EP0988371A1 - Recepteur humain tr9 du facteur de necrose tumorale - Google Patents

Recepteur humain tr9 du facteur de necrose tumorale

Info

Publication number
EP0988371A1
EP0988371A1 EP98926471A EP98926471A EP0988371A1 EP 0988371 A1 EP0988371 A1 EP 0988371A1 EP 98926471 A EP98926471 A EP 98926471A EP 98926471 A EP98926471 A EP 98926471A EP 0988371 A1 EP0988371 A1 EP 0988371A1
Authority
EP
European Patent Office
Prior art keywords
amino acid
seq
polypeptide
receptor
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98926471A
Other languages
German (de)
English (en)
Other versions
EP0988371A4 (fr
Inventor
Jian Ni
Guo-Liang Yu
Ping Fan
Reiner L. Gentz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of EP0988371A1 publication Critical patent/EP0988371A1/fr
Publication of EP0988371A4 publication Critical patent/EP0988371A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • the present invention relates to a novel member of the tumor necrosis factor family of receptors. More specifically, isolated nucleic acid molecules are provided encoding a novel human tumor necrosis factor receptor, TR9 (also known as Death Domain Containing Receptor 6, or simply DR6). TR9 polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of TR9 activity.
  • TR9 also known as Death Domain Containing Receptor 6, or simply DR6
  • TR9 polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same.
  • the invention further relates to screening methods for identifying agonists and antagonists of TR9 activity.
  • cytokines Many biological actions, for instance, response to certain stimuli and natural biological processes, are controlled by factors, such as cytokines. Many cytokines act through receptors by engaging the receptor and producing an intra-cellular response.
  • tumor necrosis factors (TNF) alpha and beta are cytokines, which act through TNF receptors to regulate numerous biological processes, including protection against infection and induction of shock and inflammatory disease.
  • the TNF molecules belong to the "TNF-ligand” superfamily, and act together with their receptors or counter-ligands, the "TNF-receptor” superfamily. So far, nine members of the TNF ligand superfamily have been identified and ten members of the TNF- receptor superfamily have been characterized.
  • TNF- ⁇ lymphotoxin- ⁇
  • LT- ⁇ lymphotoxin- ⁇
  • LT- ⁇ lymphotoxin- ⁇
  • FasL CD40L
  • CD27L CD30L
  • 4-1BBL 4-1BBL
  • OX40L nerve growth factor
  • NGF nerve growth factor
  • the superfamily of TNF receptors includes the p55TNF receptor, p75TNF receptor, TNF receptor- related protein, FAS antigen or APO-1, CD40, CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor (Meager, A., Biologicals 22:291-295 (1994)). Many members of the TNF-ligand superfamily are expressed by activated T- cells, implying that they are necessary for T-cell interactions with other cell types which underlie cell ontogeny and functions. (Meager, A., supra).
  • TNF and LT- are capable of binding to two TNF receptors (the 55- and 75- kd TNF receptors).
  • TNF and LT- ⁇ are involved in the pathogenesis of a wide range of diseases, including endotoxic shock, cerebral malaria, tumors, autoimmune disease, AIDS and graft-host rejection (Beutler et al., Science 264:667-668 (1994)). Mutations in the p55 receptor cause increased susceptibility to microbial infection.
  • Apoptosis or programmed cell death, is a physiologic process essential to the normal development and homeostasis of multicellular organisms (Steller, Science 267:1445-1449 (1995)). Derangements of apoptosis contribute to the pathogenesis of several human diseases including cancer, neurodegenerative disorders, and acquired immune deficiency syndrome (Thompson C. B., Science 267:1456-1462 (1995)). Recently, much attention has focused on the signal transduction and biological function of two cell surface death receptors, Fas/APO-1 and TNFR-1 (Cleveland et al., Cell 81 :479-482 (1995); Fraser et al., Cell 85:781-784 (1996); S.
  • Fas/APO-1 and TNFR-1 While family members are defined by the presence of cysteine-rich repeats in their extracellular domains, Fas/APO-1 and TNFR-1 also share a region of intracellular homology, appropriately designated the "death domain," which is distantly related to the Drosophila suicide gene, reaper (Golstein et al., Cell 81 :185-6 (1995); White et al., Science 264:677-83 (1994)). This shared death domain suggests that both receptors interact with a related set of signal transducing molecules that, until recently, remained unidentified.
  • Fas/APO-1 recruits the death domain-containing adapter molecule FADD/MORT1 (Chinnaiyan et al, Cell 81 :505-512 (1995); Boldin et al., J Biol. Chem. 270:7795-8 (1995); Kischkel et al, EMBO 14:5579-5588 (1995)), which in turn binds and presumably activates FLICE/MACH1, a member of the ICE/CED-3 family of pro-apoptotic proteases (Muzio et al., Cell 85:817-827 (1996); Boldin et al., Cell 85:803-815 (1996)).
  • TNFR-1 can signal an array of diverse biological activities-many of which stem from its ability to activate NF-kB (Tartaglia et al, Immunol Today 13:151-153 (1992)). Accordingly, TNFR-1 recruits the multivalent adapter molecule TRADD, which like
  • FADD also contains a death domain (Hsu et al., Cell 81 :495-504 (1995); Hsu et al., Cell 84:299-308 (1996)).
  • TRADD can signal both apoptosis and NF-kB activation (Hsu et al., Cell 84:299-308 (1996); Hsu et al., Immunity 4:387-396 (1996)).
  • TNF family ligands and receptors are varied and influence numerous functions, both normal and abnormal, in the biological processes of the mammalian system. There is a clear need, therefore, for identification and characterization of additional novel TNF receptors and ligands that influence biological activity, both normally and in disease states.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding the TR9 receptor having the amino acid sequence shown in
  • Figures 1 A-D SEQ ID NO:2 or the amino acid sequence encoded by the cDNA clone deposited as ATCC Deposit Number 209037 on May 15, 1997.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of TR9 receptor polypeptides or peptides by recombinant techniques.
  • the invention further provides an isolated TR9 polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
  • the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by the TR9 receptor. The method involves contacting cells which express the TR9 receptor with the candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.
  • the invention further provides diagnostic assays such as quantitative and diagnostic assays for detecting levels of TR9 receptor protein.
  • diagnostic assays such as quantitative and diagnostic assays for detecting levels of TR9 receptor protein.
  • a diagnostic assay in accordance with the invention for detecting over-expression of TR9, or soluble form thereof, compared to normal control tissue samples, may be used to detect the presence of tumors.
  • Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes.
  • Cellular response to TNF-family ligands include not only normal physiological responses, but also diseases associated with increased apoptosis or the inhibition of apoptosis.
  • Apoptosis-programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes.
  • Diseases associated with increased cell survival, or the inhibition of apoptosis include cancers, autoimmune disorders, viral infections, inflammation, graft vs. host disease, acute graft rejection, and chronic graft rejection.
  • Diseases associated with increased apoptosis include AIDS, neurodegenerative disorders, myelodysplastic syndromes, ischemic injury, toxin-induced liver disease, septic shock, cachexia, and anorexia.
  • the invention further provides a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TR9 polypeptide an effective amount of an agonist capable of increasing TR9 mediated signaling.
  • TR9 mediated signaling is increased to treat a disease wherein decreased apoptosis is exhibited.
  • the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TR9 polypeptide an effective amount of an antagonist capable of decreasing TR9 mediated signaling.
  • TR9 mediated signaling is decreased to treat a disease wherein increased apoptosis is exhibited.
  • Figures 1A-D shows the nucleotide sequence (SEQ ID NO: l) and deduced amino acid sequence (SEQ ID NO:2) of the TR9 receptor.
  • PSORT Analysis using the computer program PSORT reveals that the protein has a predicted leader sequence of about 40 amino acid residues (underlined) and a deduced molecular weight of about 72 kDa. It is further predicted that amino acid residues from about 41 to about 350 constitute the extracellular domain (amino acid residues from about 1 to about 310 in
  • SEQ ID NO:2 SEQ ID NO:2; from about 351 to about 367 the transmembrane domain (amino acid residues from about 311 to about 327 in SEQ ID NO:2); from about 368 to about 655 the intracellular domain (amino acid residues from about 328 to about 615 in SEQ ID NO:2)
  • Figure 2 shows the regions of similarity between the amino acid sequences of the TR9 receptor protein and Fas (SEQ ID NO:3), NGFR p75 (SEQ ID NO:4), and TNFR 1 (SEQ ID NO:5).
  • Figure 3 shows an analysis of the TR9 amino acid sequence.
  • Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
  • amino acid residues about 44 to about 121, about 156 to about 311, about 323 to about 348, about 376 to about 412, about 433 to about 474, about 485 to about 599, and about 611 to about 628 in Figures 1A-D correspond to the shown highly antigenic regions of the TR9 protein.
  • Figures 1A-D correspond to the following fragments, respectively, in SEQ ID NO:2: amino acid residues about 4 to about 81, about 116 to about 271, about 283 to about 308, about 336 to about 372, about 393 to about 434, about 445 to about 559, and about 571 to about 588.
  • Figures 4A-C Highlights of the predicted amino acid sequence of TR9.
  • Figure 4A The open reading frame for TR9 defines a type I transmembrane protein of 655 amino acids (SEQ ID NO:2).
  • Application of a computer program other than PSORT has predicted the mature protein to start at amino acid 42 (Gin, indicated by a black triangle).
  • the putative signal peptide and transmembrane domain are single and double underlined, respectively. Six potential N-glycosylation sites are indicated by black dots.
  • the cytoplasmic death domain is boxed.
  • An intracellular region containing a potential leucine-zipper motif overlapping with a proline rich sequence is underlined with a thick line.
  • Figure 4B Sequence alignment of extracellular cysteine-rich domains of TR9 (SEQ ID NO: 19) and osteoprotegrin (SEQ ID NO:20). Alignment was done with Megalign (DNASTAR) software. Shading represents identical residues.
  • Figure 4B Sequence alignment of extracellular cysteine-rich domains of TR9 (SEQ ID NO: 19) and osteoprotegrin (SEQ ID NO:20). Alignment was done with Megalign (DNASTAR) software. Shading represents identical residues.
  • Figure 4B Sequence alignment of extracellular cysteine-rich domains of TR9 (SEQ ID NO: 19) and osteoprotegrin
  • TR9 mediates nuclear factor kB activation.
  • Cotransfection of 293 cells was performed with the indicated expression constructs and a NF-kB luciferase reporter construct. After transfection (at 36 hours), cell extracts were prepared and luciferase activities determined as previously described (Chinnaiyan et al., Science 274:990-992 (1996); and Pan et al., Science 276:111-113 (1997)). Transfection efficiency was monitored by ⁇ -galactosidase activity. A portion of the transfected cells was used to monitor expression of TR9 or TR9 delta. Cell lysates were prepared and immunoprecipitated with FLAG M2 affinity gel and the presence of TR9 or TR9 delta detected by blotting with anti-FLAG.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a TR9 receptor polypeptide having the amino acid sequence shown in Figures 1A-C (SEQ ID NO:2), which was determined by sequencing a cloned cDNA.
  • the TR9 receptor protein of the present invention shares sequence homology with Fas (SEQ ID NO:3), NGFR p75 (SEQ ID NO:4), and TNFR 1(SEQ ID NO:5).
  • Fas SEQ ID NO:3
  • NGFR p75 SEQ ID NO:4
  • TNFR 1(SEQ ID NO:5) The nucleotide sequence shown in SEQ ID NO:5
  • NO:l was obtained by sequencing a cDNA clone, which was deposited on May 15, 1997 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given accession number 209037.
  • the deposited clone is inserted in the pBluescript SK(-) plasmid (Stratagene, LaJolla, CA) using the EcoRI and Xhol restriction endonuclease cleavage sites.
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • nucleic acid molecule of the present invention encoding a TR9 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in Figures 1A-D was discovered in a cDNA library derived from human microvascular endothelial cells.
  • the gene was also identified in cDNA libraries from the following tissues: human placenta, stromal cells, human amygdala, human umbilical vein endothelial cells, kidney cancer, human gall bladder, reportedly adult brain, normal human liver, hepatocellular tumor, keratinocytes, bone marrow, macrophage, human synovial sarcoma, human hippocampus, and human tonsils.
  • the determined nucleotide sequence of the TR9 cDNA of Figures 1 A-D contains an open reading frame encoding a protein of about 615 amino acid residues, with a predicted leader sequence of about 40 amino acid residues, and a deduced molecular weight of about 72 kDa.
  • the amino acid sequence of the predicted mature TR9 receptor is shown in Figures 1A-D (SEQ ID NO:2) from amino acid residue about 1 to residue about 615.
  • the TR9 protein shown in Figures 1 A-D (SEQ ID NO:2) is about 24% identical and about 43% similar to NGFR ( Figure 2).
  • TR9 induces of mammalian cells apoptosis (see Figure 6). It is expected that TR9-induced apoptosis will be efficiently blocked by inhibitors of death proteases including z-VAD-fmk, an irreversible broad spectrum caspase inhibitor and CrmA, a cowpox virus encoded serpin that preferentially inhibits apical caspases such as FLICE/MACH-1 (caspase-8).
  • the present invention also provides the mature form(s) of the TR9 receptor of the present invention.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity.
  • cleavage of a secreted protein is not entirely uniform, which results in two or more mature species on the protein.
  • the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.
  • the present invention provides a nucleotide sequence encoding the mature TR9 receptor polypeptides having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. 209037 and as shown in Figures 1 A-D (SEQ ID NO:2).
  • the mature TR9 protein having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit 209037 is meant the mature form(s) of the TR9 receptor produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host.
  • the mature TR9 receptor having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209037 may or may not differ from the predicted "mature" TR9 receptor protein shown in SEQ ID NO:2 (amino acids from about 1 to about 615) depending on the accuracy of the predicted cleavage site based on computer analysis.
  • Methods for predicting whether a protein has a secretory leader as well as the cleavage point for that leader sequence are available. For instance, the methods of McGeoch (Virus Res. 3:271-286 (1985)) and von Heinje (Nucleic Acids Res. 14:4683- 4690 (1986)) can be used.
  • the predicted amino acid sequence of the complete TR9 polypeptides of the present invention were analyzed by a computer program (“PSORT”) (K. Nakai and M. Kanehisa, Genomics 14:897-91 1 (1992)), which is an expert system for predicting the cellular location of a protein based on the amino acid sequence.
  • PSORT computer program
  • the analysis by the PSORT program predicted the cleavage site between amino acid residues 40 and 41 in Figures 1A-D (amino acid residues -1 and 1 in SEQ ID NO:2).
  • the leader sequence for the TR9 receptor protein is predicted to consist of amino acid residues from about 1 to 40 in Figures 1 A-D (amino acid residues -40 to about -1 in SEQ ID NO:2), while the mature TR9 protein is predicted to consist of residues from about 41 to 655 in Figures 1 A-D
  • the predicted TR9 receptor polypeptide encoded by the deposited cDNA comprises about 655 amino acids, but may be anywhere in the range of 645-665 amino acids; and the predicted leader sequence of this protein is about 40 amino acids, but may be anywhere in the range of about 30 to about 50 amino acids.
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDN A and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment.
  • recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention.
  • Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) shown in Figures 1 A-D (SEQ ID NO:l); DNA molecules comprising the coding sequence for the mature TR9 protein; and DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the TR9 protein shown in Figures 1A-D (SEQ ID NO:2).
  • ORF open reading frame
  • SEQ ID NO:l DNA molecules comprising the coding sequence for the mature TR9 protein
  • ORF open reading frame
  • SEQ ID NO:l DNA molecules comprising the coding sequence for the mature TR9 protein
  • nucleic acid molecules having nucleotide sequences related to extensive portions of the nucleotide sequence in Figures 1A-D of (SEQ ID NO:l), which have been determined from the following related cDNA clones: HIBEJ86R (SEQ ID NO:6), HL1AA79R (SEQ ID NO:7), HHFGD57R (SEQ ID NO:8), HSABG38R (SEQ ID NO:9), and HHPDZ31R (SEQ ID NO:10).
  • the invention includes a polynucleotide comprising any portion of at least about 30 nucleotides, preferably at least about 50 nucleotides, of the nucleotide sequence disclosed in Figures 1A-D from nucleotides 655 to 907 (nucleotides 615 to
  • the invention provides isolated nucleic acid molecules encoding the TR9 receptor polypeptide having an amino acid sequence as encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 209037 on May 15, 1997.
  • nucleic acid molecules are provided encoding the mature TR9 receptor polypeptide or the full-length TR9 receptor polypeptide lacking the N-terminal methionine.
  • the invention also provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figures 1 A-D (SEQ ID NO:l) or the nucleotide sequence of the TR9 cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • isolated molecules particularly DNA molecules, are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the TR9 receptor gene in human tissue, for instance, by Northern blot analysis.
  • the present invention is further directed to fragments of the isolated nucleic acid molecules described herein.
  • a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA, or the nucleotide sequence shown in Figures 1A-D (SEQ ID NO:l), or the complementary strand thereto is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40, 50, 100, 150, 200, 250, 300, 400, or 500 nt in length.
  • These fragments have numerous uses which include, but are not limited to, diagnostic probes and primers as discussed herein.
  • fragments 50-1500 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figures 1A-D (SEQ ID NO:l).
  • a fragment at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figures 1A-D (SEQ ID NO:l).
  • TR9 polynucleotide fragments of the invention include, for example, fragments that comprise, or alternatively, consist of, a sequence from about nucleotide 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 445-879, 451-500, 501-550, 551-600, 615-651, 651-700, 701-750, 751-800, 800-850, 850-867, 851-900, 901-950, 951-1000, 1001-1050, 1051-1 100, 1101-1150, 1 151-1200, 1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450,
  • the polynucleotide fragments of the invention encode a polypeptide which demonstrates a functional activity.
  • a polypeptide demonstrating "functional activity” is meant, a polypeptide capable of displaying one or more known functional activities associated with a complete or mature TR9 polypeptide.
  • Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a TR9 polypeptide for binding) to an anti-TR9 antibody], immunogenicity (ability to generate antibody which binds to a TR9 polypeptide), and ability to bind to a receptor or ligand for a TR9 polypeptide.
  • Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising the TR9 receptor extracellular domain (predicted to constitute amino acid residues from about 1 to about 310 in SEQ ID NO:2); a polypeptide comprising the four TNFR-like cysteine rich motifs of TR9 (amino acid residues 67 to 211 in Figures 1 A-D; amino acid residues 27 to 171 in SEQ ID NO:2), a polypeptide comprising the TR9 receptor transmembrane domain (predicted to constitute amino acid residues from about 31 1 to about 327 in SEQ ID NO:2); a polypeptide comprising the TR9 receptor intracellular domain (predicted to constitute amino acid residues from about 328 to about 615 in SEQ ID NO: 2); a polypeptide comprising the TR9 receptor extracellular and intracellular domains with all or part of the transmembrane domain deleted; a polypeptide comprising the TR9 receptor death domain (predicted to constitute
  • nucleic acid fragments of the present invention also include nucleic acid molecules encoding one or more epitope-bearing portions of the TR9 receptor protein.
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising amino acid residues from about 4 to about 81 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about 1 16 to about 271 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about 283 to about 308 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about 336 to about 372 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about 393 to about 434 in SEQ ID NO:2; a polypeptide comprising amino acid residues from about 445 to about 559 in SEQ ID NO:2; and a polypeptide comprising amino acid residues from about 571 to about 588 in SEQ ID NO:2.
  • the inventors have determined that the above polypeptide fragments are antigenic regions of the TR9 receptor. Methods for determining other such epitope-bearing portions of the TR9 protein
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes, preferably under stringent hybridization conditions, to a portion of the polynucleotide sequence of a polynucleotide of the invention such as, for instance, the cDNA clone contained in ATCC Deposit 209037.
  • stringent hybridization conditions is intended overnight incubation at 42°C in a solution comprising: 50% formamide, 5x SSC (150 mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°C.
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70, or 80-150 nt. or the entire length of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • polynucleotides of the invention hybridize to a complementary strand of a polynucleotide encoding amino acid residues 40-152, 40- 48, 40-51 , 51-66, 66-73, 73-83, 83-104, 104-110, 1 10-128, 128-146, and/or 146-152 as depicted in SEQ ID NO:2.
  • a portion of a polynucleotide of "at least 20 nt in length,” for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figures 1A-D (SEQ ID NO:l).
  • a polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly tract of the TR9 receptor cDNA shown in SEQ ID NO:l), or to a complementary stretch of T (or U) residues, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double- stranded cDNA clone generated using oligo dT as a primer).
  • nucleic acid molecules of the present invention which encode a TR9 receptor polypeptide may include, but are not limited to, those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding the about amino acid leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available.
  • a pQE vector Qiagen, Inc.
  • hexa- histidine provides for convenient purification of the fusion protein.
  • the "HA" tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37:767-778 (1984).
  • fusion proteins include the TR9 receptor fused to Fc at the N- or C-terminus.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the TR9 receptor. Variants may occur naturally, such as a natural allelic variant. By an "allelic variant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
  • variants include those produced by nucleotide substitutions, deletions or additions, which may involve one or more nucleotides.
  • the variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the TR9 receptor or portions thereof. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecules comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence shown in Figures 1 A-D (SEQ ID NO:2); (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence shown in Figures 1A-D (SEQ ID NO:2), but lacking the N- terminal methionine; (c) a nucleotide sequence encoding the predicted mature TR9 polypeptide (full-length polypeptide with any attending leader sequence removed) comprising the amino acid sequence at positions from about 1 to about 615 in SEQ ID NO:2; (d) a nucleotide sequence encoding the TR9 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
  • nucleotide sequence encoding a TR9 receptor polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the TR9 receptor.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • the reference (query) sequence may be the entire TR9 nucleotide sequence shown in Figures 1A-D (SEQ ID NO:l) or any fragment as described herein.
  • nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figures 1A-D (SEQ ID NO:l) or to the nucleotides sequence of the deposited cDNA clone can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version
  • Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences.
  • Bestfit or any other sequence alignment program uses the parameters, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • the identity between a reference (query) sequence (a sequence of the present invention) and a subject sequence is determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. A determination of whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of this embodiment.
  • a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are made for the purposes of this embodiment.
  • the present application is directed to nucleic acid molecules at least 90%,
  • nucleic acid sequence shown in Figures 1A-D SEQ ID NO:l
  • nucleic acid sequence of the deposited cDNA irrespective of whether they encode a polypeptide having TR9 receptor activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having TR9 receptor activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having TR9 receptor activity include, ter alia, (1) isolating the TR9 receptor gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the TR9 receptor gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, N.Y. (1988); and (3) Northern Blot analysis for detecting TR9 receptor mRNA expression in specific tissues.
  • FISH in situ hybridization
  • nucleic acid molecules having sequences at least 90%, 95%), 96%), 97%, 98% or 99% identical to the nucleic acid sequence shown in Figures 1 A-D (SEQ ID NO:l), the nucleic acid sequence of the deposited cDNA, or fragments thereof, which do, in fact, encode a polypeptide having TR9 receptor activity.
  • a polypeptide having TR9 receptor activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the TR9 receptor of the invention (either the full-length protein or, preferably, the mature protein), as measured in a particular immunoassay and/or biological assay.
  • TR9 receptor activity can be measured using the cell death assays performed essentially as previously described (Chinnaiyan et al., Cell 81 :505-512 (1995); Boldin et al. , J. Biol
  • TR9-induced apoptosis will be blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
  • apoptosis induced by TR9 will be blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHalC360S).
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figures
  • This invention is also related to the use of TR9 polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of TR9 associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to a disease which results from under-expression over-expression or altered expression of TR9 or a soluble form thereof, such as, for example, tumors or autoimmune disease.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis. (Saiki et al., Nature 324: 163-166 (1986)).
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the nucleic acid encoding TR9 can be used to identify and analyze TR9 expression and mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled TR9 RNA or alternatively, radiolabeled TR9 antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing.
  • cloned DNA segments may be employed as probes to detect specific DNA segments.
  • the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method.
  • a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent- tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science 230:1242 (1985)).
  • Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., restriction fragment length polymorphisms ("RFLP") and Southern blotting of genomic DNA.
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, or which are otherwise engineered to produce the polypeptides of the invention, and the production of TR9 receptor polypeptides, or fragments thereof, by recombinant techniques.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the DNA of the invention is operatively associated with an appropriate heterologous regulatory element (e.g., promoter or enhancer), such as, the phage lambda PL promoter, the E. coli lac, trp, and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • an appropriate heterologous regulatory element e.g., promoter or enhancer
  • promoter or enhancer such as, the phage lambda PL promoter, the E. coli lac, trp, and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • promoter or enhancer such as, the phage lambda PL promoter, the E. coli lac, trp, and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
  • Other suitable promoters
  • these constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will preferably include a translation initiating at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture and tetracycline or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQE70, pQE60 and pQE- 9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • the present invention also relates to host cells containing the vector constructs discussed herein, and additionally encompasses host cells containing nucleotide sequences of the invention that are operably associated with one or more heterologous control regions (e.g., promoter and/or enhancer) using techniques known of in the art.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell (e.g., a human derived cell), or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • the host strain may be chosen which modulates the expression of the inserted gene sequences, or modifies and processes the gene product in the specific fashion desired.
  • Expression from certain promoters can be elevated in the presence of certain inducers; thus expression of the genetically engineered polypeptide may be controlled.
  • different host cells have characteristics and specific mechanisms for the translational and post-translational processing and modification (e.g., phosphorylation, cleavage) of proteins. Appropriate cell lines can be chosen to ensure the desired modifications and processing of the foreign protein expressed.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection. electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology ( 1986).
  • the polypeptide may be expressed in a modified form, such as a fusion protein (comprising the polypeptide joined via a peptide bond to a heterologous protein sequence (of a different protein)), and may include not only secretion signals, but also additional heterologous functional regions.
  • a fusion protein can be made by ligating polynucleotides of the invention and the desired nucleic acid sequence encoding the desired amino acid sequence to each other, by methods known in the art, in the proper reading frame, and expressing the fusion protein product by methods known in the art.
  • a fusion protein can be made by protein synthetic techniques, e.g., by use of a peptide synthesizer.
  • a region of additional amino acids, particularly charged amino acids may be added to the
  • polypeptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide.
  • the addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EPA 0 232 262).
  • Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as an antigen for immunizations.
  • human proteins such as the hIL5-receptor
  • Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, Bennett et al., J. of Molec. Recognition 8:52-58 (1995) and Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
  • the TR9 receptor can be recovered and purified from recombinant cell cultures by standard methods which include, but are not limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells.
  • polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • polypeptides of the invention may also include an initial modified methionine residue or alternatively, may be missing the N-terminal methionine, in some cases as a result of host-mediated processes.
  • TR9 receptor polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of TR9.
  • applications in treatment of tumors, resistance to parasites, bacteria and viruses, to induce proliferation of T-cells, endothelial cells and certain hematopoietic cells, to treat restenosis, graft vs. host disease, to regulate anti-viral responses and to prevent certain autoimmune diseases after stimulation of TR9 by an agonist.
  • Additional applications relate to diagnosis and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are discussed further below.
  • the invention further provides an isolated TR9 receptor polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in Figures 1A-D (SEQ ID NO:2), or a peptide or polypeptide comprising a portion of the above polypeptides.
  • the polypeptides of this invention may be membrane bound or may be in a soluble circulating form. Soluble peptides are defined by amino acid sequence wherein the sequence comprises the polypeptide sequence lacking the transmembrane domain.
  • the polypeptides of the present invention may exist as a membrane bound receptor having a transmembrane region and an intra- and extracellular region or they may exist in soluble form wherein the transmembrane domain is lacking.
  • a form of the TR9 receptor is the TR9 receptor shown in Figures 1A-D (SEQ ID NO:2) which contains, in addition to a leader sequence, transmembrane, intracellular and extracellular domains.
  • SEQ ID NO:2 SEQ ID NO:2
  • this form of the TR9 receptor appears to be localized in the cytoplasmic membrane of cells which express this protein. It will be recognized in the art that some amino acid sequences of the TR9 receptor can be varied without significant effect on the structure or function of the protein.
  • the invention further includes variations of the TR9 receptor which show substantial TR9 receptor activity or which include regions of TR9 receptor protein such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
  • guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990).
  • the fragment, derivative or analog of the polypeptide of Figures 1A-D may be: (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue(s), and more preferably at least one but less than ten conserved amino acid residues), and such substituted amino acid residue(s) may or may not be one encoded by the genetic code; or (ii) one in which one or more of the amino acid residues includes a substituent group; or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol); or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide.
  • a conserved or non- conserved amino acid residue preferably a
  • the TR9 receptor of the present invention may include one or more amino acid substitutions, deletions, or additions, either from natural mutations or human manipulation.
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 1).
  • the number of substitutions, additions or deletions in the amino acid sequence of Figures 1A-D and/or any of the polypeptide fragments described herein is 75, 70, 60,
  • Amino acids in the TR9 protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)).
  • polypeptides of the present invention are preferably provided in an isolated form.
  • isolated polypeptide is intended a polypeptide removed from its native environment.
  • a polypeptide produced and/or contained within a recombinant host cell is considered isolated for purposes of the present invention.
  • polypeptides that have been purified, partially or substantially, from a recombinant host cell are polypeptides that have been purified, partially or substantially, from a recombinant host cell.
  • a recombinantly produced version of the TR9 receptor can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
  • polypeptides of the present invention include the polypeptide encoded by the deposited cDNA including the leader; the mature polypeptide encoded by the deposited cDNA minus the leader (i.e., the mature protein); a polypeptide comprising amino acids about -40 to about 615 in SEQ ID NO:2; a polypeptide comprising amino acids about -39 to about 615 in SEQ ID NO:2; a polypeptide comprising amino acids about 1 to about 615 in SEQ ID NO:2; a polypeptide comprising the extracellular domain; a polypeptide comprising the four TNFR-like cysteine rich motifs of TR9 (amino acid residues 67 to 211 in Figures 1A-D; amino acid residues 27-171 in SEQ ID NO:2); a polypeptide comprising the transmembrane domain; a polypeptide comprising the intracellular domain; a polypeptide comprising the extracellular and intracellular domains with all or part of the transmembrane domain deleted; a
  • polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a TR9 receptor polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the TR9 receptor.
  • a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • whether any particular polypeptide is at least 90%,
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • the identity between a reference (query) sequence (a sequence of the present invention) and a subject sequence is determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)).
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence.
  • a determination of whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of this embodiment.
  • 90 residues were perfectly matched the final percent identity would be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected.
  • polypeptides of the present invention have uses which include, but are not limited to, molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of the TR9 polypeptide depicted in Figures 1A-D (SEQ ID NO:2) or encoded by the cDNA of the deposited clone.
  • N- terminal deletions of the TR9 polypeptide can be described by the general formula m to 615, where m is a number from -39 to 614 corresponding to the position of amino acid identified in SEQ ID NO:2 and preferably, corresponds to one of the N-terminal amino acid residues identified in the N-terminal deletions specified herein.
  • N-terminal deletions of the TR9 polypeptide of the invention comprise, or alternatively consist of, amino acid residues: Q-2 to L-615; P-3 to L-615; E-4 to L-615; Q-5 to L-615; K-6 to L-615; A-7 to L-615; S-8 to L-615; N-9 to L-615; L-10 to L-615; 1-11 to L-615; G-12 to L-615; T-13 to L-615; Y-14 to L-615; R-15 to L-615; H-16 to L-615; V-17 to L-615; D-18 to L-615; R-19 to L-615; A-20 to L-615;
  • polypeptides 615; S-609 to L-615; H-610 to L-615; of SEQ ID NO:2.
  • Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • N-terminal deletions of the TR9 polypeptide can be described by the general formula m to 310 where m is a number from -40 to 309 corresponding to the amino acid sequence identified in SEQ ID NO:2.
  • N terminal deletions of the TR9 of the invention comprise, or alternatively, consist of, amino acid residues: Q-2 to L-310; P-3 to L-310; E-4 to L- 310; Q-5 to L-310; K-6 to L-310; A-7 to L-310; S-8 to L-310; N-9 to L-310; L-10 to L-310; 1-11 to L-310; G-12 to L-310; T-13 to L-310; Y-14 to L-310; R-15 to L-310; H-16 to L-310; V-17 to L-310; D-18 to L-310; R-19 to L-310; A-20 to L-310; T-21 to
  • polypeptides H-295 to L-310; P-296 to L-310; R-297 to L-310; Q-298 to L- L-300 to L-310; H-301 to L-310; K-302 to L-310; H-303 to L- D-305 to L-310; of SEQ ID NO:2.
  • Polynucleotides encoding these polypeptides are also encompassed by the invention. Further embodiments of the invention are directed to C-terminal deletions of the TR9 polypeptide described by the general formula 1 to n, where n is a number from 2 to 614 corresponding to the position of amino acid residue identified in SEQ ID NO:2 and preferably, corresponds to one of the C-terminal amino acid residues identified in the C-terminal deletions specified herein.
  • C terminal deletions of the TR9 polypeptide of the invention comprise, or alternatively, consist of, amino acid residues: A-1 to L-614; A-1 to D-613; A-1 to P-612; A-1 to L- 611; A-1 to H-610; A-1 to S-609; A-1 to Y-608; A-1 to V-607; A-1 to S-606; A-1 to D-605; A-1 to L-604; A-1 to L-603; A-1 to T-602; A-1 to Q-601 ; A-1 to S-600; A-1 to A-599; A-1 to E-598; A-1 to Q-597; A-1 to S-596; A-1 to K-595; A-1 to V-594;
  • polypeptide fragments comprising, or alternatively, consisting of, amino acids described by the general formula m to n, where m and n correspond to any one of the amino acid residues specified above for these symbols, respectively.
  • Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • Polypeptide fragments of the present invention include polypeptides comprising an amino acid sequence contained in SEQ ID NO:2, encoded by the cDNA contained in the deposited clone, or encoded by nucleic acids which hybridize (e.g., under stringent hybridization conditions) to the nucleotide sequence contained in the deposited clone, or shown in Figures 1A-D (SEQ ID NO:l) or the complementary strand thereto. Protein fragments may be "free-standing,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
  • polypeptide fragments of the invention include, for example, fragments that comprise or alternatively, consist of, from about amino acid residues -40 to 1, 1 to 20, 21 to 40, 41 to 60, 61 to 83, 84 to 100, 101 to 120, 121 to 140, 141 to 160, 160-167, 161 to 180, 181 to 200, 201 to 220, 221 to 240, 241 to 260, 261 to 280, 281 to 310, 31 1 to 350, 351 to 400, 401 to 450, 451 to 500, 551 to 600, or 601 to the end of the coding region of SEQ ID NO:2.
  • polypeptide fragments can be at least about 20, 30, 40, 50, 60, 70. 80, 90,
  • fragments of the invention are fragments characterized by structural or functional attributes of TR9.
  • Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha- regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn- forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophillic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., regions of polypeptides consisting of amino acid residues having an antigenic index of or equal to greater than 1.5, as identified using the default parameters of the Jameson- Wolf program) of TR9.
  • Certain preferred regions are those disclosed in Figure 3 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in Figures 1 A-D, such preferred regions include; Garnier-Robson predicted alpha-regions, beta-regions, turn-regions, and coil- regions; Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil- regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson- Wolf high antigenic index regions, as predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • polypeptide fragments of the invention comprise, or alternatively, consist of, amino acid residues: 40 to 48, 40 to 51, 51 to 66, 66 to 73,
  • the fragments or polypeptides of the invention are not larger than 610, 600. 580, 570, 550, 525, 500, 475, 450, 400, 425, 390, 380, 375, 350, 336, 334, 331, 305, 300, 295, 290, 285, 280, 275. 260,
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide of the invention.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide described herein.
  • An "immunogenic epitope” is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al., Proc.
  • peptides or polypeptides bearing an antigenic epitope i.e., that contain a region of a protein molecule to which an antibody can bind
  • relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, J.G. Sutcliffe et al., "Antibodies That React With Predetermined Sites on Proteins," Science 219:660-666 (1983).
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e.. immunogenic epitopes) nor to the amino or carboxyl terminals.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al., Cell
  • Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate TR9 receptor-specific antibodies include: a polypeptide comprising amino acid residues from about 4 to about 81 in SEQ ID NO:2, about 1 16 to about 271 in SEQ ID NO:2, about 283 to about 308 in SEQ ID NO:2, about 336 to about 372 in SEQ ID NO:2, about 393 to about 434 in SEQ ID NO:2, about 445 to about 559 in SEQ ID NO:2, and about 571 to about 588 in SEQ ID NO:2.
  • the inventors have determined that the above polypeptide fragments are antigenic regions of the TR9 receptor protein.
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means.
  • R.A. Houghten "General Method for the Rapid Solid-Phase Synthesis of Large Numbers of Peptides: Specificity of Antigen-
  • TR9 receptor polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al., Nature 331 :84-86 (1988)).
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric TR9 protein or protein fragment alone (Fountoulakis et al., J Biochem. 270:3958-3964 (1995)).
  • the present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of TR9 receptor protein, or the soluble form thereof, in cells and tissues, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for detecting over-expression of TR9, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors, for example.
  • Assay techniques that can be used to determine levels of a protein, such as a TR9 protein of the present invention, or a soluble form thereof, in a sample derived from a host are well-known to those of skill in the art.
  • Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
  • Assaying TR9 protein levels in a biological sample can occur using any art- known method.
  • biological sample any biological sample obtained from an individual, cell line, tissue culture, or other source which contains TR9 receptor protein or mRNA.
  • Preferred for assaying TR9 protein levels in a biological sample are antibody-based techniques.
  • TR9 protein expression in tissues can be studied with classical immunohistological methods. (Jalkanen et al., J Cell. Biol. 101:976-985 (1985); Jalkanen et al., J. Cell. Biol. 105:3087-3096 (1987)).
  • Suitable antibody-based methods useful for detecting TR9 receptor gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • Suitable labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine ( l2i l, 12I I), carbon ( l4 C), sulphur ( 35 S), tritium ( 3 H), indium ( 112 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • TNF tumor necrosis factor
  • the tumor necrosis factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes (D.V. Goeddel et al., "Tumor Necrosis Factors: Gene
  • TNF-family ligands induce such various cellular responses by binding to TNF-family receptors, including the TR9 of the present invention.
  • a cellular response to a TNF-family ligand is intended any genotypic, phenotypic, and/or morphologic change to a cell, cell line, tissue, tissue culture or patient that is induced by a TNF-family ligand.
  • cellular responses include not only normal physiological responses to TNF- family ligands, but also diseases associated with increased apoptosis or the inhibition of apoptosis.
  • Apoptosis-programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes (J.C. Ameisen,
  • cancers such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, such as breast cancer, prostrate cancer, Kaposi's sarcoma and ovarian cancer
  • autoimmune disorders such as systemic lupus erythematosus and immune-related glomerulonephritis rheumatoid arthritis
  • viral infections such as herpes viruses, pox viruses and adenoviruses
  • inflammation graft vs. host disease
  • acute graft rejection and chronic graft rejection such as herpes viruses, pox viruses and adenoviruses
  • AIDS dementia
  • neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
  • myelodysplastic syndromes such as aplastic anemia
  • ischemic injury such as that caused by myocardial infarction, stroke and reperfusion injury
  • toxin- induced liver disease such as that caused by alcohol
  • septic shock cachexia and anorexia.
  • the present invention is directed to a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TR9 polypeptide. an effective amount of TR9 ligand, analog or an agonist capable of increasing TR9 mediated signaling.
  • TR9 mediated signaling is increased to treat a disease wherein decreased apoptosis or decreased cytokine and adhesion molecule expression is exhibited.
  • Agonists include, but are not limited to, soluble forms of TR9 and antibodies (preferably monoclonal) directed against the TR9 polypeptide.
  • the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the TR9 polypeptide an effective amount of an antagonist capable of decreasing TR9 mediated signaling.
  • TR9 mediated signaling is decreased to treat a disease wherein increased apoptosis, NFkB expression and/or JNK expression is exhibited.
  • Antagonists include, but are not limited to, soluble forms of TR9 polypeptide and antibodies (preferably monoclonal) directed against the TR9 polypeptide.
  • agonist is intended naturally occurring and synthetic compounds capable of enhancing or potentiating apoptosis.
  • antagonist is intended naturally occurring and synthetic compounds capable of inhibiting apoptosis. Whether any candidate "agonist” or “antagonist” of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below.
  • TNF-family ligand/receptor cellular response assays including those described in more detail below.
  • One such screening procedure involves the use of melanophores which are transfected to express the receptor of the present invention. Such a screening technique is described in PCT WO 92/01810, published February 6, 1992.
  • Such an assay may be employed, for example, for screening for a compound which inhibits (or enhances) activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both a TNF-family ligand and the candidate antagonist (or agonist). Inhibition or enhancement of the signal generated by the ligand indicates that the compound is an antagonist or agonist of the ligand/receptor signaling pathway.
  • Other screening techniques include the use of cells which express the receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science 246:181- 296 (1989).
  • compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g.. signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
  • Another such screening technique involves introducing RNA encoding the receptor into Xenopus oocytes to transiently express the receptor.
  • the receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor.
  • Another screening technique well known in the art involves expressing in cells a construct wherein the receptor is linked to a phospholipase C or D.
  • Exemplary cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
  • the screening may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase signal.
  • Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding the receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g., by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
  • Soluble forms of the polypeptides of the present invention may be utilized in the ligand binding assay described above. These forms of the TR9 receptors are contacted with ligands in the extracellular medium after they are secreted. A determination is then made as to whether the secreted protein will bind to TR9 receptor ligands.
  • a screening method for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand.
  • the method involves contacting cells which express the TR9 polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway.
  • saying a cellular response is intended qualitatively or quantitatively measuring a cellular response to a candidate compound and/or a TNF-family ligand (e.g., determining or estimating an increase or decrease in T cell proliferation or tritiated thymidine labeling).
  • a cell expressing the TR9 polypeptide can be contacted with either an endogenous or exogenously administered TNF-family ligand.
  • Agonist according to the present invention include naturally occurring and synthetic compounds such as, for example, TNF family ligand peptide fragments, transforming growth factor, neurotransmitters (such as glutamate, dopamine, N- methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells and antimetabolites.
  • Preferred agonists include chemotherapeutic drugs such as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate and vincristine. Others include ethanol and -amyloid peptide. (Science 267: 1457-1458 (1995)).
  • agonists include polyclonal and monoclonal antibodies raised against the TR9 polypeptides of the invention, or a fragment thereof.
  • Such agonist antibodies raised against a T ⁇ F-family receptor are disclosed in Tartaglia et al., Proc. Natl. Acad. Sci. USA 88:9292-9296 (1991); and Tartaglia et al., J Biol. Chem. 267:4304- 4307(1992). See, also, PCT Application WO 94/09137.
  • Antagonists according to the present invention include naturally occurring and synthetic compounds such as, for example, the CD40 ligand, neutral amino acids, zinc, estrogen, androgens, viral genes (such as Adenovirus EIB, Baculovirus p35 and IAP,
  • Cowpox virus crmA Epstein-Barr virus BHRF1, LMP-1, African swine fever virus LMW5-HL, and Herpesvirus yl 34.5
  • calpain inhibitors cysteine protease inhibitors
  • tumor promoters such as PMA, Phenobarbital, and -Hexachlorocyclohexane
  • antagonists according to the present invention are nucleic acids corresponding to the sequences contained in Figures 1A-D, or the complementary strand thereof, and/or to nucleotide sequences contained in the deposited clone.
  • antisense sequence is generated internally by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, j., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
  • Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation.
  • Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al.. Nucleic Acids Research 10-1573 (1979); Cooney et al., Science 241 :456 (1988); and Dervan et al.. Science 251 :1300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA polynucleotide of from about 10 to 40 base pairs in length.
  • a DNA polynucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA polypeptide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the polynucleotides described herein can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the receptor.
  • the TR9 antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence.
  • a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention.
  • RNA antisense nucleic acid
  • Such a vector would contain a sequence encoding the TR9 antisense nucleic acid.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others know in the art, used for replication and expression in vertebrate cells.
  • Expression of the sequence encoding TR9, or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells.
  • Such promoters can be inducible or constitutive.
  • Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster et al., Nature
  • the antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a TR9 gene.
  • absolute complementarity although preferred, is not required.
  • a sequence "complementary to at least a portion of an RNA,” referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded TR9 antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid Generally, the larger the hybridizing nucleic acid, the more base mismatches with a TR9 RNA it may contain and still form a stable duplex (or triplex as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 247:1222-1225 (1990).
  • ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy TR9 mRNAs
  • the use of hammerhead ribozymes is preferred.
  • Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'.
  • the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of TR9 ( Figures 1A-D).
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the TR9 mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
  • DNA constructs encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA. Since ribozymes, unlike antisense molecules are catalytic, a lower intracellular concentration is required for efficiency.
  • TR9 soluble forms of TR9, (e.g.. fragments of the TR9 receptor sequence depicted in Figures 1A-D that include the ligand binding domain from the extracellular region of the full length receptor).
  • Such soluble forms of the receptor which may be naturally occurring or synthetic, antagonize TR9 mediated signaling by competing with the cell surface TR9 for binding to TNF-family ligands.
  • soluble forms of the receptor that include the ligand binding domain are novel cytokines capable of inhibiting apoptosis induced by TNF-family ligands.
  • Fas B a soluble form of the mouse Fas receptor
  • Fas ligand acts physiologically to limit apoptosis induced by Fas ligand
  • TR9 receptor like other homologous proteins
  • the experiments set forth below suggest that TR9-induced apoptosis will be blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
  • apoptosis induced by TR9 will be blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHalC360S), which were previously shown to inhibit death signaling by Fas/APO-1 and TNFR-1.
  • FADD-DN FADD-DN
  • FLICE-DN/MACHalC360S FLICE-DN/MACHalC360S
  • Antagonists of the present invention also include antibodies specific for TNF- family ligands or the TR9 polypeptides of the invention.
  • antibody or “monoclonal antibody” (mAb) as used herein is meant to include intact molecules as well as fragments thereof (such as, e.g., Fab and F(ab') 2 fragments) which are capable of binding an antigen.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).
  • Antibodies according to the present invention may be prepared by any of a variety of standard methods using TR9 immunogens of the present invention.
  • TR9 immunogens include the full length TR9 polypeptide depicted in Figures 1A-D (SEQ ID NO:2) (which may or may not include the leader sequence) and TR9 polypeptide fragments comprising, for example, the ligand binding domain, extracellular domain, transmembrane domain, intracellular domain, death domain, incomplete death domain, or any combination thereof.
  • Polyclonal and monoclonal antibody agonists or antagonists according to the present invention can be raised according to the methods disclosed in Tartaglia and Goeddel. J. Biol. Chem. 267(7):4304-4307(1992)); Tartaglia et al., Cell 73:213-216 (1993)), and PCT Application WO 94/09137 and are preferably specific to (i.e., bind uniquely to polypeptides of the invention having the amino acid sequence of SEQ ID NO:2.
  • antibody or “monoclonal antibody” (mAb) as used herein is meant to include intact molecules as well as fragments thereof (such as, for example, Fab and F(ab') fragments) which are capable of binding an antigen.
  • Fab, Fab' and F(ab') fragments lack the Fc fragment intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med, 24:316-325 (1983)).
  • antibodies according to the present invention are mAbs.
  • Such mAbs can be prepared using hybridoma technology (Kohler and Millstein, Nature 256:495-497 (1975) and U.S. Patent No. 4,376,1 10; Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988; Monoclonal Antibodies and Hybridomas: A New Dimension in Biological Analyses, Plenum Press, New York, NY, 1980; Campbell, "Monoclonal Antibody Technology," In: Laboratory Techniques in Biochemistry and Molecular Biology,
  • Proteins and other compounds which bind the TR9 domains are also candidate agonists and antagonists according to the present invention.
  • Such binding compounds can be "captured” using the yeast two-hybrid system (Fields and Song. Nature 340:245-246 (1989)).
  • a modified version of the yeast two- hybrid system has been described by Roger Brent and his colleagues (Gyuris, Cell 75:791-803 (1993): Zervos et al., Cell 72:223-232 (1993)).
  • the yeast two-hybrid system is used according to the present invention to capture compounds which bind to the ligand binding domain, extracellular, intracellular, transmembrane, and death domain of the TR9.
  • Such compounds are good candidate agonists and antagonists of the present invention.
  • the intracellular domain of the TR9 receptor may be used to identify cellular proteins which interact with the receptor in vivo.
  • Such an assay may also be used to identify ligands with potential agonistic or antagonistic activity of TR9 receptor function.
  • This screening assay has previously been used to identify protein which interact with the cytoplasmic domain of the murine TNF-RII and led to the identification of two receptor associated proteins. Rothe et al., Cell 78:681 (1994).
  • Such proteins and amino acid sequences which bind to the cytoplasmic domain of the TR9 receptors are good candidate agonist and antagonist of the present invention.
  • screening techniques include the use of cells which express the polypeptide of the present invention (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, 246:181-296 (1989).
  • potential agonists or antagonists may be contacted with a cell which expresses the polypeptide of the present invention and a second messenger response, e.g., signal transduction may be measured to determine whether the potential antagonist or agonist is effective.
  • TNF-family ligand is intended naturally occurring, recombinant, and synthetic ligands that are capable of binding to a member of the TNF receptor family and inducing the ligand/receptor signaling pathway.
  • TNF ligand family include, but are not limited to TR9 ligands including TRAIL, TNF- ⁇ , lymphotoxin- ⁇ (LT- ⁇ , also known as TNF- ⁇ ), LT- ⁇ (found in complex heterotrimer LT- ⁇ 2- ⁇ ), FasL, CD40, CD27, CD30, 4-1BB, OX40, and nerve growth factor (NGF).
  • TR9 ligands including TRAIL, TNF- ⁇ , lymphotoxin- ⁇ (LT- ⁇ , also known as TNF- ⁇ ), LT- ⁇ (found in complex heterotrimer LT- ⁇ 2- ⁇ ), FasL, CD40, CD27, CD30, 4-1BB, OX40, and nerve growth factor (NGF).
  • TRAIL TNF- ⁇
  • LT- ⁇ lymph
  • a method for treating HIV + individuals involves administering an antagonist of the present invention to reduce selective killing of CD4 T-lymphocytes. Modes of administration and dosages are discussed in detail below.
  • the immune system of the recipient animal In rejection of an allograft, the immune system of the recipient animal has not previously been primed to respond because the immune system for the most part is only primed by environmental antigens. Tissues from other members of the same species have not been presented in the same way than, for example, viruses and bacteria have been presented.
  • immunosuppressive regimens are designed to prevent the immune system from reaching the effector stage.
  • the immune profile of xenograft rejection may resemble disease recurrence more than allograft rejection.
  • the immune system In the case of disease recurrence, the immune system has already been activated, as evidenced by destruction of the native islet cells. Therefore, in disease recurrence, the immune system is already at the effector stage.
  • Agonists of the present invention are able to suppress the immune response to both allografts and xenografts because lymphocytes activated and differentiated into effector cells will express the TR9 polypeptide, and thereby are susceptible to compounds which enhance apoptosis.
  • the present invention further provides a method for creating immune privileged tissues.
  • TR9 antagonists of the invention can further be used in the treatment of inflammatory diseases and stress response related diseases, such as inflammatory bowel disease, rheumatoid arthritis, osteoarthritis, psoriasis, and septicemia.
  • soluble TR9 agonist or antagonist antibodies e.g., mABs
  • soluble TR9 or neutralizing mABs may be used to treat various chronic and acute forms of inflammation such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and inflammatory bowel disease.
  • the agonist or antagonists described herein can be administered in vitro, ex vivo, or in vivo to cells which express the receptor of the present invention.
  • administration of an "effective amount" of an agonist or antagonist is intended an amount of the compound that is sufficient to enhance or inhibit a cellular response to a TNF-family ligand and include polypeptides.
  • administration of an "effective amount” of an agonist or antagonists is intended an amount effective to enhance or inhibit TR9 mediated apoptosis.
  • an agonist according to the present invention can be co- administered with a TNF-family ligand.
  • an agonist or antagonist can be determined empirically and may be employed in pure form or in pharmaceutically acceptable salt, ester or prodrug form.
  • the agonist or antagonist may be administered in compositions in combination with one or more pharmaceutically acceptable excipients (i.e., carriers).
  • the total pharmaceutically effective amount of TR9 polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
  • the TR9 polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • Dosaging may also be arranged in a patient specific manner to provide a predetermined concentration of an agonist or antagonist in the blood, as determined by the RIA technique.
  • patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA, on the order of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
  • compositions comprising an agonist (including TR9 receptor polynucleotides, polypeptides or antibodies of the invention) or agonist (e.g., TR9 polynucleotides, polypeptides of the invention or antibodies thereto) of TR9 and a pharmaceutically acceptable carrier or excipient, which may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray
  • pharmaceutically acceptable carrier means a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • “pharmaceutically acceptable” means approved by a regulatory agency of the federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly humans.
  • suitable pharmaceutical carriers according to this embodiment are provided in "Remington's Pharmaceutical Sciences” by E.W. Martin, and include sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can be employed as liquid carriers, particularly for injectable solutions.
  • compositions of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
  • TR9 polypeptides containing the transmembrane region can also be used when appropriately solubilized by including detergents, such as CHAPS or NP-40, with buffer.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a TR9 receptor gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3. untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with probes from the cDNA as short as 50 or 60 bp.
  • Verma et al. Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, N.Y. (1988).
  • Example 1 Expression and Purification of the TR9 Receptor in E. coli
  • the bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311). pQE60 encodes ampicillin antibiotic resistance ("Amp r ”) and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site (“RBS”), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo- tri-acetic acid (“Ni-NTA”) affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
  • Amicillin antibiotic resistance Amicillin antibiotic resistance
  • ori an IPTG inducible promoter
  • RBS ribosome binding site
  • 6 six codons encoding histidine residues that allow affinity purification using nickel-nitrilo- tri-acetic acid (“Ni-NTA”)
  • a DNA fragment encoding a polypeptide may be inserted in such as way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide.
  • the polypeptide coding sequence is inserted such that translation of the six His codons is prevented and, therefore, the polypeptide is produced with no 6 X His tag.
  • the DNA sequence encoding the desired portion of the TR9 receptor protein lacking the hydrophobic leader sequence is amplified from the deposited cDNA clone using PCR ohgonucleotide primers which anneal to the amino terminal sequences of the desired portion of the TR9 receptor protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector are added to the 5' and 3' sequences, respectively.
  • the 5' primer has the sequence:
  • the amplified TR9 receptor DNA fragments and the vector pQE60 are digested with Ncol and Hindlll, and the digested DNAs are then ligated together.
  • Insertion of the TR9 receptor DNA into the restricted pQE60 vector places the TR9 receptor protein coding region including its associated stop codon downstream from the IPTG-inducible promoter and in-frame with an initiating AUG.
  • the associated stop codon prevents translation of the six histidine codons downstream of the insertion point.
  • E. coli strain M15/rep4 containing multiple copies of the plasmid pR ⁇ P4, which expresses the lac repressor and confers kanamycin resistance ("Kan r "), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing TR9 receptor protein, is available commercially from QIAGEN, Inc., supra. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin.
  • Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/ml) and kanamycin (25 ⁇ g/ml).
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1 :25 to 1 :250.
  • the cells are grown to an optical density at 600 run ("OD600") of between 0.4 and 0.6.
  • IPTG Isopropyl-b-D-thiogalactopyranoside
  • the cells are then stirred for 3-4 hours at 4°C in 6M guanidine-HCl, pH8.
  • the cell debris is removed by centrifugation, and the supernatant containing the TR9 receptor is dialyzed against 50 mM Na-acetate buffer ⁇ H6, supplemented with 200 mM NaCl.
  • the protein can be successfully refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM Tris/HCl pH7.4, containing protease inhibitors.
  • the protein can be purified by ion exchange, hydrophobic interaction and size exclusion chromatography.
  • an affinity chromatography step such as an antibody column can be used to obtain pure
  • TR9 receptor protein The purified protein is stored at 4°C or frozen at -80°C .
  • Example 2 Cloning and Expression of the TR9 Receptor Protein in a Baculovirus Expression System
  • the plasmid shuttle vector pA2 is used to insert the cloned DNA encoding the complete protein, including its naturally associated secretary signal (leader) sequence, into a baculovirus to express the mature TR9 receptor protein, using standard methods as described in Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHl and Aspl ⁇ 8.
  • the polyadenylation site of the simian virus 40 (“SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
  • the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.
  • baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAclMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in- frame AUG as required.
  • Such vectors are described, for instance, in Luckow et al., Virology 170:31-39 (1989).
  • the cDNA sequence encoding the full length TR9 protein in the deposited clone, including the AUG initiation codon and the naturally associated leader sequence shown in Figures 1A-D is amplified using PCR ohgonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence: 5' CGCCCCGGGGCCATCATGGGGACCTCTCCGAGC 3' (SEQ ID NO: 13) containing the underlined Smal restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:947- 950 (1987), followed by a number of bases of the sequence of the complete TR9 receptor protein shown in Figures 1 A-D, beginning with the AUG initiation codon.
  • the 3' primer (for cloning the soluble form) has the sequence: 5' CGCGGTACCTTAGGGCAAATGCTCATTG 3' (SEQ ID NO: 14) containing the underlined Asp718 restriction site followed by nucleotides complementary to the 3' noncoding sequence in Figures 1A-D.
  • the amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with Smal and Asp718 and again is purified on a 1% agarose gel. This fragment is designated herein "FI".
  • the plasmid is digested with the restriction enzymes Smal and Asp718 and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean” BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "VI ".
  • Fragment FI and the dephosphorylated plasmid VI are ligated together with T4 DNA ligase.
  • plasmid pBacTR9 Five ⁇ g of the plasmid pBacTR9 are co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987).
  • BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pBacTR9 are mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum-free Grace's medium (Life Technologies Inc., Rockville, MD).
  • plaque assay of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Rockville, MD., page 9-10). After appropriate incubation, blue stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf).
  • a micropipettor e.g., Eppendorf
  • the agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 ⁇ l of Grace's medium and the suspension containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4°C .
  • the recombinant virus is called V-TR9.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-TR9 at a multiplicity of infection ("MOI") of about 2.
  • MOI multiplicity of infection
  • the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD).
  • SF900 II medium minus methionine and cysteine available from Life Technologies Inc., Rockville, MD.
  • radiolabeled proteins 42 hours later, 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S-cysteine (available from Amersham) are added.
  • the cells are further incubated for 16 hours and then they are harvested by centrifugation.
  • the proteins in the supernatant as well as the intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled). Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the mature protein and thus the cleavage point and length of the secretory signal peptide.
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRS) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, cellular elements can also be used
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as PSVL and PMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC 67109).
  • Mammalian host cells that could be used include, human Hela 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
  • the gene can be expressed in stable cell lines that contain the gene integrated into a chromosome.
  • a selectable marker such as dhfr, gpt, neomycin, or hygromycin allows the identification and isolation of the transfected cells.
  • the transfected gene can also be amplified to express large amounts of the encoded protein.
  • the dihydrofolate reductase (DHFR) marker is useful to develop cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al., Bio/Technology 10:169-175 (1992)). Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the production of proteins.
  • CHO Chinese hamster ovary
  • NSO cells are often used for the production of proteins.
  • the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molec. Cell. Biol. 5:438-447 (1985)) plus a fragment of the CMV-enhancer (Boshart et al., Cell 41 :521-530 (1985)).
  • LTR strong promoter
  • CMV-enhancer Boshart et al., Cell 41 :521-530 (1985)
  • the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • the expression plasmid, pTR9-HA is made by cloning a cDNA encoding TR9 into the expression vector pcDNAI/Amp or pcDNAIII (which can be obtained from Invitrogen, Inc.).
  • the expression vector pcDNAI/Amp contains: (1) an E. coli origin of replication effective for propagation in E. coli and other prokaryotic cells; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) an
  • SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron; (5) several codons encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) followed by a termination codon and polyadenylation signal arranged so that a cDNA can be conveniently placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the poly linker.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al, Cell 31:161-11% (1984). The fusion of the HA tag to the target protein allows easy detection and recovery of the recombinant protein with an antibody that recognizes the HA epitope.
  • pcDNAIII contains, in addition, the selectable neomycin marker.
  • a DNA fragment encoding the TR9 is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the plasmid construction strategy is as follows.
  • the TR9 cDNA of the deposited clone is amplified using primers that contain convenient restriction sites, much as described above for construction of vectors for expression of TR9 in E. coli. Suitable primers include the following, which are used in this example.
  • the 5' primer containing the underlined Smal site, a Kozak sequence, an AUG start codon and codons of the 5' coding region of the complete TR9 receptor has the following sequence: 5' CGCCCCGGGGCCATCATGGGGACCTCTCCGAGC 3'
  • the 3' primer containing the underlined Xbal site, a stop codon, and nucleotides of the 3' coding sequence, has the following sequence (at the 3' end): 5'CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTAGGGCAAAT
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with Smal and Xbal and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies.
  • Plasmid DNA is isolated from resistant colonies and examined by restriction analysis or other means for the presence of the TR9-encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al, Molecular Cloning: a Laboratory Manual, Cold Spring
  • TR9-HA fusion protein is detected by radiolabeling and immunoprecipitation, using methods described in, for example Harlow et al, Antibodies: A Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988). To this end, two days after transfection, the cells are labeled by incubation in media containing 3:> S-cysteine for 8 hours. The cells and the media are collected, and the cells are washed and lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • Plasmid pC4 is used for the expression of TR9 protein.
  • Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC Accession No. 37146).
  • the plasmid contains the mouse DHFR gene under control of the SV40 early promoter.
  • Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies, Rockville, MD) supplemented with the chemotherapeutic agent methotrexate.
  • MTX methotrexate
  • Plasmid pC4 contains for expressing the gene of interest the strong promoter of the long terminal repeat (LTR) of the Rous Sarcoma Virus (Cullen et al, Molec. Cell. Biol. 5:438-447 (1985)) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al, Cell 41 :521- 530 (1985)). Downstream of the promoter are BamUl. Cbal, and Aspl ⁇ % restriction enzyme cleavage sites that allow integration of the genes. Behind these cloning sites the plasmid contains the 3' intron and polyadenylation site of the rat preproinsulin gene.
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • high efficiency promoters can also be used for the expression, e.g., the human ⁇ -actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HIV and HTLVI.
  • Clontech's Tet-Off and Tet-On gene expression systems and similar systems can be used to express the TR9 in a regulated way in mammalian cells (Gossen et. al., Proc. Natl. Acad. Sci. USA 89:5547-5551 (1992).
  • Other signals e.g., from the human growth hormone or globin genes can be used as well.
  • Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
  • the plasmid pC4 is digested with the restriction enzymes Smal and Asp718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel.
  • the DNA sequence encoding the complete TR9 protein including its leader sequence is amplified using PCR ohgonucleotide primers corresponding to the 5' and 3' sequences of the gene.
  • the 5' primer has the sequence: 5' CGCCCCGGGGCCATCATGGGGACCTCTCCGAGC 3' (SEQ ID NO: 13) restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:941-950 (1987), followed by a number of bases of the coding sequence of the TR9 receptor protein shown in Figures 1A-D (SEQ ID N0:1).
  • the 3' primer (for cloning the soluble form) has the sequence: 5' CGCGGTACCTTAGGGCAAATGCTCATTG 3' (SEQ ID NO: 14) containing the underlined Asp718 restriction site followed by nucleotides complementary to the non-translated region of the TR9 receptor gene shown in Figures 1A-D (SEQ ID NO:l).
  • the amplified fragment is digested with the endonucleases Smal and then purified again on a 1% agarose gel.
  • the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
  • E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
  • Chinese hamster ovary cells lacking an active DHFR gene are used for transfection.
  • Five ⁇ g of the expression plasmid pC4 is cotransfected with 0.5 ⁇ g of the plasmid pSV2-neo using lipofectin (Feigner et al, supra).
  • the plasmid pSV2neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
  • the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of methotrexate plus 1 mg/ml
  • the probe was purified using a CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labeled probe is then used to examine various human tissues for TR9 mRNA. Multiple Tissue Northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) are obtained from Clontech and are examined with the labeled probe using ExpressHybTM hybridization solution (Clontech) according to manufacturer's protocol number PT1190-1. Following hybridization and washing, the blots are mounted and exposed to film at -70°C overnight, and films developed according to standard procedures.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • Fas/APO-1 and TNFR-1 in mammalian cells mimics receptor activation (M. Muzio et al, Cell 55:817-827 (1996); M. P. Boldin et al, Cell 55:803-815 (1996)). Thus, this system is utilized to study the functional role of TR9.
  • the affected cells will display morphological alterations typical of cells undergoing apoptosis, becoming rounded, condensed, and detaching from the dish. Similar to
  • TR9-induced apoptosis is blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
  • TNF receptor family are crucial modulators of inflammatory and cellular immune responses, and mediate a variety of biological functions, ranging from cell proliferation, differentiation and apoptosis to cell survival (Nagata, S., Cell 88:355-365 (1997); Armitage, R. J., Curr. Opin. Immuno. 6:407-413 (1994); Golstein, P., Curr. Biol. 7:R750-R753 (1997); Baichwal et al, Curr. Biol. 7:R94-R96.
  • T ⁇ F receptors Within the T ⁇ F receptor family, six members have emerged as a distinct subgroup termed death receptors; they contain a cytoplasmic death domain and activation of these receptors leads to engagement of components of the cell death pathway ( ⁇ agata, S., Cell 88:355-365 (1997); and Golstein, P., Curr. Biol. 7:R750-
  • caspase-8 undergoes an autoactivation, initiating activation of the downstream caspases, cleavage of death substrates and demise of the cell (Muzio et al, J. Biol. Chem. 273:2952-2956 (1997); Barinaga, M., Science 280:32-34 (1998); Salvesen et al., Cell 91:443-446 (1997); and Martin et al., Cell 82: 349-352 (1995)).
  • both TNFR1 and DR3 utilize a primary adaptor molecule termed TRADD, around which assembles the FADD-caspase-8 pathway, an NF KB activating pathway involving the death domain-containing Ser/Thr kinase RIP and a JNK activating pathway that is mediated by the adaptor molecule TRAF2 (Hsu et al, Cell 81 -495-504 (1995); Hsu et al, Immunity 4:387-396 (1996); Chinnaiyan et al, Science 274:990-992 (1996); Kitson et al, Nature 384:372-375 (1996); Yeh et al., Immunity 7:715-725 (1997); Lee et al, Immunity 7:703-713 (1997); and Kelliher et al, Immunity 8:297-303 (1998).
  • TRADD primary adaptor molecule
  • TR9 a new member of the TNF receptor family possessing a cytoplasmic death domain. TR9 induced apoptosis in mammalian cells and was capable of engaging the NF KB and JNK pathways.
  • TR9 amino acid residues 42-655 as dipicted in Figures 1 A- D; amino acid residues 2-615 as presented in SEQ ID NO:2
  • TR9 delta amino acid residues 42-460 as dipicted in Figures 1 A-D; amino acid residues 2-420 as presented in SEQ ID NO:2
  • pCMVlFLAG IBI-Kodak
  • cDNAs were obtained by polymerase chain reaction using DNA oligo primers for TR9: 5 / -GGAAGATCTGCCAGAACAGAAGGCCTCGAAT-3 / (SEQ ID NO: 16) and 5'-CCATCTTCCTGACCTGCTGTAGTCTAGAGCC-3' (SEQ ID NO: 17) and for TR9 delta: 5'-GGAAGATCTGCCAGAACAGAAGGCCTC GAAT-3' (SEQ ID NO: 16) and 5'-GCCGACCACGAGCGGGCCTAGTCT AGAGCC-3' (SEQ ID NO: 18).
  • Apoptosis Assay Cell death assays were performed as previously described
  • Co-immunoprecipitation Assay In vivo interaction assays have been described elsewhere (Chinnaiyan et al, Cell 81:505-512 (1995); and Pan et al, Science 276:111- 113 (1997)). 293 cells were co-transfected with FLAG-TR9, FLAG-TR9 delta, FLAG-CD95, FLAG-DR3, FLAG-TNFR1, and ICH-lpro-FLAG, expression constructs using standard calcium phosphate precipitation.
  • FLAG-tagged expressed proteins were immunoprecipitated with FLAG M2 affinity gel (IBI-Kodak) and the presence of FADD, myc-tagged TRADD and RIP (myc-TRADD and myc-RIP), or RAIDD detected by immunoblotting with polyclonal antibody to FADD horseradish peroxidase (HRP)-conjugated antibody to myc (BMB), or polyclonal antibody to RAIDD.
  • FLAG M2 affinity gel IBI-Kodak
  • FADD myc-tagged TRADD and RIP
  • RAIDD detected by immunoblotting with polyclonal antibody to FADD horseradish peroxidase (HRP)-conjugated antibody to myc (BMB), or polyclonal antibody to RAIDD.
  • NF- ⁇ B Luciferase Assay NF KB luciferase assays were done as described elsewhere (Chinnaiyan et al, Cell 81 :505-512 (1995); and Pan et al, Science 276:111-113 (1997)).
  • JNK Activation Assay 293 cells were cultured in MEM containing 10% FBS. Cells were plated in 6-well plates and transfected with TR9 expressing plasmid or vector alone at 60-70% confluency by the lipofectamine method according to the manufacturer's instructions. Forty hours post transfection, cell extracts were prepared in lysis buffer containing 20 mM HEPES, pH 7.4, 2 mM EDTA, 250 mM NaCl, 0.1% NP-40, 2 ⁇ g/ml leupeptin, 2 ⁇ g/ml aprotinin, 1 mM PMSF, 0.5 ⁇ g/ml benzamide, 1 mM DTT and ImM orthovanadate.
  • the C-jun kinase assay was performed by a modified method as described (Haridas et al, Immunol. 160:3152- 3162 (1998)). Briefly, cell extracts (70 ⁇ g) were subjected to immunoprecipitation with 0.03 ⁇ g anti-JNK antibody for 30 min at 4°C. Immuno-complexes were collected by incubation with protein A/G-sepharose beads for 30 min at 4°C.
  • the beads were extensively washed with lysis buffer (4 X 400 ⁇ l) and kinase buffer (2 X 400 ⁇ l: 20 mM HEPES, pH 7.4, 1 mM DTT, 25 mM NaCl) and the kinase reaction allowed to proceed for 15 min at 30°C with 2 ⁇ g GST-Jun (1-79) in 20 ⁇ l containing 20 mM HEPES, pH 7.4, 10 mM MgCl 2 1 mM DTT and 10 ⁇ Ci [ 2 P]ATP. Reactions were stopped by the addition of 15 ⁇ l SDS-sample buffer and resolved by SDS- polyacrylamide gel electrophoresis.
  • JNK activity involved the co- transfection of 3 X 10 6 293 cells with vector, or the CD40, TR9, or TR9 delta expression constructs (6.4 ⁇ g) together with 2.4 ⁇ g of a JNK-myc expression plasmid using the calcium phosphate precipitation method.
  • cell extracts were prepared by lysis in NP 40 buffer (20 mM Tris-Cl, pH 8.0, 137 mM NaCl, 10% Glycerol, 2 mM EDTA, 5 mM Na 2 VO 4 , 0.5 mM PMSF and 1 % NP40) plus protease inhibitor cocktail (BMB).
  • NP 40 buffer 20 mM Tris-Cl, pH 8.0, 137 mM NaCl, 10% Glycerol, 2 mM EDTA, 5 mM Na 2 VO 4 , 0.5 mM PMSF and 1 % NP40
  • BMB protease inhibitor cocktail
  • FLAG tagged CD40, TR9, and TR9 delta were immunoprecipitated with anti-FLAG M2 affinity gel and detected by blotting with anti-FLAG antibody.
  • the kinase assay utilized 2 ⁇ g GST Jun(l-79) as substrate, 50 mM ATP and 5 ⁇ Ci ⁇ 32 P]ATP in 30 ⁇ l kinase buffer (30 mM HEPES, pH 7.4, 7 mM Mn Cl 2 , 5 mM MgCl 2 and 1 mM DTT).
  • TR9 has a putative signal sequence (amino acid residues 1-41 as depicted in Figures 1 A-D and 4A; amino acid residues -40 to 1 in SEQ ID NO:2), with the mature form predicted to start at amino acids 42 (Gin) as depicted in Figures 1A-D and 4 A
  • a transmembrane domain (amino acids 351 to 370 as depicted in Figures 1A-D and 4A; residues 311 to 330 of SEQ ID NO:2) is followed by a 285-amino acid long cytoplasmic portion of the molecule that contains a death domain related to those of all known death receptors (Figure 4C), being most related to the death domain of
  • TNFR1 (27.2%) and least like that of DR5 (19.7%).
  • the death domain in TR9 was located adjacent to the transmembrane domain followed by a 150 amino acid tail.
  • the death domain was a putative leucine zipper sequence overlapping with a proline-rich region reminescent of a SH3 domain-binding motif (Figure 4A) (Pawson et al., Science 278:2075-2080 (1997)).
  • TR9 mRNA expression in human tissues and cancer cell lines A 4-kb TR9 transcript was found in most human adult tissue, immune tissue, and cancer cell lines represented on Northern blots (Clontech) that were probed with TR9 cDNA according to the manufacturers instructions (data not shown). The transcript was abundant in heart, brain, placenta, pancreas, lymph node, thymus and prostate. Lower levels were detected in lung, skeletal muscle, kidney, testis, uterus, small intestine, colon, spleen, bone marrow, and fetal liver. However, adult liver and peripheral blood leukocytes expressed little TR9 mRNA. Additionally, smaller transcripts of 3.1 and 2.4 kb were observed in the testis and fetal liver, respectively.
  • TR9 induces apoptosis in mammalian cells — Since ectopic expression of death receptors can induce cell death in a ligand-independent manner (Chinnaiyan et al, Cell 81 :505-512 (1995); Boldin et al, J. Biol. Chem. 270:7795-7789 (1995); Chinnaiyan et al., Science 274:990-992 (1996); Kitson et al, Nature 384:372-375 (1996); and Pan et al, Science 276:111-1 13 (1997)), we tested if TR9 could induce apoptosis upon overexpression.
  • TR9 delta the putative death domain
  • TR9 was unable to induce cell death in human breast carcinoma MCF7 cells although they were very sensitive to DR4 killing ( Figure 5 and not shown), suggesting that the cell death pathway engaged by TR9 may be distinct from that engaged by other death receptors.
  • the apoptotic activity of TR9 may be modulated by other signaling pathways it activates (see below) or ligand binding may be required to unveil its full killing capacity.
  • Death receptors utilize the adaptor molecules FADD (for CD95) or both TRADD and FADD (for TNFR1 and DR3) to transmit the death signal (Chinnaiyan et al, Cell 81 :505-512 (1995); Boldin et al, J Biol. Chem. 270:7795-7789 (1995); Chinnaiyan et al, Science 274:990-992
  • TR9 could bind any of these adaptor molecules in human embryonic kidney 293 cells. TR9 did not interact with FADD, although the association between CD95 and FADD was readily detected under similar conditions (data not shown). Interestingly, TR9 was found to associate with TRADD, although the interaction was weaker than that between DR3 and TRADD (data not shown). This observation is consistent with the observation that TR9 has a weaker killing ability. Alternatively, TR9 may use a TRADD-related molecule as an adaptor, or the observed association might be bridged by another adaptor protein. Interaction was not detectable between TR9 and RAIDD or RIP, two other adaptor molecules known to be recruited to the T ⁇ FR1 and DR3 signalling complexes (data not shown).
  • TR9 activates nuclear factor- ⁇ B — Both T ⁇ FR1 and DR3 can engage a signal transduction pathway that leads to the activation of ⁇ F- ⁇ B (Smith et al, Cell 76: 959-962 (1994); Chinnaiyan et al., Science 274:990-992 (1996); Kitson et al, Nature
  • TR9 The ability of TR9 to activate NF- ⁇ B was tested in a luciferase reporter assay and was found to induce NF- ⁇ B activation in a dose-dependent manner (Figure 6). Presumably overexpressing the receptor allowed it to achieve an active configuration that was competent to signal the NF- ⁇ B system. Interestingly, the cytoplasmic deletion of TR9 that abolished its apoptotic activity similarly abrogated its ability to activate NF- ⁇ B (data not shown), suggesting that these two signaling pathways may be mediated by a common receptor- proximal adapter molecule.
  • JNK activation is known to be induced by several TNF receptors including TNFR1 and CD40 (Smith et al, Ce// 76: 959-962 (1994); Yeh et al, Immunity 7:715-725 (1997); Lee et al, Immunity 7:703-713 (1997); and Baker et al, Oncogene 12:1-9 (1996)).
  • TR9 was found to induce JNK activation in a dose-dependent manner (data not shown).
  • TRAF-binding motifs are present adjacent to the transmembrane domain PRQDP (amino acid residues 381-385 as depicted in Figures 1A-D: amino acid residues 341-345 as presented in SEQ ID NO:2), and PTQNR (amino acid residues 400-404 as depicted in Figures 1A-D; amino acid residues 360-364 as presented in SEQ ID NO:2) (Gedrich et al, J. Biol Chem. 271 :12852-12858 (1996) and Boucher et al, Biochem. and Biophy. Res. Communi. 233:592-600 (1997).
  • TR9 engages a cell death pathway different from those initiated by the CD95, TNFR1 or TRAIL/Apo2L receptors.
  • TR9 also activates NF- ⁇ B and JNK, two signaling pathways shared by TNFR1.
  • TR9 plays a role in inflammatory responses and immune regulation. It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.
  • MOLECULE TYPE DNA (genomic)
  • GCT TTC TCC AAT GGG TAC ACA GCC GAC CAC GAG CGG GCC TAC GCA GCT 1632 Ala Phe Ser Asn Gly Tyr Thr Ala Asp His Glu Arg Ala Tyr Ala Ala 410 415 420
  • AAATTTACTT AACTTACCAT AAATGCAGTG TGACTTTTCC CACACACTGG ATTGTGAGGC 2621
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • GCTAATTAGC GCCCTGCCAG ACCGGAGAAA CGATGTTTGG AGAAGATTCG TGGGCTGATG 60
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un nouveau membre de la famille des récepteurs du facteur de nécrose tumorale. Elle concerne en particulier des molécules d'acide nucléique codant le récepteur humain TR9. Elle concerne en outre des polypeptides TR9 ainsi que des vecteurs, des cellules hôtes, et des méthodes recombinantes permettant de produire lesdits polypeptides. L'invention concerne enfin des méthodes de sélection permettant d'identifier des agonistes et des antagonistes de l'activité du récepteur TR9.
EP19980926471 1997-06-11 1998-06-10 Recepteur humain tr9 du facteur de necrose tumorale Withdrawn EP0988371A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US5299197P 1997-06-11 1997-06-11
US52991P 1997-06-11
PCT/US1998/011932 WO1998056892A1 (fr) 1997-06-11 1998-06-10 Recepteur humain tr9 du facteur de necrose tumorale

Publications (2)

Publication Number Publication Date
EP0988371A1 true EP0988371A1 (fr) 2000-03-29
EP0988371A4 EP0988371A4 (fr) 2002-11-04

Family

ID=21981206

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19980926471 Withdrawn EP0988371A4 (fr) 1997-06-11 1998-06-10 Recepteur humain tr9 du facteur de necrose tumorale

Country Status (5)

Country Link
EP (1) EP0988371A4 (fr)
JP (1) JP2002503963A (fr)
AU (1) AU7830398A (fr)
CA (1) CA2295991A1 (fr)
WO (1) WO1998056892A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2371388A2 (fr) 2004-10-20 2011-10-05 Genentech, Inc. Formulations d'anticorps
EP2857516A1 (fr) 2000-04-11 2015-04-08 Genentech, Inc. Anticorps multivalents et leurs utilisations
WO2021110110A1 (fr) 2019-12-03 2021-06-10 上海交通大学医学院 RÉGION FC D'ANTICORPS AYANT UNE AFFINITÉ AMÉLIORÉE À FCγRIIB

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7888466B2 (en) 1996-01-11 2011-02-15 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US7357927B2 (en) 1996-03-12 2008-04-15 Human Genome Sciences, Inc. Death domain containing receptors
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
WO1997033904A1 (fr) 1996-03-12 1997-09-18 Human Genome Sciences, Inc. Recepteurs contenant un domaine de mort cellulaire
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US7285267B2 (en) 1997-01-14 2007-10-23 Human Genome Sciences, Inc. Tumor necrosis factor receptors 6α & 6β
ES2286843T3 (es) 1997-01-14 2007-12-01 Human Genome Sciences, Inc. Receptores 6 alfa y 6 beta del factor de necrosis tumoral.
US6949358B1 (en) 1997-06-11 2005-09-27 Human Genome Sciences, Inc. Human tumor necrosis factor receptor TR9
US6358508B1 (en) 1997-06-11 2002-03-19 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor TR9
US6194151B1 (en) 1997-09-26 2001-02-27 Millenium Pharmaceuticals, Inc. Molecules of the TNF receptor superfamily and uses therefor
GB9812607D0 (en) * 1998-06-12 1998-08-12 Zeneca Ltd Protein
US6916907B1 (en) 1998-10-23 2005-07-12 Curagen Corporation Nucleic acids encoding osteoprotegern-like proteins and methods of using same
CA2354612A1 (fr) * 1998-12-11 2000-06-15 Bristol-Myers Squibb Company Homologue recepteur du facteur de necrose tumorale (trh1)
AU3501700A (en) 1999-02-26 2000-09-14 Human Genome Sciences, Inc. Human endokine alpha and methods of use
CA2365255A1 (fr) * 1999-03-24 2000-09-28 Human Genome Sciences, Inc. Recepteur tr9 humain de facteurs de necrose des tumeurs
AU2001266557A1 (en) 2000-04-12 2001-10-23 Human Genome Sciences, Inc. Albumin fusion proteins
WO2001085209A2 (fr) * 2000-05-10 2001-11-15 Eli Lilly And Company Traitement de maladies induites par les lymphocytes t par modulation de l'activite de dr6
EP2431054A3 (fr) 2000-06-15 2013-03-06 Human Genome Sciences, Inc. Facteur delta de nécrose de tumeur humaine et epsilon
ES2609016T3 (es) 2000-06-16 2017-04-18 Human Genome Sciences, Inc. Anticuerpos que se unen inmunoespecíficamente a BLyS
KR100942393B1 (ko) 2001-05-25 2010-02-17 휴먼 게놈 사이언시즈, 인코포레이티드 Ｔｒａｉｌ 수용체에 면역특이적으로 결합하는 항체
WO2003060071A2 (fr) 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Proteines hybrides d'albumine
JP5905184B2 (ja) 2005-10-13 2016-04-20 ヒューマン ジノーム サイエンシーズ， インコーポレイテッドＨｕｍａｎ Ｇｅｎｏｍｅ Ｓｃｉｅｎｃｅｓ， Ｉｎｃ． 自己抗体陽性疾患を有する患者の処置に使用するための方法および組成物
ES2709481T3 (es) 2008-09-26 2019-04-16 Tocagen Inc Vectores recombinantes
EP2376120A2 (fr) 2008-11-25 2011-10-19 Biogen Idec MA Inc. Utilisation d'antagonistes dr6 et p75 pour favoriser la survie de cellules du systeme nerveux
UA114077C2 (xx) 2010-11-19 2017-04-25 Нейтралізуюче антитіло проти ccl20
ES2786051T3 (es) 2012-10-25 2020-10-08 Tocagen Inc Vector retroviral con casete de mini-promotor

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999011790A1 (fr) * 1997-09-04 1999-03-11 Zymogenetics, Inc. Recepteur ztnfr-6 du facteur de necrose des tumeurs
WO2000056862A1 (fr) * 1999-03-24 2000-09-28 Human Genome Sciences, Inc. Recepteur tr9 humain de facteurs de necrose des tumeurs
US6358508B1 (en) * 1997-06-11 2002-03-19 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor TR9

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4376110A (en) 1980-08-04 1983-03-08 Hybritech, Incorporated Immunometric assays using monoclonal antibodies
US4631211A (en) 1985-03-25 1986-12-23 Scripps Clinic & Research Foundation Means for sequential solid phase organic synthesis and methods using the same
US5116742A (en) 1986-12-03 1992-05-26 University Patents, Inc. RNA ribozyme restriction endoribonucleases and methods
EP0394827A1 (fr) 1989-04-26 1990-10-31 F. Hoffmann-La Roche Ag Polypeptides chimériques de CD4-immunoglobuline
US5462856A (en) 1990-07-19 1995-10-31 Bunsen Rush Laboratories, Inc. Methods for identifying chemicals that act as agonists or antagonists for receptors and other proteins involved in signal transduction via pathways that utilize G-proteins
WO1994009137A1 (fr) 1992-10-15 1994-04-28 Genentech, Inc. Anticorps contre le recepteur du facteur de necrose de tumeurs de type 2

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6358508B1 (en) * 1997-06-11 2002-03-19 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor TR9
WO1999011790A1 (fr) * 1997-09-04 1999-03-11 Zymogenetics, Inc. Recepteur ztnfr-6 du facteur de necrose des tumeurs
WO2000056862A1 (fr) * 1999-03-24 2000-09-28 Human Genome Sciences, Inc. Recepteur tr9 humain de facteurs de necrose des tumeurs

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
CHINNAIYAN ET AL.: SCIENCE, vol. 274, 1996, pages 990-992, *
DATABASE EMBL [Online] 18 February 1996 (1996-02-18) retrieved from EMBL Database accession no. N49208 XP002215173 *
DATABASE EMBL [Online] 18 January 1997 (1997-01-18) retrieved from EMBL Database accession no. AA156356 XP002215175 *
DATABASE EMBL [Online] 19 January 1997 (1997-01-19) retrieved from EMBL Database accession no. AA155873 XP002215169 *
DATABASE EMBL [Online] 19 January 1997 (1997-01-19) retrieved from EMBL Database accession no. AA186423 XP002215172 *
DATABASE EMBL [Online] 22 April 1998 (1998-04-22) retrieved from EMBL Database accession no. AA918818 XP002215170 *
DATABASE EMBL [Online] 27 August 1995 (1995-08-27) retrieved from EMBL Database accession no. D59902 XP002215174 *
DATABASE EMBL [Online] 5 August 1995 (1995-08-05) retrieved from EMBL Database accession no. H41873 XP002215176 *
DATABASE EMBL [Online] 5 October 1996 (1996-10-05) retrieved from EMBL Database accession no. AA072902 XP002215171 *
KOHNO ET AL.: PROC NATL ACAD SCI USA, vol. 87, 1990, pages 8331-8335, *
LIU ET AL.: IMMUNITY, vol. 15, 2001, pages 23-24, *
NAGATA ET AL.: CELL, vol. 88, 1997, pages 355-365, *
PAN ET AL.: FEBS LETT., vol. 431, 1998, pages 351-356, *
See also references of WO9856892A1 *
ZHAO ET AL.: J. EXP. MED., vol. 194, 2001, pages 1441-1448, *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2857516A1 (fr) 2000-04-11 2015-04-08 Genentech, Inc. Anticorps multivalents et leurs utilisations
EP2371388A2 (fr) 2004-10-20 2011-10-05 Genentech, Inc. Formulations d'anticorps
EP3498294A1 (fr) 2004-10-20 2019-06-19 Genentech, Inc. Formulations d'anticorps
WO2021110110A1 (fr) 2019-12-03 2021-06-10 上海交通大学医学院 RÉGION FC D'ANTICORPS AYANT UNE AFFINITÉ AMÉLIORÉE À FCγRIIB

Also Published As

Publication number Publication date
CA2295991A1 (fr) 1998-12-17
EP0988371A4 (fr) 2002-11-04
AU7830398A (en) 1998-12-30
JP2002503963A (ja) 2002-02-05
WO1998056892A1 (fr) 1998-12-17

Similar Documents

Publication Publication Date Title
WO1998056892A1 (fr) Recepteur humain tr9 du facteur de necrose tumorale
US7803615B1 (en) Death domain containing receptor 5
EP1012274B2 (fr) Recepteur 4 (dr4:recepteur 4 de mort cellulaire) contenant des domaines de mort cellulaire, membre de la superfamille du recepteur du facteur de necrose tumorale (tnf) et se liant a la trail ( apo-2l)
AU729062B2 (en) Tumor necrosis factor receptors 6alpha & 6beta
US6951735B2 (en) Death domain containing receptors
US20010021516A1 (en) Tumor necrosis factor receptor 5
US6214580B1 (en) Human tumor necrosis factor receptor tr10
US20050239123A1 (en) Human tumor necrosis receptor TR9
US20020127637A1 (en) Human tumor necrosis factor receptor-like protein 8
EP1788086A1 (fr) Récepteur 5 contenant un domaine de mort
AU2006246525A1 (en) Death Domain Containing Receptor 5
EP0898576A1 (fr) Recepteurs contenant un domaine de mort cellulaire

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000111

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched
AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 20021104

17Q First examination report despatched

Effective date: 20040701

RIC1 Information provided on ipc code assigned before grant

Ipc: C07K 14/715 20060101ALI20100412BHEP

Ipc: C07K 14/705 20060101ALI20100412BHEP

Ipc: C07K 14/47 20060101AFI20100412BHEP

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: HUMAN GENOME SCIENCES, INC.

18D Application deemed to be withdrawn

Effective date: 20101110