul of 5x T4 DNA ligase buffer (Life Technologies, Inc., Gaithersburg, MD) and 24 ul of ligase (1 U/ul) (Life
• the average size of the cDNA inserts was analyzed by extracting the plasmid DNA from 24 randomly selected colonies and digested with the restriction enzymes flanking the cDNA insert.
• the primary cDNA library for human small intestine contains l.lx 10 8 primary transformants with the average size of the cDNA inserts at 2.3 kb.
• the vector (without insert) background in this library is less than 1%.
• a cDNA library with 2.7 x 10 8 recombinant clones was constructed from human fetal kidney RNA.
• the cDNA was prepared from 5.0 ug of poly(A)+ RNA using another oligo-dT-VDE primer comprising 18 bases of dT and 60 bases including 28 bases of the modified VDE recognition site (underlined).
• oligo-dT-VDE primer comprising 18 bases of dT and 60 bases including 28 bases of the modified VDE recognition site (underlined).
• a variant with modification of two bases C to T at position -1 and C to G at position 6 of the original version
• deletion of three deoxyadenines at the 3' of the original version leads to a site that can also be cleaved by VDE enzyme.
• the sequence of the primer is :
• the cDNA library for human fetal kidney was prepared with similar protocol as above except the following changes: 1). the use of the modified oligo-dT-VDE primer ; 2). 2 hours of VDE digestion.
• This library contains 2.7 x 10 8 primary clones with average size of the cDNA inserts at 1.3 kb and less than 1 % of background.
• pEAKlO was prepared from pEAK8 by deleting an inhibitory regulatory sequence present in the EFl ⁇ promoter of pEAK8 and removing the BspLU 1 II site in the EFl ⁇ promoter.
• the protein expression levels from pEAKlO are 50% higher than those for pEAK8.
• the LacZ gene from E. coli was cloned in pEAKlO and in three other different commercial vectors and the resulting plasmids were transfected into 293HEK cells expressing the EBNA-1 protein and the large T-antigen (293 EBNA-T).
• the amount of recombinant protein expressed in 293 EBNA-T cells transfected with pEAKiO was, at least, three fold higher than when the same cells were transfected with any of the other plasmids.
• LacZ was cloned by standard methods (Current Protocols in Molecular Biology, Vol 1, Ausubel, et al., Eds, John Wiley & Sons, New York (1997)) into the Hind m-Not I sites of pEAKlO or pCDNA3.1 Hygro (+) [(Invitrogen, cat# V870-20) (this vector has the CMV promoter and the SV40 origin of replication)], pREP4 [(Invitrogen, cat# V004-50) (this vector has the RSV promoter, the EBNA- 1 expression cassette and an Epstein-Barr virus origin of replication)] or pCEP4 [(Invitrogen, cat# V044-50) (this vector has the CMV promoter, the EBNA-1 expression cassette and an Epstein-Barr virus origin of replication)] to generate pEAKlO- ⁇ gal, pCDNA3- ⁇ gal, pREP4- ⁇ gal or pCEP4- ⁇ gal.
• 5 x 10 5 293 EBNA-T cells were plated in 60 mm Petri dishes containing 5 ml DMEM medium supplemented with 10% calf serum and incubated at standard conditions (37 °C and 5% CO ⁇ ) for 24 hours. The medium was then changed and the plates were incubated in the same conditions for two additional hours.
• the cells were washed once with PBS and collected in 1 ml PBS, spun at 250 g for 5 minutes and resuspended in 100 ul 0.25 M Tris.ClH pH 8. The cells were then lysed by three freeze-thaw (liquid nitrogen/37 °C water bath) cycles and the insoluble material was pelleted at 12000 g for 5 minutes at 4°C.
• VDE a site-specific endonuclease from the yeast Saccharomyces cerevisiae. Journal of Biological Chemistry 268, 21844-53.

Landscapes

• Genetics & Genomics (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Wood Science & Technology (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Physics & Mathematics (AREA)
• Bioinformatics & Computational Biology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=21963583

Family Applications (1)

Country Status (3)

Families Citing this family (3)

• 1998
  • 1998-06-18 WO PCT/US1998/012620 patent/WO1998058067A1/en not_active Application Discontinuation
  • 1998-06-18 AU AU79744/98A patent/AU7974498A/en not_active Abandoned
  • 1998-06-18 EP EP98930330A patent/EP1012314A1/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events