DE60113660T2 - G-PROTEIN COUPLED RECIPE - Google Patents

Abstract

The invention provides isolated nucleic acid and amino acid sequences of four novel G-protein coupled receptors that are amplified in breast cancer cells, antibodies to such receptors, methods of detecting such nucleic acids and receptors, and methods of screening for modulators of G-protein coupled receptors.

Description

AREA OF INVENTION

The Invention provides isolated nucleic acid and amino acid sequences of four new G protein-coupled receptors involved in breast cancer cells are amplified, antibodies for such Receptors, methods for detecting such nucleic acids and Receptors and methods of screening for modulators of G protein-coupled Receptors ready.

BACKGROUND THE INVENTION

G protein-coupled Receptors are cell surface receptors, the extracellular Signals indirectly to downstream transducing the underlying effectors, the intracellular signaling proteins, enzymes or channels could be, and changes in the activity then these effectors Mediate cell events. The interaction between the receptor and the downstream lying effector is by a G protein, a heterotrimeres Protein that binds GTP mediates. G-protein coupled receptors ("GPCRs") typically are seven transmembrane areas together with an extracellular domain and a cytoplasmic end at the C-end. These receptors form one size Superfamily of related receptor molecules involved in many signaling processes a key role play, such as sensory and hormonal signal transduction. A size For example, family of olfactory GPCRs has been identified (see, for example, Buck & Axel, Cell 65: 175-187 (1991)). Further identification of GPCRs is to be understood the normal process of signal transduction and also its Involvement in pathological processes important. For example, GPCRs can for the Disease diagnosis as well as for the drug discovery will be used. The further identification of new GPCRs is therefore of great interest.

A publication by Carmeci et al. discloses details of a gene for GPR30, such a gene has homology to the G protein-coupled receptor superfamily on, that of estrogen receptor expression is associated with breast cancer. The G-protein coupled disclosed therein Receptor, however, is different from that present in the present Registration is identified.

All References to SEQ ID NOs. 1, 2, 3, 4, 7 and 8 within the description are for informational purposes only and are not intended to be within the scope of the claimed claims Fall invention.

SUMMARY THE INVENTION

The The present invention thus provides for the first time four new nucleic acids encode the G protein-coupled receptors found in breast cancer cells amplified and / or overexpressed are. These nucleic acids and the polypeptides that encode them are identified as "amplified in breast cancer G protein-coupled receptors "or" BCA-GPCRs ", i.e." BGA-GPCR-1 "," BCA-GPCR-2 "," BCA-GPCR-3 "and" BCA-GPCR-4 " BCA-GPCRs are components of signal transduction pathways in cells and can for the diagnosis of cancer, especially breast cancers, as well as in screening tests for therapeutic Compounds, e.g. For the treatment of cancer, to be used. Antibodies for and antagonists of BCA-GPCR-3 For example, be used as cancer therapeutics.

In In one aspect, the present invention provides an isolated nucleic acid which encodes a polypeptide, which is encoded by the nucleic acid Polypeptide more than 70% amino acid identity with an amino acid sequence of SEQ ID NO: 6.

In In another aspect, the present invention provides an isolated nucleic acid which encodes a polypeptide, wherein the nucleic acid is under stringent Hybridization conditions specific with a nucleic acid with a nucleotide sequence of SEQ ID NO: 5 hybridized.

In In another aspect, the present invention provides an isolated nucleic acid which encodes a polypeptide encoded by the nucleic acid Polypeptide having greater than about 70% amino acid identity with a polypeptide an amino acid sequence comprising SEQ ID NO: 6, wherein the nucleic acid selectively under moderately stringent Hybridization conditions with a nucleotide sequence of SEQ ID NO .: 5 hybridizes.

In a further aspect, the present invention provides an expression vector with an isolated vector Nucleic acid encoding a polypeptide of the invention and a host cell with the expression vector ready.

In one embodiment, the nucleic acid comprises a nucleotide sequence of SEQ ID NO: 5. In another embodiment, the nucleic acid is from a human, a mouse or a rat. In another embodiment, the nucleic acid is amplified by primers that specifically hybridize under stringent hybridization conditions to the same sequence as primer sets selected from the group consisting of:
ATGTTGGGGAACGTCGCCATC (SEQ ID NO: 9) and
TCATCCACAGAGCCTCCAGAT (SEQ ID NO: 10);
ATGGGAAAGGACAATCCAGTT (SEQ ID NO: 11) and
CTAAGAGAGTAACTCCAGCAA (SEQ ID NO: 12);
ATGGAAATAGCCAATGTGAGTTC (SEQ ID NO: 13) and
TAAATTTGCGCCAGCTTGCCTG (SEQ ID NO: 14); and
ATGGTGAGACATACCAATGAGAG (SEQ ID NO: 15) and
CATAAATATTTACTCCCAGAGCC (SEQ ID NO: 16).

In In another aspect, the present invention provides an isolated Polypeptide, wherein the polypeptide has greater than about 70% amino acid sequence identity with a amino acid sequence of SEQ ID NO: 6.

In an embodiment specifically binds the polypeptide to polyclonal antibodies that against SEQ ID NO: 6, or to an immunogenic part from that. In a further embodiment the polypeptide is derived from a human, a rat or a human Mouse. In a further embodiment the polypeptide has an amino acid sequence of SEQ ID NO: 6 or an immunogenic portion thereof.

In In a further aspect, the invention provides an antibody which binds to an isolated polypeptide, the polypeptide being more as about 70% amino acid sequence identity with a Amino acid sequence of SEQ ID NO: 6.

In In another aspect, the present invention provides a method to identify a compound ready for signal transduction modulated by BCA-PCR, the method comprising the steps of: (i) contacting the compound with a polypeptide with more as 70% amino acid sequence identity with the amino acid sequence of SEQ ID NO: 6, and (ii) determining the functional effect of Compound on the polypeptide.

In an embodiment the polypeptide is bound to a solid phase. In a further embodiment the polypeptide is covalently bound to a solid phase.

In one embodiment, the functional effect is determined by measuring changes in intracellular cAMP, IP3 or Ca ²⁺ . In another embodiment, the functional effect is a chemical effect or a physical effect. In another embodiment, the functional effect is measured by measuring the binding of the compound to the polypeptide.

In an embodiment the polypeptide is recombinant. In a further embodiment is the polypeptide is expressed in a cell or cell membrane, e.g. a eukaryotic cell or cell membrane.

In an embodiment is the cancer breast cancer.

In a further embodiment the compound is an antagonist of a polypeptide, wherein the polypeptide more than 70% amino acid identity to the amino acid sequence of SEQ ID NO: 6.

In In another aspect, the present invention provides a method ready to treat cancer, the procedure being the steps contacting a cancer cell with a therapeutically effective amount an antibody comprises wherein the antibody specific to a polypeptide with more than 70% amino acid identity with the amino acid sequence SEQ ID NO: 6 binds.

In an embodiment binds the antibody specific to a polypeptide with more than 70% amino acid identity with the amino acid sequence of SEQ ID NO: 6.

In In another aspect, the present invention provides a method for detecting the presence of a BCA-GPCR nucleic acid or a BCA-GPCR polypeptide in human tissue, the method being the steps comprising: (i) isolating a biological sample; (ii) contacting the biological Sample with a BCA-GPCR-specific reagent that is selective with a BCA-GPCR nucleic acid or a BCA-GPCR polypeptide; and (iii) recording the proportion on BCA-GPCR-specific reagent that selectively binds to the sample.

In an embodiment For example, the BCA-GPCR specific reagent is selected from the group consisting of from: BCA-GPCR-specific antibodies, BCA-GPCR-specific Oligonucleotide primers and BCA-GPCR-specific nucleic acid probes consists.

In a further embodiment the tissue is breast cancer tissue.

In In another aspect, the present invention provides a method for producing a G protein-coupled receptor polypeptide ready, the method comprising the step of expressing the polypeptide from a recombinant expression vector with a nucleic acid, the the polypeptide encoded, wherein the amino acid sequence of the polypeptide has greater than about 70% amino acid identity with a polypeptide an amino acid sequence of SEQ ID NO: 6.

In In another aspect, the present invention provides a method for preparing a recombinant cell with a polypeptide ready, the method comprising the step of transducing the cell with a Expression vector with a nucleic acid encoding the polypeptide, comprises where the amino acid sequence of the polypeptide has greater than about 70% amino acid identity with a polypeptide an amino acid sequence of SEQ ID NO: 6.

SUMMARY THE DRAWINGS

1 : Breast cancer tumors and cell lines with amplified copies of the BCA-GPCR-3 gene.

2 : BCA-GPCR-3 mRNA overexpression in breast cancer cell lines.

3 : Quantitative data of BCA-GPCR-3 mRNA overexpression in breast cancer cell lines.

DETAILED DESCRIPTION OF THE INVENTION

introduction

The present invention for the first time provides nucleic acids encoding four novel G protein-coupled receptors. These nucleic acids and the receptors that encode them are referred to individually as BCA-GPCR-1, 2, 3 and 4. These BCA-GPCRs are components of signal transduction pathways and are associated with a genomic region that is amplified in breast cancer cells. These nucleic acids provide valuable probes for the identification of breast cancer cells, since the nucleic acids are specifically amplified in certain breast cancer cells, or are very close (within 100 kb), or are regions that are specifically amplified and / or overexpressed in breast cancer cells. Nucleic acids encoding the BCA-GPCRs of the invention may be synthesized using such techniques as reverse transcription and amplification of mRNA, isolation of total RNA or poly A ⁺ RNA, Northern blotting, dot blotting, in situ hybridization, RNase protection, S1 degradation, testing of DNA microchip assemblies, and the like.

The Chromosomal localization of the genes was determined and all four of the Genes are located on chromosome 1q44 in the following orientation, starting from the centromere end, 5 'to 3 'strand: BCA-GPCR-1 (3'-5' orientation); about 40 kb; BCA-GPCR-2 (5'-3 'orientation); about 40 kb; BCA-GPCR-3 (3'-5 'orientation); about 60 kb; BCA-GPCR-4 (5'-3 'orientation), with ending at the telomere end. These genes encoding human BCA GPCRs can used to identify diseases, mutations and plants, which are caused by and connected to BCA-GPCRs, such as. Cancer, e.g. Breast cancer. The BCA-GPCRs of the invention are also for the cancer diagnosis, especially breast cancer, useful.

Isolation of new BCA-GPCRs provides a means of testing and identifying modulators of signal transduction of G-protein coupled receptors, eg activators, inhibitors, stimuli lators, enhancers, agonists and antagonists. Such modulators of signal transduction are useful for the pharmacological modulation of signaling pathways, eg in cancer cells such as breast cancer. Such activators and inhibitors identified using BCA-GPCRs may also be used for further study of signal transduction. Thus, the invention provides assays for signal transduction modulation wherein the BCA-GPCRs act as direct or indirect reporter molecules for the effect of modulators on signal transduction. BCA-GPCRs can be used in in vitro, ex vivo, and in vivo assays, eg, to alter transcriptional activation of GPCRs; Ligand binding; Phosphorylation and dephosphorylation; GPCR binding to G proteins; G protein activation, regulatory molecule binding; Voltage, membrane potential and line changes; Ion flux, changes in intracellular second messengers such as cAMP and inositol triphosphate; Changes in intracellular calcium levels; and to measure neurotransmitter release.

method to test for modulators of signal transduction include in vitro ligand binding assays using the BCA-GPCRs, parts thereof, e.g. the extracellular domain, or chimeric proteins with one or more domains GPCR, oocyte GPCR expression or tissue culture cell GPCR expression, either of course occurs or is recombinant; Membrane expression of a GPCR, the either, of course occurs or is recombinant; Tissue expression of a GPCR; expression a GPCR in a transgenic animal, etc.

Functional The BCA-GPCRs provide a seven-transmembrane G-protein coupled Receptor of the G protein-coupled receptor family that with a G protein interact to signal transduction see, e.g., Fong, Cell Signal 8: 217 (1996); Baldwin, Curr. Opin. Cell Biol. 6: 180 (1994)). The genes that make up the BCA-GPCRs are located on chromosome 1q44 and belong to an area which is amplified in breast cancer cells.

Structurally encodes the nucleotide sequence of human BCA-GPCR-1 (see e.g. SEQ ID NO: 1) a polypeptide having a predicted molecular weight of about 31 kDa and a predicted range of 26-36 kDa (see, e.g., SEQ ID NO. 2). Related BCA-GPCR-1 genes from other species should become at least about 70% amino acid identity over one amino acid region of at least about 25 amino acids in length, optionally 50 to 100 amino acids in length, share.

The The present invention also provides polymorphic variants of BCA-GPCR-1 prepared as shown in SEQ ID NO: 1: Variant # 1 in which an isoleucic acid residue against a leucine residue in amino acid position 7 of the methionine is exchanged; Variant # 2, in which a glutamic acid residue against an aspartame acid residue in the amino acid position 142 is replaced by methionine; and variant # 3, in the one Alanine residue against a glycine residue at amino acid position 6 of methionine is exchanged.

Structurally encodes the nucleotide sequence of human BCA-GPCR-2 (see e.g. SEQ ID NO: 3) a polypeptide having a predicted molecular weight of about 37 kDa and a predicted range of 32-42 kDa (see, e.g., SEQ ID NO .: 4). Related BCA-GPCR-2 genes from other species should become at least about 70% amino acid identity over one amino acid region with at least about 25 amino acids in length, optionally 50 to 100 amino acids in length, share. BCA-GPCR-2 is at least about 2-3 fold in 15% of primary breast tumors and tumor cell lines amplified.

The The present invention also provides polymorphic variants of the sequence shown in SEQ ID NO .: 4 presented BCA-GPCR-2 ready: Variant # 1, in the one Leucinsäurerest exchanged for an isoleucine residue in amino acid position 9 is; Variant # 2, in which an aspartic acid residue against a glutamic acid residue in the amino acid position 19 is exchanged; and variant # 3, in which an alanine residue is against a glycine residue in the amino acid position 6 is replaced.

Structurally, the nucleotide sequence of human BCA-GPCR-3 (see, eg, SEQ ID NO: 5 expressed in placenta and testes) encodes a polypeptide with a predicted molecular weight of about 37 kDa and a predicted range of 32-42 kDa (see, eg, SEQ ID NO .: 6). Related BCA-GPCR-3 genes from other species should share at least about 70% amino acid identity over an amino acid range of at least about 25 amino acids in length, optionally 50 to 100 amino acids in length. BCA-GPCR-3 is at least about 3-7-fold amplified in about 15% of primary breast tumors and tumor cell lines (see 1 ). In addition, BCA-GPCR-3 mRNA levels are increased in breast cancer cell lines from both amplified and non-amplified tumors (see 2 - 3 ).

The present invention also provides polymorphic variants of the BCA-GPCR-3 described in SEQ ID NO: 6 prepared: variant # 1, in which a leucine acid residue is replaced by an isoleucine residue at amino acid position 8; Variant # 2, in which an aspartic acid residue has been replaced by a glutamic acid residue at amino acid position 73; and Variation # 3, in which an alanine residue is substituted for a glycine residue at amino acid position 7.

Structurally encodes the nucleotide sequence of human BCA-GPCR-4 (see SEQ ID NO: 7) a polypeptide having a predicted molecular weight of about 37 kDa and a predicted range of 32-42 kDa (see, e.g., SEQ ID NO .: 8). Related BCA-GPCR-4 genes from other species should become at least about 70% amino acid identity over one amino acid region of at least about 25 amino acids in length, optionally 50 to 100 amino acids in length, share. BCA-GPCR-4 is at least about 2-3 fold in 15% of primary breast tumors and tumor cell lines amplified.

The present invention also provides polymorphic variants of BCA-GPCR-4, which is shown in SEQ ID NO: 8, ready: Variant # 1, in the a leucine acid residue exchanged for an isoleucine residue in amino acid position 7 is; Variant # 2, in which a glutamic acid residue against an aspartic acid residue in the amino acid position 13 is exchanged; and variant # 3, in which a serine residue is against a glycine residue in the amino acid position 10 is replaced.

specific Areas of the BCA-GPCR nucleotide and amino acid sequences can be used polymorphic variants, interspecies homologs and alleles of BCA-GPCRs to identify. This identification may be in vitro, e.g. under stringent hybridization conditions, or PCR (using of primers containing SEQ ID NOs: 1, 3, 5 and 7, e.g. SEQ ID NO: 9-16, hybridize), and sequence analysis or using the sequence information in a computer system for comparison with other nucleotide sequences carried out become. Typically, the identification of polymorphic variants and alleles of a BCA-GPCR by comparing an amino acid sequence of about 25 amino acids or more, e.g. 50-100 Amino acids, carried out. The amino acid identity of about at least 70% or above, optional 75%, 80%, 85% or 90-95% or above, typically demonstrates that a protein a polymorphic variant, an interspecies homolog or an allele a BCA GPCR. The sequence comparison is done using the BLAST and BLAST 2.0 sequence comparison algorithms with default parameters carried out, which will be discussed below become. Antibody, specific to a BCA-GPCR or a conserved region thereof bind, can also used to identify alleles, interspecies homologs and polymorphs Identify variants. It is expected that the polymorphic Variants, alleles and interspecies homologs have the seven-transmembrane structure maintain a G protein-coupled receptor.

BCA-GPCR nucleotide and amino acid sequence information can Also used to build models of BCA GPCRs in a computer system to construct. These models are subsequently used to make connections which can activate or inhibit BCA-GPCRs. Such Compounds that have the activity of a BCA-GPCR used to understand the role of BCA-GPCRs in signal transduction to investigate.

definitions

"BCA-GPCR" and "BCA-GPCR-1, 2, 3 or 4" refer to novel G protein-coupled receptors for which the genes are located on chromosome 1q44 and belong to a region of the chromosome that is amplified in breast cancer cells. The BCA-GPCRs of the invention have seven transmembrane domains and exhibit "G-protein coupled receptor activity", eg, they bind to G-proteins in response to extracellular stimuli and promote the production of second messengers such as IP3, cAMP and Ca ²⁺ via the stimulation of downstream effectors such as phospholipase C and adenylate cyclase (for a description of the structure and function of GPCRs see eg Fong, supra, and Baldwin, supra).

topologically BCA-GPCRs have an N-terminal "extracellular domain", a "transmembrane domain" with seventh transmembrane regions and corresponding cytoplasmic and extracellular loops and a C-terminal cytoplasmic Domain "(see e.g. Buck & Axel, Cell 65: 175-187 (1991)). These domains can using methods known to those skilled in the art, such as e.g. Sequence analysis programs that identify hydrophobic and hydrophilic domains, structurally identified (see, e.g., Kyte & Doolittle, J. Mol. Biol. 157: 105-132 (1982)). Such domains are for the production of chimeric Proteins and for In vitro assays of the invention useful.

"Extracellular domain" therefore refers to the domain of a BCA-GPCR that protrudes from the cell membrane and frequently binds to an extracellular ligand. This domain is common for in vitro Li gandenbindungstests, both in the soluble and solid phase, useful.

"Transmembrane domain" includes seven Transmembrane areas plus the corresponding cytoplasmic and extracellular Grind. Certain areas of the transmembrane domain can also involved in ligand binding.

"Cytoplasmic Domain "refers to the domain a BCA-GPCR, which after the seventh transmembrane area in the Cytoplasm sticks out and to the C-end of the polypeptide.

"GPCR activity" refers to the ability of a GPCR to transduce a signal. Such activity may be measured, for example, in a heterologous cell by coupling a GPCR (or a chimeric GPCR) with a G protein and a downstream effector such as PLC and measuring increases in intracellular calcium (see, eg, Offermans & Simon, J. Biol. Chem. 270: 15175-15180 (1995)). Receptor activity can be effectively measured by recording ligand-induced changes in [Ca ²⁺ ] _i using fluorescent Ca ²⁺ indicator dyes and fluorometric imaging.

The Terms "BCA-GPCR" and "BCA-GPCR-1, 2, 3 or 4 " Therefore, polymorphic variants, alleles, mutants and interspecies homologs and BCA-GPCR domains thereof, which: (1) about 70% amino acid sequence identity, preferably about 75, 80, 85, 90 or 95% or higher amino acid sequence identity with SEQ ID NO .: 2, 4, 6 or 8 above a window of about 25 amino acids, preferably 50-100 amino acids; or (3) (with a size of at least about 100, preferably at least about 500 or 1000 nucleotides) under stringent hybridization conditions with a sequence SEQ ID NO .: 1, 3, 5 or 7 and conservatively modified variants thereof specifically hybridize. This term also refers to a domain a BCA-GPCR as described above or a fusion protein with a domain a BCA-GPCR linked to a heterologous protein.

A "host cell" is a naturally occurring one Cell or a transformed cell containing an expression vector contains and supports the replication or expression of the expression vector. Host cells can be cultured Cells, explants, cells in vivo and the like. host cells can prokaryotic cells, e.g. E. coli or eukaryotic cells such as. Yeast, insect, amphibian or mammalian cells, e.g. CHO, HeLa and the like.

"Biological sample" as used herein is a sample of biological tissue or fluid containing nucleic acids or Polypeptides of new BCA-GPCRs contains. Such samples include, but are not limited to, tissue of humans, mice and rats is isolated. Biological samples can also be tissue sections such as e.g. frozen sections for histological purposes include. A biological Sample is typically derived from a eukaryotic organism e.g. Insects, protozoa, birds, Fish, reptiles and preferably a mammal such as e.g. a rat, a mouse, a cow, a dog, a guinea pig or one Rabbit and most preferably a primate such as e.g. chimpanzees or humans, received. Preferred tissues include e.g. normal Prostate epithelial tissue, placental and testicular tissue.

The term "functional effects" in the context of assays for testing compounds that modulate BCA-GPCR mediated signal transduction involves the determination of any parameter that is indirectly or directly under the influence of a BCA-GPCR, eg, a functional, physical, or functional chemical effect. It includes ligand binding, change in ion flux, membrane potential, current flow, transcription, G-protein binding, gene amplification, expression in cancer cells, GPCR phosphorylation or dephosphorylation, signal transduction, receptor-ligand interactions, levels of second messengers (eg, cAmp, cGMP , IP ₃ or intracellular Ca ²⁺ ), in vitro, in vivo and ex vivo, and also includes other physiological effects such as increases or decreases in neurotransmitter or hormone release.

By "determining the functional effect" is meant testing for a compound that increases or decreases a parameter that is indirectly or directly under the influence of a BCA-GPCR, eg, functional, physical, and chemical effects. Such functional effects may be measured by any means known to those skilled in the art, eg, changes in spectroscopic properties (eg, fluorescence, absorbance, refractive index), hydrodynamic (eg, shape), chromatographic or solubility characteristics, patch clamping, stress sensitive dyes, whole cell currents, radioisotope efflux, inducible markers, transcriptional activation of BCA-GPCRs; Ligand binding assays; Voltage, membrane potential and line changes; Ionenflußtests; Changes in intracellular second messengers such as cAMP and inositol triphosphate (IP3); Changes in intracellular calcium levels; Neurotransmitter release and the like.

"Inhibitors", "activators", and "modulators" of BCA-GPCRs used interchangeably to inhibit, activate or modulate molecules Reference to the signal transduction using in vitro and in vivo tests be identified, e.g. Ligands, agonists, antagonists and their homologues and imitators. Inhibitors are compounds that e.g. partially bind to, partially or completely the Block signal transduction stimulation, reduce it, prevent it, delay their activation, inactivate, insensitize or downregulate them, e.g. Antagonists. Activators are compounds which are e.g. tie stimulate, increase, open, activate, facilitate, signal transduction, increase their activation, make them sensitive or upregulate, e.g. Agonists. Modulators include compounds, e.g. the interaction of a Polypeptides with: extracellular Proteins that bind activators or an inhibitor; G-proteins, G-protein alpha, beta and -Gamma-subunits; and kinases change. Include modulators also genetically modified versions of BCA-GPCRs, e.g. with changed Activity, as well as of course occurring and synthetic ligands, antagonists, agonists, antibodies, small ones chemical molecules and the same. Such tests for inhibitors and activators include e.g. the expression of BCA-GPCRs in vitro, in cells or cell membranes, applying presumed modulator connections and then that Determining the functional effects on signal transduction, such as described above.

rehearse or assays involving BCA-GPCRs linked to a potential activator, Inhibitor or modulator are treated with control samples without the inhibitor, activator or modulator compared to the Extent of To investigate inhibition. The control samples (untreated with Inhibitors) is assigned a relative BCA-GPCR activity value of 100%. Inhibition of BCA-GPCR is achieved when the BCA-GPCR activity value is relative for control about 80%, preferably 50%, more preferably 25-0%. Activation of a BCA-GPCR is achieved when the BCA-GPCR activity value is relative for control (untreated with activators) 110%, more preferably 150%, more preferably 200-500% (i.e., two to five times higher relative for control), more preferably 1000-3000% higher.

The Terms "isolated," "purified," or "biologically pure" refer to Material that is substantially or substantially free of components that accompany it normally, as in its natural one To find state. Purity and homogeneity are typically below Use of analytical chemistry methods such as e.g. Polyacrylamide gel electrophoresis or high performance liquid chromatography certainly. A protein that is the predominant species found in a preparation is substantially purified. In particular, an isolated BCA-GPCR nucleic acid of separated open reading frames flanking the BCA-GPCR gene and encode proteins other than the BCA-GPCR. The term "purified" means that a nucleic acid or a protein essentially a band in an electrophoresis gel caused. In particular, it means that the nucleic acid or the protein at least 85% pure, more preferably at least 95% pure and most preferably at least 99% pure.

Refers to "biologically active" BCA-GPCR to a BCA-GPCR with a signal transduction activity and a activity G protein-coupled receptor as described above.

"Nucleic acid" refers to Deoxyribonucleotides or ribonucleotides and polymers thereof either in single or double-stranded Shape. The term includes nucleic acids, the known nucleotide analogues or modified skeletal radicals or containing bonds that are synthetic, naturally occurring and not-natural, the similar ones Have binding properties as the reference nucleic acid and the similar in a way be metabolized to the reference nucleotides. Examples of such Analogs include without limitation phosphorothioates, phosphoramidates, Methylphosphonates, chiralmethylphosphonates, 2-O-methylribonucleotides, Peptide nucleic acids (PNAs).

If not stated otherwise a special nucleic acid sequence also implicitly conservatively modified variants thereof (e.g., degenerate Codon substitutions) and complementary Sequences as well as the explicitly stated sequence. In particular, degenerate Codon substitutions by generating sequences in which the third position of one or more selected (or all) codons with mixed base and / or deoxyinosine residues are replaced (Bather et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al. J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). The term nucleic acid is used exchangeable with gene, cDNA, mRNA, oligonucleotide and polynucleotide used.

The Terms "polypeptide", "peptide" and "protein" are used interchangeably herein used to refer to a polymer of amino acid residues. The terms apply to Amino acid polymers in which one or more amino acid residues an artificial one is a chemical imitator of a corresponding naturally occurring amino acid, also for Naturally occurring amino acid polymers and a non-naturally occurring one Amino acid polymer.

Of the Term "amino acid" refers to Naturally occurring and synthetic amino acids as well as amino acid analogues and amino acid counterfeiters, similar in a way to the course occurring amino acids function. Naturally occurring amino acids are those that are encoded by the genetic code, as well as those amino acids, The later modified, e.g. Hydroxyproline, γ-carboxyglutamate and O-phosphoserine. amino acid analogs refers to compounds that have the same basic chemical Structure as natural occurring amino acids have, i. an α-carbon, the to a hydrogen, a carboxyl group, an amino group and an R group is attached, e.g. Homoserine, norleucine, methionine sulfoxide, Methionine methyl. Such analogs have modified R groups (e.g., norleucine) or modified peptide scaffolds, but retain the same basic chemical structure like a naturally occurring amino acid. amino acid imitators refers to chemical compounds that have a structure different from the general chemical structure of an amino acid is, but in a similar way to a course occurring amino acid works.

Amino acids can be used herein either with their usual known three-letter symbols or with the one-letter symbols used by the IUPAC-IUB Biochemical Nomenclature Commission recommended to be designated. nucleotides can as well with their usual accepted one-letter codes.

"Conservative modified Variants "applies as well as Amino acid- as well as nucleic acid sequences. In terms of special nucleic acid sequences conservatively modified variants refers to those nucleic acids that identical or substantially identical amino acid sequences code, or if the nucleic acid no amino acid sequence coded to substantially identical sequences. Due to degeneration of the genetic code encode a large number of functionally identical ones Nucleic acids either given protein. For example, the codecs GCA, GCC, GCG and GCU encode all the amino acid Alanine. In every position where an alanine is set by a codon Thus, the codon may be in any of the corresponding ones changed codons changed without changing the encoded polypeptide. Such nucleic acid variations are "silent variations" that are a species of conservatively modified variations. Each nucleic acid sequence herein, which encodes a polypeptide, also describes any silent Variation of the nucleic acid. A person skilled in the art will recognize that each Codon in a nucleic acid (except AUG, that usually the only codon for Methionine is, and TGG, that common the only codon for Tryptophan) can be modified to a functionally identical molecule to surrender. Thus, any silent variation of a nucleic acid is a polypeptide encoded in any sequence described.

One One skilled in the art will recognize that in terms of amino acid sequences single substitutions, deletions or additions to a nucleic acid, a Polypeptide, a polypeptide or a protein sequence comprising a single amino acid or a small percentage of amino acids in the encoded sequence changes, added or deleted, a "conservative modified variant "is the change for the substitution of an amino acid with a chemically similar amino acid leads. Tables of conservative substitution, the functionally similar amino acids are well known in the art. Such conservative Modified variants are additional to polymorphic variants, interspecies homologs and alleles of Invention and close these are not enough.

• 1) Alanin (A), Glycin (G);
• 2) Asparaginsäure (D), Glutaminsäure (E);
• 3) Asparagin (N), Glutamin (Q);
• 4) Arginin (R), Lysin (K);
• 5) Isoleucin (I); Leucin (L), Methionin (M), Valin (V);
• 6) Phenylalanin (F), Tyrosin (Y), Tryptophan (W);
• 7) Serin (S), Threonin (T); und
• 8) Cystein (C), Methionin (M).

(siehe z.B. Creighton, Proteins (1984)).The following eight groups each contain amino acids that are conservative substitutions to each other:

• 1) alanine (A), glycine (G);
• 2) aspartic acid (D), glutamic acid (E);
• 3) asparagine (N), glutamine (Q);
• 4) arginine (R), lysine (K);
• 5) isoleucine (I); Leucine (L), methionine (M), valine (V);
• 6) phenylalanine (F), tyrosine (Y), tryptophan (W);
• 7) serine (S), threonine (T); and
• 8) Cysteine (C), methionine (M).

(see eg Creighton, Proteins (1984)).

Macromolecular Structures such as e.g. Polypeptide structures may be of various types Organizational levels are described. For a general discussion see this organization e.g. Alberts et al., Molecular Biology of the Cell (3rd ed., 1994), and Cantor and Schimmel, Biophysical Chemistry Part 1: The Conformation of Biological Macromolecules (1980). "Primary structure" refers to the amino acid sequence a special peptide. "Secondary structure" refers to Locally ordered, three-dimensional structures within a polypeptide. These structures are generally known as domains. Domains are parts of a polypeptide that form a compact unit of the polypeptide and typically 25 to about 500 amino acids are long. Typical domains consist of sections of lesser organization such as e.g. expansions from β-sheet and α-helices. "Tertiary structure" refers to the complete Three-dimensional structure of a polypeptide monomer. "Quaternary structure" refers to the three-dimensional structure created by the non-covalent bond from independent tertiary Units is formed. Anisotropic terms are also called energy terms known.

A "marker" or "detectable moiety" is a composition that is detectable by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Useful labels include, for example, ³² P, fluorescent dyes, electron dense reagents, enzymes (eg as commonly used in an ELISA), biotin, digoxigenin or haptens and proteins for which Ant or 7 can be detected, eg by incorporating a radiolabel into the peptide, and which are used to detect antibodies that are specifically reactive with the peptide).

A "labeled nucleic acid probe or a labeled oligonucleotide "is one which is either covalently, by a connector or a chemical bond or non-covalent, by ionic, van der Waals, electrostatic or hydrogen bonds bound to a marker is, so that the Presence of the probe by detecting the presence of the at Probe bound marker can be detected.

As used herein is a "nucleic acid probe or an oligonucleotide "as nucleic acid which is capable of binding to a target nucleic acid complementary Sequence through one or more types of chemical bonds, usually by complementary Base pairing, usually by hydrogen bond formation. As used herein a probe can be natural (i.e., A, G, C or T) or modified bases (7-deazaguanosine, Inosine, etc.). Furthermore can the bases in a probe with a compound other than one Phosphodiester bond, as long as they do not hybridize to disturb. Probes can Thus, for example, be peptide nucleic acids in which the constituent bases rather are linked by peptide bonds as phosphodiester bonds. It is for a person skilled in the art understands that probes Target sequences, which complete complementarity with the probe sequence missing, depending on the stringency the hybridization conditions can bind. The probes are preferably labeled directly with isotopes, chromophores, lumiphors, chromogens or indirectly marked, e.g. with biotin, to which a streptavidin complex later can bind. By testing for the presence or absence of the Probe can indicate the presence or absence of the selected sequence or partial sequence.

Of the Term "recombinant" indicates if he with reference e.g. to a cell or a nucleic acid, a protein or a Vector is used that the Cell, the nucleic acid, the protein or the vector by the introduction of a heterologous nucleic acid or of a heterologous protein or the alteration of a natural one nucleic acid or a natural one Was modified or that the cell of such a modified Cell is derived. Thus, for example, recombinant cells express Genes that are within the natural (Non-recombinant) Form of the cell are not found, or express natural genes, otherwise abnormally expressed, under-expressed or even at all are not expressed.

Of the Term "heterologous" indicates if he is used with respect to parts of a nucleic acid that the nucleic acid two or more subsequences, not to find in the same relationship to each other in nature. Are. The nucleic acid For example, it is typically produced recombinantly, giving two or more sequences of unrelated genes having arranged are to prepare a new functional nucleic acid, e.g. one Promoter from one source and one coding area from another Source. Likewise, a heterologous protein indicates that the protein includes two or more subsequences that are in the same relationship not found in nature (e.g., a fusion protein).

A "promoter" is defined as an array of nucleic acid control sequences that facilitate transcription to direct a nucleic acid. As used herein, a promoter includes required nucleic acid sequences near the start site of transcription, such as in the case of a polymerase II promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which may be located not less than several thousand base pairs from the start site of transcription. A "constitutive" promoter is a promoter that is active under most environmental and development conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation. The term "operatively linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter or an array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.

An "expression vector" is a nucleic acid structure, which is produced recombinantly or synthetically, with a number of specified nucleic acid elements, which enable transcription of a particular nucleic acid in a host cell. The expression vector may be part of a plasmid, a virus or a nucleic acid fragment be. Typically included the expression vector is a nucleic acid to be transcribed, the is effectively linked to a promoter.

The Terms "identical" or percent "identity" in context with two or more nucleic acid or Polypeptide sequences refer to two or more sequences or Subsequences that are the same or a fixed percentage of amino acid residues or nucleotides that are the same (i.e., about 70% identity, preferably 75%, 80%, 85%, 90% or 95% identity over a specified area in the Compared to and geared to maximum agreement over one Comparison window, or a specified range, as using BLAST or BLAST 2.0 sequence comparison algorithms with below described standard parameters or by manual alignment and visual examination measured. Such sequences then become as "essentially identically ". This definition also refers to the complement of a test sequence. Preferably, the identity exists over a range that is at least about 25 amino acids or nucleotides is long, or more preferably over a range of 50-100 amino acids or Nucleotide is long.

To the Sequence comparison typically acts on a sequence as a reference sequence, be compared with the test sequences. If a sequence comparison algorithm is used, the test and reference sequences become a computer entered, subsequence coordinates are set, if necessary, and Sequence algorithm program parameters are set. Standard program parameters can be used or alternative parameters can be be determined. The sequence comparison algorithm then calculates the percentage of sequence identities for the test sequences relative to the reference sequence on the basis of the program parameters.

A "comparison window" as used herein comprises a reference to a segment of any of the number of adjacent ones Positions selected from the group consisting of 20 to 600, usually about 50 to about 200, more ordinary about 100 to about 150, in which there is a sequence with a reference sequence be compared with the same number of adjacent positions can after the two sequences are optimally aligned. method for alignment of sequences for comparison are in the art well known. The optimal alignment of sequences for comparison can e.g. through the algorithm of local homology by Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm by Needleman & Wunsch, Biol. 48: 443 (1970), by the method of searching for similarity from Pearson & Lipman, Proc. Nat'I., Adad. Sci. USA 85: 2444 (1988), through computerized implementations of these algorithms (CAP, BESTFIT, FASTA and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) or through manual alignment and visual examination (See, e.g., Current Protocols in Molecular Biology (Ausubel et al. Ed. 1995 Supplement)).

A preferred example of an algorithm suitable for determining the percentage of sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms described in Altschul et al., Nuc. Acids Res. 25: 3389-3402 (1977) and Altschul et al. Biol. 215: 403-410 (1990). BLAST and BLAST 2.0 are used with the parameters described herein to determine the percentage of sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm first involves identifying high-order sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or meet some threshold value T of positive value, if they are aligned to a word of the same length in a database sequence. T is referred to as the environmental word rating threshold (Altschul et al., Supra). These initial environment word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence as far as the cumulative alignment score can be increased. Cumulative scores are calculated for nucleotide sequences using the parameters M (backward score for a pair of matching residues, always> 0) and N (penalty score for mismatched residues, always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. The extension of the word hits in each direction is paused when: the cumulative alignment score decreases by the amount X from its maximum achieved value; the cumulative score is zero or lower due to the accumulation of one or more residual scores with negative scores; or the end of a sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M = 5, N = 4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3 and an expectation (s) of 10 and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc Natl Acad Sci USA 89: 10915 (1989)) alignments ( B) of 50, expectation (E) of 10, M = 5, N = 4 and a comparison of both strands.

Of the BLAST algorithm performs also a statistical analysis of the similarity between two sequences by (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90: 5873-5787 (1993)). A measure of similarity, the BLAST algorithm is provided, the smallest sum probability (P (N)), which provides an indication of the probability with which a match occur randomly between two nucleotide or amino acid sequences would. A nucleic acid For example, it is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid with the reference nucleic acid less than 0.2, more preferably less than about 0.01 and most preferably less than about 0.001.

One another example of a useful one Algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise Orientations to show the relationship and percentage of sequence identity. It carries too a tree or a dendogram that shows the cluster relationships, which are used to create the alignment. PILEUP used a simplification of the progressive alignment procedure of Feng & Doolittle, J. Mol. Evol. 35: 351-360 (1987). The method used is similar to the method that from Higgins & Sharp, CABIOS 5: 151-153 (1989). The program can hold up to 300 sequences each with a maximum length of 5000 nucleotides or amino acids align. The multiple alignment procedure begins with the pairwise Alignment of the two most similar Sequences wherein a cluster of two aligned sequences is generated becomes. This cluster will then move on to the next best-related sequence or aligned clusters of aligned sequences. Two pilings Seguences are by a simple extension of the pairs Aligned alignment of two single sequences. The final alignment goes through a series of progressive, pairwise alignments reached. The program is set by specifying special sequences and their amino acid or nucleotide coordinates for Areas of sequence comparison and by setting the program parameters carried out. Under Using PILEUP becomes a reference sequence with other test sequences compared to the percentage of the sequence identity relationship using the following parameters. Standard gap weight (3.00), standard gap length weight (0.10) and weighted end column. PILEUP can be obtained from the GCG sequence analysis software package, e.g. Version 7.0 (Devereaux et al., Nuc. Acids Res. 12: 387-395 (1984)), to be obtained.

A Stating that two nucleic acid sequences or polypeptides are substantially identical, is to that this through the first nucleic acid encoded polypeptide with the antibodies raised against that of the second nucleic acid encoded polypeptide are raised, is immunologically cross-reactive, as described below. Thus, a polypeptide is typically essentially identical to a second polypeptide, for example, when the two peptides are conserved only by conservative substitutions differ. Another indication that two nucleic acid sequences are substantially identical, is that the two molecules or their complements hybridize with each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical, is that the same Primer can be used to amplify the sequence.

The term "selectively (or specifically) hybridizes with" refers to the binding, duplication or hybridization of a molecule with only one particular nucleotide sequence under stringent hybridization conditions if this sequence is present in a complex mixture (eg, whole cellular or library DNA or RNA).

The term "stringent hybridization conditions" refers to conditions under which a probe hybridizes with its targeting sequence, typically in a complex nucleic acid mixture, but not with other sequences. Stringent conditions are sequence dependent and are different under different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to hybridization of nucleic acids can be found in Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, "Overview of Principles of Hybridization and the Strategy of Nucleic Acid Assays" (1993). Generally, stringent conditions are selected to be about 5-10 ° C lower than the thermal melting point (T _m ) for the specific sequence at a defined ionic strength, pH. _M T is the temperature (under defined ionic strength, pH, and nucleic acid concentration) complementary to hybridize at which 50% of the probes to the target with the target sequence at equilibrium (as the target sequences are present in excess, at t 50% _m of the probes in equilibrium busy). Stringent conditions are those under which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature at least about 30 ° C for short probes (eg 10 to 50 nucleotides) and at least about 60 ° C for long probes (eg more than 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least twice background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions may include: 50% formamide, 5x SSC and 1% SDS, incubate at 42 ° C, or 5x SSC, 1% SDS, incubate at 65 ° C, wash in 0.2x SSC, and 0 , 1% SDS at 65 ° C.

Nucleic acids that under stringent conditions do not hybridize with each other are nevertheless substantially identical if the polypeptides they contain encode, are essentially identical. This happens, for example, if a copy of a nucleic acid using the maximum codon generation generated by the genetic code is allowed to be generated. In such cases hybridize the nucleic acids typically moderately stringent Hybridization conditions. Exemplary "moderately stringent Hybridization conditions " hybridization in a buffer of 40% formamide, 1M NaCl, 1% SDS at 37 ° C and washing in 1X SCC at 45 ° C. Positive hybridization is at least twice the background. Those skilled in the art will readily recognize that alternative hybridization and washing conditions can be used to conditions more similar To provide stringency.

"Antibody" refers to a polypeptide with a framework region of an immunoglobulin gene or fragments thereof that are specific binds to an antigen and recognizes this. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and Mu genes of the constant region as well as the Myriad immunoglobulin genes of the variable range. Light chains are called either kappa or lambda classified. Heavy chains are called gamma, mu, Alpha, delta or epsilon classified, in turn, the immunoglobulin classes Define IgG, IgM, IgA, IgD or IgE.

An exemplary immunoglobulin (antibody) moiety comprises a tetramer. Each tetramer consists of two identical pairs of polypeptide chains, each pair having a "light" (about 25 kDa) and a "heavy" chain (about 50-70 kDa). The N-terminus of each chain defines a variable range of about 100 to 110 or more amino acids that are primarily responsible for antigen recognition. The terms variable light chain (V _L ) and variable heavy chain (V _H ) refer to these light and heavy chains, respectively.

Antibodies exist, for example, as intact immunoglobulins or as a number of well labeled fragments produced by degradation with various peptidases. Thus, for example, pepsin degrades an antibody among the disulfide bonds in the hinge region to produce F (ab) ' ₂ , a dimer of Fab, which itself has a light chain linked to V _H -C _H 1 by a disulfide bond. The F (ab) ' ₂ can be reduced under mild conditions to break up the disulfide bond in the hinge region, thereby converting the F (ab)' ₂ dimer into a Fab 'monomer. The Fab 'monomer is essentially Fab with part of the hinge region (see Fundamental Immunology (Paul Hrsg., 3rd Ed. 1993)). Although various antibody fragments are defined for the degradation of an intact antibody, one skilled in the art will recognize that such fragments can be newly synthesized either chemically or using recombinant DNA methodology. Thus, the term antibody as used herein also encompasses antibody fragments produced either by the modification of whole antibodies, or those newly prepared using recombinant DNA methodologies (eg, Ein-Ket ten-Fv), or those identified using phage display libraries (see, eg, McCafferty et al., Nature 348: 552-554 (1990)).

to Production of monoclonal or polyclonal antibodies can Any method known in the art is used (see, e.g., Kohler & Milstein, Nature 256: 495-497 (1975); Kozbor et al., Immunology Today 4:72 (1983); Cole et al. Pp. 77-96 in Monoclonal Antibodies and Cancer Therapy (1985)). Process for the production of single-chain antibodies (U.S. Patent 4,946 778) be construed to be antibodies for polypeptides of this invention. Transgenic mice or other organisms such as. other mammals can also be used to express humanized antibodies. alternative The phage display technology can be used to detect antibodies and identify heteromeric Fab fragments specific to selected antigens see, e.g., McCafferty et al., Nature 348: 552-554 (1990); Marks et al., Biotechnology 10: 779-783 (1992)).

A "chimeric antibody" is an antibody molecule in which (a) the constant area or part thereof is changed, replaced or replaced is, so that the Antigen binding site (variable region) with a constant range another or changed Class, an effector function and / or species or a completely different one Molecule, that the chimera antibody gives new properties, e.g. an enzyme, toxin, hormone, growth factor, Pharmaceuticals, etc., is connected; or (b) the variable range or part of it changed, replaced or against a variable range with another or amended antigen specificity is exchanged.

An "anti-BCA-GPCR" antibody is an antibody or an antibody fragment, which specifically binds to a polypeptide bounded by a BCA-GPCR gene, cDNA or a partial sequence thereof is encoded.

Of the Term "immunoassay" is a test that an antibody used to specifically bind an antigen. The immunoassay is by the use of specific binding properties of a special antibody to isolate the antigen, to target this and / or to quantify this.

Of the Expression "binds specific (or selective) " an antibody or "is specific (or selectively) immunoreactive with ", when reference is made to a protein or peptide on a binding reaction that determines the presence of the protein in one heterogeneous population of proteins or other biology. Under defined immunoassay conditions, the specified binding antibody therefore, to a special protein at least twice the background and do not substantially bind in a significant amount other proteins present in the sample. The specific binding to an antibody under such conditions may require an antibody, because of its specificity for a selected special protein becomes. Polyclonal antibodies, which are increased against a particular BCA-GPCR can be selected, for example, to obtain only those polyclonal antibodies that interfere with the BCA-GPCR are specifically immunoreactive, and not with other proteins, apart from polymorphic variants, orthologues and alleles of the BCA-GPCR. This selection can be achieved by subtracting antibodies that with BCA-GPCR molecules Crossreact, be achieved. A variety of immunoassays Can be used to antibodies select which are specifically immunoreactive with a specific protein. Solid-phase ELISA immunoassays for example, are routinely used to antibodies select which are specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassays and conditions used can be to determine the specific immunoreactivity). typically, is a specific or selective immune response at least twice the background signal or noise and typically more than 10 to 100 times the background. Antibodies only with a special BCA-GPCR orthologs, e.g. of specific species, e.g. one Rat, a mouse or a human, can react, too prepared as described above by subtracting antibodies which bind to the same BCA-GPCR from other species.

Of the Expression "connects selectively with "refers on the ability a nucleic acid, with another "selective to hybridise ", as defined above, or the ability of an antibody to a protein "selective (or specifically) to bind ", as defined above.

isolation of nucleic acids, encode the BCA-GPCRs.

A. General Recombinant DNA methods

This invention is based on routine methods in the field of recombinant genetics. Basic texts, which disclose the general methods for use in this invention include Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed., 1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., Eds., 1994).

Be for nucleic acids the sizes either Given kilobases (kb) or base pairs (bp). These are estimates, those of agarose or acrylamide gel electrophoresis, sequenced nucleic acids or from published DNA sequences are derived. For Proteins become sizes in kilodaltons (kDa) or amino acid residue numbers given. Protein sizes are from gel electrophoresis, from sequenced proteins, derived from amino acid sequences or published Estimated protein sequences.

oligonucleotides which are not commercially available are, can according to the solid phase phosphoramidite triester method, first by Beaucage & Caruthers, Tetrahedron Letts. 22: 1859 to 1862 (1981), using an automated Synthesizers as described in Van Devanter et al., Nucleic Acids Res. 12: 6159-6168 (1984). described, chemically synthesized. The purification of oligonucleotides happens either by natural Acrylamide gel electrophoresis or by anion exchange HPLC, such as at Pearson & Reanier, J. Chrom. 255: 137-149 (1983).

The Sequence of cloned genes and synthetic oligonucleotides can after cloning e.g. using the chain termination method for sequencing double-stranded Templates by Wallace et al., Gene 16: 21-26 (1981).

B. cloning process for the Isolation of nucleotide sequences encoding BCA-GPCRs

in the In general, the nucleic acid sequences, encode the BCA-GPCRs, and related nucleic acid sequence homologs from cDNA and genomic DNA libraries by hybridization with a probe cloned or using amplification methods with oligonucleotide primers isolated. BCA-GPCR sequences For example, they are typically derived from mammalian nucleic acid (genomic or cDNA) libraries by hybridization with a nucleic acid probe, whose sequence is derived from SEQ ID NO: 1, 3, 5 or 7 can, isolated. Suitable tissues that make up BCA-GPCR RNA and cDNA can be isolated include e.g. Breast cancer cells, normal prostate epithelial cells, Placenta or testicles.

amplification using primers also be used to amplify BCA-GPCR nucleic acids from DNA or RNA and isolate. The degenerate primers contain the following amino acid sequences can code also be used to amplify a sequence of a BCA-GPCR: SEQ ID NOs: 9-16 (See, for example, Dieffenfach & Dveksler, PCR Primer: A Laboratory Manual (1995)). These primers may e.g. be used to either the full-length sequence or amplify a probe from one to several hundred nucleotides, which is then used to make a mammalian library for BCA-GPCRs full length to screen.

Nucleic acids that BCA-GPCRs also from expression libraries using antibodies as Probes are isolated. Such polyclonal or monoclonal antibodies may be included Use of the sequence of SEQ ID NO: 2, 4, 6 or 8 raised become.

polymorphic BCA-GPCR variants, alleles, and interspecies homologs that become one BCA-GPCR are substantially identical, can be detected using BCA-GPCR nucleic acid probes and oligonucleotides under stringent hybridization conditions be isolated by screening libraries. Alternatively, expression libraries used to contain BCA-GPCRs and polymorphic BCA-GPCR variants, alleles and interspecies homologs by immunological detection of expressed Homologs with antisera or purified antibodies raised against BCA-GPCRs which also recognize the BCA-GPCR homolog and selectively bind to this, to clone.

Around To make a cDNA library, one should choose a source that rich in BCA-GPCR mRNA. The mRNA is then used from reverse transcriptase to cDNA, to a recombinant Vector ligated and spread into a recombinant host, transfected for screening and cloning. Process for the preparation and for screening cDNA libraries are well known (see, e.g., Gubler & Hoffman, Gene 25: 263-269 (1983); Sambrook et al., Supra; Ausubel et al., Supra).

For a genomic library, the DNA is extracted from the tissue and either mechanically sheared or enzymatically degraded to give fragments of about 12-20 kb. The fragments are then separated from undesired sizes by gradient centrifugation and are probed into bacteriopha gen lambda vectors constructed. These vectors and phages are packaged in vitro. Recombinant phages are analyzed by plaque hybridization as described in Benton & Davis, Science 1964180-182 (1977). Colony hybridization is carried out as described generally in Grunstein et al., Proc. Natl. Acad. Sci. USA, 72: 3961-3965 (1975).

One alternative method for isolating BCA-GPCR nucleic acids and their homologues combined the use of synthetic oligonucleotide primers and amplification of an RNA or DNA template (see U.S. patents 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., Ed., 1990)). Methods such as Polymerase chain reaction (PCR) and ligase chain reaction (LCR) can be used to detect nucleic acid sequences from BCA-GPCRs directly from mRNA, from cDNA, from genomic libraries or amplify cDNA libraries. Degenerate oligonucleotides can be fixed to provide BCA-GPCR homologs using the herein provided Amplify sequences. Restriction endonuclease sites can be found in the primers are integrated. Polymerase chain reaction or others In vitro amplification methods may also be useful, for example to nucleic acid sequences to clone the proteins to be expressed to nucleic acids for Use as probes to detect the presence of BCA-GPCR coding mRNA in physiological samples, for nucleic acid sequencing or for others To produce purposes. Genes that amplify through the PCR reaction can, can purified from agarose gels and cloned into a suitable vector become.

Gene expression of BCA-GPCRs may also be analyzed by methods known in the art, eg, reverse transcription and amplification of mRNA, isolation of total RNA or poly A ⁺ RNA, Northern blotting, dot blotting, in situ hybridization, RNase protection, DNA microchip array testing, and the like. In one embodiment, high density oligonucleotide analysis technology (eg, GeneChip ^™ ) is used to identify homologous and polymorphic variants of the GPCRs of the invention. In the case where the identified homologs are associated with a known disease, they can be used with GeneChip ^™ as a diagnostic tool in detecting the disease in a biological sample, see, eg, Gunthand et al., AIDS Res. Hum. Retroviruses 14: 869-876 (1998); Kozal et al., Nat. Med. 2: 753-759 (1996); Matson et al., Anal. Biochem. 224: 110-106 (1995); Lockhart et al., Nat. Biotechnol. 14: 1675-1680 (1996); Gingeras et al., Genome Res. 8: 435-448 (1998); Hacia et al., Nucleic Acids Res. 26: 3865-3866 (1998).

synthetic Oligonucleotides can used to recombinant BCA-GPCR genes for use as probes or to construct for the expression of protein. This method is performed using a series of overlapping oligonucleotides, usually 40 - 120 bp are long, which are both the sense and non-sense strands of the Represent gene performed. These DNA fragments are then subjected to double stranding, ligated and cloned. Alternatively, amplification methods with precise primers used to amplify a specific partial sequence of the BCA-GPCR nucleic acid. The specific partial sequence is then ligated to an expression vector.

The Nucleic acid, which encodes a BCA-GPCR, typically becomes prior to transformation in prokaryotic or eukaryotic cells for replication and / or Expression cloned in intermediate vectors. These intermediate vectors are typically prokaryotic vectors, e.g. Plasmids, or shuttle vectors.

Optional can nucleic acids, the chimera Proteins with BCA-GPCRs or domains encode thereof according to standard procedures getting produced. A domain such as. a ligand binding domain, an extracellular domain, a Transmembrane domain (e.g., one with seven transmembrane regions and corresponding extracellular and cytosolic loops), the transmembrane domain and a cytoplasmic Domain, an active location, a subunit connection area, etc. may be, for example covalently linked to a heterologous protein. An extracellular domain can for example linked to a heterologous GPCR transmembrane domain or a heterologous extracellular GPCR domain can be linked to a transmembrane domain become. Other heterologous proteins of choice include e.g. green fluorescent Protein, luciferase or β-gal.

C. Expression in prokaryotes and eukaryotes

To obtain high level expression of a cloned gene or a cloned nucleic acid, such as those cDNAs encoding BCA-GPCRs, one typically subclones a BCA-GPCR into an expression vector containing a strong promoter for direct transcription, transcription / Translational terminator, and when a nucleic acid encoding a protein contains a ribosome binding site for translation initiation. Suitable bacterial promoters are well known in the art and, for example, in Sambrook et al. and Ausubel et al. described. Bacterial expression systems for expressing the BCA-GPCR protein are described, for example, in E. coli, Bacillus sp. and Salmonella (Palva et al., Gene 22: 229-235 (1983); Mosbach et al., Nature 302: 543-545 (1983).) Equipments for such expression systems are commercially available Eukaryotic systems for mammalian cells, yeast and Insect cells are well known in the art and are also commercially available In one embodiment, the eukaryotic expression vector is an adenovirus vector, an adeno-related vector or a retroviral vector.

Of the Promoter used to express a heterologous nucleic acid to steer hangs from the special application. The promoter is optionally about at the same distance from the heterologous transcription start site arranged as from the transcription start site in its natural Setting. However, as known in the art, one can some variation in this distance without loss of promoter function Be taken into account.

In addition to Contains promoter the expression vector typically comprises a transcription unit or an expression cassette containing all the additional elements that for the Expression of BCA-GPCR-encoding nucleic acid required in host cells are. A typical expression cassette thus contains a promoter which effective with the nucleic acid sequence which encodes a BCA-GPCR, and signals that are efficient Polyadenylation of the transcript, ribosome binding sites and the translation completion are required. The nucleic acid sequence, which encodes a BCA-GPCR can typically be cleavable Signal peptide sequence linked to the secretion of the coded Promote protein through the transformed cell. Such signal peptides would including the signal peptides of tissue plasminogen activator, Insulin and neuronal growth factor and juvenile hormone esterase of Heliothis virescens include. Additional elements of the cassette can Amplifier, and when genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

In addition to a promoter sequence, the expression cassette should also have a Transcriptional end region downstream of the structural gene, around for to ensure an efficient shutdown. The end area can be the same Gen as the promoter sequence can be obtained or may be from different Genes are obtained.

Of the special expression vector that is used to genetically Transporting information into the cell is not special critical. Any of the conventional vectors used for Expression used in eukaryotic or prokaryotic cells can be used. Standard bacterial expression vectors include plasmids such as e.g. pBR322-based plasmids, pSKF, pET23D and fusion expression systems such as e.g. GST and LacZ. epitope can also be added to recombinant proteins to appropriate isolation methods to provide, e.g. c-myc.

Expression vectors containing regulatory elements of eukaryotic viruses are typically used in eukaryotic expression vectors, eg, SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009 / A ⁺ , pMTO10 / A ⁺ , pMAMneo-5, baculovirus pDSVE, and any other vector capable of expressing proteins under the direction of the SV40 early promoter, later SV40 promoter, metallothionein Promoter, mouse mammalian tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown to be effective for expression in eukaryotic cells.

Some Expression systems have markers that provide gene amplification, such as. Thymidine kinase, hygromycin B phosphotransferase and dihydrofolate reductase. Alternatively, high yield expression systems are not Include gene amplification, also suitable, e.g. under use of a baculovirus vector in insect cells, with a BCA-GPCR coding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.

The Elements typically included in expression vectors Also include a replicon that functions in E. coli Gene that encodes antibiotic resistance to the selection of bacteria that harboring recombinant plasmids, and unique restriction sites in non-essential regions of the plasmid to allow to allow the insertion of eukaryotic sequences. The chosen special Antibiotic resistance gene is not critical, any of the many Resistance genes known in the art are suitable. The prokaryotic Sequences are chosen optimally, so that you Do not disturb the replication of DNA in eukaryotic cells if required.

Standard transfection are used to bacterial, mammalian, yeast or insect cell lines to produce the big one Amounts of BCA-GPCR protein which were then purified using standard procedures See, e.g., Colley et al., J. Biol. Chem. 264: 17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, Vol. 182 (German, ed., 1990)). The transformation of eukaryotic and prokaryotic cells is performed according to standard procedures (see e.g. Morrison, J. Bact. 132: 349-351 (1977); Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362 (Wu et al., Eds., 1983).

any the well-known methods for introducing foreign nucleotide sequences in host cells be used. These include the use of calcium phosphate transfection, Polybrene, protoplast fusion, electroporation, liposomes, microinjection, Plasma vectors, virus vectors and any of the other well-known Procedure for introduction of cloned genomic DNA, cDNA, synthetic DNA or others foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessary that the special genetic engineering procedure, which is used, at least one gene is successful to introduce into the host cell, which is able to express a BCA-GPCR.

After this the expression vector is introduced into the cells, the transfected Cultured cells under conditions that favor the expression of a BCA-GPCR, which were identified from the culture using below Standard procedure recovered becomes.

cleaning of BCA GPCRs

Either Naturally Occurring or recombinant BCA-GPCRs may be for use in functional Tests are cleaned. Alternatively, recombinant BCA-GPCRs cleaned. Naturally occurring BCA GPCRs are e.g. from any suitable one Tissue or any suitable cell that is naturally occurring BCA-GPCRs expressed, purified. Recombinant BCA-GPCRs are made from a any suitable bacterial or eukaryotic expression system, e.g. CHO cells or insect cells, purified.

One BCA-GPCR can be purified to substantial purity by standard procedures be inclusive selective failure with such substances as ammonium sulfate; Column chromatography, immuno-purification method and others (see, e.g., Scopes, Protein Purification: Principles and Practice (1982); US Patent No. 4,673,641; Ausubel et al., Supra; and Sambrook et al., supra).

A Number of procedures can be used if a recombinant BCA-GPCR is purified. Proteins with fixed molecular adhesion properties can for example, be reversibly fused with a BCA-GPCR. With the appropriate ligand, a BCA-GPCR can be selectively attached to a purification column be adsorbed and then from the column in a relatively pure Be freed form. The fused protein is then purified by enzymatic activity away. After all could a BCA-GPCR are purified using immunoaffinity columns.

A. Purification of BCA-GPCRs from recombinant cells

recombinant Proteins are made by transformed bacteria or eukaryotic Cells such as e.g. CHO cells or insect cells in large quantities, typically expressed after promoter induction; the expression but it can be constitutive. The promoter induction with IPTG is an example of an inducible promoter system. Cells become according to standard procedure bred in the field. Fresh or frozen cells are used to isolate protein.

Proteins expressed in bacteria can form insoluble aggregates ("inclusion bodies"). Various protocols are suitable for the purification of BCA-GPCR inclusion bodies. For example, purification of inclusion bodies typically involves extraction, separation and / or purification of inclusion bodies by disruption of bacterial cells, eg by incubation in a buffer containing 50 mM TRIS / HCl, pH 7.5, 50 mM NaCl, 5 mM MgCl ₂ , 1 mM DTT, 0.1 mM ATP and 1 mM PMSF. The cell suspension can be lysed using 2-3 passes through a French press, homogenized using a Polytron (Brinkman Instruments), or sonicated on ice. Alternative methods of lysing will be apparent to those skilled in the art (see, eg, Sambrook et al., Supra; Ausubel et al., Supra).

If necessary, the inclusion bodies are solubilized and the lysed cell suspension is typically centrifuged to remove unwanted insoluble matter. Proteins which contain the inclusion bodies can be renatured by dilution or dialysis with a compatible buffer. Suitable solvents include, but are not limited to, urea (from about 4 M to about 8 M), formamide (at least about 80%, volume / volume basis), and guanidine hydrochloride (from about 4 M to about 8 M). Some solvents capable of solubilizing aggregate-forming proteins, for example, SDS (sodium dodecyl sulfate), 70% formic acid, are for use in this method due to the possibility of irreversible denaturation of the proteins resulting from a lack of immunogenicity and / or activity accompanied, unsuitable. Although guanidine hydrochloride and similar agents are denaturants, this denaturation is not irreversible and renaturation may occur upon removal (eg, by dialysis) or dilution of the denaturant, allowing for the reformation of the immunologically and / or biologically active protein. Other suitable buffers are known to those skilled in the art. The BCA-GPCR is separated from other bacterial proteins by standard separation techniques, eg Ni-NTA agarose resin.

Alternatively, it is possible to purify the BCA-GPCR from bacterial periplasm. After lysis of the bacteria, when the BCA-GPCR is exported into the periplasm of the bacteria, the periplasmic portion of the bacteria can be isolated by cold osmotic shock in addition to other methods known to those skilled in the art. To isolate recombinant proteins from the periplasm, the bacterial cells are centrifuged to form a pellet. The pellet is resuspended in a buffer containing 20% sucrose. To lyse the cells, the bacteria are centrifuged and the pellet is resuspended in ice-cold 5 mM MgSO ₄ and kept in an ice bath for approximately 10 minutes. The cell suspension is centrifuged and the supernatant decanted and stored. The recombinant proteins present in the supernatant can be separated from the host proteins by standard separation techniques well known to those skilled in the art.

B. Standard protein separation method for cleaning BCA-GPCRs

Solubility fractionation

Often can as an initial step, especially if the protein mixture is complex is an initial salt fractionation many of the unwanted host cell proteins (or proteins derived from derived from the cell culture media) from the recombinant ones of interest Separate proteins. The preferred salt is ammonium sulfate. ammonium sulfate drops proteins by effectively reducing the amount of water in the protein mixture. The proteins precipitate then on the basis of their solubility out. The more hydrophobic a protein is, the more likely it is lower ammonium sulfate concentrations. A typical protocol comprises adding saturated Ammonium sulfate to a protein solution, So that the resulting ammonium sulfate concentration is between 20 and 30%. This concentration falls most hydrophobic proteins. The precipitation is then discarded (if the protein of interest is not hydrophobic) and ammonium sulfate becomes the supernatant in a known concentration added to the one of interest To precipitate protein. The precipitate is then solubilized in buffer and the excess salt either by dialysis or diafiltration, if necessary. Other methods based on solubility of proteins, e.g. cold ethanol precipitation, are Well-known and knowledgeable used to fractionate complex protein mixtures.

Size differential filtration

The Molecular weight of a BCA-GPCR can be used to remove it from Proteins with larger and larger smaller size below Use of ultrafiltration through membranes with different Pore size (for example Amicon or Millipore membranes) to isolate. As a first step, the protein mixture is replaced by a Ultrafiltered membrane with a pore size, which has a lower molecular weight limit than the molecular weight of the protein of interest. The filter residue of ultrafiltration is then ultrafiltered on a membrane with a molecular limit, which is bigger as the molecular weight of the protein of interest. The recombinant Protein goes through the membrane into the filtrate. The filtrate can then subjected to chromatography as described below.

Säulenchromatoaraphie

BCA-GPCRs can also be separated from other proteins based on their size, net surface charge, hydrophobicity, and affinity for ligands. In addition, antibodies raised against proteins can be conjugated to column matrices and the proteins can be immunopurified. All of these methods are well known in the art. It will be apparent to one skilled in the art that chromatography processes can be carried out on any scale and using equipment of many different types Manufacturers (eg Pharmacia Biotech) can be performed.

immunological Detection of BCA-GPCRs

In addition to Detection of BCA-GPCR genes and gene expression using the nucleic acid hybridization technology it is also possible to use immunoassays to detect BCA-GPCRs, e.g. around cells, e.g. Cancer cells, especially breast cancer cells, and Identify variants of BCA GPCRs. Immunoassays can be used to qualitatively or quantitatively analyze BCA-GPCRs. A general overview of the Applicable technology is in Harlow & Lane, Antibodies: A Laboratory Manual (1988).

A. Antibodies for BCA-GPCRs

method for generating polyclonal and monoclonal antibodies, the are specifically known to react with BCA-GPCRs, are known (see e.g. Coligan, Current Protocols in Immunology (1991); Harlow & Lane, above; Goding, Monoclonal Antibodies: Principles and Practice (2nd Ed. 1986); and Kohler & Milstein, Nature 256: 495-497 (1975). Such methods include antibody production by selection of antibodies from libraries of recombinant antibodies in phage or the like Vectors as well as the production of polyclonal and monoclonal antibodies by immunizing rabbits or mice (see, e.g., Huse et al. Science 246: 1275-1281 (1989); Ward et al., Nature 341: 544-546 (1989)). Such antibodies can be used for therapeutic and diagnostic applications, e.g. in the treatment and / or Detection of breast cancer.

A Number of BCA-GPCRs with immunogens can be used to make antibodies, which are specifically reactive with BCA-GPCRs. A recombinant BCA-GPCR or an antigenic fragment thereof is isolated, for example, as described herein. A recombinant protein may be present in eukaryotic or prokaryotic cells are expressed as described above, and purified as generally described above. A recombinant protein is the preferred immunogen for production of monoclonal or polyclonal antibodies. Alternatively, a synthetic peptide derived from the sequences disclosed herein is and with a carrier protein conjugated to be used as an immunogen. A naturally occurring one Protein can also be used either in pure or impure form. The product is then injected into an animal that is able to antibody to create. Either monoclonal or polyclonal antibodies can be used for subsequent Use in immunoassays to measure the protein produced.

method for the production of polyclonal antibodies are known to those skilled in the art. An inbred strain of mice (e.g., BALB / C mice) or rabbit is treated with the protein using a standard adjuvant such as. Friend's Aid and a standard immunization protocol immunized. The immune response of the animal to the immunogen preparation is monitored by taking test blood withdrawals and the titer of reactivity to the BCA-GPCR determined becomes. When suitably high titers of antibody of the immunogen are obtained Blood is collected from the animal and antisera are made. The further fractionation of the antisera for the enrichment of antibodies, the can be carried out against the protein, if desired (see Harlow & Lane, above).

monoclonal antibody can obtained by various methods that trusts professionals are. In short, spleen cells are produced by an animal that has a desired Antigen are immunized, usually immortalized by fusion with a myeloma cell (see Kohler & Milstein, Eur. J. Immunol. 6: 511-519 (1976)). Alternative methods of immortalization include Transformation with Epstein-Barr virus, oncogenes or retroviruses or other methods well known in the art. colonies which arise from individual immortalized cells are on the generation of antibodies with the desired specificity and affinity for the Antigen screened and the yield of monoclonal antibodies, the can be generated by such cells, by different methods be improved, including injection into the peritoneal cavity of a vertebrate host. Alternatively, one can use DNA sequences containing a monoclonal antibody or encode a binding fragment thereof by screening a DNA library of human B cells according to the general protocol, outlined by Huse et al., Science 246: 1275-1281 (1989), isolate.

Monoclonal antibodies and polyclonal sera are collected and titrated against the immunogen protein in an immunoassay, for example a solid phase immunoassay, with the immunogen fixed to a solid support. Typically, polyclonal antisera will have a titer of 10 ⁴ or greater and tested for cross-reactivity against non-BCA-GPCR proteins or even other related proteins from other organisms using a competitive binding immunoassay. Specific polyclonal antisera and monoclonal antibodies usually bind with a Ka of at least about 0.1 mM, more usually at least about 1 μM, optionally at least about 0.1 μM or better, and optionally 0.01 μM or better.

As soon as BCA-GPCR-specific antibodies to disposal can stand Through BCA-GPCRs a variety of immunoassay procedures are demonstrated. For a review of For immunological and immunoassay procedures, see Basic and Clinical Immunology (Stites & Terr Ed. 7th Ed. 1991). moreover can they Immunoassays of the present invention in any of several configurations be performed, in Enzyme Immunoassay (Maggio, ed., 1980); and Harlow & Lane, above, are extensively reviewed.

B. Immunological binding assays

BCA-GPCRs can using any of a number of well-recognized ones immunological binding tests detected and / or quantified See, for example, U.S. Patents 4,366,241; 4,376,110; 4,517,288; 4,837,168). For a review of general immunoassays see also Methods in Cell Biology: Antibodies in Cell Biology, Vol. 37 (Asai, ed., 1993); Basic and Clinical Immunology (Stites & Terr, Ed., 7th Ed. 1991). Immunological binding tests (or immunoassays) typically use an antibody specific to a Protein or antigen of choice (in this case the BCA-GPCR or an antigen subsequence thereof) binds. The antibody (e.g., anti-BCA-GPCR) can by any one of a number of means, the professionals good are known and prepared as described above.

immunoassays also use often a marker to be specific to the antibody and to bind the antigen-formed complex and mark it. The marking agent may itself be one of the components comprising the Antibody / antigen complex include. Thus, the label can be a labeled BCA-GPCR polypeptide or a labeled anti-BCA-GPCR antibody. Alternatively, you can the marker means a third portion, e.g. be a secondary antibody, which specifically binds to the antibody / BCA-GPCR complex secondary antibody is typically for antibody the species from which the first antibody is derived, specifically). Other proteins that are capable of maintaining constant immunoglobulin areas to bind specifically, e.g. Protein A or Protein G, too used as marking agents. These proteins have a strong non-immunogenic reactivity with constant immunoglobulin regions from a variety of species (see, e.g., Kronval et al., J. Biol. Immunol. 111: 1401-140.6 (1973); Akerstrom et al., J. Immunol. 135: 2589-2542 (1985)). The marker can be detected with a detectable fraction, e.g. a biotin modified that's another molecule can specifically bind, e.g. Streptavidin. A variety of detectable proportions are well known to those skilled in the art.

In all the tests can the incubation and / or washing steps after each combination of Reagents may be required. Incubation steps can be from about 5 seconds to several hours, optionally about 5 minutes until about 24 hours, vary. The incubation period, however, depends the test format, the antigen, the solution volume, the concentrations and the like. Usually The tests are carried out at ambient temperature, although they have one Range of temperatures, e.g. 10 ° C to 40 ° C, can be performed.

Noncompetitive test formats

immunoassays For detection of BCA-GPCRs in samples can be either competitive or be non-competitive. Non-competitive immunoassays are tests, in which the amount of antigen is measured directly. For example, in a preferred "sandwich" test the anti-BCA-GPCR antibodies be attached directly to a solid substrate on which it fixes are. These fixed antibodies then capture BCA-GPCRs present in the test sample. Of the so fixed BCA-GPCR is then replaced by a labeling agent, e.g. one second BCA-GPCR antibody, who wears a marker, bound. Alternatively, the second antibody may lack a marker, but it can in turn be bound by a labeled third antibody be that for antibody is specific to the species from which the second antibody derived is. The second or third antibody is typically used with a detectable fraction such as e.g. Biotin modified to the one another molecule specifically binds, e.g. Streptavidin to a detectable proportion provide.

Comitive test formats

In Competitive testing will determine the amount of BCA-GPCR present in the sample is present by measuring the amount of a known, added (exogenous) BCA-GPCR, that of the anti-BCA-GPCR antibody the unknown BCA-GPCR present in a sample displaced (by Competition) is measured indirectly. In a competitive test a known amount of BCA-GPCR is added to a sample and the sample is then contacted with an antibody which binds specifically to the BCA-GPCR. The amount of exogenous BCA-GPCR, the antibody is inversely proportional to the concentration of BCA-GPCR, which is present in the sample. In a particularly preferred embodiment becomes the antibody fixed on a solid substrate. The amount of BCA-GPCR attached the antibody can be bound either by measuring the amount of BCA-GPCR, which is present in a BCA-GPCR / antibody complex, or alternatively by measuring the amount of residual uncomplexed Protein be determined. The amount of BCA-GPCR can be provided by a labeled BCA-GPCR molecule detected become.

One Hapten inhibition test is another more preferred competitive Test. In this test, the known BCA-GPCR is attached to a solid Substrate fixed. A known amount of anti-BCA-GPCR antibody becomes Sample is added and the sample is then fixed with the BCA-GPCR brought into contact. The amount of anti-BCA-GPCR antibody that bound to the known fixed BCA-GPCR is to the amount BCA-GPCR present in the sample is inversely proportional. Again, the amount of antibody fixed can be detected by either the fixed fraction of the antibody or the fraction of the antibody, the in solution remains, grasped become. The detection can be direct when the antibody is labeled is, or be indirect by the subsequent addition of a labeled Portion which specifically binds to the antibody as above described.

crossreactivity

immunoassays in competitive binding format also for crossreactivity be used. A protein which is at least partially represented by SEQ ID NRN .: 2, 4, 5 and 8 can, for example, on a solid carrier be fixed. Proteins (e.g., BCA-GPCR proteins and homologs) added to the test, which fixed the binding of the antisera to the Antigen compete. The ability the added proteins to fix the binding of the antisera to the Competing protein is associated with the ability of BCA-GPCRs encoded by SEQ ID NO: 2, 4, 6 or 8, to compete with each other, compared. The percentage of cross-reactivity for the above proteins will be calculated using standard calculations. Those Antisera with less than 10% cross-reactivity with each of the above Listed added proteins are selected and collected. The cross-reacting antibody are optionally selected from the collected antisera by immunoabsorption with the added proteins considered, e.g. distantly related Homologues, removed.

The immunoabsorbed and collected antisera are then in a competitive binding immunoassay as described above, a second protein that is believed to be possibly is an allele or a polymorphic variant of a BCA-GPCR, with the immunogenic protein (i.e., the BCA-GPCR of SEQ ID NOs: 2, 4, 6 or 8). To perform this comparison, will be the two proteins each in a wide range of concentrations tested and the amount of each protein that is required to inhibit 50% of the binding of the antisera to the fixed protein, is determined. If the amount of second protein required is to inhibit 50% of the binding is less than 10 times the Amount of the protein encoding SEQ ID NO: 2, 4, 6 or 8 which is required to inhibit 50% of the binding, then The second protein is said to be specific to the polyclonal antibody binds that for a BCA-GPCR immunogen be generated.

Other test formats

Western blot (Immunoblot) analysis is used to detect the presence of BCA-GPCR to detect and quantify in the sample. The process generally includes the separation of sample proteins by gel electrophoresis on the Based on the molecular weight, transferring the separated proteins a suitable solid support (such as a nitrocellulose filter, a nylon filter or a derivatized nylon filter), and incubating the sample with the antibodies specifically bind BCA-GPCR. The anti-BCA-GPCR antibodies bind specifically to the BCA-GPCR on the solid support. These antibodies can be direct be marked or can alternatively afterwards using labeled antibodies (e.g., labeled sheep anti-mouse antibodies), which bind specifically to the anti-BCA-GPCR antibodies.

Other Test formats include liposome immunoassays (LIA) using liposomes, which are designed to deliver specific molecules (e.g., antibodies) bind and release encapsulated reagents or markers. The released chemicals are then detected according to standard procedures (see Monroe et al., Amer. Clin. Prod. Rev. 5: 34-41 (1986)).

reduction of non-specific binding

One Professional will recognize that it often he wishes is to minimize non-specific binding in immunoassays. Especially if the test involves an antigen or an antibody, that is fixed to a solid substrate, it is desirable that the Extent to minimize non-specific binding to the substrate. medium to reduce such non-specific binding are those skilled in the art well known. Typically, this process involves coating of the substrate having a proteinaceous composition. Especially protein compositions such as e.g. Bovine serum albumin (BSA), non-fat milk powder and gelatin extensively used, taking Milk powder is most preferred.

marker

The particular marker or group that is used in the assay is not a critical aspect of the invention as long as it does not significantly interfere with the specific binding of the antibody used in the assay. The detectable group may be any material having a detectable physical or chemical property. Such detectable markers have been well developed in the field of immunoassays, and in general, almost any marker useful in such methods can be applied to the present invention. Thus, a marker is any composition that is detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include magnetic beads (eg, DYNABEADS ^™ ), fluorescent dyes (eg, fluorescein isothiocyanate, Texas red, rhodamine, and the like), radiolabels (eg, ³ H, ¹²⁵ I, ³⁵ S, ¹⁴ C or ³² P), enzymes (eg Horseradish peroxidase, alkaline phosphatase, and others commonly used in an ELISA) and colorimetric markers such as colloidal gold or colored glass or plastic beads (eg, polystyrene, polypropylene, latex, etc.).

Of the Marker can be used directly or indirectly with the desired component of the test according to methods that are well known in the art. As above indicated, a wide variety of markers can be used the choice of marker being of the required sensitivity, easy conjugation with the compound, stability requirements, the available Instrumentation and Disposal arrangements depends.

Non-radioactive Markers become common attached by indirect means: In general, a ligand molecule (e.g., biotin) will covalently bind bound the molecule. The ligand then binds to other molecules (e.g., streptavidin) molecule that either inherently detectable or covalent to a signaling system e.g. a detectable enzyme, a fluorescent compound or a chemiluminescent compound is bound. The ligands and their goals can be in any suitable combination with antibodies that Recognize BCA GPCRs or secondary antibodies the anti-BCA GPCR recognize, be used.

The molecules can can also be directly conjugated to signal generation compounds, e.g. by conjugation with an enzyme or fluorophore. As a marker Enzymes of interest are mainly hydrolases, in particular Phosphatases, esterases and glycosidases, or oxidotases, in particular Peroxidases. Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone etc. Chemiluminescent compounds include luciferin and 2,3-dihydrophthalazinediones, e.g. Luminol. For a review of various Marking or signal generation systems that are used can, See U.S. Patent No. 4,391,904.

Means for detecting labels are well known to those skilled in the art. Thus, for example, if the label is a radioactive label, the detection means will comprise a scintillation counter or a photographic film as in autoradiography. If the label is a fluorescent label, it can be detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence can be detected visually by means of a photographic film through the use of electrical detectors such as charge-coupled devices (CCDs) or photomultipliers and the like. Likewise, enzymatic labels can be detected by providing the appropriate substrates for the enzyme and detecting the resulting reaction product. Finally, Kings Simple colorimetric markers can be detected simply by observing the color associated with the marker. Thus, in various dipstick tests, conjugated gold often appears pink, while various conjugated beads appear in the color of the bead.

Some Test formats do not require the use of labeled compounds. Agglutination tests can For example, be used to detect the presence of the target antibodies. In this case, antigen-coated particles are sampled with the target antibodies agglutinated. In this format, none of the components must be selected be and the presence of the target antibody is characterized by simple visual Investigation proved.

Tests for modulators of BCA GPCRs

A. Tests for BCA-GPCR activity

BCA-GPCRs and their alleles and polymorphic variants are G-protein coupled receptors that participate in signal transduction and are assigned to a region that is amplified in breast cancer cells. The activity of BCA-GPCR polypeptides can be determined using a variety of in vitro and in vivo assays to determine functional, chemical and physical effects, eg, measuring ligand binding (eg, binding of radioactive ligands), second Messengers (eg cAMP, cGMP, IP ₃ , DAG or Ca ²⁺ ), ion flux, phosphorylation levels, transcription levels, neurotransmitter levels and the like. Furthermore, such assays can be used to test for inhibitors and activators of BCA-GPCR. Modulators may also be genetically modified versions of a BCA-GPCR. Screening assays of the invention are used to identify modulators that can be used as a therapeutic of, for example, antibodies to BCA-GPCRs and antagonists of BCA-GPCR activity.

Of the BCA-GPCR of the assay is derived from a polypeptide having a sequence of SEQ ID NO: 2, 4, 6 or 8 or a conservatively modified Variant of it selected. Alternatively, the BCA-GPCR of the test is derived from a eukaryote and includes an amino acid subsequence with amino acid sequence identity SEQ ID NRN .: 1-2 or 7. Generally, the amino acid sequence identity is at least 70%, optionally at least 85%, optionally at least 90-95%. Optional comprises the polypeptide of the tests is a domain of a BCA-GPCR, e.g. an extracellular Domain, a transmembrane domain, a cytoplasmic domain, a ligand binding domain, a subunit connection domain, an active body and the like. Either a BCA-GPCR or a domain of which may be covalently linked to a heterologous protein, a chimeric one To produce protein used in the assays described herein becomes.

modulators the BCA-GPCR activity are tested using BCA-GPCR polypeptides as above described which are either recombinant or naturally occurring. The protein can be isolated, expressed in a cell, in one of a cell-derived membrane expressed in tissue or in a Animal expressed, either recombinant or naturally occurring. Breast cancer cells, normal prostate epithelial cells, placenta, testicular tissue, transformed cells or membranes may be used, for example become. The modulation is done using one of the herein tested in vitro or in vivo tests. Signal transduction may also be in vitro with reactions in the soluble or solid state using a chimeric molecule such as. an extracellular domain of a receptor covalent with a heterologous signal transduction domain or a heterologous extracellular domain, the covalently attached to the transmembrane and / or cytoplasmic domain of a Receptor is bound to be examined. Gene amplification can also be investigated. Furthermore, ligand binding domains of the protein of interest in vitro in reactions in the soluble or solid state used to target ligand binding testing.

The Ligand binding to BCA-GPCR, a domain or a chimeric protein can in solution, in a two-ply membrane attached to a solid phase is to be tested in a lipid monolayer or in vesicles. The binding of a modulator can be accomplished using e.g. amendments the spectroscopic properties (e.g., fluorescence, absorbance, refractive index), hydrodynamic (e.g., shape), chromatographic, or solubility characteristics be tested.

Receptor G protein interactions can also be studied. For example, the binding of the G protein to the receptor or its release from the receptor can be investigated. For example, in the absence of GTP, an activator results in the formation of a tight complex of G protein (all three subunits) with the receptor. This complex can be detected in a variety of ways, as indicated above. Such a test can be modified to look for inhibitors. Adding an activator to the receptor and G protein in the absence of GTP, forming a tight complex and then screening for inhibitors by looking at the dissociation of the receptor G protein complex. In the presence of GTP, the release of the alpha subunit of the G protein from the other two G protein subunits serves as a criterion for activation.

One activated or inhibited G protein in turn changes its properties the downstream lying effectors such. Proteins, enzymes and channels. The classical examples are the activation of cGMP phosphodiesterase by transducin in the visual system, adenylate cyclase by the stimulating G protein, Phospholipase C by Gq and other cognate G proteins and the modulation of different channels by Gi and other G proteins. Downstream consequences can also be examined, such. Production of diacylglycerol and IP3 by phospholipase C and again by calcium mobilization IP3.

Activated GPCR receptors become substrates for kinases that phosphorylate the C-terminus of the receptor (and possibly other sites as well). Thus, activators promote the transfer of ³² P of gamma-labeled GTP to the receptor, which can be tested with a scintillation counter. Phosphorylation of the C-terminal end promotes the binding of arrestin-like proteins and interferes with the binding of G-proteins. The kinase / arrestin pathway plays a key role in the desensitization of many GPCR receptors. For a general review of GPCR signal transduction and methods for testing signal transduction, see, for example, Methods in Enzymology, Volumes 237 and 238 (1994) and Volume 96 (1983); Bourne et al., Nature 10: 349: 117-27 (1991); Bourne et al., Nature 348: 125-32 (1990); Pitcher et al., Annu. Rev. Biochem. 67: 653-92 (1998).

rehearse or assays involving a potential BCA-GPCR inhibitor or Activator will be treated with control samples without the Test compound compared to investigate the extent of modulation. Control samples (untreated with activators or inhibitors) will a relative BCA-GPCR activity value of 100 assigned. The inhibition of a BCA-GPCR is achieved when the BCA-GPCR activity value about 90% relative to the control, optionally 50%, optionally 25-0%. Activation of a BCA-GPCR is achieved when the BCA-GPCR activity value is relative to control 110%, optionally 150%, 200-500% or 1000-2000%.

amendments of the ion flux can by determining changes the polarization (i.e., electrical potential) of the cell or membrane, the one BCA-GPCR expressed. A means of determining changes in the cellular Polarization is in measuring changes in the current (causing changes the polarization) with voltage limiting and patch clamp method, e.g. "at the cell mounted "mode," indoor-outdoor "mode, and mode the "whole cell" (see, for example, Ackerman et al., New Engl. J. Med. 336: 1575-1595 (1997)). Whole cell streams are expediently determined using standard methodology (see, e.g., Hamil et al., PFlugers. Archive. 391: 85 (1981). Other known tests include: Radiolabelled ion flux tests and fluorescence tests using voltage sensitive Dyes (see, e.g., Vestergarrd-Bogind et al., J. Membrane Biol. 88: 67-75 (1988); Gonzales & Tsien, Chem. Biol. 4: 269-277 (1997); Daniel et al., J. Pharmacol. Meth. 25: 185-193 (1991); Holevinsky et al., J. Membrane Biology 137: 59-70 (1994)). In general the compounds to be tested are in the range from 1 pM to 100 mM ago.

The effects of the test compounds on the function of the polypeptides can be measured by examining any of the parameters described above. Any suitable physiological change affecting GPCR activity can be used to assess the effect of a test compound on the polypeptides of this invention. If the functional consequences are determined using intact cells or animals, one can also measure a variety of effects, such as transmitter release, hormone release, transcriptional changes to both known and uncharacterized genetic markers (eg Northern blots), changes in cell metabolism such as Cell growth or pH changes, and changes in intracellular second messengers such as Ca ²⁺ , IP3 or cAMP.

Preferred assays for G-protein coupled receptors include cells loaded with ion or voltage sensitive dyes to report receptor activity. Assays for determining the activity of such receptors may also use known agonists and antagonists for other G protein-coupled receptors as negative or positive controls to evaluate the activity of compounds tested. In tests for the identification of modulating compounds (eg, agonists, antagonists), changes in the level of ions in the cytoplasm or membrane voltage are used an ion-sensitive or membrane voltage fluorescent indicator monitored. Among the ion-sensitive indicators and voltage probes that may be used are those disclosed in the 1997 Molecular Probes catalog. For G protein-coupled receptors, promiscuous G proteins such as Gα15 and Gα16 can be used in the test of choice (Wilkie et al., Proc Natl Acad Sci USA 88: 10049-10053 (1991)). Such promiscuous G-proteins allow the coupling of a broad range of receptors with signal transduction pathways in heterologous cells.

The Receptor activation typically directs subsequent intracellular events on, e.g. increased in second messengers such as e.g. IP3, the intracellular storage released by calcium ions. The activation of some G-protein coupled Receptors stimulates the formation of inositol triphosphate (IP3) by phospholipase C-mediated hydrolysis of phosphatidylinositol (Berridge & Irvine, Nature 312: 315-21 (1984)). In turn, IP3 stimulates the release of intracellular calcium ion stores. Thus, a change the cytoplasmic calcium ion mirror or a change the level of second messengers, e.g. IP3 can be used to the function of G protein-coupled To evaluate the receptor. Cells carrying such G protein-coupled receptors can express increased cytoplasmic calcium levels as a result of the contribution of both intracellular Save as well over Activation of ion channels in which case it is desirable, though not required may be such tests in calcium-free buffer, optionally with a chelating agent, e.g. EGTA is supplemented to perform the fluorescence reaction resulting from the calcium release of internal storage results, to distinguish.

Other Tests can determining the activity of receptors which, when activated, change the level of intracellular cyclic nucleotides, e.g. cAMP or cGMP, by activating the Inhibit downstream lying effectors such. Adenylate cyclase lead. There are cyclic ones Nucleotide gated ion channels, e.g. Rod photoreceptor cell channels and olfactory Neurons channels the for Cations are permeable to activation by binding cAMP or cGMP (See, e.g., Altenhofe et al., Proc Natl Acad Sci., USA 88: 9868-9872 (1991). and Dhallan et al., Nature 347: 184-187 (1990)). In cases, in which activates the receptor to lower the levels which leads to cyclic nucleotides, For example, it may be preferable to expose the cells to agents that intracellular Increase levels of cyclic nucleotides, e.g. Forskolin, before added a receptor activating compound in the assay to the cells becomes. Cells for this kind of test can by cotransfecting a host cell with DNA, one by one cyclic nucleotide gated ion channel encodes GPCR phosphatase and DNA encoding a receptor (e.g., certain glutamate receptors, Muscarinic acetylcholine receptors, dopamine receptors, serotonin receptors and the like) which, when activated, undergo a change cause in the mirror of cyclic nucleotides in the cytoplasm, getting produced.

In an embodiment can changes of the intracellular CAMP or cGMP can be measured using immunoassays. That in Offermanns & Simon, J. Biol. Chem. 270: 15175-15180 (1995) The method described can be used to measure the mirror of cAMP to determine. In Felley-Bosco et al., Am. J. Resp. Cell and Mol. Biol. 11: 159-164 (1994) can also be used to describe the To determine levels of cGMP. Furthermore, a test equipment for Measuring cAMP and / or cGMP in U.S. Patent 4,115,538 issued by the reference is incorporated herein.

In another embodiment, a phosphatidylinositol (PI) hydrolysis may be analyzed according to US Pat. No. 5,436,128, which is incorporated herein by reference. In short, the assay involves labeling cells with ³ H-myo-inositol for 48 or more h. The labeled cells are treated with a test compound for one hour. The treated cells are lysed and extracted into chloroform-methanol-water, after which the inositol phosphates are separated by ion exchange chromatography and quantitated by scintillation counting. Multiple stimulation is determined by calculating the ratio of cpm in the presence of agonist to cpm in the presence of buffer control. Similarly, multiple inhibition is determined by calculating the ratio of cpm in the presence of antagonist to cpm in the presence of buffer control (which may or may not contain an agonist).

In another embodiment, transcription levels can be measured to evaluate the effects of a test compound on signal transduction. A host cell containing the protein of interest is contacted with a test compound for a time sufficient to effect any interactions, and then the level of gene expression is measured. The amount of time to effect such interactions can be determined empirically, such as by the passage of time and measuring the level of transcription as a function of time. The amount of transcription can be measured using any method known to those skilled in the art. The For example, mRNA expression of the protein of interest can be detected using Northern blots, or their polypeptide products can be identified using immunoassays. Alternatively, transcription-based assays using a reporter gene may be used as described in U.S. Patent 5,436,128, which is incorporated herein by reference. The reporter genes may be, for example, chloramphenicol acetyltransferase, fire fly luciferase, bacterial luciferase, β-galactosidase and alkaline phosphatase. Further, the protein of interest may be used as an indirect reporter via attachment to a second reporter such as a green fluorescent protein (see, eg, Mistili & Spector, Nature Biotechnology 15: 961-964 (1997)).

The Amount of transcription is then compared with the amount of transcription either compared in the same cell in the absence of the test compound or she can deal with the amount of transcription in a substantially identical cell lacking the protein of interest compared become. A substantially identical cell can be of the same Cells from which the recombinant cell was made, the but not by insertion derived from heterologous DNA. Any Difference in the amount of transcription indicates that the test compound in a sense the activity changed the protein of interest Has.

B. modulators

The As modulators of compounds tested by BCA-GPCRs, a any small chemical compound or biological entity, e.g. a macromolecule such as. a protein, a sugar, a nucleic acid or a lipid. alternative can Modulators genetically modified Versions of a BCA GPCR be. Typically, test compounds are small chemical molecules and peptides. In essence, any chemical compound may be considered potential Modulator or ligand used in the tests of the invention, although most common Compounds that are in aqueous or organic (especially DMSO based) solutions can, be used. The tests are designed to be large chemical Libraries by automating the test steps and providing connections from any convenient source for the tests, which are typically parallel (e.g., in microtiter formats or microtiter plates in robotic tests). It's closed recognize that it There are many suppliers of chemical compounds, including Sigma (St. Louis, MO), Aldrich (St. Louis, MO), Sigma-Aldrich (St. Louis, MO), Fluka Chemika-Biochemica Analytika (Buchs Switzerland) and the like.

In a preferred embodiment High throughput screening methods involve providing a combinatorial chemical or peptide library containing a size Number of potential therapeutic compounds (potential Modulator or ligand compounds). Such "combinatorial chemical libraries" or "ligand libraries" are then in one or several tests as described herein to those screened Identify library members (especially chemical Species or subclasses) that exhibit a desired characteristic activity. The compounds thus identified may serve as conventional "lead compounds" or may themselves as potential or actual Therapeutics are used.

A combinatorial chemical library is a collection of different chemical compounds, either by chemical synthesis or biological synthesis, by combining a number of chemical "engineering blocks" such as e.g. reagents be generated. A linear combinatorial chemical library such as. For example, a polypeptide library is made by combining a set of chemical construction blocks (amino acids) in every possible one Way for a given connection length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical Connections can synthesized by such combinatorial mixing of chemical engineering blocks become.

The preparation and screening of combinatorial chemical libraries is well known to those skilled in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, for example, U.S. Patent 5,010,175, Furka, Int., J. Pept, Prot. Res., 37: 487-493 (1991), and Houghton et al., Nature 354 : 84-88 (1991)). Other chemistries for generating libraries of chemical diversity may also be used. Such chemistries include, but are not limited to: peptoids (eg, PCT Publication No. WO 91/19735), encoded peptides (eg, PCT Publication WO 93/20242), random bio-oligomers (eg, PCT Publication No. WO 92/00091 ), Benzodiazepines (eg, US Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines, and dipeptides (Hobbs et al., Proc. Nat. Acad Sci., USA 90: 6909-6913 (1993)), vinyl-like Polypeptides (Hagihara et al., J.Amer.Chem.Soc. 114: 6568 (1992)), non-peptidic peptide mimics with glucose backbone (Hirschmann et al., J. Amer. Chem. Soc. 114: 9217-9218 (1992)), analogous organic syntheses of libraries of small compounds (Chen et al., J. Amer. Chem. Soc. 116: 2661 (1994)), oligocarbamates (Cho et al., Science 261: 1303 (1993)) and / or peptidyl phosphonates (Campbell et al., J. Org. Chem. 59: 658 (1994)), nucleic acid libraries (see Ausubel, Berger and Sambrook, supra), peptide nucleic acid libraries (see, eg, US Patent 5,539,083), antibody libraries (See, for example, Vaughn et al., Nature Biotechnology, 14 (3): 309-314 (1996) and PCT / US96 / 10287), carbohydrate libraries (see, eg, Liang et al., Science, 274: 1520-1522 (1996) and U.S. Patent 5,593,853), libraries for small organic molecules (see, eg, benzodiazepines, Baum C & EN, Jan. 18, 33, 33), isoprenoids, U.S. Patent 5,569,588, thiazolidinones and metathiazanones, U.S. Patent 5,549,974 Pyrrolidines, U.S. Patents 5,525,735 and 5,519,134, morpholine compounds, U.S. Patent 5,506,337, Benzodiazoepine 5,288,514, and the like).

devices for the Preparation of combinatorial libraries are commercially available (see, e.g. 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, MA). Furthermore Many combinatorial libraries are themselves commercial available (see, e.g., ComGenex, Princeton, N.J., Tripos, Inc., St. Louis, MO, 3D Pharmaceuticals, Exton, PA, Martek Biosciences, Columbia, MD, etc.).

C. High Throughput Testing in the solid state and soluble

In an embodiment provides the invention soluble Tests using molecules such as. a domain such as. a ligand binding domain, an extracellular domain, a Transmembrane domain (e.g., one with seven transmembrane regions and cytosolic loops), the transmembrane domain and a cytoplasmic domain, an active site, a subunit connection area, etc .; a domain, which is covalently linked to a heterologous protein chimeric Molecule too produce; a BCA-GPCR; or a cell or tissue that / that expressing a BCA-GPCR that is either naturally occurring or recombinant is ready. In another embodiment, the invention In-vitro solid phase assay in a high throughput format ready, with the domain, the chimera Molecule, the BCA-GPCR or cell or tissue containing a BCA-GPCR expressed, attached to a solid phase substrate.

In the high throughput tests of the invention it is possible to to several thousand different modulators or ligands on one single day screen. In particular, each well of a microtiter plate used to make a separate test against a selected potential Perform modulator, or when concentration or incubation time effects are observed to be able to 5-10 each Troughs test a single modulator. Thus, a single Standard microtiter plate test about 100 (e.g., 96) modulators. If plates with 1536 wells are used, then a single plate can easily test about 100 to about 1500 different compounds. It is possible, to test several different plates per day; Test screens for up to about 6000-20000 different connections is using the integrated Systems of the invention possible.

The molecule of interest can be attached to the component in the solid state directly or indirectly via a covalent or non-covalent bond, e.g. via a marker, bound become. The marker can be any of a variety of components be. In general, a molecule that binds the marker (a marker binder) on a solid support and the labeled molecule of interest (e.g., the one of interest signal transduction) gets on the solid carrier attached by interaction of the marker and marker binder.

A Number of markers and marker binders can be known on the basis Molecular interactions, the are well described in the literature. If, for example a marker a natural binder has, for example, biotin, protein A or protein G, can he in conjunction with suitable marker binders (avidin, streptavidin, Neutravidin, the Fc region of an immunoglobulin, etc.) become. antibody for molecules with natural Binders such as e.g. Biotin are also widely available and suitable marker binders; see SIGMA Immunochemicals 1998 catalog Sigma, St. Louis MO).

Likewise, any hapten or antigenic compound may be used in combination with a suitable antibody to create a marker / marker binder pair. Thousands of specific antibodies are commercially available and many additional antibodies are described in the literature. For example, in one common configuration, the label is a first antibody and the marker binder is a second antibody that recognizes the first antibody. In addition to antibody-antigen interactions, receptor-ligand interactions are also suitable as marker and marker binder pairs. Agonists and Antago cell membrane receptors (eg, cell receptor-ligand interactions such as transferrin, c-kit, viral receptor ligands, cytokine receptors, chemokine receptors, interleukin receptors, immunoglobulin receptors and antibodies, the cadherin family, the integrin family, the selectin family, and the like, see, eg, Pigott & Power, The Adhesion Molecule Facts Book I (1993) Similarly, toxins and venomes, viarle epitopes, hormones (eg, opiates, steroids, etc.), intracellular receptors (eg, the effects of various small ligands, including steroids, thyroid hormone, retinoids, and vitamin D; peptides ), Drugs, lectins, sugars, nucleic acids (both linear and cyclic polymer configurations), oligosaccharides, proteins, phospholipids and antibodies all interact with different cell receptors.

synthetic Polymers such as, e.g. Polyurethanes, polyesters, polycarbonates, polyureas, Polyamides, polyethyleneimines, polyarylene sulfides, polysiloxanes, polyimides and polyacetates also form a suitable marker or marker binder. Many more Marker / marker binder pairs are also as described herein Test systems useful, as for a person skilled in the art upon review of this disclosure would.

Usual binders such as. Peptides, polyethers and the like can also serve as markers and include polypeptide sequences such as e.g. Polyglysequences between about 5 and 200 amino acids. Such flexible binders are known to those skilled in the art. Poly (ethylene glycol) -Binder are, for example, from Shearwater Polymers, Inc., Huntsville, Alabama, available. These binders optionally have amide bonds, sulfhydryl bonds or heterofunctional bonds.

marker ties are grown on solid substrates using any one of Variety of currently available fixed stationary methods. Solid substrates usually become derivatized or functionalized by all or part of the Substrate is exposed to a chemical reagent that is a chemical Group at the surface fixed, which is reactive with a part of the marker binder. Groups, for attachment to a longer Chain part would be suitable For example, include amines, hydroxyl, thiol and carboxyl groups. Aminoalkylsilanes and hydroxyalkylsilanes can be used to form a Variety of surfaces such as. glass surfaces to functionalize. The construction of such solid phase biopolymer assemblies is well described in the literature. See, e.g. Merrifield, J. At the. Chem. Soc. 85: 2149 to 2154 (1963) (which describes the solid phase synthesis of, e.g., peptides); Geysen et al., J. Immun. Meth. 102: 259-274 (1987) (which describes the synthesis of solid phase components on pins); Frank & Doring, Tetrahedron 44: 60316040 (1988) (which describes the synthesis of various peptide sequences on cellulose discs); Folder et al., Science, 251: 767-777 (1991); Sheldon et al., Clinical Chemistry 39 (4): 718-719 (1993); and Kozal et al. Nature Medicine 2 (7): 753759 (1996) (which covers all arrangements of biopolymers, which are fixed to solid substrates, describe). Non-chemical Methods for fixing marker binders to substrates include other common methods such as. Warmth, Crosslinking by UV radiation and the like.

D. Computer based tests

Yet another test for Compounds that modulate BCA-GPCR activity include computerized Drug design using a computer system a three-dimensional structure of BCA-GPCR on the basis of the structure information, by the amino acid sequence is encoded to generate. The entered amino acid sequence is directly and actively with a predetermined algorithm in a computer program interacting with secondary, tertiary and quaternary structural models of the protein. The models of protein structure become then examined to identify areas of the structure that the ability have, e.g. Bind ligands. These areas are then used to identify ligands that bind to the protein.

The three-dimensional structural model of the protein is generated by inputting protein amino acid sequences of at least 10 amino acid residues or corresponding nucleic acid sequences encoding a BCA-GPCR polypeptide into the computer system. The amino acid sequence of the polypeptide or nucleic acid encoding the polypeptide is selected from the group consisting of SEQ ID NOS: 1-8 and conservatively modified versions thereof. The amino acid sequence represents the primary or partial sequence of the protein encoding the structural information of the protein. At least 10 residues of the amino acid sequence (or a nucleotide sequence encoding 10 amino acids) are incorporated into the computer system of computer keyboards, machine readable carriers, electronic storage media (eg, magnetic disks, tapes, cassettes, and chips), optical media (eg, CD-ROM), information, which are distributed by Internet sites, and entered by a RAM. The three-dimensional structural model of the protein is then used by the interaction of the amino acid sequence and the computer system a software known to those skilled in the art.

The amino acid sequence represents a primary Structure that encodes the information needed to form the secondary, tertiary and quaternary Structure of the protein of interest is required. The software considers certain parameters by the primary sequence be encoded to produce the structural model. These parameters are referred to as "energy terms" and include mainly electrostatic potentials, hydrophobic potentials, for solvents accessible surfaces and hydrogen bonding. secondary Energy terms include van der Waals potentials. Form biological molecules the structure that minimizes the energy terms in a cumulative way. The computer program therefore uses these terms from the primary structure or amino acid sequence encoded to the secondary To create a structural model.

The tertiary Structure of the protein encoded by the secondary structure becomes then formed on the basis of the energy terms of the secondary structure. Of the User can enter additional variables at this point, such as whether the protein is bound to the membrane or soluble, his place in the body and its cellular Location, e.g. cytoplasmic, surface or nuclear. These variables together with the energy terms of the secondary structure are used around the model of tertiary Structure to form. When modeling the tertiary structure that compares Computer program hydrophobic surfaces the secondary structure with equal and hydrophilic surfaces the secondary Structure with same.

As soon as the structure has been generated will become potential ligand binding regions identified by the computer system. Three-dimensional structures for potential Ligands are made by entering amino acid or nucleotide sequences or chemical forms of compounds as above described. The three-dimensional structure of the potential ligand is then compared to that of the BCA-GPCR protein to form ligands to identify those that bind to BCA-GPCR. The binding affinity between The protein and ligands are synthesized using energy determined to determine which ligands have an increased probability for the Have binding to the protein.

Computer systems are also used to screen for mutations, polymorphic variants, alleles and interspecies homologs of BCA-GPCR genes. Such mutations may be associated with disease states or genetic engineering. As described above, GeneChip ^™ and the related technology can also be used to screen for mutations, polymorphic variants, alleles and interspecies homologs. Once the variants are identified, diagnostic tests can be used to identify patients with such mutated genes. The identification of the mutant BCA-GPCR genes involves receiving an input of a first nucleic acid or amino acid sequence encoding a BCA-GPCR selected from the group consisting of SEQ ID NOs: 1-8 and conservatively modified ones Versions of it. The sequence is entered into the computer system as described above. The first nucleic acid or amino acid sequence is then compared to a second nucleic acid or amino acid sequence that has a significant identity to the first sequence. The second sequence is entered into the computer system in the manner described above. Once the first and second sequences are compared, nucleotide or amino acid differences between the sequences are identified. Such sequences may represent allelic differences in BCA-GPCR genes and mutations associated with disease states and genetic engineering.

equipment

BCA-GPCRs and their homologues are a useful one Tool for identifying cells, e.g. Cancer cells for forensic medicine and paternity regulations, for the diagnosis of diseases such as Cancer, e.g. Breast cancer, and for the Investigation of signal transduction. BCA-GPCR-specific reagents that are specific hybridize with BCA-GPCR nucleic acids, such as. BCA-GPCR probes and primers, and BCA-GPCR specific reagents, which bind specifically to a BCA-GPCR protein, e.g. BCA-GPCR antibodies used to study signal transduction regulation.

Nucleic acid assays for the presence of BCA-GPCR DNA and RNA in a sample include numerous methods known to those skilled in the art, such as Southern analysis, Northern analysis, dot blots, RNase protection, S1 analysis, amplification methods such as PCR and LCR and in situ hybridization. In in situ hybridization, for example, the target nucleic acid is released from its cellular environment in that it is available for hybridization within the cell while preserving the cellular morphology for subsequent interpretation and analysis (see Example I). The following articles provide an overview of the art of in situ hybridization: Singer et al., Biotechniques 4: 230-250 (1986); Haase et al., Methods in Virology, Vol. VII, pp. 189-226 (1984), and Nucleic Acid Hybridization: A Practical Approach (Hames et al., Ed. 1987). In addition, a BCA-GPCR protein can be detected by the various immunoassay methods described above. The test sample is typically compared to both a positive control (eg, a sample expressing a recombinant BCA-GPCR) and a negative control.

The The present invention also provides equipment for screening for modulators ready by BCA GPCRs. Such equipments can be made from readily available Materials and reagents are produced. Such equipments can for example, any one or more of the following materials include: a BCA-GPCR, reaction tube and instructions for Testing BCA-GPCR activity. Optionally contains equipment biologically active BCA-GPCR. A wide variety of equipment and components can according to the present Invention in dependence from the intended user of the equipment and the special needs be produced by the user.

Administration and pharmaceutical compositions

BCA-GPCR modulators can directly to the mammalian subjects for modulation of signal transduction in vivo, e.g. for the treatment a cancer such as Breast cancer, administered. The administration happens by any of the ways that normally lead to the introduction of a Modulator compound in ultimate contact with the to be treated Tissues are used. The BCA GPCR modulators are in one administered in any suitable manner, optionally with pharmaceutical acceptable Carriers. Suitable methods for administering such modulators are to disposal and are well-known to professionals and, though used more than one way can be to administer a special composition a special way often provide a more immediate and effective response than another Path.

pharmaceutical compatible carrier are partly due to the special composition administered as well as by the special procedure used to administer the composition is used, determined. Consequently, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, 17th Ed., 1985)).

The BCA-GPCR modulators alone or in combination with other appropriate Components can to aerosol formulations (i.e., they can be "sputtered") to deliver via inhalation to be administered. Aerosol formulations can be put under pressure acceptable propellants, e.g. Dichlorodifluoromethane, propane, nitrogen and the like.

formulations suitable for administration include aqueous and non-aqueous Solutions, isotonic sterile solutions, the antioxidants, buffers, bacteriostats and solutes, which may make the formulation isotonic, and aqueous and non-aqueous sterile suspensions, suspending agents, solubilizers, compaction agents, Stabilizers and preservatives may include. In the practice of this invention the compositions, for example, orally, topically, intravenously, intraperitoneally, administered intravesically or intrathecally. Optionally the compositions administered orally or nasally. The formulations of connections in sealed unit dose or multi-dose containers such as e.g. Ampoules and vials be presented. solutions and suspension ethanol can from sterile powders, granules and tablets of the kind previously described. The Modulators can also administered as part of a prepared food or drug become.

The dose administered to a patient in the context of the present invention Invention should be sufficient to give a favorable response in the subject over the Time to effect. Such doses are prophylactic or to a Person already suffering from the disease. The compositions become administered to a patient in an amount sufficient to an effective protective or therapeutic response in the patient cause. An amount that is appropriate to accomplish this is as "therapeutic effective dose ". The dose is determined by the effectiveness of the special BCA-GPCR modulators (e.g., GPCR antagonists and anti-GPCR antibodies) that are used and the condition of the person as well as the body weight or the surface of the treating area certainly. The size of the dose is also affected by the existence, nature and extent of any Adverse adverse events that determine the administration of a special connection or a vector in a special person accompany.

at the determination of the effective amount of the modulator to be administered For example, a physician may report circulating plasma levels of the modulator, modulator toxicity, and evaluate the generation of anti-modulator antibodies. In general is the dose equivalent a modulator of about 1 ng / kg to 10 mg / kg for a typical person.

to Administration can the BCA-GPCR modulators of the present invention are administered at a rate are caused by the LD-50 of the modulator and the side effects of the inhibitor at various concentrations, such as on the mass and overall health of the patient is determined. The Administration can be over single or distributed doses are carried out.

EXAMPLES

The The following examples are for explanation only and not for limitation provided. Professionals will easily find a variety of non-critical Recognize parameters that changed or could be modified essentially similar To give results.

Example I: Identification and cloning new BCA GPCRs

Four human BCA-GPCRs were cloned and their nucleic acid sequences are provided in SEQ ID NO: 1, 3, 5 and 7. The derived ones amino acid sequences are provided in SEQ ID NOS: 2, 4, 6 and 8. The new BCA GPCRs were designated as BCA-GPCR-1, -2, -3 and -4, respectively.

These sequences can be amplified from cDNA or genomic DNA using standard PCR conditions using the following PCR primers:
ATGTTGGGGAACGTCGCCATC (SEQ ID NO: 9) and
TCATCCACAGAGCCTCCAGAT (SEQ ID NO: 10) (BCA-GPCR-1)
ATGGGAAAGGACAATCCAGTT (SEQ ID NO: 11) and
CTAAGAGAGTAACTCCAGCAA (SEQ ID NO: 12); (BCA-GPCR-2)
ATGGAAATAGCCAATGTGAGTTC (SEQ ID NO: 13) and
TAAATTTGCGCCAGCTTGCCTG (SEQ ID NO: 14); (BCA-GPCR-3)
and
ATGGTGAGACATACCAATGAGAG (SEQ ID NO: 15) and
CATAAATATTTACTCCCAGAGCC (SEQ ID NO: 16) (BCA-GPCR-4).

Example II: mRNA expression and gene amplification of BCA-GPCR-3 in breast cancer cells and tumors

Gene amplification of BCA-GPCR-3 in breast cancer cell lines and tumors was measured according to standard methodology (see 1 ).

BCA-GPCR-3 mRNA expression in breast cancer cell lines was assayed using PT-PCR according to the standard methodology (see 2 and 3 ). BCA-GPCR-3 mRNA levels were elevated in cancer cell lines from both amplified and non-amplified tumors, a hallmark of oncogenes.

BCA-GPCR-1 Nucleic Acid Sequence: SEQ ID NO: 1

BCA-GPCR-1 amino acid sequence: SEQ ID NO: 2

BCA-GPCR-2 Nucleic Acid Sequence: SEQ ID NO: 3

BCA-GPCR-2 amino acid sequence: SEQ ID NO: 4

BCA-GPCR-3 Nucleic Acid Sequence: SEQ ID NO: 5

BCA-GPCR-3 amino acid sequence: SEQ ID NO: 6

BCA-GPCR-4 Nucleic Acid Sequence: SEQ ID NO: 7

BCA-GPCR-4 amino acid sequence: SEQ ID NO: 8

Claims (27)

Isolated nucleic acid encoding a polypeptide being that by the nucleic acid encoded polypeptide more than 70% amino acid identity with an amino acid sequence comprising SEQ ID NO: 6, wherein the expression of the polypeptide in breast cancer cells and tumors compared to normal mammalian epithelial cells is regulated differentially. Isolated nucleic acid encoding a polypeptide being that by the nucleic acid coded polypeptide 90% or more amino acid identity with an amino acid sequence comprising SEQ ID NO: 6, wherein the expression of the polypeptide in breast cancer cells and tumors compared to normal mammalian epithelial cells is regulated differentially. Isolated nucleic acid according to claim 1 or 2, wherein the nucleic acid selectively with a nucleotide sequence of SEQ ID NO: 5 under stringent Hybridization conditions with 50% formamide, 5x SSC and 1% SDS at 42 ° C and wash conditions with 0.2x SSC and 0.1% SDS at 65 ° C hybridized. Isolated nucleic acid encoding a polypeptide with the amino acid sequence of SEQ ID NO: 6. Isolated nucleic acid with the nucleotide sequence of SEQ ID NO: 5. Isolated nucleic acid according to one of the preceding Claims, wherein the nucleic acid from a human, a mouse or a rat. An isolated nucleic acid according to any one of the preceding claims, wherein the nucleic acid is amplified by primers which hybridize under stringent hybridization conditions with the same sequence as a primer set of ATGGAAATAGCCAATGTGAGTTC (SEQ ID NO: 13) and TAAATTTGCGCCAGCTTGCCTG (SEQ ID NO .: 14) specifically hybridize. Isolated polypeptide, wherein the polypeptide is more as 70% amino acid sequence identity with the amino acid sequence comprising SEQ ID NO: 6, wherein the expression of the polypeptide in breast cancer cells and tumors compared to normal mammalian epithelial cells is regulated differentially. An isolated polypeptide according to claim 8 with 90% or more amino acid sequence identity with a amino acid sequence of SEQ ID NO: 6. Isolated polypeptide containing the amino acid sequence of SEQ ID NO: 6. An isolated polypeptide according to claim 8, 9 or 10, wherein the polypeptide is from a human, a rat or a Mouse is from. Antibody, which selectively binds to the polypeptide according to any one of claims 8 to 11 binds. Expression vector with the nucleic acid according to one of the claims 1 to 7. A host cell containing the vector of claim 13 is transfected. A method for detecting the presence of a GPCR3 nucleic acid or a polypeptide in a biological sample from a human Fabric, the process comprising the steps of: (i) isolating the biological sample, (ii) contacting the biological sample with a specific reagent that deals with a nucleic acid according to claim 5; or selectively linking a polypeptide of claim 10; and (Iii) Detecting the proportion of specific reagent that matches with the Sample connects selectively. The method of claim 15, wherein the specific Reagent selected from the group is, which consists of the following: specific antibodies, specific Oligonucleotide primers and specific nucleic acid probes. The method of claim 15 or claim 16, wherein the tissue is breast cancer tissue. A process for producing a polypeptide, wherein the method comprises the step of expressing the polypeptide from a recombinant expression vector according to claim 13. Process for producing a recombinant cell with a polypeptide, wherein the method comprises the step of transduction the cell comprises an expression vector comprising a nucleic acid, the a polypeptide encoded according to any one of claims 8 to 11. Isolated nucleic acid containing at least 100 adjacent Nucleotides of SEQ ID NO: 5 or of the complement of SEQ ID NO: 5 includes. The isolated nucleic acid of claim 20, wherein the nucleic acid at least 100 contiguous nucleotides of SEQ ID NO: 5 and comprises amplified a primer set of SEQ ID NO: 13 and SEQ ID NO: 14 is. Isolated nucleic acid encoding a polypeptide with the amino acid part sequence of SEQ ID NO: 6 encoded by a nucleic acid encoding amplified the primer set of SEQ ID NO: 13 and SEQ ID NO: 14 is. Vector with the nucleic acid according to any one of claims 20-22. Isolated host cell with the vector of claim 23rd Isolated polypeptide with at least 200 contiguous amino acids of SEQ ID NO: 6. Isolated polypeptide with the amino acid region of SEQ ID NO: 6 from the methionine residue at position 22 to Isoleucine residue in position 340. Antibody, which selectively binds to a polypeptide according to claim 25 or 26.