EP0986539A1 - Derives de polyamides pyrrole-imidazole liant l'adn - Google Patents

Derives de polyamides pyrrole-imidazole liant l'adn

Info

Publication number
EP0986539A1
EP0986539A1 EP98918047A EP98918047A EP0986539A1 EP 0986539 A1 EP0986539 A1 EP 0986539A1 EP 98918047 A EP98918047 A EP 98918047A EP 98918047 A EP98918047 A EP 98918047A EP 0986539 A1 EP0986539 A1 EP 0986539A1
Authority
EP
European Patent Office
Prior art keywords
polyamide
impypy
pypypy
impypypy
impy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP98918047A
Other languages
German (de)
English (en)
Inventor
Peter B. Dervan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
California Institute of Technology CalTech
Original Assignee
California Institute of Technology CalTech
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/837,524 external-priority patent/US6143901A/en
Priority claimed from US08/853,522 external-priority patent/US6635417B1/en
Application filed by California Institute of Technology CalTech filed Critical California Institute of Technology CalTech
Publication of EP0986539A1 publication Critical patent/EP0986539A1/fr
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645—Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D207/00—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/30—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members
    • C07D207/34—Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
    • C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
    • C07D233/66—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D233/90—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06—Dipeptides
    • C07K5/06139—Dipeptides with the first amino acid being heterocyclic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06—Dipeptides
    • C07K5/06139—Dipeptides with the first amino acid being heterocyclic
    • C07K5/06182—Dipeptides with the first amino acid being heterocyclic and Pristinamycin II; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G69/00—Macromolecular compounds obtained by reactions forming a carboxylic amide link in the main chain of the macromolecule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6839—Triple helix formation or other higher order conformations in hybridisation assays

Definitions

  • This invention relates to the fields of molecular biology, biochemistry, and drug design. More particularly, the present invention provides synthetic polyamides containing pyrrole and imidazole amino acids which bind specific base pair sequences of double helical DNA with affinities and specificities comparable to DNA binding proteins such as the transcription factors. A series of molecular templates are described which allow for rational targeting of any predetermined DNA sequence of ⁇ therapeutic potential. This non-biological approach to DNA recognition provides an underpinning for the design of synthetic cell -permeable ligands for the control of gene-expression .
  • Designed bifunctional small molecules which target specific D ⁇ A sequences offer a potentially general approach for gene-specific, sequence-specific, or organism specific modification, detection or capture of plasmids, genes, cD ⁇ A, cosmids, or chromosomes. More specifically, a life threatening disease may result from a single error within the 3 x 10 units of information stored within the double helix. Sequence-specific polyamides may discriminate such small errors, hence bifunctional polyamides could have broad diagnostic applications which range from determining the molecular basis of life threatening diseases to sequence-specific visualization of disease genes in living organisms.
  • the genetic information is in fact, stored on two stands of DNA (in antiparallel orientation) in a structure termed the double helix.
  • the DNA double helix consists of A,T and G,C base pairs held together by specific Watson-Crick hydrogen bonds like rungs on a twisted ladder.
  • the common B-form of DNA is characterized by a wide (12A) and shallow major groove and a deep and narrow
  • Distamycin A Two distinct DNA binding modes exist for Distamycin A.
  • a single molecule of Distamycin binds in the middle of the minor groove of a 5 base pair A,T rich sequence.
  • the amide hydrogens of the N-methylpyrrole-carboxamides form bifurcated hydrogen bonds with Adenine ⁇ 3 and thymine 02 atoms on the floor of the minor groove.
  • 2 distamycin ligands form an antiparallel side-by-side dimer in the minor groove of a 5 base pair A,T rich site.
  • each polyamide subunit forms hydrogen bonds to a unique D ⁇ A strand in the minor groove.
  • Polyamides containing N-methylpyrrole (Py) and N- methylimidazole (Im) amino acids provide a model for the design of artificial molecules for recognition of double helical D ⁇ A.
  • the D ⁇ A binding sequence specificity depends on the sequence of side-by- side amino acid pairings.
  • a pairing of Im opposite Py targets a G*C base pair while a pairing of Py opposite Im targets a C»G base pair.
  • a Py/Py combination is degenerate targeting both A»T and T*A base pairs. Specificity for G,C base pairs results from the formation of a putative hydrogen bond between the imidazole ⁇ 3 and the exocyclic amine group of guanine. Validity of the pairing rules is supported by a variety of footprinting and NMR structure studies. (Mrksich, et al . , J. Am. Chem.
  • a simple hairpin polyamide motif with ⁇ -aminobutyric acid ( ⁇ ) serving as a turn-specific internal -guide-residue provides a synthetically accessible method of linking polyamide subunits within the 2:1 motif.
  • the hairpin polyamide model is supported by footprinting, affinity cleaving and NMR structure studies. (Church, et al . Biochemistry 1990, 29, 6827; He, et al . J. Am . Chem . Soc 1993, 115, 7061; de Clairac, et al . J " . Am. Chem . Soc submi tted. )
  • This invention provides improved polyamides for selectively binding a DNA molecule.
  • Compounds of the present invention comprise a polyamide of the formula:
  • R 1 , R a , R b , R e , R f , R 1 , R j , R n , and R° are chosen independently from H, Cl , NO, N-acetyl, benzyl, C ⁇ - 6 alkyl, C x - 6 alkylamine, C x - 6 alkyldiamine, C x - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, and C ⁇ - 6 alkynyl;
  • R 2 is selected from the group consisting of H, NH 2 ,
  • R 3 , R d , R 1 and R q are selected independently from the group consisting of H, NH 2 , OH, SH, Br, Cl, F, OMe, CH 2 OH,
  • R 4 is -NH(CH 2 )o- 6 R 5 R 6 or NH(CH 2 ) r CO NH (CH 2 ) 0 - 6 NR 5 R 6 or
  • NHR 5 or NH(CH 2 ) r CONHR 5 where R 5 and R 6 are independently chosen from H, Cl, NO, N-acetyl, benzyl, C x - 6 alkyl, C ⁇ - 6 alkylamine, C ⁇ - 6 alkyldiamine, C ⁇ - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, C ⁇ - 6 L, where L groups are independently chosen from biotin, oligodeoxynucleotide, N-ethylnitrosourea,
  • fluorescein bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, ethyl red, 4- (psoralen- 8 -yloxy) -butyrate,
  • X, X a , X b , X e , X f , X 1 , X j , X n , X° are chosen independently from the group consisting of N, CH, COH, CCH 3 , CNH 2 , CC1, CF; and a, b, c, d, e, f, i, j, k, and m are integers chosen independently, having values ranging from 0 to 5 ; or a pharmaceutically acceptable salt thereof.
  • the invention further comprises a polyamide having the formula:
  • R 1 , R a(i - m) and R b( i' m) are chosen independently from H, Cl, NO, N-acetyl, benzyl, C ⁇ - 6 alkyl, C ⁇ - 6 alkylamine, Ci- 6 alkyldiamine, C ⁇ - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, and C ⁇ -6 alkynyl ;
  • R 2 is selected from the group consisting of H, NH 2 , SH, Cl, Br, F, N-acetyl, and N-formyl;
  • R f(m) and R c(k ' ) are selected independently from the group consisting of H, NH 2 , OH, SH, Br, Cl , F, OMe, CH 2 OH, CH 2 SH, CH 2 NH 2 ;
  • R 4 is -NH(CH 2 ) 0 - 6 NR 5 R 6 or NH(CH 2 ) r CO NH (CH 2 ) 0 - 6 NR 5 R 6 or NHR 5 or NH(CH 2 ) r CONHR 5 , where R 5 and R 6 are independently chosen from H, Cl , NO, N-acetyl, benzyl, C ⁇ - 6 alkyl, C X - 6 alkylamine, C__- 6 alkyldiamine, C ⁇ - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, C ⁇ - 6 L . where L groups are independently chosen from biotin, oligodeoxynucleotide, N-ethylnitrosourea,
  • fluorescein bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, ethyl red, 4- (psoralen-8 -yloxy) -butyrate,
  • X, ⁇ a(i ' m) and ⁇ b(3 ' m) are chosen independently from the group consisting of N, CH, COH, CCH 3 , CNH 2 , CCl, CF; and a, b, c, d, e, f, g, h, i, j, k, 1, m, n, o and p are integers chosen independently, having values ranging from 0 to 5; or a pharmaceutically acceptable salt thereof.
  • alkyl or “lower alkyl” in the present invention is meant C ⁇ -C 6 alkyl, i.e., straight or branched chain alkyl groups having 1-6 carbon atoms, such as, for example, methyl, ethyl, propyl, isopropyl, n-butyl, sec- butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2 -hexyl, 3 -hexyl, and 3-methylpentyl .
  • Preferred Ci-C ⁇ alkyl groups are methyl, ethyl, propyl,
  • Ci-C alkyl groups such as methyl, ethyl,
  • FIGURE Small molecules isolated from natural sources.
  • FIGURE 2 Hairpin polyamides .
  • FIGURE 3 Chemical structures of polyamides.
  • FIGURE 4 Solid phase synthesis of polyamides.
  • FIGURE 5 Extended hairpin polyamides.
  • FIGURE 6 Association profile of extended hairpin polyamides .
  • FIGURE 7. Binding models for polyamides.
  • FIGURE 8 Schematic binding models for eight ring hairpin polyamide .
  • FIGURE 9 Eight-residue hairpin polyamides.
  • FIGURE 10 Structure of 4- ⁇ -4 polyamides.
  • FIGURE 11 Recognition of DNA by 4- ⁇ -4 polyamides
  • FIGURE 12 Placement of ⁇ / ⁇ pairs.
  • FIGURE 13 ⁇ -linked fully overlapped polyamide complexes.
  • FIGURE 14.10-ring hairpin polyamides.
  • FIGURE 15 Discrimination of seven base pair sequence by polyamides .
  • FIGURE 16 Hairpin polyamides that recognize seven base pair sequence .
  • FIGURE 20 Structure of (+) CC-1065 and duocarmycins .
  • FIGURE 21 Alkylation mechanism of CC-1065.
  • FIGURE 22 Structure of Bizlesin and CBI .
  • FIGURE 23 Synthesis of CBI -polyamide conjugate.
  • FIGURE 24 Synthesis of bifunctional methidium-polyamide conjugates.
  • FIGURE 25 Synthesis of polyamide -rhodamine conjugate.
  • FIGURE 26 Structure of polyamide -DYE conjugates.
  • FIGURE 27 Synthesis of biotin-polyamide conjugates.
  • FIGURE 28 Bifunctional biotin-polyamide conjugates.
  • FIGURE 29 Affinity capture using bifunctional biotin- polyamide conjugates.
  • FIGURE 30 Psoralen-polyamide conjugate.
  • FIGURE 31 Cooperative dimerization of polyamides.
  • FIGURE 32 Binding of polyamides to mismatched sites.
  • FIGURE 33 Footprint titration of polyamides.
  • FIGURE 34 General izable polyamide motifs.
  • FIGURE 35 Examples of polyamides.
  • FIGURE 36 Determination of polyamide affinity.
  • FIGURE 37 N-terminally extended polyamides.
  • FIGURE 38 Polyamides binding 16 base pair sequence.
  • FIGURE 39 Determination of 16 base pair sequence.
  • FIGURE 40 Binding of polyamides to mismatched sites.
  • FIGURE 41 ⁇ -substitution in polyamides.
  • FIGURE 42 Affinity determinations for ⁇ -substituted polyamides .
  • FIGURE 43 Binding of polyamides to TATA box.
  • a promoter is a regulatory sequence of DNA that is involved in the binding of RNA polymerase to initiate transcription of a gene.
  • a gene is a segment of DNA involved in producing a peptide, polypeptide or protein, including the coding region, non-coding regions preceding ("leader”) and following (“trailer”) the coding region, as well as intervening non-coding sequences ("introns") between individual coding segments ("exons"). Coding refers to the representation of amino acids, start and stop signals in a three base “triplet” code. Promoters are often upstream (“ ⁇ 5 to”) the transcription initiation site of the corresponding gene.
  • Enhancers comprise yet another group of regulatory sequences of DNA that can increase the utilization of promoters, and can function in either orientation (5' -3' or 3' -5') and in any location (upstream or downstream) relative to the promoter.
  • the regulatory sequence has a positive activity, i.e., binding of an endogeneous ligand (e.g. a transcription factor) to the regulatory sequence increases transcription, thereby resulting in increased expression of the corresponding target gene. In such a case, interference with transcription by binding a polyamide to a regulatory sequence would reduce or abolish expression of a gene.
  • the promoter may also include or be adjacent to a regulatory sequence known in the art as a silencer.
  • a silencer sequence generally has a negative regulatory effect on expression of the gene.
  • expression of a gene may be increased directly by using a polyamide to prevent binding of a factor to a silencer regulatory sequence or indirectly, by using a polyamide to block transcription of a factor to a silencer regulatory sequence.
  • polyamides of this invention bind to double stranded DNA in a sequence specific manner.
  • the function of a segment of DNA of a given sequence, such as 5'-TATAAA-3X depends on its position relative to other functional regions in the DNA sequence. In this case, if the sequence 5'-TATAAA-3' on the coding strand of DNA is positioned about 30 base pairs upstream of the transcription start site, the sequence forms part of the promoter region (Lewin, Genes VI, pp. 831-835).
  • sequence 5'- TATAAA-3' is downstream of the transcription start site in a coding region and in proper register with the reading frame, the sequence encodes the tyrosyl and lysyl amino acid residues (Lewin, Genes VI, pp. 213-215) .
  • the binding of the polyamides of this invention modulate gene expression by altering the binding of DNA binding proteins, such as RNA polymerase, transcription factors, TBF, TFIIIB and other proteins.
  • DNA binding proteins such as RNA polymerase, transcription factors, TBF, TFIIIB and other proteins.
  • the effect on gene expression of polyamide binding to a segment of double stranded DNA is believed to be related to the function, e.g., promoter, of that segment of DNA.
  • the improved polyamides of the present invention may bind to any of the above-described DNA sequences or any other sequence having a desired effect upon expression of a gene.
  • U.S. Patent No. 5,578,444 describes numerous promoter targeting sequences from which base pair sequences for targeting an improved polyamide of the present invention may be identified.
  • the basic structure of DNA in a living cell includes both major and a minor groove .
  • the minor groove is the narrow groove of DNA as illustrated in common molecular biology references such as Lewin, B., Genes VI, Oxford University Press, New York (1997) .
  • a effective quantity of one or more polyamide is contacted with the cell and internalized by the cell.
  • the cell may be contacted in vivo or in vi tro.
  • Effective extracellular concentrations of polyamides that can modulate gene expression range from about 10 nanomolar to about 1 micromolar.
  • a suitable number of cells is plated on tissue culture plates and various quantities of one or more polyamide are added to separate wells.
  • Gene expression following exposure to a polyamide can be monitored in the cells or medium by detecting the amount of the protein gene product present as determined by various techniques utilizing specific antibodies, including ELISA and western blot.
  • gene expression following exposure to a polyamide can be monitored by detecting the amount of messenger RNA present as determined by various techniques, including northern blot and RT-PCR.
  • a sample of body tissue or fluid such as plasma, blood, urine, cerebrospinal fluid, saliva, or biopsy of skin, muscle, liver, brain or other appropriate tissue source is analyzed.
  • Gene expression following exposure to a polyamide can be monitored by detecting the amount of the protein gene product present as determined by various techniques utilizing specific antibodies, including ELISA and western blot.
  • gene expression following exposure to a polyamide can be monitored by the detecting the amount of messenger RNA present as determined by various techniques, including northern blot and RT-PCR.
  • the polyamides of this invention may be formulated into diagnostic and therapeutic compositions for in vivo or in vi tro use. Representative methods of formulation may be found in Remington : The Science and Practice of Pharmacy, 19th ed. , Mack Publishing Co., Easton, PA (1995) .
  • the polyamides may be incorporated into a physiologically acceptable pharmaceutical composition that is administered to a patient in need of treatment or an animal for medical or research purposes.
  • the polyamide composition comprises pharmaceutically acceptable carriers, excipients, adjuvants, stabilizers, and vehicles.
  • the composition may be in solid, liquid, gel, or aerosol form.
  • the polyamide composition of the present invention may be administered in various dosage forms orally, parentally, by inhalation spray, rectally, or topically.
  • parenterai as used herein includes, subcutaneous, intravenous, intramuscular, intrasternal , infusion techniques or intraperitoneally.
  • the selection of the precise concentration, composition, and delivery regimen is influenced by, inter alia, the specific pharmacological properties of the particular selected compound, the intended use, the nature and severity of the condition being treated or diagnosed, the age, weight, gender, physical condition and mental acuity of the intended recipient as well as the route of administration. Such considerations are within the purview of the skilled artisan. Thus, the dosage regimen may vary widely, but can be determined routinely using standard methods.
  • Polyamides of the present invention are also useful for detecting the presence of double stranded DNA of a specific sequence for diagnostic or preparative purposes.
  • the sample containing the double stranded DNA can be contacted by polyamide linked to a solid substrate, thereby isolating DNA comprising a desired sequence.
  • polyamides linked to a suitable detectable marker such as biotin, a hapten, a radioisotope or a dye molecule, can be contacted by a sample containing double stranded DNA.
  • bifunctional sequence specific DNA binding molecules requires the integration of two separate entities: recognition and functional activity.
  • Polyamides that specifically bind with subnanomolar affinity to the minor groove of a predetermined sequence of double stranded DNA are linked to a functional molecule, providing the corresponding bifunctional conjugates useful in molecular biology, genomic sequencing, and human medicine.
  • Polyamides of this invention can be conjugated to a variety of functional molecules, which can be independently chosen from but is not limited to arylboronic acids, biotins, polyhistidines comprised from about 2 to 8 amino acids, haptens to which an antibody binds, solid phase supports, oligodeoxynucleotides, N-ethylnitrosourea, fluorescein, bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, captothesin, pyrene, mitomycin, texas red, anthracene, anthrinilic acid, avidin, DAPI, isosulfan blue, malachite green, psoralen, ethyl red, 4- (psoraen-8- yloxy) -butyrate, tartaric acid, ( +) - ⁇ -tocopheral , psoralen, EDTA, methidium,
  • bifunctional polyamides are useful for DNA affinity capture, covalent DNA modification, oxidative DNA cleavage, DNA photocleavage .
  • Such bifunctional polyamides are useful for DNA detection by providing a polyamide linked to a detectable label. DNA complexed to a labeled polyamide can then be determined using the appropriate detection system as is well known to one skilled in the art. For example, DNA associated with a polyamide linked to biotin can be detected by a streptavidin / alkaline phosphatase system.
  • the present invention also describes a diagnostic system, preferably in kit form, for assaying for the presence of the double stranded DNA sequence bound by the polyamide of this invention in a body sample, such brain tissue, cell suspensions or tissue sections, or body fluid samples such as CSF, blood, plasma or serum, where it is desirable to detect the presence, and preferably the amount, of the double stranded DNA sequence bound by the polyamide in the sample according to the diagnostic methods described herein.
  • the diagnostic system includes, in an amount sufficient to perform at least one assay, a specific polyamide as a separately packaged reagent. Instructions for use of the packaged reagent (s) are also typically included.
  • a package refers to a solid matrix or material such as glass, plastic (e.g., polyethylene, polypropylene or polycarbonate) , paper, foil and the like capable of holding within fixed limits a polyamide of the present invention.
  • a package can be a glass vial used to contain milligram quantities of a contemplated polyamide or it can be a microliter plate well to which microgram quantities of a contemplated polypamide have been operatively affixed, i.e., linked so as to be capable of being bound by the target DNA sequence.
  • Instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent or sample admixtures, temperature, buffer conditions and the like.
  • a diagnostic system of the present invention preferably also includes a detectable label and a detecting or indicating means capable of signaling the binding of the contemplated polyamide of the present invention to the target DNA sequence.
  • detectable labels such as biotin
  • detecting or indicating means such as enzyme-linked (direct or indirect) streptavidin
  • Polyamides comprising Hp, Im, and Py provide for coded targeting of pre-determined DNA sequences with high affinity and specificity.
  • Im and Py polyamides may be combined to form Im/Py, Py/Im, Py/Py binding pairs which complement the four Watson-Crick base pairs A, C, G, and T. Table 1 illustrates such pairings.
  • Three or four-ring improved polyamides of the present invention are covalently coupled to form six or eight-ring structures, respectively, that bind specifically to four or six base pair targets, respectively, at subnanomolar concentrations.
  • the improved polyamides of the present invention may be directed to any DNA sequence comprised of A, C, G, or T.
  • the present invention comprises improved polyamides having three or four-ring polyamide structures covalently coupled to form six or eight-ring hairpin structures, respectively, of the general structures I - XXVIII:
  • X 1 - 12 is a substituted imidazole such as N- methylimidazolecarboxamide (Im) , or a substituted pyrrole such as N-methylpyrrolecarboxamide (Py) .
  • An improved polyamide of the present invention may also include a C- terminal aliphatic amino acid such as a ⁇ -alanine residue ( ⁇ ) joined to an amide group such as dimethylaminopropylamide (Dp) .
  • an improved polyamide of the present invention may further include a aliphatic amino acid such as ⁇ -alanine residue ( ⁇ ) or glycine (G) , an amide group such as dimethylaminopropylamide (Dp) , an alcohol such as EtOH, an acid such as ethylenediaminetetraacetic acid (EDTA) , or any derivative thereof joined to the ⁇ -aminobutyric acid ( ⁇ ) residue.
  • ⁇ -alanine in the synthetic methods provides aromatic/aliphatic pairing (Im/ ⁇ , ⁇ /lm, Py/ ⁇ , and ⁇ /Py) and aliphatic/aliphatic pairing ( ⁇ / ⁇ ) substitution.
  • XXIX may be covalently coupled through the ⁇ residue which represents a -NH-CH 2 -CH 2 -CH 2 -CONH- hairpin linkage derived from ⁇ -aminobutyric acid or a chiral hairpin linkage derived from R-2 , 4 -diaminobutyric acid.
  • the present invention provides the reagents and methodologies for substituting the ⁇ -residue of certain polyamides with a moiety such as (R) -2 , 4 , -diaminobutyric acid ( (R) 2 ⁇ ).
  • the NMR structure of a hairpin polyamide of sequence composition ImPyPy- ⁇ -PyPyPy complexed with a 5'-TGTTA-3' target site indicated that it was possible to substitute the ⁇ -position of the ⁇ -aminobutyric acid residue within the hairpin-DNA complex (de Claire, et al . J " . Am . Chem . Soc 1997 , 119, 7909) .
  • Modeling indicated that replacing the ⁇ -H of ⁇ with an amino group that may confer an R- configuration at the ⁇ -carbon and could be accommodated within the floor and walls of the minor groove.
  • a polyamide of Formulas I -XXIX may also be conjugated to a bifunctional group including but not limited to arylboronic acid, biotins, polyhistidine of 2 to 8 amino acids, hapten to which an antibody binds, solid phase support, oligodeoxynucleotide, N- ethylnitrosourea, fluorescein, bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, captothesin, pyrene, mitomycin, texas red, anthracene, anthrinilic acid, avidin, DAPI, isosulfan blue, malachite green, psoralen, ethyl red, 4- (psoraen- 8 -yloxy) -butyrate, tartaric acid, or (+) - ⁇ -tocopheral .
  • arylboronic acid biotins
  • polyamide refers to a polymer comprising the subunits listed below:
  • R 1 is Ci-ioo alkyl (preferably C ⁇ - ⁇ 0 alkyl such as methyl, ethyl, isopropyl) , Ci-ioo alkylamine (preferably C ⁇ - ⁇ 0 alkylamine such as ethylamine) , Ci-ioo alkyldiamine (preferably C ⁇ - ⁇ 0 alkyldiamine such as
  • Ci-ioo alkynyl preferably Ci-io alkynyl such as CH 2 C ⁇ CH 3
  • Ci-iooL preferably Ci-iooL
  • L includes but is not limited to an arylboronic acid, biotin, polyhistidine comprising from 2 to 8 amino acids, hapten to which an antibody binds, solid phase support, oligodeoxynucleotide, N- ethylnitrosourea, fluorescein, bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, captothesin, pyrene, mitomycin, texas red, anthracene, anthrinilic acid, avidin, DAPI , isosulfan blue, malachite green, psoralen, ethyl red,
  • R 2 is H, NH 2 , SH, Cl, Br, F, N-acetyl, or N-formyl;
  • R3 is H , NH 2 , OH , SH , Br , Cl , F , OMe , CH 2 OH , CH 2 SH , or
  • X is N, CH, COH, CCH 3 , CNH 2 , CCl, or CF .
  • R 5 and R 6 are H.
  • the compounds of the present invention may comprise a compound of Formula XXIX or XXX:
  • R 1 , R a , R b , R e , R f , R 1 , R j , R n , and R° are chosen independently from H, Cl, NO, N-acetyl, benzyl, C ⁇ - 6 alkyl, C ⁇ - 6 alkylamine, X - 6 alkyldiamine, C x - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, and Ci-g alkynyl;
  • R 2 is selected from the group consisting of H, NH 2 , SH, Cl, Br, F, N-acetyl, and N-formyl;
  • R 3 , R d , R 1 and R q are selected independently from the group consisting of H, NH 2 , OH, SH, Br, Cl , F, OMe, CH 2 OH, CH 2 SH, CH 2 NH 2 ;
  • R 4 is -NH(CH 2 )o-eNR 5 R G or NH(CH 2 ) r C0 NH (CH 2 ) 0 - 6 NR 5 R 6 or NHR 5 or NH(CH 2 ) r CONHR 5 , where R 5 and R 6 are independently chosen from H, Cl , NO, N-acetyl, benzyl, C 1 - 6 alkyl, C ⁇ - 6 alkylamine, C ⁇ - 6 alkyldiamine, C ⁇ - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, C ⁇ L, where L groups are independently chosen from biotin, oligodeoxynucleotide, N-ethylnitrosourea,
  • fluorescein bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, ethyl red, 4- (psoralen-8 -yloxy) -butyrate,
  • tartaric acid (+) - ⁇ -tocopheral , and x - 6 alkynyl, where r is an integer having a value ranging from 0 to 6;
  • X, X a , X b , X e , X f , X 1 , X 3 , X n , X° are chosen independently from the group consisting of N, CH, COH, CCH 3 , CNH 2 , CC1, CF; and a, b, c, d, e, f, i, j, k, and m are integers chosen independently, having values ranging from 0 to 5; or a pharmaceutically acceptable salt thereof.
  • the invention further comprises a polyamide having the formula:
  • R 1 , R a(i ' m) and R b ⁇ i - m) are chosen independently from H, Cl, NO, N-acetyl, benzyl, C ⁇ - 6 alkyl, C ⁇ - 6 alkylamine, C ⁇ - G alkyldiamine, C ⁇ - 6 alkylcarboxylate, x . 6 alkenyl, and C ⁇ - 6 alkynyl ;
  • R 2 is selected from the group consisting of H, NH 2 , SH, Cl, Br, F, N-acetyl, and N-formyl;
  • R f(m) and R c(k ' m) are selected independently from the group consisting of H, NH 2 , OH, SH, Br, Cl , F, OMe, CH 2 OH, CH 2 SH, CH 2 NH 2 ;
  • R 4 is -NH(CH 2 )o- 6 NR 5 R 6 or NH(CH 2 ) r C0 NH (CH 2 ) 0 -eNR 5 R 6 or NHR 5 or NH (CH 2 ) r CONHR 5 , where R 5 and R 6 are independently chosen from H, Cl, NO, N-acetyl, benzyl, C ⁇ - 6 alkyl, C ⁇ - 6 alkylamine, C ⁇ - 6 alkyldiamine, C ⁇ - 6 alkylcarboxylate, C ⁇ - 6 alkenyl, C ⁇ . 6 L, where L groups are independently chosen from biotin, oligodeoxynucleotide, N-ethylnitrosourea,
  • fluorescein bromoacetamide, iodoacetamide, DL- ⁇ -lipoic acid, acridine, ethyl red, 4- (psoralen-8-yloxy) -butyrate,
  • Polyamides of the present invention may be synthesized by solid phase methods using compounds such as Boc-protected 3-methoxypyrrole, imidazole, and pyrrole aromatic amino acids, which are cleaved from the support by aminolysis, deprotected with sodium thiophenoxide, and purified by reverse-phase HPLC.
  • the identity and purity of the polyamides may be verified using any of a variety of analytical techniques available to one skilled in the art such as 1H-NMR, analytical HPLC, and/or matrix-assisted laser-desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS- monoisotropic) .
  • analytical techniques available to one skilled in the art such as 1H-NMR, analytical HPLC, and/or matrix-assisted laser-desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS- monoisotropic) .
  • the above polyamide subunits can be synthesized in small scale by methods known in the art.
  • the synthesis of Boc-Py-OBt ester 7 (Grehn, L. and Ragnarsson, U. J. Org. Chem. 1981, 46, 3492.) and Boc-Im acid 11 (Grehn, et al . Acta. Chim. Scand . 1990, 44 , 67.) has been previously described. Available procedures provide only milligram to gram quantities of monomer (J. Org. Chem. 52, 3493-3500 (1987); Bailey, et al . Org. Synth . 51, 101 (1971); Nishsiwaki, et al . Heterocycles 27, 1945 (1988).
  • the polyamide polymer can be a homopolymer of Py and
  • amino acids including but not limited to the naturally occurring amino acids and preferably being glycine
  • amino acids of the formula -NH- (CH) n -CO- where n is an integer from 1-12 (preferably n being 1 as in ⁇ -alanine or 2 as in ⁇ - aminobutyric acid) .
  • the carboxy terminus of the polyamide may comprise - NH(CH 2 )o-6, NR X R 2 or NH(CH 2 ) b C0 NH (CH 2 ) o-eNR ⁇ 2 , NHR 1 or
  • R 1 and R 2 are independently chosen from C ⁇ - 6 alkyl
  • Ci- 6 alkylamine preferably C 1 - 3 alkylamine such as ethylamine
  • C ⁇ - 6 alkyldiamine preferably C 1 - 3 alkyldiamine such as N,N-dimethylpropylamine
  • C ⁇ - 6 alkylcarboxylate preferably a C 1 - 3 alkylcarboxylate such as-CHCOOH
  • C x preferably C 1 - 3 alkylamine such as ethylamine
  • C ⁇ - 6 alkyldiamine preferably C 1 - 3 alkyldiamine such as N,N-dimethylpropylamine
  • C ⁇ - 6 alkylcarboxylate preferably a C 1 - 3 alkylcarboxylate such as-CHCOOH
  • alkynyl (preferably C 1 - 3 alkynyl such as -CH 2 C ⁇ CH 3 ) , or a C ⁇ - 6 L where L includes but is not limited to biotin, oligodeoxynucleotide, , N-ethylnitrosourea, fluorescein, bromoacetamide, iodoacetamide , DL- ⁇ -lipoic acid, acridine, ethyl red, 4 - (psoraen- 8 -yloxy) -butyrate, tartaric acid, (+) - ⁇ -tocopheral .
  • L includes but is not limited to biotin, oligodeoxynucleotide, , N-ethylnitrosourea, fluorescein, bromoacetamide, iodoacetamide , DL- ⁇ -lipoic acid, acridine, ethyl red, 4 - (psora
  • Most preferred compounds of the instant invention are polyamides core sequence composition: ImPyPyPy- ⁇ - PyPyPyPy, PyPylmPy- ⁇ -PyPyPy, ImPyPyPy- ⁇ -ImPyPy, PylmPyPy- ⁇ -PylmPyPy, ImPylmPy- ⁇ -PyPyPy, ImlmPy- ⁇ -PyPyPyPy, ImlmPyPy- ⁇ - PyPyPyPyPyPy, ImlmlmPy- ⁇ -PyPyPyPy, ImlmPyPy- ⁇ -ImPyPyPy, ImPyPyPy- ⁇ -ImlmPyPy, ImlmPyPy- ⁇ -ImlmPyPy, ImlmPyPy- ⁇ -ImlmPyPy, ImlmPy- ⁇ -ImlmPyPy,
  • Distamycin and its analogs can be produced by traditional multi-step synthetic organic chemistry (Weiss, et al . J. Am . Chem . Soc . 1957, 79, 1266; Arcamone, et al . Gazz . Chim . Ital . 1967, 97, 1097; Penco, et al Gazz . Chim . Ital . 1967, 97, 1110; Bailer, et al . Tetrahedron 1978, 34 , 2389.)
  • the repeating amide of distamycin is formed from an aromatic carboxylic acid and an aromatic amine, both of which have proven problematic for solution phase coupling reactions.
  • hairpins may be shown as chemical structures binding to a schematic representation of the minor groove.
  • An abbreviated representation may alternatively be used wherein, imidazole rings are represented as filled circles, pyrrole rings are represented as unfilled circles, ⁇ -alanine is represented as a diamond, Glycine is represented as a triangle, amide bonds are represented as lines, ⁇ -aminobutyric acid is represented as a curved line, and the positively charged di thylaminopropylamide is represented with a ( +) .
  • An example of both notations is shown below for the optimized 6 -ring hairpin polyamide ImPyPy- ⁇ -PyPyPy- ⁇ -Dp binding to a cognate 5'-TGTTA-3' site:
  • TGATT-3' > 5'-TGATA-3' -TGAAA-3 5'-TGAAT-3' as shown in schematic form below: 5'-T G T T T-3' 5'-T G T T A-3 ' 5 ' -T G T A A-3 ' 5 ' -T G T A T-3 '
  • ImPyPy- ⁇ -PyPyPy- ⁇ -Dp binds 5' -TGT (A, T) 2 -3' sites with between 2-fold and 12- fold higher affinity than 5 ' -TGA (A, T) 2 -3 ' sites. Therefore binding sites containing 5'-GT-3' steps may be preferred over those containing 5'-GA-3' steps for therapeutic targets .
  • individual polyamide subunits can recognize DNA with two possible binding orientations.
  • Recognition of 5'-TGTTA-3' by a polyamide of core sequence composition ImPyPy- ⁇ -PyPyPy places the N-terminus of each polyamide subunit at the 5' -side of each recognized DNA strand. Placement of the polyamide N- terminus at the 3' side of each recognized strand would result in targeting of a 5'-TCTTA-3' sequence.
  • Each binding orientation represents a unique and distinguishable hairpin fold. Subunit orientation preference was not defined by the prior art, however, in order to successfully apply the pairing rules towards polyamide design, a single predictable subunit binding orientation must be preferred.
  • DNA-binding orientations is shown below:
  • a series of four polyamides were prepared: ImPyPy- ⁇ - PyPyPy- ⁇ -Dp, ImlmPy- ⁇ -PyPyPy- ⁇ -Dp, ImPyPy- ⁇ -PylmPy- ⁇ -Dp, and ImlmPy- ⁇ -PylmPy- ⁇ -Dp.
  • Each polyamide places a Py/Py, Im/Py, Py/Im, or Im/lm pair opposite either a T/A or G/C base pair in eight possible ring pairing-base pair combinations.
  • the structure of four hairpin polyamides, which differ in the central ring pairings, are shown in Figure 2.
  • 6 -ring hairpin polyamide motif provides a versatile template for recognition of a wide variety of sequences in the DNA minor groove.
  • Six-ring hairpin polyamides recognize their cognate sites with affinities ranging from 1 x 10 7 M "1 to 1 x 10 8 M "1 and specificity against single base pair mismatch sites ranging from 2-fold to 60-fold.
  • 6- ring hairpin motif The broad sequence repertoire recognized by the 6- ring hairpin motif represents a significant advance in ligand design. However, no 6 -ring hairpin polyamide has been identified which recognizes a target site with subnanomolar affinity.
  • the series is based on ImPyPy-Dp with pyrrolecarboxamide moieties added sequentially to the C-termini to afford ImPyPyPy-Dp, ImPyPyPyPy-Dp , ImPyPyPyPyPy-Dp, ImPyPyPyPyPyPy-Dp, and ImPyPyPyPyPyPyPy-Dp which are designed to bind 5 to 10 base pair sites, respectively as side-by-side antiparellel dimers .
  • DNA binding sites are based on a 5'-TGACA-3' core sequence and contain sequential A,T inserts in the center of the binding site that will be recognized by the additional pyrrole carboxamides .
  • Chemical structures of the polyamides are shown in Figure 3. It was determined that polyamides based on 4 or 5- ring subunits are optimal, and that subunits must not contain more than 5 consecutive rings. Binding affinity reaches a maximum value for the five ring polyamide ImPyPyPyPy-Dp and addition of up to two additional pyrrolecarboxamides has no effect on the observed association constant (Table 2) . Furthermore, sequence specificity decreases as the length of the polyamides increases beyond five rings.
  • the present invention provides for the replacement of a central pyrrole or imidazole amino acid with a more flexible amino acid subunit, thus allowing the antiparallel dimer to reset the register for continued gain in affinity and specificity.
  • ⁇ -alanine is an optimal linker for joining polyamide subunits in an extended conformation, providing a useful structural motif for the design of new polyamides targeted to sequences longer than 7 base pairs.
  • Solid phase synthesis involves the stepwise assembly of a molecule while one end is covalently anchored to an insoluble matrix at all stages of the synthesis.
  • Solid phase synthesis protocols for pyrrole- imidazole polyamides reduce the synthetic investment from months to days.
  • a representative solid phase synthesis of a polyamide is shown in Figure 4.
  • Polyamides containing more than 4 residues are preferably prepared " by solid phase methodology.
  • the polyamide is attached to an insoluble matrix by a linkage which is cleaved by a single step process which introduces a positive charge into the polyamide.
  • the addition of an aliphatic amino acid at the C-terminus of the pyrrole- imidazole polyamides allows the use of Boc- ⁇ -alanine-Pam-Resin resin which is commercially available in appropriate substitution levels (0.2 mmol/gram)
  • Aminolysis of the resin ester linkage provides a simple and efficient method for cleaving the polyamide from the support .
  • Solid phase polyamide synthesis protocols were modified from the in si tu neutralization Boc-chemistry protocols recently reported by Kent and coworkers . (Schnolzer, et al . Int . J. Peptide . Protein . Res . 1992, 40, 180; Milton, et al . Science 1992, 256,1445.) Coupling cycles are rapid, 72 min per residue for manual synthesis or 180 min per residue for machine-assisted synthesis, and require no special precautions beyond those used for ordinary solid phase peptide synthesis.
  • the manual solid phase protocol for synthesis of pyrrole- imidazole polyamides has been adapted for use on a ABI 430A peptide synthesizer.
  • Stepwise cleavage of a sample of resin and analysis by HPLC indicates that high stepwise yields (> 99%) are routinely achieved.
  • the large number of polyamides made available by solid phase synthetic methodology makes possible the elucidation of the rules necessary for development of polyamides which bind DNA with subnanomolar affinities.
  • Cleavage of the polyamide from the resin with a primary diamine provides a polyamide having an unmodified primary amine group.
  • the amine group may then be modified with an activated carboxylic acid or by nucleophilic aromatic substitution to provide a bifunctional polyamide.
  • Standard techniques available to one skilled in the art may be used to determine the DNA binding properties of novel pyrrole-imidazole polyamides.
  • Affinity cleaving titration experiments (25 mM Tris-Acetate, 20 mM NaCl, 100 mM bp calf thymus DNA, pH 7, 22°C, 10 M DTT, 10 mM Fe(II)) using polyamides modified with EDTA*Fe (II) at the C-terminus are used to determine oriented binding.
  • MPE*Fe(II) footprinting experiments Hertzberg and Dervan, J. Am . Chem . Soc , 104, 313 (1982); Van Dyke and Dervan, Biochemi stry, 22, 2373 (1983); Van Dyke and Dervan, Nucleic Acids Res .
  • the binding data for ImPyPy- ⁇ -PyPyPy-Dp which was shown previously to bind DNA in a "hairpin" conformation, indicates that ⁇ -aminobutyric acid does not effectively link polyamide subunits in an extended conformation.
  • the discovery of ⁇ -alanine as an effective linker for joining polyamide subunits in an extended conformation provides a useful structural motif for the design of new polyamides based on subunits ⁇ 5 -rings targeted to sites longer than 7 bp .
  • At least two distinct binding modes are expected to form for the ImPyPy-X-PyPyPy-Dp polyamides described above that bind in an extended conformation. These binding modes as "slipped" and “overlapped” .
  • the "slipped" (13 base pair) binding mode integrates the 2:1 and 1:1 polyamide-DNA binding motifs at a single site.
  • the ImPyPy moieties of two ImPyPy-X-PyPyPy-Dp polyamides bind the central 5'-AGACA- 3' sequence in a 2:1 manner as in the ImPyPy homodimer, and the PyPyPy moieties of the polyamides bind to A,T flanking sequences as in the 1:1 complexes of distamycin.
  • a schematic model of the "slipped" and "overlapped” binding modes is shown below.
  • the present invention provides ⁇ -alanine as an optimal linker for joining polyamide subunits in a "slipped" extended conformation, providing a structural motif whereby a MW « 900 polyamide recognizes a 13 base- pair DNA sequence.
  • the ⁇ -alanine-linked compound ImPyPy- ⁇ -PyPyPy-Dp binds to a 13 bp 5 ' -AAAAAGACAAAAA-3 ' site with an association constant.
  • K a 5 x 10 9 M '1 , that is higher than the formally N-methylpyrrole-linked polyamide ImPyPy-Py-PyPyPy-Dp by a factor of -85.
  • ⁇ -aminobutyric acid and preferably ⁇ -alanine, effectively link polyamides in hairpin and extended conformations, respectively. It has also been demonstrated that ⁇ -aminobutyric does not optimally link polyamide subunits in extended conformations, and that ⁇ - alanine does not optimally link polyamide subunits in hairpin conformations. These results suggested that ⁇ - aminobutyric acid and ⁇ -alanine could be combined within a single polyamide with predictable results. (Trauger, et al, Chem. & Biol . , 3, 369 (1996)).
  • Extended hairpin polyamides provide a general method by which a polyamide may interfere with protein-DNA interactions by recognizing a unique sequence adjacent to certain protein binding sites.
  • a schematic binding model of extended hairpin polyamide recognition of a 9 base pair sequence is shown below: ⁇ - hairpin turn
  • Extended hairpin polyamide motifs that provide versatile templates for recognition of a wide variety of sequences in the DNA minor groove.
  • Extended hairpin polyamides recognize their 9 to 13 base pair sites target site with affinities ranging from 1 x 10 8 M “1 to >5 x 10 10 M "1 and specificity against single base pair mismatch sites ranging from 5-fold to 60-fold.
  • a schematic of nine extended hairpin polyamides containing 9 to 12 rings and recognizing 9 to 13 base pair target sites is shown in Figure 5.
  • an endonuclease protection assay to measure the rate of polyamide-DNA complex formation.
  • Such an assay may comprise a labeled restriction fragment comprising a polyamide binding site that overlaps a restriction endonuclease cleavage site. Cleavage by the cognate is prevented when the overlapping polyamide binding site is occupied by the polyamide.
  • a second labeled DNA fragment may be that contains the restriction site, but lacks the overlapping polyamide binding site.
  • the rate of polyamide association with its target binding site may be assessed by incubating the solutions of the polyamide with the labeled target and reference fragments for a sufficient timer period.
  • the reference site is nearly completely digested, but protection at the target site is observed and can be correlated with polyamide concentration and the time of equilibration.
  • the dissociation rate is analyzed by adding an excess of unlabeled competitor DNA to an equilibrated solution of the labeled DNA fragments and polyamide. Addition of the competitor reduces the concentration of free polyamide to zero. The rate at with polyamide dissociation occurs from the target site on the labeled fragment can be followed by the rate of loss of protection from restriction enzyme digestion as the re-equilibration time is increased.
  • First generation six-ring hairpin polyamides bind DNA with association constants of approximately 1 x 10 8 M "1 ( Figure 6)
  • the observation that unlinked four-ring polyamides form 2:1 complexes with 70-fold-higher affinity relative to three-ring polyamides suggested an eight-ring hairpin polyamide motif for recognition of DNA at subnanomolar concentration.
  • the present inventor has shown that two eight-ring pyrrole- imidazole polyamides differing in sequence by a single amino acid bind specifically to respective six base pair target sites which differ in sequence by a single base pair. (Trauger, et al . Nature, 382, 559-561 (1996)). Binding is observed at subnanomolar concentrations of ligand.
  • DNA-binding affinities were determined for two eight-ring hairpin polyamides, ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp and ImPyPyPy- ⁇ -PyPyPyPy- ⁇ -Dp, which differ by a single amino acid, for two 6 base pair (bp) target sites, 5'- AGTACT-3' and 5'-AGTATT-3X which differ by a single base pair.
  • the sites 5'-AGTACA-3' and 5'-AGTATT-3' are for ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp "match” and "single base pair mismatch” sites, respectively, and for polyamide ImPyPy- ⁇ -PyPyPyPy- ⁇ -Dp "single base pair mismatch” and "match” sites, respectively.
  • Binding models for 5'- AGTACT-3' and 5'-AGTATT-3' in complex with ImPyPyPy- ⁇ - ImPyPyPy- ⁇ -Dp and ImPyPyPy- ⁇ -PyPyPyPy- ⁇ -Dp are shown in Figure 7.
  • ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp and ImPyPyPy- ⁇ -PyPyPyPy- ⁇ -Dp were synthesized by solid phase methods and purified by reversed phase HPLC. Equilibrium association constants for match and mismatch six base pair binding sites on a
  • ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp binds its match site 5'-AGTACT-3' at 0.03 nM concentration and its single base pair mismatch site 5'-AGTATT-3' with nearly 100-fold lower affinity.
  • ImPyPyPy- ⁇ -PyPyPyPy- ⁇ -Dp binds its designated match site 5'-AGTATT-3' at 0.3 nM concentration and its single base pair mismatch site 5'- AGTACT-3 1 with nearly 10-fold lower affinity.
  • ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp and ImPyPyPy- ⁇ - PyPyPyPy- ⁇ -Dp for their respective match sites results from very small structural changes.
  • Replacing a single nitrogen atom in ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp with C-H reduces the affinity of the polyamide*5 ' -AGTACT-3 ' complex by -7-5-fold representing a free energy difference of -2.5 kcal/mole.
  • ImPylmPy- ⁇ -Dp, and Imlmlmlm- ⁇ -PyPyPyPy- ⁇ -Dp were designed for recognition of three core sequences consisting of solely G,C base pairs.
  • DNase I footprint titrations allow the determination of equilibrium association constants (K a ) for each polyamide.
  • the two designed double base pair mismatch sequences 5'- TGCGCA-3' and 5'-TGGGGA-3 are bound with at least 200- fold reduced affinity.
  • the four ring hairpin polyamide motif provides a versatile template for recognition of a wide variety of sequences in the DNA minor groove.
  • Eight ring and residue hairpin polyamides recognize 6 base pair target sites with affinities ranging from 1 x 10 7 M "1 to >1 x 10 10 M "1 and specificity against single base pair mismatch sites ranging from 2- fold to > 100-fold.
  • a schematic of fifteen 8-residue hairpin polyamides recognizing 6 base pair target sites is shown in Figure 9.
  • First generation fully overlapped ⁇ -linked polyamides based on three ring subunits bind DNA with association constants of approximately 8 x 10 8 M "1 .
  • the 4- ⁇ -4 polyamide ImlmlmPy- ⁇ -PyPyPyPy- ⁇ -Dp binds a 5'-AGGGAA-3' target site in a hairpin conformation with an association constant of K a « 4 x 10 8 .
  • the ⁇ and ⁇ linkers specificity turn and extended binding respectively and enlarge targeted binding site size from 6 to 11 base pairs, resulting in a 2.1 kcal/mol enhancement in binding energy.
  • two polyamides containing either two or three Im amino acid residues ImPyPyPyPy- ⁇ -ImPyPyPyPy- ⁇ -Dp and ImlmPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp, were prepared by solid phase synthetic methodology and their DNA binding properties analyzed.
  • the structures of two 10 -ring hairpin polyamides are shown in Figure 14.
  • K a equilibrium association constant
  • the replacement of a single electron lone-pair with a hydrogen atom within a -1500 MW polyamide is found to modulate affinity and specificity by more than an order of magnitude. Sequence-specific recognition of a 7 bp target site by a ten-ring hairpin polyamide at subnanomolar concentration expands the effective targetable sequence repertoire of the pyrrole- imidazole polyamide-DNA motif.
  • K a 1 x ⁇ o 10 K a ⁇ 1 x 10 7
  • a polyamide, ImPy- ⁇ -ImPy- ⁇ -ImPy- ⁇ -ImPy- ⁇ -ImPy- ⁇ -Dp, based on ⁇ -alanine linked 2 -ring subunits was prepared to target a seven basepair region adjacent to a binding site for the transcription factor TBP in a conserved HIV gene-promoter sequence.
  • An isomeric mismatched polyamide, ImPy- ⁇ -ImPy- ⁇ -ImPy- ⁇ -ImPy- ⁇ -ImPy- ⁇ -Dp which differs only by the position of the Py and Im amino acids within the 2- ⁇ -2- ⁇ -2- ⁇ -2 molecular template binds the targeted 5-TGCTGCA-3' sequence with 100-fold reduced affinity.
  • a schematic representation of a polyamide and a control polyamide which are molecular isomers, yet discriminate a 7 -base pair sequence of an HIV gene promoter with a 100-fold specificity is shown in Figure 15.
  • hairpin polyamides based on 5-ring subunits provide a useful structural motif for the recognition of 7 bp binding sites at subnanomolar concentrations.
  • a 5- ⁇ -5 polyamide ImPyPyPyPy- ⁇ -ImPyPyPyPy- ⁇ -Dp based on 2 ⁇ -aminobutyric acid linked 5-ring subunits is preferred over the corresponding ⁇ -substituted, 2- ⁇ -2- ⁇ -2- ⁇ -2 polyamide ImPy- ⁇ -PyPy- ⁇ -ImPy- ⁇ -PyPy- ⁇ -Dp .
  • the present inventor has discovered that a ⁇ / ⁇ pairing is preferred to a Py/ ⁇ pairing for extension of the targetable binding site size of the hairpin polyamide motif.
  • Three "12-ring hairpin" polyamides ImPyPyPyPyPy- ⁇ -ImPyPyPyPyPy- ⁇ -Dp, ImPyPy- ⁇ -PyPy- ⁇ -ImPyPy- ⁇ -PyPy- ⁇ -Dp and ImPy- ⁇ -PyPyPy- ⁇ -ImPyPy- ⁇ -PyPy- ⁇ -Dp were synthesized by solid phase synthetic methodology.
  • a paired ⁇ / ⁇ substituted hairpin motif allows specific targeting of sequences of the form 5 ' -WGWGWWCW-3 ' .
  • Substitution of a ⁇ / ⁇ pair for the second pyrrole pairing of a 12 -ring hairpin polyamide provides polyamides which target a wide variety of 8 base pair sequences of mixed sequence composition. Sequences are bound with subnanomolar affinity and 50-100 fold specificity versus single base pair mismatch sites as shown in Table 4.
  • DMSO/ ⁇ MP were purchased from Applied Biosystems . Boc- ⁇ - aminobutyric acid was from NOVA Biochem, dichloromethane
  • HPLC analysis was performed either on a HP 10.90M analytical HPLC or a Beckman Gold system using a RAINEN Ci8, Microsorb MV, 5 ⁇ m, 300 x 4.6 mm reversed phase column in 0.1% (wt/v) TFA with acetonitrile as eluent and a flow rate of 1.0 mL/min, gradient elution 1.25% acetonitrile/min.
  • Preparatory HPLC was carried out on a Beckman HPLC using a Waters DeltaPak 25 x 100 mm , lOO ⁇ m C 18 column equipped with a guard, 0.1% (wt/v) TFA, 0.25% acetonitrile/min.
  • Methyl -4 -nitropyrrole-2 -carboxylate (450g, 2.8 mol) was dissolved in ethyl acetate (8 L) .
  • a slurry of 40 g of 10% Pd/C in 800 mL ethyl acetate was then added and the mixture stirred under a slight positive pressure of hydrogen (ca. 1.1 atm) for 48 h.
  • Pd/C was removed by filtration through Celite, washed 1 x 50 mL ethyl acetate, and the volume of the mixture reduced to ca. 500 mL. 7 L of cold ethyl ether was added and HCl gas gently bubbled through the mixture.
  • the Boc-pyrrole ester contaminated with Boc-anhydride was dissolved in 700 mL MeOH, 700 mL of 2M NaOH was added and the solution heated at 60 °C for 6 h.
  • the reaction was cooled to room temperature, washed with ethyl ether (4 x 1000 mL) , the pH of the aqueous layer reduced to ca. 3 with 10% (v/v) H 2 S0 4 , and extracted with ethyl acetate (4 x 2000 mL) .
  • the combined ethyl acetate extracts were dried (sodium sulfate) and concentrated in vacuo to provide a tan foam.
  • the foam was dissolved in 500 mL of DCM and 2 L petroleum ether added, the resulting slurry was concentrated in vacuo .
  • the reaction was redissolved and concentrated three additional times to provide (320 g, 78 % yield) of 4-
  • Boc-Py-acid, 4- [( ert-Butoxycarbonyl) amino] -1- methylpyrrole-2 -carboxylic acid (31 g, 129 mmol) was dissolved in 500 mL DMF, HOBt (17.4 g, 129 mmol) was added followed by DCC (34 g, 129 mmol) .
  • the reaction was stirred for 24 h and then filtered dropwise into a well stirred solution of 5 L of ice water. The precipitate was allowed to sit for 15 min at 0 °C and then collected by filtration.
  • the wet cake was dissolved in 500 mL DCM, and the organic layer added slowly to a stirred solution of cold petroleum ether (4 °C) .
  • N-methylimidazole (320 g, 3.9 mol) was combined with 2 L acetonitrile and 1 L triethylamine in a 12 L flask equipped with a mechanical stirrer and the solution cooled to -20 °C.
  • Ethyl chloroformate 1000 g, 9.2 mol was added with stirring, keeping the temperature between -20 °C and - 25 °C.
  • the reaction was allowed to slowly warm to room temperature and stir for 36 h.
  • Precipitated triethylamine hydrochloride was removed by filtration and the solution concentrated in vacuo. at 65 °C.
  • the imidazole amine ethyl 4-amino-l-methylimidazole- 2 -carboxylate hydrochloride (75 g, 395 mmol) was dissolved in 200 mL DMF .
  • DIEA 45 mL, 491 mmol was added followed by di-t-butyldicarbonate (99 g, 491 mmol) .
  • the mixture was shaken at 60 °C for 18 h, allowed to assume room temperature, and partitioned between 500 mL brine, 500 mL ethyl ether.
  • the ether layer was extracted (2 x 200 mL each) 10% citric acid, brine, satd.
  • Boc-ester contaminated with 20% Boc-anhydride as indicated by X H NMR.
  • the Boc-ester used without further purification, was dissolved in 200 mL IM NaOH. The reaction mixture was allowed to stand for 3 h at 60 °C with occasional agitation. The reaction mixture was cooled to 0 °C, and carefully neutralized with 1 M HCl to pH 2, at which time a white gel forms. The gel was collected by vacuum filtration, frozen before drying, and remaining water lyophilized to yield 4- [( tert-butoxycarbonyl) amino] - 1-methylimidazole-2 -carboxylic acid as a white powder.
  • N- ( ert-butoxycarbonyl) -tris (N- methylpyrrolecarboxamide) (20 mg, 41 ⁇ mol) in DMF (lOO ⁇ l) was added HBTU (26 mg, 69 ⁇ mol) followed by DIEA (50 ⁇ l, 288 ⁇ mol) .
  • the reaction was allowed to stand for 5 minutes, agitated, and allowed to stand for an additional five minutes.
  • Aminotris- (N-methylpyrrolecarboxamide) 24 mg, 41 ⁇ mol
  • DIEA 50 ⁇ l, 288 ⁇ mol
  • N-methyl - Imidazole-2 -carboxylic acid 100 mg, 741 ⁇ mol
  • HOBt 72 mg, 500 ⁇ mol
  • DCC 100 mg, 500 ⁇ mol
  • the activation was allowed to stand for 12 hours, precipitated dicyclohexylurea removed by filtration and Aminohexa- (N- methylpyrrolecarboxamide) ditrifluoroacetate (10 mg, 9.4 ⁇ mol) added followed by DIEA (100 ⁇ l, 576 ⁇ mol) , and the reaction allowed to stand for 2 hours.
  • Reversed phase HPLC purification of the reaction mixture afforded ImPyPyPyPyPyPyPyPy-Dp as a white powder. Yield: 6.3 mg (62%);
  • Boc imidazole acid (257 mg, 1 mmol) and HOBt (135 mg, 1 mmol) were dissolved in 2 L DMF, DCC (202 mg, 1 mmol) is then added and the solution allowed to stand for at least 5 min.
  • Boc-Pyrrole acid (514 mg, 2 mmol) was dissolved in 2 mL dichloromethane, DCC (420 mg, 2 mmol) added, and the solution allowed to stand for 10 min, DMAP (101 mg, 1 mmol) was added and the solution allowed to stand for 1 min.
  • Boc- ⁇ -alanme-Pam-Resm (1.25 g, 0.25 mmol) is placed m a 20 mL glass reaction vessel, shaken in DMF for 5 mm and the reaction vessel drained. The res was washed with DCM (2 x 30 s.) and the Boc group removed with 80% TFA/DCM/0.5M PhSH, 1 x 30s., 1 x 20 mm The res was washed with DCM (2 x 30 s.) followed by DMF (1 x 30 s.) A resm sample (5 - 10 mg) was taken for analysis. The vessel was drained completely and activated monomer added, followed by DIEA if necessary. The reaction vessel was shaken vigorously to make a slurry. The coupling was allowed to proceed for 45 mm, and a resm sample taken. The reaction vessel was then washed with DCM, followed by DMF.
  • Machine-assisted synthesis was performed on a ABI 430A synthesizer on a 0.18 mmol scale (900 mg resm; 0.2 mmol/gram) .
  • a double couple cycle is employed when coupling aliphatic amino acids to imidazole, all
  • the ABI 430A synthesizer was left in the standard hardware configuration for NMP-HOBt protocols.
  • Reagent positions 1 and 7 were DIEA
  • reagent position 2 was TFA/0.5M thiophenol
  • reagent position 3 was 70% ethanolamine/methanol
  • reagent position 4 was acetic anhydride
  • reagent position 5 was DMSO/NMP
  • reagent position 6 was methanol
  • reagent position 8 was DMF.
  • switch list 21, 25, 26, 35, 37, 44 switch list 21, 25, 26, 35, 37, 44
  • a second for transfer of reagent position 8 directly to the cartridge switch list 37, 39, 45, 46
  • Boc-Py-OBt ester (357 mg, 1 mmol) was dissolved in 2 ml DMF and filtered into a synthesis cartridge. Boc-Im acid monomer was activated (DCC/HOBt) , filtered, and placed in a synthesis cartridge. Imidazole-2 -carboxylic acid was added manually. At the initiation of the coupling cycle the synthesis was interrupted, the reaction vessel vented and the activated monomer added directly to the reaction vessel through the resin sampling loop via syringe. When manual addition was necessary an empty synthesis cartridge was used. Aliphatic amino acids (2 mmol) and HBTU (1.9 mmol) were placed in a synthesis cartridge.
  • a resin sample (ca. 4 mg) was placed in a 4 mL glass test tube, 200 ⁇ L of N, N-dimethylaminopropylamine was added and the mixture heated at 100 °C for 5 min. The cleavage mixture was filtered and a 25 ⁇ L sample analyzed by analytical HPLC at 254 nm.
  • Boc- ⁇ -Pam-resin (1.25 g, 0.25 mmol amine) was shaken in
  • the coupling was allowed to proceed for 45 min.
  • a resin sample (8-10 mg) was taken after 40 min to check reaction progress.
  • the reaction vessel was washed with DMF for 30 s and dichloromethane for 1 min to complete a single reaction cycle.
  • Six additional cycles were performed adding, Boclm-OH (DCC/HOBt) , Boclm-OH (DCC/HOBt) , Boc- ⁇ -aminobutyric acid (HBTU/DIEA) and allowed to couple for 2 hours, BocPy-OBt, BocPy-OBt, and pyrrole-2- carboxylic acid (HBTU/DIEA) .
  • the resin was washed with DMF, DCM, MeOH, and ethyl ether and then dried in vacuo .
  • PyPyPy- ⁇ -ImlmPy- ⁇ -Pam-Resin (180 mg, 29 ⁇ mol) 12 was weighed into a glass scintillation vial, 1.5 ml of N, N- dimethylaminopropylamine added, and the mixture heated at 55 °C for 18 hours.
  • the resin was removed by filtration through a disposable polypropylene filter and washed with 5 ml of water, the amine solution and the water washes combined, and the solution loaded on a C ⁇ 8 preparatory HPLC column, the column allowed to wash for 4 min in 0.1% TFA at 8 ml/min, the polyamide was then eluted in 100 min.
  • Polyamide was prepared by machine assisted solid phase synthesis protocols and 900 mg resin cleaved and purifed to provide ImlmPy- ⁇ -PyPyPy- ⁇ -Dp as a white powder. (69 mg, 48% recovery), UV J , 246 (43,300), 308 (54,200) HPLC, r.t.
  • Polyamide was prepared by manual solid phase protocols and isolated as a white powder. (8 mg, 28% recovery) , UV ⁇ max , 246 (43,400), 312 (50,200) HPLC, r.t. 24.8, 1 H NMR
  • Polyamide was prepared by machine assisted solid phase methods protocols as a white powder. (14 mg, 48% recovery) , UV ATM ax , 246 (44,400) , 312 (52,300) HPLC, r.t.
  • ImPyPy- ⁇ -PyPyPy- ⁇ -Pam-Resin was prepared by machine- assisted synthesis protocols.
  • a sample of resin (1 g, 0.17 mmol was placed in a 20 mL glass scintillation vial, 4 mL of dimethylaminopropylamine added, and the solution heated at 55 °C for 18 h.
  • ImPyPy- ⁇ -PyPyPy-G-Dp was prepared as described for ImPyPy- ⁇ - PyPyPy- ⁇ -Dp. (12 mg, 40% recovery) .
  • a sample of machine-synthesized resin (350 mg, 0.17 mmol/gram 1 ) was placed in a 20 mL glass scintillation vial, and treated with 2 mL 3 , 3 " -diamino-N-methyldipropylamine at 55 °C for 18 hours.
  • the resin was removed by filtration through a disposable propylene filter, and the resulting solution dissolved with water to a total volume of 8 mL, and purified directly by preparatory reversed phase HPLC to provide ImImIm- ⁇ -PyPyPy- ⁇ -Dp- ⁇ H 2 (28 mg, 41% recovery) as a white powder.
  • ImPyPy-G-PyPyPy-G-Dp-NH 2 Polyamide was prepared by manual solid phase methods as a white powder upon cleavage of 240 mg resin with N- methyl -bis (aminopropyl) amine (2 ml, 55 °C) (19.0 mg, 44 % recovery after HPLC purification).
  • ImPyPy-G-PyPyPy- ⁇ -Dp- ⁇ H 2 Polyamide was prepared by manual solid phase methods as a white powder upon cleavage of 240 mg resin with N- methyl -bis (aminopropyl) amine (2 ml, 55 °C) (25 mg, 55 % recovery). HPLC, r.t.
  • Polyamide was prepared by automated solid phase methods as a white powder upon cleavage of 240 mg resin with N-methyl -bis (aminopropyl) amine (2 ml, 55 °C) (23.0 mg,
  • the polyamide was prepared by machine-assisted solid phase methods as a white powder. (29 mg 59 % recovery) .
  • a sample of machine-synthesized resin (350 mg, 0.16 mmol/gram) was placed in a 20 mL glass scintillation vial, and treated with 2 mL 3 , 3 ' -diamino-N-methyldipropylamine at 55 °C for 18 hours.
  • the resin was removed by filtration through a disposable propylene filter, and the resulting solution dissolved with water to a total volume of 8 mL, and purified directly by preparatory reversed phase HPLC to provide ImImImPy- ⁇ -PyPyPyPy- ⁇ -Dp- ⁇ H2 (31 mg, 40% recovery)
  • a sample of ImPyPyPyPy- ⁇ -ImPyPyPyPy- ⁇ - esin prepared by machine-assisted solid phase synthesis (240 mg, 0.16 mmol/gram) was placed in a 20 mL glass scintillation vial, and treated with 3 , 3 -diamino-N-methyldipropylamine (2 mL) at 55 °C for 18 hours. Resin was removed by filtration, and the filtrate diluted to a total volume of 8 mL with 0.1 % (wt/v) aqueous TFA.
  • the polyamide was prepared as a white powder as described for ImPyPyPyPy- ⁇ - ImPyPy PyPy- ⁇ -NH2.
  • EDTA-dianhydride 50 mg was dissolved in 1 mL DMSO/NMP solution and 1 mL DIEA by heating at 55 °C for 5 min.
  • the dianhydride solution was added to Imlmlm- ⁇ -PyPyPy- ⁇ -Dp-NH 2 (8.0 mg, 7 ⁇ mol) dissolved in 750 ⁇ L DMSO .
  • the mixture was heated at 55 °C for 25 minutes, and treated with 3 mL 0. IM NaOH, and heated at 55 °C for 10 minutes.
  • the polyamide was prepared by machine-assisted solid phase methods as a white powder. (17 mg, 56% recovery) .
  • Polyamide was prepared by manual solid phase methods and obtained as a white powder upon cleavage of 240 mg resin. (initial subsitution of 0.2 mmol Boc-Glycine/gram) with dimethylaminopropylamine (11.9 mg, 29% recovery). HPLC, r.t.
  • Polyamide was prepared by manual solid phase methods as a white powder upon cleavage of 180 mg resin (initial subsitution of 0.2 mmol Boc- ⁇ -alanine/gram) with dimethylaminopropylamine (2 ml, 55 °C) . (12.3 mg, 38 % recovery after HPLC purification). HPLC, r.t.
  • ImPyPy- ⁇ -PyPyPy-G-Dp Polyamide was prepared by automated solid phase methods as a white powder upon cleavage of 180 mg resin
  • Polyamide was prepared by automated solid phase methods as a white powder upon cleavage of 240 mg resin (initial subsitution of 0.2 mmol Boc- ⁇ -alanine/gram) with dimethylaminopropylamine (2 ml, 55 °C) . (19.0 mg, 43 % recovery after HPLC purification). HPLC, r.t.
  • ImPyPy-Py-PyPyPy-G-Dp Polyamide was prepared by manual solid phase methods. Recovery is based on cleavage of 180 mg resin (initial subsitution of 0.2 mmol Boc-Glycine/gram) with dimethylaminopropylamine (2 ml, 55 °C) . (8 mg, 24% recovery after HPLC purification) . A small quantity of the failure heptamide AcPyPyPyPyPyPyPy-Dp was found in the initial preparation and was removed by a second preparatory HPLC purification to afford pure ImPyPy-Py-PyPyPy-G-Dp as a white powder (1.2 mg) . HPLC, r.t. 28.5, UN ⁇ ⁇ , ax ( ⁇ ) , 246
  • ImPyPy- Py- PyPyPy- ⁇ -Dp Polyamide was prepared by machine assisted solid phase synthesis to afford a white powder upon cleavage of 800 mg resin (initial subsitution of 0.2 mmol Boc- ⁇ -alanine/gram) with dimethylaminopropylamine (2 ml, 55 °C) . (56 mg, 36 % recovery after HPLC purification) ( ⁇ ) 246 (34,800), 308 (57,000); HPLC r.t.
  • Polyamide was prepared by manual solid phase methods as a white powder upon cleavage of 240 mg resin with N- methyl -bis (aminopropyl) amine (2 ml, 55 °C) (19.0 mg, 44 % recovery after HPLC purification).
  • Polyamide was prepared by manual solid phase methods as a white powder upon cleavage of 240 mg resin with N- methyl -bis (aminopropyl) amine (2 ml, 55 °C) (25 mg, 55 % recovery) .
  • Polyamide was prepared by automated solid phase methods as a white powder upon cleavage of 240 mg resin with N-methyl -bis (aminopropyl) amine (2 ml, 55 °C) (23.0 mg, 53 % recovery).
  • EDTA-dianhydride 50 mg was dissolved in 1 mL DMSO/ ⁇ MP solution and 1 mL DIEA by heating at 55 °C for 5 min.
  • the dianhydride solution was added to ImPyPy-G-PyPyPy-G-Bp
  • ImPyPy-G-PyPyPy- ⁇ -Bp-EDTA Polyamide was prepared from ImPyPy-G-PyPyPy- ⁇ -Bp (20 mg) as described for ImPyPy-G-PyPyPy-G-Bp-EDTA. (13.0 mg, 55 % recovery after HPLC purification) . HPLC, r.t.
  • ImPyPy- ⁇ -PyPyPy-G-Bp-EDTA Polyamide was prepared from ImPyPy- ⁇ -PyPyPy-G-Bp (12 mg) as described for ImPyPy-G-PyPyPy-G-Bp-EDTA. (6 mg, 42 % recovery after HPLC purification). HPLC, r.t. 28.0; X H NMR
  • the polyamide was prepared by machine-assisted solid phase methods as a white powder. (12 mg 19 % recovery) .
  • the polyamide was prepared by machine-assisted solid phase methods as a white powder. (29 mg 59 % recovery) .
  • EDTA-dianhydride 50 mg was dissolved in 1 mL DMSO/NMP solution and 1 mL DIEA by heating at 55 °C for 5 min.
  • the dianhydride solution was added to ImPyPy- ⁇ - ImPyPy- ⁇ -PyPyPy-G-Dp-NH 2 (9.0 mg, 5 ⁇ mol) dissolved in 750 ⁇ L DMSO .
  • the mixture was heated at 55 °C for 25 minutes, and treated with 3 mL 0. IM NaOH, and heated at 55 °C for 10 minutes.
  • the polyamide was prepared by machine assisted solid phase methods as a white powder (13 mg, 52 % recovery) .
  • the polyamide was prepared by machine assisted solid phase methods as a white powder (3 mg, 10 % recovery) .
  • Polyamide ImPyPyPy- ⁇ -ImPyPyPy- ⁇ -Dp was prepared by machine-assisted solid phase methods as a white powder (17 mg, 56% recovery) .
  • the polyamide ImPyPyPy- ⁇ -PyPyPyPy- ⁇ -Dp was prepared by machine-assisted solid phase methods as a white powder (12 mg, 19 % recovery) .
  • a sample of polyamide machine-synthesized on resin (350 mg, 0.16 mmol/gram) was placed in a 20 mL glass scintillation vial, and treated with 2 mL 3 , 3 ' -diamino-N- methyldipropylamine at 55 °C for 18 hours.
  • the resin was removed by filtration through a disposable propylene filter, and the resulting solution dissolved with water to a total volume of 8 mL, and purified directly by preparatory reversed phase HPLC to provide ImlmlmPy- ⁇ - PyPyPyPy- ⁇ -Dp- ⁇ H 2 (31 mg, 40% recovery) as a white powder.
  • the polyamide ImlmPyPy- ⁇ -ImlmPyPy- ⁇ -PAM-Resin was assembled on 0.2 mmol/gram Boc- ⁇ -PAM-resin by machine assisted synthesis.
  • the ⁇ -Im step was assembled using Boc- ⁇ -
  • the polyamide ImPylmPy- ⁇ -ImPylmPy- ⁇ -PAM-Resin was assembled on 0.2 mmol/gram Boc- ⁇ -PAM-resin by manual polyamide synthesis.
  • the Py-Im and ⁇ -Im steps were addedusing Boc- ⁇ -Im acid and Boc-Py-Im acid (HBTU, DIEA) , all other residues were added as appropriate activated Boc protected monomer units.
  • a sample of resin 250 mg, 0.16 mmol/gram 21 ) was placed in a 20 mL glass scintillation vial, 2 mL dimethylaminopropylamine added and the mixture allowed to stand at 55 °C for 18 hours.
  • Resin was removed by filtration through a disposable propylene filter, and the resulting solution diluted with water to a total volume of 8 mL, and purified directly by preparatory reversed phase HPLC to provide ImPylmPy- ⁇ -ImPylmPy- ⁇ -Dp (19 mg, 32% recovery) as a white powder.
  • the polyamide Imlmlmlm- ⁇ -PyPyPyPy- ⁇ -PAM-Resin was assembled on 0.2 mmol/gram Boc-b-PAM-resin by manual polyamide synthesis.
  • the ⁇ -Im step was added using Boc- ⁇ -Im acid (HBTU, DIEA) , all other residues were added as appropriate activated Boc protected monomer units.
  • a sample of resin 250 mg, 0.16 mmol/gram 21 ) was placed in a 20 mL glass scintillation vial, 2 mL dimethylaminopropylamine added and the mixture allowed to stand at 55 °C for 18 hours.
  • a sample of ImPyPyPy- ⁇ -PyPyPyPy- ⁇ -resin prepared by machine-assisted solid phase synthesis (240 mg, 0.16 mmol/gram) was placed in a 20 mL glass scintillation vial, and treated with dimethylaminopropylamine (2 mL) at 55 °C for 18 hours. Resin was removed by filtration, and the filtrate diluted to a total volume of 8 mL with 0.1 % (wt/v) aqueous TFA.
  • the resulting crude polyamide/amine solution was purified directly by reversed phase HPLC to provide the trifluoroacetate salt of ImPyPyPy- ⁇ -PyPyPyPy- ⁇ - Dp (31 mg, 40% recovery) as a white powder.
  • the polyamide was prepared as described for
  • ImPyPyPyPy- ⁇ -ImPyPyPyPy- ⁇ -Dp as a white powder (28 mg, 34% recovery).
  • the polyamide was prepared as a white powder as described for ImPyPyPyPy- ⁇ -ImPyPyPyPy- ⁇ -NH 2 .
  • EDTA-dianhydride 50 mg was dissolved by heating at 55 °C for 5 min. in a solution of DMSO/NMP (1 ml) and DIEA (1 mL) .
  • the dianhydride solution was added to ImPyPyPyPy- ⁇ - ImPyPyPyPy- ⁇ -Dp-NH 2 (8.1 mg) dissolved in DMSO (750 ⁇ L) .
  • the mixture was heated at 55 °C for 25 minutes, and treated with 0.1M NaOH (3 mL) , and heated at 55 °C for 10 minutes.
  • the experimental target plasmid pSES9hp was constructed by hybridization of the inserts: 5 ' - GATCCTATGTCAGTCATGGGGATGACTGTCAGTCATGGCCATGACTGTCAGTCAT GCGCATGACTGTCAGTCTTAAGC- 3 ' and
  • the hybridized insert was ligated into linearized pUC19 BamHI/Hindlll plasmid using T4 DNA ligase.
  • the plasmid pSES9hp was linearized with EcoRI and PvuII and then treated with Klenow fragment, deoxyadenosine
  • a fresh 50 ⁇ M MPE»Fe(II) solution was made from 100 ⁇ L of a 100 ⁇ M MPE solution and 100 ⁇ L of a 100 ⁇ M ferrous ammonium sulfate (Fe (NH 4 ) 2 (S0 4 ) 2 «6H 2 0) solution.
  • MPE*Fe(II) solution (5 ⁇ M) was added to the equilibrated DNA, and the reactions were allowed to equilibrate for 5 minutes. Cleavage was initiated by the addition of dithiothreitol (5 mM) and allowed to proceed for 14 min.
  • Reactions were stopped by ethanol precipitation, resuspended in 100 mM tris-borate-EDTA/80% formamide loading buffer, denatured at 85°C for 5 min, placed on ice, and half of each tube ( ⁇ 15 kcpm) was immediately loaded onto an 8% denaturing polyacrylamide gel (5% crosslink, 7 M urea) at 2000 V.
  • ferrous ammonium sulfate Fe (NH 4 ) 2 (S0 4 ) 2 «6H 2 0) (10 ⁇ M) was added to the equilibrated DNA, and the reactions were allowed to equilibrate for 15 minutes. Cleavage was initiated by the addition of dithiothreitol (10 mM) and allowed to proceed for 30 min. Reactions were stopped by ethanol precipitation, resuspended in 100 mM tris-borate- EDTA/80% formamide loading buffer, denatured at 85°C for 5 min, placed on ice, and the entire sample was immediately loaded onto an 8% denaturing polyacrylamide gel (5% crosslink, 7 M urea) at 2000 V.
  • ferrous ammonium sulfate Fe (NH 4 ) 2 (S0 4 ) 2 «6H 2 0
  • Affinity cleavage assays (25 mM Tris-acetate, 10 mM NaCl, 100 ⁇ M/base pair calf thymus DNA, pH 7.0 and 22 °C) were performed in order to identify the binding orientations of the EDTA analogues of the three hairpin polyamides: ImlmPyPy- ⁇ -ImlmPyPy- ⁇ -Dp-EDTA, ImPylmPy- ⁇ - ImPylmPy- ⁇ -Dp-EDTA , and Imlmlmlm- ⁇ -PyPyPyPy- ⁇ -Dp-EDTA
  • the polyamides ImlmPyPy- ⁇ -ImlmPyPy- ⁇ -Dp-EDTA, ImPylmPy- ⁇ - ImPylmPy- ⁇ -Dp-EDTA recognize their respective palindromic match sequences, 5'-TGGCCA-3' and 5 ' -TGCGCA-3 ' ,
  • the polyamide Imlmlmlm- ⁇ -PyPyPyPy- ⁇ -Dp-EDTA recognizes a non-palindromic sequence, 5 ' -TGGGGA-3 ' , in a single orientation with cleavage visible only on the 5'- side of the site, as predicted by the hairpin model.
  • reactiona were carried out in a volume of 400 ⁇ L . We note explicitly that no carrier DNA was used in these reactions.
  • a polyamide stock solution or water (for reference lanes) was added to an assay buffer where the final concentrations were: 10 mM Tris «HCl buffer (pH 7.0), 10 mM KC1, 10 mM MgCl 2 , 5 mM CaCl 2 , and 20 kcpm 3'- radiolabeled DNA. The solutions were allowed to equilibrate for a minimum of 12 hours at 22 °C.
  • Cleavage was initiated by the addition of 10 ⁇ L of a DNase I stock solution (diluted with 1 mM DTT to give a stock concentration of 0.28 u/mL) and was allowed to proceed for 5 min at 22 °C. The reactions were stopped by adding 50 mL of a solution containing 2.25 M NaCl, 150 mM EDTA, 0.6 mg/mL glycogen, and 30 mM base-pair calf thymus DNA, and then ethanol precipitated.
  • a DNase I stock solution diluted with 1 mM DTT to give a stock concentration of 0.28 u/mL
  • the reactions were stopped by adding 50 mL of a solution containing 2.25 M NaCl, 150 mM EDTA, 0.6 mg/mL glycogen, and 30 mM base-pair calf thymus DNA, and then ethanol precipitated.
  • the cleavage products were reauspended in 100 mM tris-borate-EDTA/80% formamide loading buffer, denatured at 85°C for 5 min, placed on ice, and immediately loaded onto an 8% denaturing polyacrylamide gel (5% crosslink, 7 M urea) at 2000 V for 1 hour. The gels were dried under vacuum at 80°C, then quantitated using storage phosphor technology.
  • [L] tot corresponds to the total polyamide concentration
  • K_ corresponds to the equilibrium association constant
  • ⁇ m n and ⁇ m ax represent the experimentally determined site saturation values when the site is unoccupied or saturated, respectively.
  • Novel polyamide conjugates have been designed which modify double-helical DNA in a sequence specific manner. More specifically the metalopeptide Ni (II) *Gly-Gly- His has been covalently attached to a pyrrole-imidazole polyamide.
  • the conjugate was synthesized using manual solid phase synthesis protocols developed by the Dervan group using Boc-pyrrole-OBt ester and Boc- imidazole acid monomers, activated esters of ⁇ -aminobutyric acid and ⁇ - alanine, and Boc- ⁇ -alanine-Pam resin.
  • Individual polyamides are purified by reversed phase HPLC and characterized by MALDI-TOF mass spectrometry.
  • the metallopeptide Ni (II) *Gly-Gly-His has been shown to promote the efficient oxidative cleavage of DNA in the presence of monoperoxyphthalic acid. (Mack and Dervan, J. Am . Chem . Soc , 112, 4604 (1990); Mack and Dervan, Biochemistry, 31, 9399 (1992)).
  • the reaction is thought to proceed through a mechanism that involves abatraction of hydrogen atom(s) from the deoxyribose backbone of DNA by a nondiffusable high valent nickel bound oxygen.
  • Bifunctional conjugates were designed in order to combine the ability of polyamides to recognize any predetermined DNA sequence with the Ni (II) *Gly-Gly-His chemistry.
  • the symmetric anhydride of the amino acid His and the activated ester of Gly were coupled to the extended hairpin polyamide directly on the ⁇ -alanine-Pam resin employing solid phase chemistry protocols.
  • Denaturing polyacrylamide gel electrophoresis of 32P end- labeled DNA treated with the Ni (II) »Gly-Gly-His modified polyamide at pH 7.5 demonstrated the ability of the conjugate to cleave the double helical DNA in a sequence selective manner in 77 % and 72 % yields on the 3 ' -end-labeled DNA (at 10 nM polyamide).
  • the chemical structure of the Ni (II) »Gly-Gly- His modified polyamide is shown in Figure 18.
  • sequence specific DNA binding-modifying molecules requires the integration of two separate entities: recognition and functional reactivity.
  • the present inventor has discovered ligands which combine pyrrole-imidazole polyamide DNA binding motifs with mechanism based reactive functionalities capable of electrophilic modification of bases in the minor groove.
  • the design of sequence specific molecules for alkylation of double helical DNA requires both a apecific DNA binding molecule and an atom specific DNA cleaving moiety.
  • Hairpin polyamides are sequence specific molecules that can bind to any predetermined DNA sequence. Bromoacetyl and the prodrug analogue of the cyclopropyl electrophile of CC-1065 react in an atom specific manner with double helical DNA.
  • the two criteria for successful bifunctional molecule design are sequence specific reactions at designated single atoms within the bound complex, and cleavage yields that are quantitative under physiological conditions (i.e. neutral pH, 37° C, 100-200nM KCl/NaCl) .
  • physiological conditions i.e. neutral pH, 37° C, 100-200nM KCl/NaCl.
  • the 'cleaving functionality' must be sufficiently reactive with DNA at
  • hairpin polyamides equipped with either an N-terminal bromoacetyl group or a prodrug analogue of the cyclopropyl electrophile of CC-1065 have been prepared.
  • A. Bromoacetylated polyamides The polyamide NH2PyPyPyPy-g-ImPyPyPy-b-Dp was designed to target the sequence 5' -AGTTT*A-3 ' . T* indicates the thymine opposite the alkylated adenine.
  • the polyamide was synthesized by solid phase protocols, cleaved from the solid support with dimethyl amino propylamine, " and purified by reverse phase HPLC chromatography. The terminal pyrrole residue was deprotected and left unacetylated, leaving a free primary amine on the N-terminus.
  • bromoacetic acid was activated with HOBt and DCC in 1 ml DMF. After 5 minutes, the DCU was filtered off and the solution added to the polyamide with DIEA. After 15 minutes, .the reaction mixture was purified directly by reversed phase HPLC to isolate the bromoacetylated polyamide. Short reaction times were used to avoid alkylation of the unprotected imidazole ring nitrogen.
  • the purified N-bromoacetyl hairpin polyamide was characterized by mass spectrometry. The synthesis of a bromoacetylated hairpin polyamide is described in Figure 19.
  • Another set of polyamides was synthesized, based on an extended hairpin motif. This motif combines the ⁇ -turn of the hairpin motif with the ⁇ -alanine spacer of the extended motif, combining the 2:1 binding mode with the 1:1 binding mode.
  • the following compounds were synthesized: PyPy- ⁇ - PyPyPy- ⁇ - ImPyPy- ⁇ -Dp, PyPyPy- ⁇ -PyPyPy- ⁇ -ImPyPy- ⁇ -Dp, PyPy- ⁇ - PyPyPy- ⁇ -PyPylm- ⁇ -Dp, and PyPyPyPyPyPy- ⁇ -PyPylm- ⁇ -Dp .
  • Boc- ⁇ -alanine-Pam resin (1.25 g, 0.25 mmol) was placed in a 20 ml glass reaction vessel and shaken in DMF for 5 minutes and drained. The resin was washed with DCM (2 volumes) and deprotected with 80% TFA/DCM/0.5 M PhSH (1 wash, 1 X 20 minutes) . Following deprotection, the resin was washed 3 time with DCM and 1 time with DMF. Boc- pyrrole-OBt ester (357 mg, 1 mmol) was added in 2 ml of DMF followed by 1 ml DIEA. The coupling reaction was shaken vigorously for 45 minutes. Resin samples (5 mg)were taken periodically to monitor the synthesis by HPLC.
  • Boc-Py-OBt (2X) Boc- ⁇ -Im- COOH
  • Boc-Py-OBt (4X) Boc- ⁇ -Im-COOH was activated by addition of HBTU (378 mg, 1 mmol) in 2 ml of DMF. DIEA (1 ml) was added and the solution was allowed to stand for 5 minutes until clear. After completion of the synthesis, the resin was washed with DMF, DCM, methanol, and ethyl ether. The resin was then lyophilized to remove solvent. The polyamide was cleaved off the resin with (N,N)- dimethylamino propylamine (2 ml) in a glass scintillation vial at 55 C for 12 hours. The polyamide was filtered and
  • UV ⁇ ma ⁇ ( ⁇ ) 310 nm (66,600) .
  • Polyamide was synthesized as above on glycine linked
  • (+) CC-1065 is a natural product isolated from Strep tomyces zelensis . It binds in the minor groove and shows antitumor activity due to a reactive cyclopropyl moiety which alkylates preferentially at N3 of adenine (Boger and Johnson. Angew. Chem . Int . Ed . Eng . 1996, 35, 1438-1474) .
  • duocarmycins are structurally very similar to CC- 1065, having the reactive cyclopropyl ring, but lacking the third conjugated ring system. These compounds bind in AT tracts, and display strong sequence selectivity for alkylation at adenines . Alkylation will occur at N3 of guanine as well, but only when other AT bp are protected in the minor groove.
  • flanking sequence preferences for alkylation by CC-1065 are 5 ' -AAA-3 ' >5 ' -TTA-3 ' >5 ' -TAA-3 ' >5 ' - ATA-3
  • the alkylation reaction is reversible for the two duocarmycin compounds but irreversible for CC-1065. This discrepancy is explained by the more extensive non-covalent interactions of CC-1065 with the DNA minor groove.
  • (+) CC- 1065 is the natural enantiomer. The unnatural enantiomer has been synthesized by Boger and coworkers and shown to alkylate DNA as well.
  • CC-1065 When compared to N-Bromoacetyldistamycin, CC-1065 shows very different reactivity. For reaction times of 1 hour at 37° C, N-Bromoacetyldistamycin shows almost no visible cleavage, while (+) CC-1065 shows intense cleavage at 13 adenines. After 10 hours at 37°, N- Bromoacetyldistamycin shows a comparable amount of cleavage to (+) CC-1065 at 1 hour, but at only one adenine.
  • CC-1065 alkylation shows faster kinetics than that of N- Bromoacetyldistamycin.
  • the alkylation mechanism for CC-1065 is shown in Figure 21.
  • pro-drug analogues of CC-1065 have also been made.
  • One of the most popular is bizelesin, a bifunctional interstrand DNA crosslinker synthesized by Upjohn. It is believed to go through the same cyclopropyl intermediate as CC-1065, but is more stable than the cyclopropyl analogues.
  • the structures of Bizelesin and CBI are shown in Figure 22.
  • N-Boc-4-hydroxy-2-napthylamine was ayntheaized by the condensation of ammonia and 1,3 dihydroxynaphthalene with immediate Boc protection by Boc anhydride.
  • NIS protected the iodonaphthylamine .
  • Alkylation with allyl bromide provided a substrate for a favorable 5-exo-trig aryl radical-alkene cyclization to occur, using Bu3SnH and TEMPO radical trap. Cleavage of the TEMPO trap intermediate occurred upon heating with activated Zn powder.
  • Treatment with PP-3/CCl 4 , followed by hydrolysis of the benzyl ether gave the desired product.
  • ImPyPy- ⁇ -ED (10 mg) was dissolved in 2 ml DMF added 100 ⁇ l at a time to a solution of disuccinimidyl glutarate (100 mg) and DIEA (10 ⁇ l) in 1 ml DMF at room temperature. The reaction was monitored by analytical HPLC and was complete within an hour after final addition of polyamide. Preparative HPLC gave a white powder. MS (FAB) : 695.2
  • a bent sequence of DNA may recruit a non-specific protein, as in HMG-I, or prevent a protein from making the appropriate contacts for high-affinity binding.
  • Small molecules designed to bind predetermined sequencea of DNA and modulate the local DNA topology may be a general approach for regulation of the function of DNA binding proteins.
  • Intercalators are a class of molecules which are potent antibiotic and antitumor drugs.
  • Lerman first described intercalation as the insertion of a flat, aromatic chromophore between adjacent base pairs of the double helix.
  • the rise of B-form DNA is usually 3.4A/base pair.
  • the stacking of the intercalator separates the adjacent base pairs by another 3.4A and extends the length of the helix and equivalent amount per bound intercalator.
  • the base pairs neighboring the intercalation site are also unwound 10-26° with respect to one another. Generally, it is these structural distortions introduced by intercalation which are considered to be the basis for their therapeutic activity. However, it is important to note that in most cases the DNA helix returns to its B-form structure within a few base pairs of the intercalation site.
  • intercalators Due to their nature of stacking between the base pairs, intercalators generally exhibit little or no sequence specificity.
  • Actinomycin D consists of an aromatic phenoxazone core coupled to two identical cyclic pentapeptides that make contacts to the exocyclic amine of guanine, granting specificity for intercalation at 5'-GC-3' steps.
  • carbohydrate moieties attached to the chromophore of the anthracycline and pluramycin intercalators interact with the DNA bases in both the major and minor grooves and grant these molecules their sequence preferences. In almost all cases, the sequence specificity of these natural products is limited to the two base pairs adjacent to the intercalation site.
  • Netropsin and distamycin A are pyrrole carboxamide natural products which bind in the minor groove of DNA at sites of 4-5 contiguous A,T base pairs.
  • Linking a non-specific intercalator moiety to a polyamide may produce the aequence specific distortions of DNA structure required to regulate protein: DNA interactions.
  • Ethidium bromide is a common intercalator which has been shown to bind DNA with a Ka of approximately 10 5 M- 1 and unwind the DNA helix by 26°. (LePecq and Paoletti (1967) J. Mol . Biol . 27, 87-106; Waring, M. (1970)
  • Methidium-polyamide conjugates are designed to sequence specifically induce helical unwinding and extension which may be sufficient to inhibit DNA binding by a wide variety of DNA binding proteins, such as the transcription factor, GCN-4, SP1, and NF- ⁇ B.
  • Polyamides generally contain a C-terminal positively charged dimethylaminopropyl amide. In this case, since the C-terminus is conjugated to the methidium, DM ⁇ was placed on the N-terminus to retain the net positive charge. This alteration has no significant effect on polyamide binding.
  • Boc-chemistry solid phase polyamide synthesis allows for the rapid preparation of milligram quantities ' of purified polyamide suitable for methidium conjugation in solution.
  • DM ⁇ -ImPyPy- ⁇ -ImPyPy- ⁇ -C n -Mdm conjugates are targeted to the 5'-TGACT-3' portion of the ARE and GCRE binding sites of GCN4.
  • intercalation is expected to occur between the two base pairs at the 3 ' end of the GCN4 biding site, AT for ARE (5 ' -CTGACTAAT-3 ' ) and TT GCRE (5' -ATGACTCTT-3' ) (intercalation site bolded) .
  • Coupling of the methidium (K a 10 M ⁇ ) and polyamide (K a 10 5 M -1 ) moieties is also expected to produce a significant increase in binding affinity.
  • Binding of a methidium-polyamide conjugate to a 5'-AGTGTA-3' site is depicted below.
  • the methidium is represented as a grey rectangle and is placed between the base pairs where intercalation is predicted baaed on molecular modeling atudiea.
  • HPLC analysis was performed either on a HP 1090 M analytical HPLC or a Beckman Gold system using a Rainen C18, Microsorb MV, 5 ⁇ m, 300 x 4.6 mm reversed phase column in 0.1% (wt/v) TFA with acetonitrile as eluent and a flow rate of 1.0 ml/min, gradient elution 1.25% acetonitrile/min.
  • Preparatory HPLC was carried out on a Beckman instrument using a Waters DeltaPak 25 x 100 mm 100 ⁇ m C ⁇ 8 column in 0.1% (wt/v) TFA, gradient elution 0.25%/min. CH3CN. Water was obtained from a Millipore Milli-Q water purification system.
  • Thymidine-5 ' -triphosphate (3000 Ci/mmol), and [ ⁇ - 32 P] - deoxyadenosine-5 ' -triphosphate (6000 Ci/mmol), were purchased from Du Pont/NEN.
  • Boc-Im acid and Boc-Py-OBt were ayntheaized in 5 and 6 steps, respectively.
  • DM ⁇ -ImPyPy- ⁇ -ImPyPy- ⁇ -Pam-resin was prepared using Boc-chemistry manual solid phase synthesis protocols.
  • Polyamide was cleaved from the resin (400 mg) by aminolysis in neat diamine (2 mL, 24-48 hours, 60° C) and purified by preparative HPLC.
  • ImPyPy- ⁇ -ImPyPy- ⁇ -C2-Mdm as a purple powder. (3.0 mg, 2 ⁇ mol, 10.5% recovery).
  • ImPyPy- ⁇ - ImPyPy- ⁇ -C4-Mdm as a purple powder. (8.7 mg, 6 ⁇ mol, 19% recovery). HPLC r.t. 29.7, UN ⁇ max ( ⁇ ) , 290
  • ImPyPy- ⁇ -ImPyPy- ⁇ -C6-Mdm as a purple powder. (5.3 mg, 3.7 ⁇ mol, 14% recovery).
  • Solution methods for the sequence-specific detection of nucleic acids offer several advantages in terms of sample preparation and of time resolution of measurements.
  • DNA-binding pyrrole- imidazole polyamide will sequence-specifically deliver environmentally sensitive fluorochromes to the DNA.
  • dyes show a markedly increased fluorescence upon binding to DNA, among these are Hoechst 33258, ethidium bromide, and most notably thiazole orange. More generally, dyes such as dansyl and mansyl show tremendous sensitivity to environment .
  • Conjugates have been prepared with a number of such dyes in order to develop sequence-specific, high affinity DNA fluorochromes .
  • the polyamide portion of each dye was prepared using solid phase synthetic methodology and reacted with an amine reactive fluorochrome .
  • a number of dyes and 'linker diamines' are being investigated. These conjugates are unique, in that they combine the ability to recognize any predetermined DNA sequence with the ability to signal binding events directly.
  • conjugates will be prepared purified, and characterized. Donor-acceptor pairs such as fluorescein- rhodamine or thiazole-orange/rhodamine will be analyzed for their computability in this system.
  • This energy transfer system increases the currently accessible recognition sequence for polyamides and provides for a unique binding- dependent signal, applicable for both homogeneous and heterogeneous detection systems.
  • Pyrene and similar systems for excimers provide two or more molecules are close in three dimensional space.
  • DNA-binding polyamides deliver pyrene to proximal positions on DNA. Binding is then monitored by the formation of the excimer.
  • the structure of a pyrene polyamide conjugate is shown below.
  • Conjugates prepared between sequence specific DNA binding polyamides and biotin are useful for a variety of applications.
  • First, such compounds can be readily attached to a variety of matrices through the strong interaction of biotin with the protein streptavidin.
  • strepdavidin-derivatized matrices include magnetic beads for separations as well as resins for chromatography.
  • polyamide-biotin conjugates have been synthesized by solid phase synthetic methods. Following resin cleavage with a variety of diamines, the polyamides were reacted with carious biotin carboxylic acid derivatives to yield conjugates. The conjugates were purified by HPLC and characterized by MALDI-TOF mass spectroscopy and IH NMR. The synthesis of biotin-polyamide conjugate is shown in Figure 27. The chemical ' structure of a number of bifunctional biotin-polyamide conjugates prepared by the present invention are shown in Figures 28A- D. A scheme for sequence specific affinity capture by a bifunctional polyamide-biotin conjugates is outlined in Figure 29.
  • Photoactivated modification of DNA by a polyamide- psoralen conjugate Psoralen and psoralen derivatives have been used as photoactive drugs in the treatment of cancer.
  • An engineered, radiolabeled restriction fragment from pUC-19 was prepared in which a nine bp polyamide binding site overlaps by two base pairs with the cleavage site for the restriction endonuclease Pvu II. Cleavage by Pvu II is prevented when the overlapping polyamide binding site is occupied by the polyamide.
  • a second radiolabeled DNA fragment was prepared which contains a Pvu II site, but lacks the overlapping polyamide binding site.
  • the rate of polyamide association with its target binding site was assessed by combining solutions of the polyamide with the radiolabeled target and reference fragments and allowing them to for 5 minutes to 5 hours before initiating a treatment (1-2 minutes) with the enzyme Pvu II.
  • the reference site is nearly completely digested, but protection at the target site is observed and can be correlated with polyamide concentration and the time of equilibration.
  • the dissociation rate is analyzed by adding an excess of unlabeled competitor DNA to an equilibrated aolution of the labeled DNA fragments and polyamide. Addition of the competitor reduces the concentration of free polyamide to zero.
  • the rate at with polyamide dissociation occurs from the target site on the labeled fragment can be followed by the rate of losa of protection from Pvu II digestion as the re-equilibration time is increased.
  • the association profile with respect to time for the 9-ring extended hairpin polyamide ImPyPy- ⁇ -ImPyPy- ⁇ - PyPyPy-G-Dp binding its cognate 9 base pair match site is shown in Figure 6.
  • half-time is defined as the time required for 50% of a population of DNA and polyamide to dissociate or associate.
  • a more biomimetic approach is to bind larger D ⁇ A sequences while maintaining the size of the polyamide.
  • Nature's transcription factors often bind large DNA sequences by formation of cooperative protein dimers at adjacent half-sites (Ptashne, et al . A Genetic Swi tch, Blackwell Scientific Publications and Cell Press: Palo Alto, CA, 1986; Pabo, et al . Ann. Rev. Biochem . 1992, 61 , 1053-1095; Marmorstein, et al . Nature 1992, 356, 408-414; Klemm, et al . Cell 1994, 77, 21-32; Bellon, et al . Nature Struct. Biol . 1997, 4, 586-591).
  • the two ligands can slip sideways with respect to one another, allowing recognition of other sequences (Trauger, et al . J. Am . Chem . Soc . 1996,
  • Hairpin polyamides utilizing the turn-specific ⁇ -aminobutyric acid linker are constrained to be fully overlapped and preclude the "slipped motif" option (Mrksich, et al . J " . Am . Chem . Soc . 1994, 116, 7983-7988; Parks, et al . ibid . 1996, 118 , 6153-6159; Swalley, et al . ibid . 1996, 118 , 8198-8206; Swalley, et al . ibid . 1997,
  • a cooperative six-ring extended hairpin polyamide which dimerizes to specifically bind a predetermined ten base pair sequence.
  • a sequence contained in the regulatory region of the HIV-1 genome was selected as the target site (Jones, et al . Ann. Rev. Biochem . 1994, 63 , 717-743; Freeh, et al . Virology 1996, 224 , 256-267) .
  • the polyamide ring pairing rules provided herein such as the inclusion of ⁇ -alanine ( ⁇ ) to relax ligand curvature, and the preference of ⁇ -aminobutyric acid ( ⁇ ) for a "hairpin turn" conformation within polyamide-DNA complexes were considered.
  • Figure 32 illustrates the (ImPy- ⁇ -ImPy- (R) H2N ⁇ -ImPy-C 2 - OH) 2 • 5' -AGCAGCTGCT-3 ' complex, demonstrating binding models for complexes of a 10 base pair match and single- base pair mismatch sites (the mismatched base pair is highlighted by shading) .
  • the shaded and open circles represent imidazole and pyrrole rings, respectively, diamonds represent ⁇ -alanine, half-circles represent
  • Figure 33a represents a storage phosphor autoradiogram of the 8% denaturing polyacrylamide gel used to separate the fragments generated by DNase I digestion in a quantitative footprint titration experiment with polyamide ImPy- ⁇ - ImPy- (i?) H2N ⁇ -ImPy-C 2 -OH: lane 1, A lane; lane 2, DNase I digestion products obtained in the absence of polyamide; lanes 3-12, DNase I digestion products obtained in the presence of 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50, and 100 nM polyamide ImPy- ⁇ -ImPy- (R) H2N ⁇ -ImPy-C 2 -OH, respectively.
  • Plasmid pJT-LTR was prepared by ligating an insert having the sequence 5 ' -CCGGTAACCAGAGAGACCCAGTACAGGCAA- AAAGCAGCTGCTTATATGCAGCATCTGAGGGACGCCACTCCCCAGTCCCGCCCAGGCCA CGCCTCCCTGGAAAGTCCCCAGCGGAAAGTCCCTTGTAGAAAGCTCGATGTCAGCAGTC
  • the eight-ring polyamide ImPy- ⁇ - ImPyPy- (R) H2N ⁇ -PyImPy-C 2 -OH binds the twelve base pair match site 5' -AAGCAGCTGCTT-3 ' with 10- fold higher affinity than ImPy- ⁇ - ImPy- (J?) H2N ⁇ -ImPy-C 2 -OH, and is approximately 100-fold specific for this site versus the double-base pair mismatch site 5' -CAGATGCTGCAT-3 ' .
  • the DNA-binding affinity and specificity of the six- ring polyamide ImPy- ⁇ -ImPy- (R) HN ⁇ -ImPy-C 2 -OH for its ten base pair binding site are typical of standard six-ring hairpins which recognize five base pairs.
  • use of a the cooperative hairpin dimer motif doubles the binding site size relative to the standard hairpin motif without sacrificing affinity or specificity, and without increasing the molecular weight of the ligand.
  • a novel cooperative hairpin dimer motif, relatively low molecular weight pyrrole-imidazole polyamides can specifically recognize 10-12 base pairs of DNA.
  • Figure 34 provides general polyamide motifs for use in desigining polyamides having improved binding and specificity.
  • Figure 35 provides five general formulas for polyamides of the present invention.
  • Figure 36 illustrates the DNA footprint analysis and affinities of additional cooperatively-bound polyamides.
  • Figure 37 demonstrates the N-terminal extension of the polyamide ImPyPy-X-ImlmPy- ⁇ - PyPyPy- ⁇ -Dp where X is ⁇ , C5-8, ⁇ - ⁇ , or ⁇ -C5.
  • Table 5 illustratea recognition of 15 Base-Pairs by ImPyPy-X-ImlmPy- ⁇ -PyPyPy- ⁇ -Dp polyamides.
  • Association constants (K a ) for the match site 5 ' -AACCAAGTCTTGGTA-3 ' and specificities for the match site versus center (5'- AACCAACTGTTGGTA-3 ' ) and edge (5 ' -AACCAAGTCTTGCGA-3 ' ) mismatch sites are also illustrated.
  • Table 6 illustrates recognition of 15 Base-Pairs by ImlmPy- ⁇ -PyPyPy-X- ImPyPy- ⁇ - polyamides.
  • Association constants (K a ) for the match site 5 ' -AACCAAGTCTTGGTA-3 ' a specificities for the match site versus center (5 ' -AACCAACTGTTGGTA-3 ' ) and edge (5 AACCAAGTCTTGCGA-3 ' ) mismatch sites are shown.
  • Solution conditions 10 mM Tris»HCl, 10 mM KCl, 10 mM MgCl 2 , and 5 mM CaCl 2 at 24 °C a pH 7.0.
  • Table 7 illustrates recognition of 15 base pairs by ImPyPy-X-ImImPy- ⁇ -PyPyPy-C3-0 Association constants (K a ) for the match site 5 ' -AACCAAGTCTTGGTA-3 ' and specificities f the match site versus center (5 ' -AACCAACTGTTGGTA-3 ' ) and edge (5 ' -AACCAAGTCTTGCGA-3 ' mismatch sites.
  • K a Association constants
  • Table 8 illustrates recognition of 16 Base-Pairs by ImPyPyPy-X-ImlmPy- ⁇ -PyPyPy- ⁇ -D Association constants (K a ) for the match site 5 ' -AACCAAGTACTTGGTA-3 ' and specificities f the match site versus center (5 ' -AACCAACTAGTTGGTA-3 ' ) and edge (5 ' -AACCAAGTACTTGCGA-3 mismatch sites.
  • Table 9 illustrates recognition of recognition of 9-11 base pairs by ImPyPy-X-ImPyP
  • Solution conditions 10 mM Tris»HCl, 10 mM KCl, 10 mM MgCl 2 , and 5 mM CaCl 2 at 22 °C an pH 7.0.
  • Table 10 illustrates recognition of 16 Base-Pairs by a polyamide having the formula ImPyPyPy-X-ImImPy- ⁇ -PyPyPy-C3-OH. Association constants (K a ) for the match site 5'-
  • Table 11 illustrates recognition of 17 Base-Pairs by a polyamide of the formula ImPyPy-

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Polymers & Plastics (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Pyrrole Compounds (AREA)

Abstract

L'invention concerne de nouvelles petites molécules de polyamides de formule (I) qui lient spécifiquement, avec une affinité sub-nanomolaire, n'importe quelle séquence prédéterminée du génome humain, et qui pourraient être utilisées en biologie moléculaire et en médecine humaine. Ces composés conçus de manière rationnelle, qui ciblent le sillon mineur d'un ADN en double hélice de forme B, offrent une approche générale du contrôle de l'expression génétique. L'invention propose des règles simples qui permettent de contrôler rationnellement la spécificité de la séquence de liaison de l'ADN pour les polyamides synthétiques contenant des acides aminés N-méthylpyrrole et N-méthylimidazole. L'invention concerne également une série de matrices moléculaires destinées à la conception rationnelle des polyamides et permettant de créer des petites molécules qui reconnaissent des séquences d'ADN prédéterminées, et dont l'affinité et la spécificité sont comparables à celles des protéines de liaison de l'ADN telles que les facteurs transcriptionnels.
EP98918047A 1997-04-06 1998-04-08 Derives de polyamides pyrrole-imidazole liant l'adn Ceased EP0986539A1 (fr)

Applications Claiming Priority (13)

Application Number Priority Date Filing Date Title
US4202297P 1997-04-06 1997-04-06
US4344697P 1997-04-08 1997-04-08
US4344497P 1997-04-08 1997-04-08
US43446P 1997-04-08
US43444P 1997-04-08
US42022P 1997-04-16
US08/837,524 US6143901A (en) 1996-07-31 1997-04-21 Complex formation between dsDNA and pyrrole imidazole polyamides
US837524 1997-04-21
US853522 1997-05-08
US08/853,522 US6635417B1 (en) 1996-07-31 1997-05-08 Complex formation between DSDNA and oligomer of cyclic heterocycles
PCT/US1997/012722 WO1998050582A1 (fr) 1997-05-08 1997-07-21 Formation de complexes entre un adn a double brin et un oligomere d'heterocycles
WOPCT/US97/12722 1997-07-21
PCT/US1998/006997 WO1998049142A1 (fr) 1997-04-06 1998-04-08 Derives de polyamides pyrrole-imidazole liant l'adn

Publications (1)

Publication Number Publication Date
EP0986539A1 true EP0986539A1 (fr) 2000-03-22

Family

ID=27556422

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98918047A Ceased EP0986539A1 (fr) 1997-04-06 1998-04-08 Derives de polyamides pyrrole-imidazole liant l'adn

Country Status (4)

Country Link
EP (1) EP0986539A1 (fr)
JP (1) JP2002515063A (fr)
CA (1) CA2286232A1 (fr)
WO (1) WO1998049142A1 (fr)

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801155A (en) 1995-04-03 1998-09-01 Epoch Pharmaceuticals, Inc. Covalently linked oligonucleotide minor grove binder conjugates
WO2000015773A2 (fr) * 1998-09-11 2000-03-23 California Institute Of Technology Inhibition de transcription d'oncogenes par des polyamides synthetiques
EP1144414B1 (fr) * 1999-01-08 2004-10-06 California Institute Of Technology Compositions et methodes concernant des composes cycliques subissant des interactions specifiques de paires de bases nucleotidiques avec des acides nucleiques bicatenaires
JP2001136974A (ja) * 1999-11-16 2001-05-22 Japan Science & Technology Corp 生理活性ピロールイミダゾール誘導体のスクリーニング方法
US6559125B1 (en) 2000-01-28 2003-05-06 California Institute Of Technology Polyamide-alkylator conjugates and related products and method
US7078536B2 (en) 2001-03-14 2006-07-18 Genesoft Pharmaceuticals, Inc. Charged compounds comprising a nucleic acid binding moiety and uses therefor
US6555693B2 (en) 2000-03-16 2003-04-29 Genesoft, Inc. Charged compounds comprising a nucleic acid binding moiety and uses therefor
GB0011938D0 (en) * 2000-05-17 2000-07-05 Angeletti P Ist Richerche Bio Improvements relating to gene delivery systems
EP1307470A2 (fr) * 2000-07-11 2003-05-07 Universite De Geneve Molecules liant l'adn, liees et specifiques aux sequences
US7122626B2 (en) 2001-04-26 2006-10-17 Genesoft Pharmceuticals, Inc. Halogen-substitued thienyl compounds
WO2002095022A2 (fr) * 2001-05-21 2002-11-28 Universite De Geneve Composes de fixation sequence-specifique de l'adn et leur utilisation pour le ciblage de telomeres et d'autres sequences d'adn
CA2450625A1 (fr) 2001-06-13 2002-12-19 Genesoft Pharmaceuticals, Inc. Composes isoquinoline presentant une activite anti-infectieuse
WO2002101007A2 (fr) 2001-06-13 2002-12-19 Genesoft Pharmaceuticals, Inc Composes benzamides anti-pathogenes
AU2002312371A1 (en) 2001-06-13 2002-12-23 Roland W. Burli Aryl-benzimidazole compounds having antiinfective activity
US6825228B2 (en) 2001-06-13 2004-11-30 Genesoft Pharmaceuticals, Inc. Benzothiophene compounds having antiinfective activity
US7067622B2 (en) 2001-06-25 2006-06-27 Japan Science And Technology Agency Method of the solid phase synthesis of pyrrole-imidazole polyamide
EP1442022A4 (fr) * 2001-11-07 2005-05-04 Pharmacia Corp Modulateurs polyamides de transcription de cox2
ATE425753T1 (de) 2002-08-02 2009-04-15 Genesoft Pharmaceuticals Inc Biaryl-verbindungen mit antiinfektiver wirkung
EP1562931A2 (fr) 2002-10-25 2005-08-17 Genesoft Pharmaceuticals, Inc. Composes biaryle anti-infectieux
AU2003297822A1 (en) 2002-12-10 2004-06-30 Oscient Pharmaceuticals Corporation Antibacterial compounds having a (pyrrole carboxamide)-(benzamide)-(imidazole carboxamide) motif
US8017599B2 (en) 2003-10-07 2011-09-13 University Of Western Sydney Sequence selective pyrrole and imidazole polyamide metallocomplexes
US20060025429A1 (en) * 2004-06-07 2006-02-02 Dervan Peter B Composition and methods for inhibiting expression of hypoxia-inducible genes
JP2007176795A (ja) * 2004-08-18 2007-07-12 Univ Nihon ＴＧＦ−β遺伝子発現抑制剤
JPWO2007034784A1 (ja) * 2005-09-20 2009-03-26 学校法人日本大学 Ｃｔｇｆ遺伝子発現抑制剤
EP1975142A4 (fr) * 2005-11-22 2009-12-02 Univ Nihon Synthèse en phase solide automatisée de polyamide de pyrrole-imidazole
WO2007130616A2 (fr) * 2006-05-04 2007-11-15 Nanovir, Llc Polyamides destinés au traitement du papillomavirus humain
WO2008066890A2 (fr) 2006-11-29 2008-06-05 California Institute Of Technology Polyamides comportant des structures de type queue
US8835480B2 (en) 2007-04-23 2014-09-16 California Institute Of Technology Inhibitors for steroid response elements and related methods
US9630950B2 (en) 2007-04-23 2017-04-25 California Institute Of Technology Inhibitors for steroid response elements and RNA polymerase II and related methods
ES2904673T3 (es) * 2008-02-01 2022-04-05 Ascendis Pharma As Profármaco que comprende un conjugado de fármaco-enlazador.
EP2266583A4 (fr) 2008-04-17 2012-09-19 Univ Nihon Inhibiteur d'expression de gène sélectif pour le gène de la métalloprotéinase-9 de matrice
WO2016129680A1 (fr) 2015-02-12 2016-08-18 国立大学法人京都大学 Conjugué de ctb et d'un polyamide pyrrole-imidazole pour activer l'expression d'un gène spécifique
US10307401B2 (en) 2016-08-29 2019-06-04 California Institute Of Technology Compositions and methods for treatment of prostate cancer
JPWO2022019303A1 (fr) * 2020-07-20 2022-01-27
WO2022215622A1 (fr) * 2021-04-09 2022-10-13 学校法人川崎学園 Inhibiteur de métastases cancéreuses ayant un composé polyamide pyrrole-imidazole en tant que composant efficace de celui-ci
WO2023200009A1 (fr) * 2022-04-15 2023-10-19 国立大学法人 東京大学 Inhibiteur du facteur de transcription protozoaire

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6090947A (en) * 1996-02-26 2000-07-18 California Institute Of Technology Method for the synthesis of pyrrole and imidazole carboxamides on a solid support

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9849142A1 *

Also Published As

Publication number Publication date
WO1998049142A1 (fr) 1998-11-05
JP2002515063A (ja) 2002-05-21
CA2286232A1 (fr) 1998-11-05

Similar Documents

Publication Publication Date Title
WO1998049142A1 (fr) Derives de polyamides pyrrole-imidazole liant l'adn
US6472537B1 (en) Polyamides for binding in the minor groove of double stranded DNA
US6506906B1 (en) Preparation and use of bifunctional molecules having DNA sequence binding specificity
AU735022B2 (en) Method for the synthesis of pyrrole and imidazole carboxamides on a solid support
WO1998037066A9 (fr) Polyamides ameliores pour assurer une liaison dans le sillon mineur de l'adn a double brins
US7049061B1 (en) Stereochemical control of the DNA binding affinity, sequence specificity, and orientation-preference of chiral hairpin polyamides in the minor groove
AU747998B2 (en) Complex formation between dsDNA and oligomer of heterocycles
Herman et al. Tandem hairpin motif for recognition in the minor groove of DNA by pyrrole–imidazole polyamides
AU747668B2 (en) Inhibition of major groove DNA binding proteins by modified polyamides
JP2005508832A (ja) 間隔を開けてアルギニン部分を含むトランスポーター
JP2005538035A (ja) グアニジニウム輸送試薬および結合体
JP2011523415A (ja) 新規な二重標的化抗腫瘍複合体
US6555692B1 (en) Preparation and use of bifunctional molecules having DNA sequence binding specificity
US6559125B1 (en) Polyamide-alkylator conjugates and related products and method
Dastpeyman et al. Modular synthesis of trifunctional peptide-oligonucleotide conjugates via native chemical ligation
Bremer et al. Recognition of the DNA minor groove by pyrrole-imidazole polyamides: comparison of desmethyl-and N-methylpyrrole
AU747300B2 (en) DNA binding pyrrole and imidazole polyamide derivatives
CA2281947A1 (fr) Polyamides ameliores pour assurer une liaison dans le sillon mineur de l'adn a double brins
JP2002514209A (ja) 副溝における、キラルヘアピンポリアミドのｄｎａ結合親和性、配列特異性、および配向優先性の立体化学的制御
WO2023205451A1 (fr) Peptides cycliques pour administrer des agents thérapeutiques
Szewczyk et al. Recognition of the DNA Minor Groove by Pyrrole-Imidazole Polyamides: Comparison of Desmethyl-and N-Methylpyrrole
Dervan et al. Cooperative Hairpin Dimers for DNA Recognition by Pyrrole-Imidazole Polyamides

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19991011

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20010605

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20071108