EP0931145A1

EP0931145A1 - Ptx sensitive g proteins, the production and use thereof

Info

Publication number: EP0931145A1
Application number: EP97944809A
Authority: EP
Inventors: Winfried Siffert
Original assignee: Individual
Current assignee: Individual
Priority date: 1996-09-13
Filing date: 1997-08-29
Publication date: 1999-07-28
Also published as: CN1230222A; NO991227L; BG103238A; JP2001501811A; US6251853B1; PL332417A1; NO991227D0; WO1998011212A1; IL128746A0; BR9711475A; EE9900092A; CZ73499A3; EA199900253A1; KR20000036058A; TR199900500T2; HUP9904110A3; CA2265467A1; AU4619297A; IS4987A; DE19637518A1

Abstract

Beta-3 sub-unit of a human G protein, consisting of 6 WD recurrent patterns at the most.

Description

PTX-sensitive G-Proteme, its production and use

description

The present invention relates to new human G-Proteme, in particular ß3-Unteremheιten G-Proteme, processes for their preparation and their use in diagnostics and therapy

Heterotomeric guan nucleotide-binding proteins (G-proteins) are of outstanding importance in intracellular signal transduction. They mediate the forwarding of extra cellular signals after stimulation of hormone receptors and other receptors, which undergo a conformational change after receptor activation. This leads to the activation of G-proteins, which can subsequently activate or inhibit intracellular effectors (e.g. ion channels, enzymes). Heterotomeric G-proteins are composed of three subunits, the α, β and γ subunits. So far, several different α subunits, 5 β subunits and approx. 12 γ subunits have been detected using biochemical and molecular biological methods (Birnbaumer, L and Birnbaumer, M. Signal transduction by G proteins- 1994 edition. J. Recept. Res. 15: 213-252, 1995; Offermanns, S. and Schultz, G. Complex Information process g by the transraembrane signaling System mvolving G proteins. Naunyn Schmiedebergs Arch. Pharmacol. 350: 329-338, 1994; Nürnberg, B., Gudermann, T., and Schultz, G. Receptors and G proteins as pπmary components of transmembrane Signal transduction Part 2 G proteins: strueture and function. J. Mol. Med. 73 123-132, 1995; Neer, EJ Heterotrimeric G proteins- Organizers of Transmembrane Signals. Cell 80: 249-257, 1995; Rens- Do iano, S. and Hamm, HE Structural and functional relation- ships of heterotrimeric G-proteins. FASEB J. 9: 1059-1066, 1995).

The receptor-mediated activation of certain α-subunits can be inhibited by pretreatment with pertussis tox (PTX). These include, in particular, the α isoforms il, αι2 and αι3, and different αo subunits. Such G proteins are also referred to as "PTX-sensitive G proteins".

ßγ subunits perform essential functions in G-prototype activation and in the modulation of intracellular reactions. All previously known G-protein ß subunits have high homologies at the level of the nucleotide sequence and at the level of the amino acid sequence. These similarities are not only within the human ß subunits found (ßl, ß2, ß3) but also in comparison to ß subunits of other species, for example fruit flies or yeast.

From X-ray structure analyzes, those amino acids in α, β and γ subunits were determined which are in contact with each other and which are necessary for the orderly formation of the hetero trimer.

All previously known G-Prot ß subunits belong to the so-called "WD repeat" proteins. The N-terminus of the ß-subunit mainly interacts with γ-subunits, the C-terminus is involved in the interaction with receptors.

ß sub-units form so-called propeller structures. The ß-propellers of the Gß subunits consist of 7 "ß-propellers - blades", each propeller blade consisting of 4 amino acid regions arranged in antiparallel. The seven-fold symmetry of the ß-propeller can be demonstrated at the level of the amino acid sequence, which contains 7 so-called WD repeats. A WD repeat motif comprises approximately 40 amino acids and has a number of conserved amino acids, including Trp-Asp dipeptide sequences. This WD mot v often ends the WD repeat (Fig. 1).

Surprisingly, it has now been found that, for example, hypertensives have G-protein β3 subunits which consist only of 6 instead of the otherwise described 7 WD repeat motifs. These hypertensives showed an increased cellular activation of PTX-sensitive G proteins compared to normotonics.

The molecular analysis revealed a new amino acid sequence for the ß3 subunit in these hypertensives, which is shortened by 41 amino acids compared to the known sequence. The sequence is shown in SEQ ID NO: 2. Formally, it emerges from the well-known human β3 subunit by deleting amino acids 167-207.

The corresponding DNA sequence coding therefor is described in SEQ ID NO: 1.

The reason for the appearance of the truncated Gß3 subunit in hypertensives is probably an alternative splicing of the corresponding gene. There is an intron at the DNA level just in front of the putative splice point. The intron begins behind nucleotide 497 of the open reading frame (numbering according to SEQ ID NO: 1). An intron could also be detected using PCR on genomic DNA, starting at nucleotide 620. The shortened form is evidently the result of the deletion of a complete exon. Another object of the invention is a method for producing shortened forms of human Gß3 subunits as mentioned above, by expressing a nucleic acid sequence coding therefor in a host organism.

The recombinant expression is preferably carried out by producing a gene construct which, in addition to the coding nucleic acid sequence, also contains further signal and regulatory sequences, such as promoters, terminators, riboseal binding sites, polyadenylation sites and the like. The general procedure for the recombinant expression of a gene is familiar to the person skilled in the art.

Another object of the invention is the use of the nucleic acid sequences according to the invention for the production of medicaments for gene therapy treatment. By introducing these nucleic acid sequences in direct form or after producing a corresponding gene vector in the cells of patients, an increased activatability of G proteins can be achieved in these.

This is desirable in a number of diseases in which G protein-associated misregistration is present.

Diseases which are associated with a G protein malfunction are to be understood as diseases in which the G protein is involved in signal transduction and does not fulfill its function in a physiological manner.

The diseases include cardiovascular diseases, metabolic disorders and immune diseases.

Cardiovascular diseases include: hypertension, gestational hypertension (gestosis, "hypertension in pregnancy"), coronary heart disease, localized and / or generalized atherosclerosis, stenosis of the blood vessels, restenosis after revascularizing vascular interventions (e.g. PTCA with and without stent implantation), Apoplex tendency. Thrombosis tendency and increased platelet aggregation.

Metabolic disorders include: Metabolic syndrome, insulin resistance and hyperinsulinemia, type II diabetes mellitus, diabetic complications (e.g. nephropathy, neuropathy, retmopathy, etc.). Disorders, disturbed central chemoreception (C0 ₂ tolerance, acidosis tolerance, sudden child death (SIDS)).

The following can be mentioned as immune diseases: disturbed strength of the body's immune response (formation of immunoglobulins, aggressiveness of T cells and NK cells), impaired general tendency to proliferate including wound healing ability, tendency to tumor development and proliferation including metastatic potential of malignant transformed cells, duration of the Latency after HIV infection until the clinical onset of the disease, Kaposi's sarcoma, tendency to cirrhosis of the liver, graft tolerance and graft rejection.

Another object of the invention is the use of the nucleic acid sequences according to the invention for the diagnosis of

Diseases, especially to determine the risk of developing an illness associated with G-Protem malfunction.

In addition to determining the risk for certain diseases, general physiological data and statements can also be made through the use according to the invention, for example on central chemoreception, C0 tolerance, acidosis tolerance, risk of sudden child death (SIDS), suitability for certain sports.

Another object of the invention is the use of nucleic acid sequences which are complementary to the nucleic acid sequences coding for the shortened form of the Gß3 subunit. Such sequences can be used as antisense constructs for the treatment or prevention of diseases which are associated with a G-protein malfunction.

Another object of the invention is a method for determining a relative risk of disease in diseases associated with G-protein malfunction for a subject, characterized in that the gene sequence for human G-protein β3-lower unit of the subject with the gene sequence SEQ ID NO : l compares and, if it matches SEQ ID N0: 1, assigns the subject an increased risk of disease.

In the method according to the invention for determining the relative risk of disease, body material which contains the genetic information of the subject is removed from a subject. this will usually achieved by taking blood and isolating the nucleic acid from it.

The gene structure for the G-protein β3 subunit is determined from the isolated nucleic acid of the test subject and compared with the sequence given in SEQ ID N0: 1.

The gene structure can be determined by sequencing the nucleic acid. This can be done either directly from the genomic DNA or after amplification of the nucleic acid, for example using the PCR technique.

The gene structure can occur at the mRiMA or cDNA level.

The determination by sequencing after PCR amplification of the cDNA is preferred. The primers suitable for the PCR reaction can easily be derived for the person skilled in the art from the sequences set out in SEQ ID NO: 1. The procedure is advantageously such that a strand and counter strand binding primer are chosen before and after the deletion site.

However, the gene comparison can also be carried out using other methods, for example by selective hybridization or by appropriate mapping with restriction enzymes.

The diagnostic procedures described above can also be performed at the protein level. For example, the proteins according to the invention can be used to produce specific antibodies which specifically recognize the shortened form of the Gß3 subunit. Using such antibodies, protein-chemical tests can then be carried out in addition to or alternatively to the genetic tests, if necessary using conventional ELISA methods.

Another object of the invention is the production of transgenic animals that carry the gene modification described above (shortening the Gß3-Untereιnheιt). Such transgenic animals are particularly important as animal models for the investigation and therapy of the diseases described above. The methods for producing transgenic animals are generally known to the person skilled in the art.

The following examples serve to further illustrate the invention. Experimental part

1 Functional results for G protein activation in essential hypertension

The activation of G proteins from cells of normotensive subjects and hypertensive patients was characterized in detail. For this purpose, the stimulated incorporation of radioactively labeled [ ³⁵ S] GTPγS according to the method described by Wieland et al. described method (Wieland, T., Liedel, K., Kaldenberg Stasch, S., Meyer zu Heπngdorf, D, Schmidt, M, and Jakobs, K H. Analysis of receptor-G protem mteractions m permeabilized cells Naunyn - Schmiedeberg 's Arch. Pharmacol 351: 329 336, 1995). G proteins were first activated by stimulation of cells permeabilized with Digitonm using the peptide mastoparan-7. This peptide mimics the configuration of an activated, G protein-coupled receptor, so that it can be used to induce receptor-independent, direct G protein activation (Ross, EM and Higashi ia, T. Regulation of G-protein activation by mastoparan and other cationic peptides. Methods Enzy ol. 237: 27-38, 1994). The binding of GTPγS induced by MAS - 7 is completely PTX-sensitive, so that the activation of heterotimeric G-type proteins of the Gi type is thus quantified. Fig. 2 shows the concentration dependence of the G protein activation induced by Mastιparan-7 (MAS-7) in normotonia (NT) and hypertension (HT). MAS-7 induces a strong [ ³⁵ S] GTPγS binding on HT cells, the EC50 of which is approx. 5 μiM (Fig. 2). A binding maximum is reached at about 25 to 50 μM MAS-7. In contrast, the same [ ³⁵ S] GTPγS binding to NT cells requires a tenfold higher concentration (Fig. 2). These data demonstrate that the activation of PTX-sensitive G-Proteme in HT cells requires significantly less activated receptor than that in NT cells.

Fig. 3 shows the time course of the binding of [ ³⁵ S] GTPγS stimulated by mastoparan-7 to cell lines of the normotome nucleus (NT) and hypertensive (HT).

The binding of [ ³⁵ S] GTPγS to hypertensive cells is significantly accelerated (rate constants 0.005 s - for normotonia versus 0.01 s ^l for hypertension).

Fig. 4 shows the GDP dependency of the binding of [ ³⁵ S] GTPγS, which was muted by mastoparan-7 st, to isolated cell membranes of normotome nuclei and hypertensives. It can be seen that the maximum of the stimulated [ ³⁵ S] GTPγS binding on membranes of hypertensive patients is already at lower concentrations of GDP takes place (approx. 0.2 μmol / L), whereas a concentration of 1 μmol / L GDP is required for the same effect with normotome cores.

Similarly, the maximum binding of [ ³⁵ S] GTPγS stimulated by mastoparan-7 to membrane preparations of hypertensive cells requires a low concentration of free Mg ²⁺ (about 0.01 mmol / L), while for the same maximum [ ³⁵ S] GTPγS binding to membranes of normotonic cells requires a free Mg ²⁺ concentration of 0.1 mmol / 1 (Fig. 5).

Subsequently, experiments were carried out to reconstitute the increased activatability of G proteins from hypertensive cells. For this purpose, the photoreceptor Rhodopsm and the G-Proteme-α subunit Transducm (αt) were purified from cattle eye (Phillips, WJ, Wong, SC, and Ceπone, RA Rhodopsm / trans ducm mteractions. II Influence of the transducm-ßγ subunit romplex on the couplmg of the transducm a subunit to rhodopsm J.Biol.Chem. 267: 17040 17046, 1992). In addition, G proteins were extracted from membranes of normotonic and hypertensive cells by adding cholate (Mitchell, J., Northup, JK, and Schimmer, BP Defective guanyl nucleotidebmdmg prote ßγ sub units in a forskolin resistant mutant of the Yl adrenocortical cell lme. Proc.Natl. Acad. Sci. U. S. A. 89 (19): 8933-8937, 1992). The specific binding of [ ³⁵ S] GTPγS to α-transducin (αt) induced by Rhodopsm (= receptor) was measured and the influence of cholate extracts from membranes of normotonic and hypertensive cells on this binding was investigated. The protein concentration of the chola extracts was identical in all experiments.

Fig. 6 shows the influence of cholate extracts from normotonic and hypertensive cells on the Rhodopsm-stimulated binding of [ ³⁵ S] GTPγS to αt.

It can be seen here that cholate extracts from hypertensive cells require the rhodopsm-catalyzed binding of [ ³⁵ S] GTPγS to αt to be significantly higher than is mediated by cholate extracts from normotome nuclei.

The experiments shown allow the following conclusions - conclusions -

• In hypertensive lines there is an increased activatability of G-Protemen. Compared to G-protein activation, this takes place more efficiently in normotonic cells, in that hypertension cells require significantly less activated receptor and additionally the kinetics of the G protein activation is significantly accelerated (Fig. 2 and 3).

• In addition, the maximum G-protein activation in hypertonic cells requires significantly lower concentrations of free GDP and free Mg- ² - ' ^* compared to normotonic cells. This leads to the conclusion that the protein interactions of α, ß and γ subunits in hypertensive cells are significantly more efficient than those in normotonic cells (Fig. 4 and 5).

• The binding of [ ³⁵ S] GTPγS to αt, which is catalyzed by Rhodopsm, is significantly increased by cholate extracts from hypertensive cells than by cholate extracts from normotonic cells. This proves that the increased G-protein activation in hypertensive cells can be reconstructed in a vitro system (Fig. 6). In addition, the unequivocal conclusion can be drawn from these findings that the underlying alteration is to be found in hypertensive cells in the case of β-lower parts, ie heterotrimeric G proteins. In the reconstitution system mentioned, in the presence of αt, the α subunits still present in the cholate extracts are no longer activated. In addition, the added photoreceptor Rhodopsm specifically activates only the added αt, but not the α-subunits remaining endogenously in chola extracts.

The new protein consists of 299 amino acids. Compared to the previously described human Gß3 subunit, there is a deletion in the area of the 4th WD repeat. However, due to the regularity of the sequence of certain amino acids, it can be predicted that the new, short Gß3 protein also forms a regular propeller structure, whereby this new propeller no longer consists of seven (Fig. 1), but now consists of 6 propeller blades (Fig 7).

Since both the N-terminus and the C-terminus of the new, short Gß3 subunits are unchanged from the previously known Gß3 subunit, an undisturbed interaction with α- and γ-subunits of heterotrimeric G proteins as well as with coupling receptors can be achieved predict. In connection with the functional results described above, it follows that the new, short Gß3 subunit functionally mediates the increased activation of heterotrimeric G proteins observed in hypertensives. An alternative splicing of the gene coding for human Gß3 is assumed to be the cause of the occurrence of the shortened Gß3 subunits in hypertensives. In fact, there is an intron at the DNA level just before the putative splice (Fig. 10).

The intron begins behind base 497 of the open reading frame when the A of the ATG start codon is defined as +1.

The intron boundaries and the "branch site" are shown in italics and underlined.

GGA CAC CAC GTG ≤tgaggctgaacattgctggtgctggggcttgggagtgggcccgg cctttctctaacaαtctccctccattttσαcaσ TGC CTT GTG GGA

Since an intron can also be detected using PCR on genomic DNA starting at approximately base 620 of the open reading frame, the shortened form of human Gß3 described here is obviously the result of an alternative splicing of the original Gß3, with the deletion of a complete exon.

SEQUENCE LIST (1) GENERAL INFORMATION: (i) LOGIN:

(A) NAME: BASF Aktiengesellschaft

(B) STREET: Carl-Bosch-Strasse 38

(C) LOCATION: Ludwigshafen

(E) COUNTRY: Federal Republic of Germany

(F) POSTCODE: D-67056

(G) TELEPHON: 0621/6048526 (H) TELEFAX: 0621/6043123 (I) TELEX: 1762175170

(ii) APPLICATION TITLE: PTX-sensitive G-Protems, production and use (iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER READABLE FORM:

(A) DISK: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: Patentin Release # 1.0, Version # 1.25 (EPA) (2) INFORMATION ABOUT SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LONG: 1394 base pairs

(B) TYPE: nucleic acid

(C) STRAND FORM: Double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA (iii) HYPOTHETICAL: NO (iii) ANTISENSE: NO

(vi) ORIGINAL ORIGIN:

(A) ORGANISM: Homo sapiens

(ix) FEATURES:

(A) NAME / KEY: CDS

(B) LOCATION: 1..900

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: ATG GGG GAG ATG GAG CAA CTG CGT CAG GAA GCG GAG CAG CTC AAG AAG 48 Met Gly Glu Met Glu Gin Leu Arg Gin Glu Ala Glu Gin Leu Lys Lys

1 5 10 15

CAG ATT GCA GAT GCC AGG AAA GCC TGT GCT GAC GTT ACT CTG GCA GAG 96 Gin Ile Ala Asp Ala Arg Lys Ala Cys Ala Asp Val Thr Leu Ala Glu

20 25 30

CTG GTG TCT GGC CTA GAG GTG GTG GGA CGA GTC CAG ATG CGG ACG CGG 144 Leu Val Ser Gly Leu Glu Val Val Gly Arg Val Gin Met Arg Thr Arg

35 40 45

CGG ACG TTA AGG GGA CAC CTG GCC AAG ATT TAC GCC ATG CAC TGG GCC 192 Arg Thr Leu Arg Gly His Leu Ala Lys Ile Tyr Ala Met His Trp Ala 50 55 60 ACT GAT TCT AAG CTG CTG GTA AGT GCC TCG CAA GAT GGG AAG CTG ATC 240 Thr Asp Ser Lys Leu Leu Val Ser Ala Ser Gin Asp Gly Lys Leu Ile 65 70 75 80

GTG TGG GAC AGC TAC ACC ACC AAC AAG GTG CAC GCC ATC CCA CTG CGC 288 Val Trp Asp Ser Tyr Thr Thr Asn Lys Val His Ala Ile Pro Leu Arg

85 90 95

TCC TCC TGG GTC ATG ACC TGT GCC TAT GCC CCA TCA GGG AAC TTT GTG 336 Ser Ser Trp Val Met Thr Cys Ala Tyr Ala Pro Ser Gly Asn Phe Val

100 105 110

GCA TGT GGG GGG CTG GAC AAC ATG TGT TCC ATC TAC AAC CTC AAA TCC 384 Ala Cys Gly Gly Leu Asp Asn Met Cys Ser Ile Tyr Asn Leu Lys Ser

115 120 125

CGT GAG GGC AAT GTC AAG GTC AGC CGG GAG CTT TCT GCT CAC ACA GGT 432 Arg Glu Gly Asn Val Lys Val Ser Arg Glu Leu Ser Ala His Thr Gly

130 135 140

TAT CTC TCC TGC TGC CGC TTC CTG GAT GAC AAC AAT ATT GTG ACC AGC 480 Tyr Leu Ser Cys Cys Arg Phe Leu Asp Asp Asn Asn Ile Val Thr Ser 145 150 155 160

TCG GGG GAC ACC ACG TGT GCC AAG CTC TGG GAT GTG CGA GAG GGG ACC 528 Ser Gly Asp Thr Thr Cys Ala Lys Leu Trp Asp Val Arg Glu Gly Thr

165 170 175

TGC CGT CAG ACT TTC ACT GGC CAC GAG TCG GAC ATC AAC GCC ATC TGT 576 Cys Arg Gin Thr Phe Thr Gly His Glu Ser Asp Ile Asn Ala Ile Cys

180 185 190

TTC TTC CCC AAT GGA GAG GCC ATC TGC ACG GGC TCG GAT GAC GCT TCC 624 Phe Phe Pro Asn Gly Glu Ala Ile Cys Thr Gly Ser Asp Asp Ala Ser

195 200 205

TGC CGC TTG TTT GAC CTG CGG GCA GAC CAG GAG CTG ATC TGC TTC TCC 672 Cys Arg Leu Phe Asp Leu Arg Ala Asp Gin Glu Leu Ile Cys Phe Ser

210 215 220

CAC GAG AGC ATC ATC TGC GGC ATC ACG TCT GTG GCC TTC TCC CTC AGT 720 His Glu Ser Ile Ile Cys Gly Ile Thr Ser Val Ala Phe Ser Leu Ser 225 230 235 240

GGC CGC CTA CTA TTC GCT GGC TAC GAC GAC TTC AAC TGC AAT GTC TGG 768 Gly Arg Leu Leu Phe Ala Gly Tyr Asp Asp Phe Asn Cys Asn Val Trp

245 250 255

GAC TCC ATG AAG TCT GAG CGT GTG GGC ATC CTC TCT GGC CAC GAT AAC 816 Asp Ser Met Lys Ser Glu Arg Val Gly Ile Leu Ser Gly His Asp Asn

260 265 270

AGG GTG AGC TGC CTG GGA GTC ACA GCT GAC GGG ATG GCT GTG GCC ACA 864 Arg Val Ser Cys Leu Gly Val Thr Ala Asp Gly Met Ala Val Ala Thr

275 280 285

GGT TCC TGG GAC AGC TTC CTC AAA ATC TGG AAC TGAGGAGGCT GGAGAAAGGG 917 Gly Ser Trp Asp Ser Phe Leu Lys Ile Trp Asn

290 295 300

AAGTGGAAGG CAGTGAACAC ACTCAGCAGC CCCCTGCCCG ACCCCATCTC ATTCAGGTGT 977 TCTCTTCTAT ATTCCGGGTG CCATTCCCAC TAAGCTTTCT CCTTTGAGGG CAGTGGGGAG 1037 CATGGGACTG TGCCTTTGGG AGGCAGCATC AGGGACACAG GGGCAAAGAA CTGCCCCATC 1097 TCCTCCCATG GCCTTCCCTC CCCACAGTCC TCACAGCCTC TCCCTTAATG AGCAAGGACA 1157 ACCTGCCCCT CCCCAGCCCT TTGCAGGCCC AGCAGACTTG AGTCTGAGGC CCCAGGCCCT 1217 AGGATTCCTC CCCCAGAGCC ACTACCTTTG TCCAGGCCTG GGTGGTATAG GGCGTTTGGC 1277 CCTGTGACTA TGGCTCTGGC ACCACTAGGG TCCTGGCCCT CTTCTTATTC ATGCTTTCTC 1337 CTTTTTCTAC CTTTTTTTCT CTCCTAAGAC ACCTGCAATA AAGTGTAGCA CCCTGGT 1394 (2) INFORMATION FOR SEQ ID NO : 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 299 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Gly Glu Met Glu Gin Leu Arg Gin Glu Ala Glu Gin Leu Lys Lys

1 5 10 15

Gin Ile Ala Asp Ala Arg Lys Ala Cys Ala Asp Val Thr Leu Ala Glu

20 25 30

Leu Val Ser Gly Leu Glu Val Val Gly Arg Val Gin Met Arg Thr Arg

35 40 45

Arg Thr Leu Arg Gly His Leu Ala Lys Ile Tyr Ala Met His Trp Ala

50 55 60

Thr Asp Ser Lys Leu Leu Val Ser Ala Ser Gin Asp Gly Lys Leu Ile 65 70 75 80

Val Trp Asp Ser Tyr Thr Thr Asn Lys Val His Ala Ile Pro Leu Arg

85 90 95

Ser Ser Trp Val Met Thr Cys Ala Tyr Ala Pro Ser Gly Asn Phe Val

100 105 110

Ala Cys Gly Gly Leu Asp Asn Met Cys Ser Ile Tyr Asn Leu Lys Ser

115 120 125

Arg Glu Gly Asn Val Lys Val Ser Arg Glu Leu Ser Ala His Thr Gly

130 135 140

Tyr Leu Ser Cys Cys Arg Phe Leu Asp Asp Asn Asn Ile Val Thr Ser 145 150 155 160

Ser Gly Asp Thr Thr Cys Ala Lys Leu Trp Asp Val Arg Glu Gly Thr

165 170 175

Cys Arg Gin Thr Phe Thr Gly His Glu Ser Asp Ile Asn Ala Ile Cys

180 185 190

Phe Phe Pro Asn Gly Glu Ala Ile Cys Thr Gly Ser Asp Asp Ala Ser

195 200 205

Cys Arg Leu Phe Asp Leu Arg Ala Asp Gin Glu Leu Ile Cys Phe Ser

210 215 220

His Glu Ser Ile Ile Cys Gly Ile Thr Ser Val Ala Phe Ser Leu Ser 225 230 235 240

Gly Arg Leu Leu Phe Ala Gly Tyr Asp Asp Phe Asn Cys Asn Val Trp

245 250 255

Asp Ser Met Lys Ser Glu Arg Val Gly Ile Leu Ser Gly His Asp Asn 260 265 270 Arg Val Ser Cys Leu Gly Val Thr Ala Asp Gly Met Ala Val Ala Thr

275 280 285

Gly Ser Trp Asp Ser Phe Leu Lys Ile Trp Asn 290 295

Claims

claims

1. Beta-3 subunit of a human G protein, which consists of a maximum of six WD repeat motifs.

2. Protein according to claim 1 with the m SEQ ID NO: 2 shown amino acid sequence.

3. Nucleic acid sequence coding for a protein according to claim 1 or 2.

4. Nucleic acid sequence according to claim 3 with the sequence shown in SEQ ID NO: 1.

5. A method for producing a protein according to any one of the preceding claims, characterized in that a nucleic acid sequence according to one of the preceding claims is optionally provided with suitable regulatory signals and m is expressed in a host organism.

6. The method according to claim 5, wherein the expression takes place in immune cells of immunodeficient people.

7. The method according to claim 6, wherein it is HIV positive people.

8. The method according to claim 5, wherein the expression takes place in human body cells.

9. The use of a nucleic acid sequence according to any one of the standing before ^¬ claims for the manufacture of a medicament for the treatment of diseases associated with G protein dysregulation disease.

10. Use of a gene modification in the gene for human G protein β3 subunit for the diagnosis of diseases.

11. Use of a gene change in the gene for human G protein .beta.3 subunit integrated to determine the risk of developing a medical ^¬, the falling ill with G protein dysregulation is associated.

12. Use according to claim 10 or 11, characterized in that the gene modification comprises the nucleic acid sequence shown in SEQ ID NO: 1.

5 13. Use according to claim 10-12, characterized in that the disease is a cardiovascular disease, a metabolic disorder or an immune disease.

14. Use according to claim 10-12, characterized in that 10 the disease is hypertension.

15. Use of a nucleic acid sequence according to one of the preceding claims for the production of transgenic animals.

16. Use of a nucleic acid sequence which is complementary to the nucleic acid sequence according to claim 3 or 4 for the production of an antisense medicament for the therapy or prevention of diseases.

20. Use according to claim 16, characterized in that the diseases are hypertension, pregnancy hypertension, coronary heart disease, restenosis by angioplasty or apoplexy.

25 18. Use according to claim 16, characterized in that the diseases is a diabetic secondary disease such as nepropathy, polyneuropathy or retinal pathy.

19. Use according to claim 16, characterized in that the 30 disease is a metastatic tumor.

20. A method for determining a relative risk of disease of diseases associated with G protein misregistration for a subject by determining the gene sequence for human

35 G-protein ß3 subunit of the test person with the gene sequence SEQ ID NO: 1 and, in the event that it matches SEQ ID NO: 1, assigns the test person an increased risk of disease.

40 21. The method according to claim 20, characterized in that one carries out the gene comparison by sequencing, restriction analysis or selective hybridization.

22. Use of a protein according to claim 1 or 2 for the production of antibodies specifically directed against this protein.