EP0833665A1 - Nukleinsäuren und ligander enthaltende zusammensetzungen zur therapeutische behandlung - Google Patents

Nukleinsäuren und ligander enthaltende zusammensetzungen zur therapeutische behandlung

Info

Publication number
EP0833665A1
EP0833665A1 EP96920274A EP96920274A EP0833665A1 EP 0833665 A1 EP0833665 A1 EP 0833665A1 EP 96920274 A EP96920274 A EP 96920274A EP 96920274 A EP96920274 A EP 96920274A EP 0833665 A1 EP0833665 A1 EP 0833665A1
Authority
EP
European Patent Office
Prior art keywords
receptor
nucleic acid
fgf
dna
binding domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96920274A
Other languages
English (en)
French (fr)
Inventor
Barbara A. Sosnowski
J. Andrew Baird
Lois A. Chandler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Selective Genetics Inc
Original Assignee
Selective Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Selective Genetics Inc filed Critical Selective Genetics Inc
Publication of EP0833665A1 publication Critical patent/EP0833665A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/168Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K41/00Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
    • A61K41/0042Photocleavage of drugs in vivo, e.g. cleavage of photolabile linkers in vivo by UV radiation for releasing the pharmacologically-active agent from the administered agent; photothrombosis or photoocclusion
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/642Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a cytokine, e.g. IL2, chemokine, growth factors or interferons being the inactive part of the conjugate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/50Fibroblast growth factor [FGF]
    • C07K14/503Fibroblast growth factor [FGF] basic FGF [bFGF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/04Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/55Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Definitions

  • the present invention relates generally to the treatment of diseases, and more specifically, to the preparation and use of complexes containing receptor-binding internalized ligands NABD and cytocide-encoding agents to alter the function, gene expression, or viability of a cell in a therapeutic manner.
  • a major goal of treatment of neoplastic diseases and hyperproliferative disorders is to ablate the abnormally growing cells while leaving normal cells untouched.
  • Various methods are under development for providing treatment, but none provide the requisite degree of specificity.
  • Immunotoxins and cytotoxins are protein conjugates of toxin molecules with either antibodies or factors which bind to receptors on target cells.
  • Three major problems may limit the usefulness of immunotoxins.
  • the antibodies may react with more than one cell surface molecule, thereby effecting delivery to multiple cell types, possibly including normal cells.
  • the antibody reactive molecule may be present on normal cells.
  • the toxin molecule may be toxic to cells prior to delivery and internalization. Cytotoxins suffer from similar disadvantages of specificity and toxicity.
  • Another limitation in the therapeutic use of immunotoxins and cytotoxins is the relatively low ratio of therapeutic to toxic dosage. Additionally, it may be difficult to direct sufficient concentrations of the toxin into the cytoplasm and intracellular compartments in which the agent can exert its desired activity.
  • cytotoxic therapy has been attempted using viral vectors to deliver DNA encoding the toxins into cells. If eukaryotic viruses are used, such as the retroviruses currently in use, they may recombine with host DNA to produce infectious virus. Moreover, because retro viral vectors are often inactivated by the complement system, use in vivo is limited. Retroviral vectors also lack specificity in delivery; receptors for most viral vectors are present on a large fraction, if not all, cells. Thus, infection with such a viral vector will infect normal as well as abnormal cells. Because of this general infection mechanism, it is not desirable for the viral vector to directly encode a cytotoxic molecule.
  • the present invention exploits the use of conjugates which have increased specificity and deliver higher amounts of nucleic acids to targeted cells, while providing other related advantages.
  • the present invention generally provides therapeutic compositions.
  • the composition has the formula: receptor-binding internalized ligand — nucleic acid binding domai — cytocide-encoding agent.
  • the receptor-binding internalized ligand is a polypeptide reactive with a cell surface receptor
  • the nucleic acid binding domain binds to a nucleic acid
  • the cytocide-encoding agent is a nucleic acid molecule encoding a cytocide and which binds to the nucleic acid binding domain
  • the composition binds to the cell surface receptor and internalizes the cytocide-encoding agent in cells bearing the receptor.
  • the composition has the formula: receptor-binding internalized ligand-nucleic acid binding comain-prodrug-encoding agent.
  • the receptor-binding internalized ligand is a polypeptide reactive with an FGF receptor, VEGF receptor, HBEGF receptor, or a cytokine.
  • the cytocide-encoding agent encodes a protein that inhibits protein synthesis and is preferably a ribosome inactivating protein, most preferably saporin.
  • the protein is gelonin or diphtheria toxin in other embodiments.
  • the prodrug-encoding agent encodes HSV-thymidine kinase.
  • the nucleic acid binding domain is poly-L-lysine in one embodiment.
  • the nucleic acid binding domain is a transcription factor selected from the group consisting of helix-turn-helix motif proteins, homeodomain proteins, zinc finger motif proteins, steroid receptor proteins, leucine zipper motif proteins, helix- loop-helix motif proteins, and ⁇ -sheet motif proteins.
  • the nucleic acid binding domain binds nonspecifically to nucleic acids and is selected from the group consisting of poly-L-lysine, protamine, histone and spermine.
  • the nucleic acid binding domain binds the coding region of a ribosome inactivating protein such as saporin.
  • FGF is conjugated to poly-L-lysine.
  • the cytocide-encoding agent contains a tissue-specific promoter, such as alpha-crystalline, gamma-crystalline, ⁇ -fetoprotein, CEA, prostate-specific antigen, erbB-2, tyrosinase, ⁇ -actin, c-myc, VEGF receptor, FGF receptor or cyclin D.
  • the composition also contains a linker.
  • the linker increases the flexibility of the conjugate and is (Gly m Ser p ) n , (Ala Ala Pro Ala) n , wherein n is 1 to 6, m is 1 to 6 and p is 1 to 4, or the linker is a disulfide bond.
  • the composition has the formula: receptor-binding internalized ligand-cytocide encoding agent-nucleic acid binding domain, wherein the receptor-binding internalized ligand is conjugated to the cytocide-encoding agent, which is bound to the nucleic acid binding domain to form a complex.
  • the invention provides methods for preventing excessive cell proliferation in the anterior eye following surgery, treating corneal clouding following excimer laser surgery, preventing closure of a trabeculectomy, preventing pterygii recurrence, treating hyperproliferative diseases in the back of the eye, such as macular degeneration, diabetic retinopathy and proliferative virtreal retinopathy, treating smooth muscle cell hyperplasia after a wound healing response to a procedure, e.g., vein grafting, endarterectomies and arterio venous shunts and treating cancer.
  • an effective amount of the compositions described above are administered.
  • Figure 1 is a photograph of an SDS-PAGE of FGF2-K152 under non- reducing (left) and reducing (right) conditions. Lane 1, FGF2-K152; lane 2, FGF2; lane 3, FGF2-K152: lane 4, FGF2.
  • the open arrow identifies material unable to enter the gel.
  • the closed arrow identifies a protein band corresponding to FGF2.
  • Figure 2 is a graph depicting the proliferation of bovine aortic endothelial cells in response to FGF2 (closed box) and FGF2-K152 (open circle) conjugate.
  • Figure 3 is a photograph of a gel showing the effects of various lengths of poly-L-lysine on the ability to interact with DNA.
  • Thirty-five ng of labeled DNA were added to increasing concentrations of either FGF2 or FGF2-K: lanes 1, 0 ng; lanes 2, 0.1 ng; lanes 3, 1 ng; lanes 4, 10 ng; lanes 5, 20 ng; lanes 6, 35 ng; lanes 7, 100 ng.
  • Panel A FGF2; panel B, FGF2-K152; panel C, FGF2-K13; panel D, FGF2- K84; panel E, EGF2-K267; panel F, FGF2-K39.
  • the lengths of the digested DNA are indicated.
  • Figure 4 is a chart depicting the activity of ⁇ -gal following transfection of FGF2/poly-L-lysine/DNA ⁇ -gal into COS cells.
  • the five bars, from left to right, are FGF2, FGF2-K13, FGF2- K39, FGF2-K84, and FGF2-K152.
  • Figure 5 are photographs of toroid format observed by electron microscopy. The upper panel shows an example of a toroid; the lower panel shows an incomplete toroid.
  • Figure 6 is a graph depicting proliferation of bovine aortic-endothelial cells.
  • cells were treated with FGF2-K152-DNA; in the lower panel, cells were treated with a mixture of FGF2, Kl 52, and DNA.
  • Figure 7A is a graph displaying ⁇ -gal activity after transfection of FGF2/poly-L-lysine/pSV ⁇ -gal into COS cells (lane 1), B16 cells (lane 2), NIH 3T3 cells (lane 3), and BHK cells (lane 4).
  • Figure 7B is a graph depicting ⁇ -gal expression in COS cells, pSV ⁇ -gal (lanes 1, 3) or pNASS ⁇ -gal (lanes 2, 4) were incubated with (lanes 1, 2) or without (lanes 3, 4) FGF2-K84 and the complexes incubated on COS cells for 48 hrs.
  • Figure 7C is a graph showing activity of ⁇ -gal activity at various times following transfection with either plasmid alone or with complexes of FGF2/K84/pSV ⁇ -gal. - ⁇ -, DNA alone; - ⁇ -, FGF2-K84-DNA.
  • Figure 7D is a graph showing ⁇ -gal activity after transfection of various concentrations of FGF2/K84/pSV ⁇ -gal. Lane 1, O ⁇ g; lane 2, 0,1 ⁇ g; lane 3, l ⁇ g; lane 4, 5 ⁇ g; lane 5, lO ⁇ g.
  • Figure 8A is a graph showing ⁇ -gal activity in COS cells following transfection of FGF2-K84- ⁇ SV ⁇ -gal (lane 1), FGF2+K84+pSV ⁇ -gal (lane 2), FGF2+pSV ⁇ -gal (lane 3), K84+pSV ⁇ -gal (lane 4); pSV ⁇ -gal (lane 5), FGF2-K84 (lane 6), FGF2 (lane 7) and K84 (lane 8).
  • Figure 8B is a graph showing completion for cell bindings.
  • Lane 1 FGF2-K84-pSV ⁇ -gal complex transfected into COS cells; lane 2, FGF2-K84-pSV ⁇ -gal plus 100 ⁇ g FGF2; lane 3, no complex.
  • Figure 8C is a graph showing the attenuation of ⁇ -gal activity upon the addition of heparin during transfection.
  • Figure 8D is a graph showing ligand targeting of DNA, pSV ⁇ -gal DNA alone (lane 1), FGF2-K84 (lane 2), histone H1-K84 (lane 3) and cytochrome C-K84 (lane 4) were condensed with pSV ⁇ -gal DNA and added to BHK cells, ⁇ -gal activity was measured 48 hr later.
  • Figure 9A is a graph showing the effect of chloroquine on ⁇ -gal expression, pSV ⁇ -gal and FGF2-K84 were mixed in the absence (lane 1) or presence (lane 2) of 100 ⁇ M chloroquine and incubated for 1 hr at room temperature prior to addition of the complexes to COS cells. Lane 3, chloroquine alone; lane 4, DNA alone.
  • Figure 9B is a graph showing the effect of endosome disruptive peptide on ⁇ -gal expression. Lane 1, control; lane 2, FGF2-K84-pSV ⁇ -gal; lane 3, FGF2-K84- pSV ⁇ -gal+EDP.
  • Figure 9C are photographs of cells stained for ⁇ -gal activity following transfection of COS cells with (right panel) or without (left panel) endosome disruptive peptide and FGF2-K84-pSV ⁇ -gal.
  • Figure 10 is a photograph of a fluorograph .analyzing cell-free translation products. Lane 1, no RNA; lane 2, saporin RNA; lane 3, luciferase RNA; lane 4, saporin RNA and luciferase RNA; lane 5, saporin RNA followed 30 min later with luciferase RNA.
  • Figure 11 is a graph depicting direct cytotoxicity of cells transfected by a CaPO 4 with an expression vector encoding saporin. Lane 1, mock transfection; lane 2, transfection with pSV ⁇ -gal; lane 3, transfection with saporin-containing vector.
  • Figure 12 is a pair of graphs showing cytotoxicity of cells transfected with FGF2-K84-pSVSAP. Left panel, BHK21 cells; right panel, NIH 3T3 cells. Lane 1, FGF2-K84-pSV ⁇ -gal; lane 2, FGF2-K84-pSVSAP.
  • Figure 13A is a graph showing ⁇ -gal activity with an endosome disruptive peptide in the complex.
  • Figure 13B is a graph showing ⁇ -gal activity with an endosome disruptive peptide in the complex.
  • Figure 13C is a graph showing ⁇ -gal activity with an endosome disruptive peptide in the complex.
  • amino acids which occur in the various amino acid sequences appearing herein, are identified according to their well known, three letter or one letter abbreviations.
  • nucleotides which occur in the various DNA fragments, are designated with the standard single letter designations used routinely in the art.
  • binding refers to the ability of a ligand to specifically recognize and detectably bind to such receptors, as assayed by standard in vitro assays.
  • binding measures the capacity of a VEGF conjugate, VEGF monomer, or VEGF dimer to recognize a VEGF receptor on a vascular endothelial cell, such as an aortic vascular endothelial cell line, using a procedure substantially as described in Moscatelli, J Cell Physiol. 757:123-130, 1987.
  • biological activity refers to the in vivo activities of a compound or physiological responses that result upon in vivo administration of a compound, composition or other mixture.
  • Biological activity thus encompasses therapeutic effects and pharmaceutical activity of such compounds, compositions and mixtures.
  • Such biological activity may be defined with reference to particular in vitro activities as measured in a defined assay.
  • reference herein to the biological activity of FGF, or fragments of FGF refers to the ability of FGF to bind to cells bearing FGF receptors and internalize a linked agent.
  • Such activity is typically assessed in vitro by linking the FGF to a cytotoxic agent, such as saporin, contacting cells bearing FGF receptors, such as fibroblasts, with the conjugate and assessing cell proliferation or growth.
  • In vivo activity may be determined using recognized animal models, such as the mouse xenograft model for anti -tumor activity (see, e.g., Beitz et al., Cancer Research 52:227-230, 1992; Houghton et al., Cancer Res. ⁇ 2:535-539, 1982; Bogden et al., Cancer (Philadelphia) 4-5:10-20, 1981; Hoogenhout et al., Int. J. Radiat. Oncol, Biol. Phys. 9:871-879, 1983; Stastny et al., Cancer Res. 55:5740-5744, 1993).
  • mouse xenograft model for anti -tumor activity see, e.g., Beitz et al., Cancer Research 52:227-230, 1992; Houghton et al., Cancer Res. ⁇ 2:535-539, 1982; Bogden et al., Cancer (Philadelphia)
  • biological activity of a cytocide- encoding agent refers to the ability of such agent to interfere with the metabolism of the cell by inhibiting protein synthesis.
  • biological or cytotoxic activity may be assayed by any method known to those of skill in the art including, but not limited to, in vitro assays that measure protein synthesis and in vivo assays that assess cytotoxicity by measuring the effect of a test compound on cell proliferation or on protein synthesis. Assays that assess cytotoxicity in targeted cells are particularly preferred.
  • conjugate refers to a molecule that contains at least one receptor-internalized binding ligand and at least one nucleic acid binding domain that are linked directly or via a linker and that are produced by chemical coupling methods or by recombinant expression of chimeric DNA molecules to produce fusion proteins.
  • a "cytocide-encoding agent” is a nucleic acid molecule that encodes a protein that inhibits protein synthesis. Such a protein may act by cleaving rRNA or ribonucloprotein, inhibiting an elongation factor, cleaving mRNA, or other mechanism that reduces protein synthesis to a level such that the cell cannot survive.
  • the cytocide-encoding agent may contain additional elements besides the cytocide gene. Such elements include a promoter, enhancer, splice sites, transcription terminator, poly(A) signal sequence, bacterial or mammalian origins of replication, selection markers, and the like.
  • cytotoxic agent refers to a molecule capable of inhibiting cell function.
  • the agent may inhibit proliferation or may be toxic to cells.
  • a variety of cytotoxic agents can be used and include those that inhibit protein synthesis and those that inhibit expression of certain genes essential for cellular growth or survival. Cytotoxic agents include those that result in cell death and those that inhibit cell growth, proliferation and/or differentiation.
  • cytotoxic agents include, but are not limited to, saporin, the ricins, abrin and other ribosome inactivating proteins (RIPs), aquatic-derived cytotoxins, Pseudomonas exotoxin, inhibitors of DNA, RNA or protein synthesis, such as antisense nucleic acids, other metabolic inhibitors, such as DNA cleaving molecules, prodrugs, such as thymidine kinase from HSV and bacterial cytosine deaminase, and light activated porphyrin.
  • Suitable RIPs include ricin, ricin A chain, maize RIP, gelonin, diphtheria toxin, diphtheria toxin A chain, trichosanthin, tritin, pokeweed antiviral protein (PAP), mirabilis antiviral protein (MAP), Dianthins 32 and 30, abrin, monordin, bryodin, shiga, a catalytic inhibitor of protein biosynthesis from cucumber seeds (see, e.g., WO 93/24620), Pseudomonas exotoxin, biologically active fragments of cytotoxins and others known to those of skill in this art.
  • Suitable cytotoxic agents also include cytotoxic molecules that inhibit cellular metabolic processes, including transcription, translation, biosynthetic or degradative pathways, DNA synthesis, and other such processes that kill cells or inhibit cell proliferation.
  • Heparin-binding growth factor refers to any member of a family of heparin-binding growth factor proteins, in which at least one member of the family binds heparin.
  • Preferred growth factors in this regard include FGF, VEGF, and HBEGF.
  • Such growth factors encompass isoforms, peptide fragments derived from a family member, splice variants, and single or multiple exons, some forms of which may not bind heparin.
  • hybridize under conditions of a specified stringency is used to describe the stability of hybrids formed between two single-stranded nucleic acid molecules.
  • Stringency of hybridization is typically expressed in conditions of ionic strength and temperature at which such hybrids are annealed and washed.
  • high, medium and low stringency encompass the following conditions or equivalent conditions thereto:
  • high stringency 0.1 x SSPE or SSC, 0.1% SDS, 65°C
  • medium stringency 0.2 x SSPE or SSC, 0.1% SDS, 50°C
  • NABD nucleic acid binding domain
  • the NABD may bind to single or double strands of RNA or DNA or mixed RNA DNA hybrids.
  • the nucleic acid binding domain may bind to a specific sequence or bind irrespective of the sequence.
  • nucleic acids refer to RNA or DNA that are intended for internalization into a cell and includes, but are not limited to, DNA encoding a therapeutic protein, DNA encoding a cytotoxic protein, DNA encoding a prodrug, DNA encoding a cytocide, the complement of these DNAs, an antisense nucleic acid and other such molecules.
  • Reference to nucleic acids includes duplex DNA, single-stranded DNA, RNA in any form, including triplex, duplex or single-stranded RNA, anti-sense RNA, polynucleotides, oligonucleotides, single nucleotides, chimeras, and derivatives thereof.
  • Nucleic acids may be composed of the well-known deoxyribonucleotides and ribonucleotides composed of the bases adenosine, cytosine, guanine, thymidine, and uridine. As well, various other nucleotide derivatives and non-phosphate backbones or phosphate-derivative backbones may be used.
  • PO oligonucleotides normal phosphodiester oligonucleotides
  • PO oligonucleotides are sensitive to DNA- and RNA-specific nucleases
  • several resistant types of oligonucleotides have been developed in which the phosphate group has been altered to a phosphotriester, methylphosphonate, or phosphorothioate (see U.S. Patent No. 5,218,088).
  • operative linkage or operative association of heterologous DNA to regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, refers to the functional relationship between such DNA and such sequences of nucleotides.
  • operative linkage of heterologous DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA in reading frame.
  • polypeptide reactive with .an FGF receptor refers to any polypeptide that specifically interacts with an FGF receptor, preferably the high-affinity FGF receptor and that is transported into the cell by virtue of its interaction with the FGF receptor.
  • Polypeptides reactive with an FGF receptor are also called FGF proteins.
  • Such polypeptides include, but are not limited to, FGF-1 to FGF- 9.
  • bFGF FGF-2 should be generally understood to refer to polypeptides having substantially the same amino acid sequences and receptor-targeting activity as that of bovine bFGF or human bFGF. It is understood that differences in amino acid sequences can occur among FGFs of different species as well as among FGFs from individual organisms or species.
  • a prodrug is a compound that metabolizes or otherwise converts an inactive, nontoxic compound to a biologically, pharmaceutically, therapeutically, of toxic active form of the compound.
  • a prodrug may also be a pharmaceutically inactive compound that is modified upon administration to yield an active compound through metabolic or other processes.
  • the prodrug may alter the metabolic stability or the transport characteristics of a drug, mask side effects or toxicity, improve or alter other characteristics or properties of a drug.
  • pharmacodynamic processes and drug metabolism in vivo those of skill in this art, once a pharmaceutically active compound is known, can design inactive forms of the compound (see, e.g., Nogrady, Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388-392, 1985).
  • receptor-binding internalized ligand refers to any peptide, polypeptide, protein or non-protein, such as a peptidomimetic, that is capable of binding to a cell-surface molecule and is internalized.
  • the receptor-binding internalized ligand is conjugated to a nucleic acid binding domain, either as a fusion protein or through chemical conjugation, and is used to deliver a cytocide-encoding or pro-drug encoding agent to a cell.
  • the ligand is directly conjugated to a nucleic acid molecule, which may be further complexed with a nucleic acid binding domain.
  • Such ligands include growth factors, cytokines, antibodies or fragments thereof, hormones, and the like.
  • SAP serum-derived neurotrophic factor
  • SAP refers to polypeptides that are isolated from the leaves or seeds of Saponaria officinalis, as well as modified forms that have amino acid substitutions, deletions, insertions or additions, which still express substantial ribosome inactivating activity. Purified preparations of saporin are frequently observed to include several molecular isoforms of the protein. It is understood that differences in amino acid sequences can occur in saporin from different species as well as between saporin molecules from individual organisms of the same species. Saporin for use herein may be purified from leaves, chemically synthesized, or synthesized by expression of DNA encoding a saporin polypeptide.
  • a targeted agent is a nucleic acid molecule that is intended for internalization by complexing or linkage to a receptor-binding internalized ligand, and nucleic acid binding domain, and that upon internalization in some manner alters or affects cellular metabolism, growth, activity, viability or other property or characteristic of the cell.
  • a "therapeutic nucleic acid” describes any nucleic acid molecule used in the context of the invention that modifies gene transcription or translation. This term also includes nucleic acids that bind to sites on proteins. It includes, but is not limited to, the following types of nucleic acids: nucleic acids encoding a protein, antisense RNA, DNA intended to form triplex molecules, extracellular protein binding oligonucleotides, and small nucleotide molecules.
  • a therapeutic nucleic acid may be used to effect genetic therapy by serving as a replacement for a defective gene, by encoding a therapeutic product, such as TNF, or by encoding a cytotoxic molecule, especially an enzyme, such as saporin.
  • the therapeutic nucleic acid may encode all or a portion of a gene, and may function by recombining with DNA already present in a cell, thereby replacing a defective portion of a gene. It may also encode a portion of a protein and exert its effect by virtue of co-suppression of a gene product.
  • the present invention provides cytocide-encoding agents complexed with a conjugate of a receptor-binding internalized ligand and a nucleic acid binding domain. Upon binding to an appropriate receptor, the complex is internalized by the cell and is trafficked through the cell via the endosomal compartment, where at least a portion of the complex may be cleaved.
  • receptor-binding internalized ligands are used to deliver a cytocide-encoding agent to a cell expressing an appropriate receptor on its cell surface.
  • Numerous molecules that bind specific receptors have been identified and are suitable for use in the present invention. Such molecules include growth factors, cytokines, and antibodies. Many growth factors and families of growth factors share structural and functional features and may be used in the present invention. One such family of growth factors specifically binds to heparin. The ability of heparin-binding growth factors to interact with heparin appears in general to be a reflection of a physiologically more relevant interaction occurring in vivo between these factors and heparin sulfate proteoglycan molecules, which are found on the surface of cells and in extracellular matrix.
  • Heparin-binding growth factors include the fibroblast growth factors FGF-1 through FGF-9, vascular endothelial growth factor (VEGF), and heparin binding-epidermal growth factor (HBEGF).
  • Antibodies that are specific to cell surface molecules expressed by a selected cell type are readily generated as monoclonals or polyclonal antisera. Many such antibodies are available (e.g., American Type Culture Collection, Rockville, MD).
  • Other growth factors such as PDGF (platelet-derived growth factor), EGF (epidermal growth factor), TGF- ⁇ (tumor growth factor), TGF- ⁇ , IGF-I (insulin-like growth factor), and IGF-II also bind to specific identified receptors on cell surfaces and may be used in the present invention.
  • Cytokines including interleukins, CSFs (colony stimulating factors), and interferons, have specific receptors, which are mostly found on hematopoeitic cells, and may be used as described herein. These ligands are discussed in more detail below.
  • Fragments of these ligands may be used within the present invention, so long as the fragment retains the ability to bind to the appropriate cell surface molecule. Likewise, ligands with substitutions or other alterations, but which retain binding ability, may also be used.
  • Fibroblast growth factors One family of growth factors that has a broad spectrum of activities is the fibroblast growth factor (FGF) family. These proteins share the ability to bind to heparin, induce intracellular receptor-mediated tyrosine phosphorylation and the expression of the c-fos mRNA transcript, and stimulate DNA synthesis and cell proliferation. This family of proteins includes FGFs designated FGF-1 (acidic FGF (aFGF)), FGF-2 (basic FGF (bFGF)), FGF-3 (int-2) (see, e.g., Moore et al., EMBO J.
  • FGF-1 acidic FGF
  • bFGF basic FGF
  • FGF-3 int-2
  • FGF-4 hst-1/K-FGF
  • FGF-5 see, e.g., U.S. Patent No.
  • FGF-6 hst-2
  • FGF-7 keratinocyte growth factor
  • FGF-8 see, e.g., Tanaka et al., Proc Natl. Acad. Sci. USA 59:8528-8532, 1992
  • FGF-9 see, Miyamoto et al., Mol. Cell. Biol. 75:4251-4259, 1993.
  • DNA encoding FGF peptides and/or the amino acid sequences of FGFs are known to those of skill in the art.
  • DNA encoding an FGF may be prepared synthetically based on a known amino acid or DNA sequence, isolated using methods known to those of skill in the art, or obtained from commercial or other sources.
  • DNA encoding virtually all of the FGF family of peptides is known.
  • DNA encoding human FGF-1 Jaye et al., Science 255:541-545, 1986; U.S. Patent No. 5,223,483
  • bovine FGF-2 Abraham et al., Science 255:545-548, 1986; Esch et al., Proc. Natl. Acad. Sci.
  • DNA encoding an FGF may be produced from any of the preceding DNA fragments by substitution of degenerate codons. It is understood that once the complete amino acid sequence of a peptide, such as an FGF peptide, and the DNA fragment encoding such peptide are available to those of skill in this art, it is routine to substitute degenerate codons and produce any of the possible DNA fragments that encode such peptide.
  • FGF refers to polypeptides having amino acid sequences of native FGF proteins, as well as modified sequences, having amino acid substitutions, deletions, insertions or additions in the native protein but retaining the ability to bind to FGF receptors and to be internalized. It is understood that differences in amino acid sequences can occur among FGFs of different species as well as among FGFs from individual organisms or species.
  • FGFs are intended to encompass proteins isolated from natural sources as well as those made synthetically, as by recombinant means or possibly by chemical synthesis.
  • FGF also encompasses muteins that possess the ability to bind to FGF-receptor expressing cells.
  • Such muteins include, but are not limited to, those produced by replacing one or more of the cysteines with serine as described herein or that have any other amino acids deleted or replaced as long as the resulting protein has the ability to bind to FGF-receptor bearing cells and internalize the linked targeted agent.
  • muteins will have conservative amino acid changes, such as those set forth below in Table 1.
  • DNA encoding such muteins will, unless modified by replacement of degenerate codons, hybridize under conditions of at least low stringency to native DNA sequence encoding the starting FGF.
  • Acidic and basic FGF are about 55% identical at the amino acid level and are highly conserved among species.
  • the other members of the FGF family have a high degree of amino acid sequence similarities and common physical and biological properties with FGF-1 and FGF-2, including the ability to bind to one or more FGF receptors.
  • Basic FGF, int-2, hst-1 K-FGF, FGF-5, hst-2/FGF-6 and FGF-8 may have oncogenic potential; bFGF is expressed in melanomas, int-2 is expressed in mammary tumor virus and hst-1/K-FGF is expressed in angiogenic tumors.
  • Acidic FGF, bFGF, KGF and FGF-9 are expressed in normal cells and tissues.
  • FGFs exhibit a mitogenic effect on a wide variety of mesenchymal, endocrine and neural cells and are also important in differentiation and development. Of particular interest is their stimulatory effect on collateral vascularization and angiogenesis. In some instances, FGF-induced mitogenic stimulation may be detrimental. For example, cell proliferation and angiogenesis are an integral aspect of tumor growth. Members of the FGF family, including bFGF, are thought to play a pathophysiological role, for example, in tumor development, rheumatoid arthritis, proliferative diabetic retinopathies and other complications of diabetes.
  • FGFs are mediated by high affinity receptor tyrosine kinases present on the cell surface of FGF-responsive cells (see, e.g., PCT WO 91/00916, WO 90/05522, PCT WO 92/12948; Imamura et al., Biochem. Biophys. Res. Comm. 755:583-590, 1988; Huang et al., J. Biol. Chem. 267:9568-9571, 1986; Partanen et al., EMBO J. 10:1347, 1991; and Moscatelli, J Cell. Physiol. 757:123, 1987). Lower affinity receptors also appear to play a role in mediating FGF activities.
  • the high affinity receptor proteins are single chain polypeptides with molecular weights ranging from 110 to 150 kD, depending on cell type that constitute a family of structurally related FGF receptors.
  • FGF receptor genes Four FGF receptor genes have been identified, and three of these genes generate multiple mRNA transcripts via alternative splicing of the primary transcript.
  • VEGFs Vascular endothelial growth factors
  • VEGF was originally isolated from a guinea pig heptocarcinoma cell line, line 10 (see, e.g., U.S. Patent No. 4,456,550), and has subsequently been identified in humans and in normal cells. It is expressed during normal development and in certain normal adult organs. Purified VEGF is a basic, heparin-binding, homodimeric glycoprotein that is heat-stable, acid-stable and may be inactivated by reducing agents.
  • DNA sequences encoding VEGF and methods to isolate these sequences may be found primarily in U.S. Patent No. 5,240,848, U.S. Patent No. 5,332,671, U.S. Patent No. 5,219,739, U.S. Patent No. 5,194,596, and Houch et al., Mol. Endocrin. 5:180, 1991.
  • "DNA encoding a VEGF peptide or polypeptide” refers to any of the DNA fragments set forth herein as coding such peptides, to any such DNA fragments known to those of skill in the art, any DNA fragment that encodes a VEGF that binds to a VEGF receptor and is internalized thereby.
  • VEGF DNA may be isolated from a human cell library, for example, using any of the preceding DNA fragments as a probe or any DNA fragment that encodes any of the VEGF peptides set forth in SEQ ID NOs. 1-4. It is understood that once the complete amino acid sequence of a peptide, such as a VEGF peptide, and the DNA fragment encoding such peptide are available to those of skill in this art, it is routine to substitute degenerate codons and produce any of the possible DNA fragments that encode such peptide. It is also generally possible to synthesize DNA encoding such peptide based on the amino acid sequence.
  • VEGF family members arise from a single gene organized as eight exons and spanning approximately 14 kb in the human genome.
  • Four molecular species of VEGF result from alternative splicing of mRNA and contain 121, 165, 189 and 206 amino acids. The four species have similar biological activities, but differ markedly in their secretion patterns.
  • the predominant isoform secreted by a variety of normal and transformed cells is VEGF 165 .
  • Transcripts encoding VEGF 121 and VEGF lg9 are detectable in most cells and tissues that express the VEGF gene.
  • VEGF 206 is less abundant and has been identified only in a human fetal liver cDNA library.
  • VEGF 121 is a weakly acidic polypeptide that lacks the heparin binding domain and, consequently, does not bind to heparin.
  • VEGF I89 and VEGF 206 are more basic than VEGF 165 and bind to heparin with greater affinity.
  • all isoforms are considered to be heparin-binding growth factors within the context of this invention.
  • the secreted isoforms, VEGF, 21 and VEGF 165 are preferred VEGF proteins.
  • VEGF vascular endothelial growth
  • VEGF vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • VEGF vascular endothelial growth factor
  • VEGF protein or fragment thereof bind the VEGF receptor and be internalized into the cell bearing the receptor.
  • VEGF it may be desirable in certain contexts for VEGF to manifest certain of its biological activities.
  • VEGF it would be desirable that VEGF exhibit vessel permeability activity and promotion of fibroblast migration and angiogenesis. It will be apparent from the teachings provided within the subject application which of the activities of VEGF are desirable to maintain.
  • VEGF promotes an array of responses in endothelium, including blood vessel hyperpermeability, endothelial cell growth, angiogenesis, and enhanced glucose transport.
  • VEGF stimulates the growth of endothelial cells from a variety of sources (including brain capillaries, fetal and adult aortas, and umbilical veins) at low concentrations, but is reported to have no effect on the growth of vascular smooth muscle cells, adrenal cortex cells, keratinocytes, lens epithelial cells, or BHK-21 fibroblasts.
  • VEGF also is a potent polypeptide regulator of blood vessel function; it causes a rapid but transient increase in microvascular permeability without causing endothelial cell damage or mast cell degranulation, and its action is not blocked by antihistamines. VEGF has also been reported to induce monocyte migration and activation and has been implicated as a tumor angiogenesis factor in some human gliomas. Also, VEGF is a chemoattractant for monocytes and VEGF has been shown to enhance the activity of the inflammatory mediator tumor necrosis factor (TNF).
  • TNF tumor necrosis factor
  • VEGF receptors Two tyrosine kinases have been identified as VEGF receptors.
  • the first known as fins-like tyrosine kinase or FLT is a receptor tyrosine kinase that is specific for VEGF.
  • FLT fins-like tyrosine kinase
  • expression of FLT mRNA is localized to the endothelium and to populations of cells that give rise to endothelium.
  • the second receptor, KDR (human kinase insert domain- containing receptor), and its mouse homologue FLK-1 are closely related to FLT.
  • the KDR FLK-1 receptor is expressed in endothelium during the fetal growth stage, during earlier embryonic development, and in adult tissues.
  • messenger RNA encoding FLT and KDR have been identified in tumor blood vessels and specifically by endothelial cells of blood vessels supplying glioblastomas.
  • FLT and KDR mRNAs are upregulated in tumor blood vessels in invasive human colon adenocarcinoma, but not in the blood vessels of adjacent normal tissues.
  • HBEGF heparin-binding EGF-like growth factor
  • HBEGFs exhibit a mitogenic effect on a wide variety of cells including BALB/c 3T3 fibroblast cells and smooth muscle cells, but unlike VEGFs, are not mitogenic for endothelial cells (Higashiyama et al., Science 257:936-939, 1991). HBEGF also has a stimulatory effect on collateral vascularization and angiogenesis. Members of the HBEGF family are thought to play a pathophysiological role, for example, in a variety of tumors, such as bladder carcinomas, breast tumors and non- small cell lung tumors. Thus, these cell types are likely candidates for delivery of cytocide-encoded agents.
  • HBEGF isolated from U-937 cells is heterogeneous in structure and contains at least 86 amino acids and two sites of O-linked glycosyl groups (Higashiyama et al., J. Biol. Chem. 267:6205-6212, 1992).
  • the carboxyl-terminal half of the secreted HBEGF shares approximately 35% sequence identity with human EGF, including six cysteines spaced in the pattern characteristic of members of the EGF protein family.
  • the amino-terminal portion of the mature factor is characterized by stretches of hydrophilic residues and has no structural equivalent in EGF.
  • Site-directed mutagenesis of HBEGF and studies with peptide fragments have indicated that the heparin-binding sequences of HBEGF reside primarily in a 21 amino acid stretch upstream of and slightly overlapping the EGF-like domain.
  • HBEGFs The effects of HBEGFs are mediated by EGF receptor tyrosine kinases expressed on cell surfaces of HBEGF-responsive cells (see, e.g., U.S. Patent Nos. 5,183,884 and 5,218,090; and Ullrich et al., Nature 509:4113-425, 1984).
  • the EGF receptor proteins which are single chain polypeptides with molecular weights 170 kD, constitute a family of structurally related EGF receptors.
  • Cells known to express the EGF receptors include smooth muscle cells, fibroblasts, keratinocytes, and numerous human cancer cell lines, such as the: A431 (epidermoid); KB3-1 (epidermoid); COLO 205 (colon); CRL 1739 (gastric); HEP G2 (hepatoma); LNCAP (prostate); MCF-7 (breast); MDA-MB-468 (breast); NCI 417D (lung); MG63 (osteosarcoma); U-251 (glioblastoma); D-54MB (glioma); and SW-13 (adrenal).
  • A431 epidermoid
  • KB3-1 epidermoid
  • COLO 205 colon
  • CRL 1739 gastric
  • HEP G2 hepatoma
  • LNCAP prostate
  • MCF-7 breast
  • MDA-MB-468 breast
  • NCI 417D lung
  • MG63 osteo
  • HBEGF need only bind a specific HBEGF receptor and be internalized. Any member of the HBEGF family, whether or not it binds heparin, is useful within the context of this invention as long as it meets the requirements set forth above. Members of the HBEGF family are those that have sufficient nucleotide identity to hybridize under normal stringency conditions (typically greater than 75% nucleotide identity). Subfragments or subportions of a full-length HBEGF may also be desirable. One skilled in the art may find from the teachings provided within that certain biological activities are more or less desirable, depending upon the application.
  • DNA encoding an HBEGF peptide or polypeptide refers to any DNA fragment encoding an HBEGF, as defined above.
  • Exemplary DNA fragments include: any such DNA fragments known to those of skill in the art; any DNA fragment that encodes an HBEGF or fragment that binds to an HBEGF receptor and is internalized thereby; and any DNA fragment that encodes any of the HBEGF polypeptides set forth in SEQ ID NOs. 5-8.
  • Such DNA sequences encoding HBEGF fragments are available from publicly accessible databases, such as: EMBL, GenBank (Accession Nos.
  • any DNA fragment that may be produced from any of the preceding DNA fragments by substitution of degenerate codons is also contemplated for use herein. It is understood that since the complete amino acid sequence of HBEGF polypeptides, and DNA fragments encoding such peptides, are available to those of skill in this art, it is routine to substitute degenerate codons and produce any of the possible DNA fragments that encode such HBEGF polypeptides. It is also generally possible to synthesize DNA encoding such peptides based on the amino acid sequence.
  • receptor-binding ligands may be used in the present invention. Any protein, polypeptide, analogue, or fragment that binds to a cell-surface receptor and is internalized may be used. In general, in addition to the specific heparin-binding growth factors discussed above, other growth factors and cytokines are especially well suited for use. These ligands may be produced by recombinant or other means in preparation for conjugation to the nucleic acid binding domain. The DNA sequences and methods to obtain the sequences of these receptor-binding internalized ligands are well known. For example, these ligands include CSF-1 (GenBank Accession Nos.
  • IGF-Ia Insulin-like growth factor la
  • IGF-Ib GenBank Accession No. X56774 S61860; Sandberg-Nordqvist et al., Brain Res. Mol. Brain Res. 72:275-277, 1992; Sandberg-Nordqvist, A.C., Cancer Res. 55:2475-2478, 1993); IGF-I (GenBank Accession No. X03563, M29644; Dull et al., Nature 570:771-781, 1984; Rail et al., Meth. Enzymol. 746:239-248, 1987); IGF-II (GenBank Accession No. J03242; Shen et al., Proc. Natl. Acad. Sci.
  • IL-l- ⁇ interleukin 1 alpha
  • IL-l- ⁇ interleukin 1 beta
  • IL-1 GenBank Accession No. K02770, M54933, M38756; Auron et al, Proc. Natl. Acad. Sci. USA 57:7907-791 1, 1984; Webb et al., Adv. Gene Technol. 22:339-340, 1985
  • IL-2 GenBank Accession No. A14844, A21785, X00695, X00200, X00201, X00202; Lupker et al., Patent No. EP 0307285-A, March 15, 1989; Perez et al., Patent No.
  • IL-5 GenBank Accession No. X04688, J03478; Azuma et al., Nucleic Acids Res. 74:9149- 9158, 1986; Tanabe et al., J. Biol. Chem. 262:16580-16584, 1987
  • IL-6 GenBank Accession No. Y00081, X04602, M54894, M38669, M14584; Yasukawa et al., EMBO J. 6:2939-2945, 1987; Hirano et al., Nature 524:73-76, 1986; Wong et al., Behring Inst. Mitt.
  • IL-7 GenBank Accession No. J04156; Goodwin et al., Proc. Natl. Acad. Sci. USA 56:302- 306, 1989
  • IL-8 GenBank Accession No. Zl 1686; Kusner et al., Kidney Int. 59:1240- 1248, 1991
  • IL-10 GenBank Accession No. X78437, M57627; Vieira et al, Proc. Natl. Acad. Sci. USA 55:1172-1176, 1991
  • IL-11 GenBank Accession No.
  • DNA sequences of other suitable receptor-binding internalized ligands may be obtained from GenBank or EMBL DNA databases, reverse- synthesized from protein sequence obtained from PIR database or isolated by standard methods (Sambrook et al., supra) from cDNA or genomic libraries.
  • ligands may be customized for a particular application. Means for modifying proteins is provided below. Briefly, additions, substitutions and deletions of amino acids may be produced by any commonly employed recombinant DNA method.
  • An amino acid residue of FGF, VEGF, HBEGF or other receptor- binding internalized ligand is non-essential if the polypeptide that has been modified by deletion of the residue possesses substantially the same ability to bind to its receptor and internalize a linked agent as the unmodified polypeptide.
  • any polypeptide or peptide analogue including peptidomimetics, that is reactive with an FGF receptor, a VEGF receptor, an HBEGF receptor, other growth factor receptor (e.g., PDGF receptor), cytokine receptor or other cell surface molecule including members of the families and fragments thereof, or constrained analogs of such peptides that bind to the receptor and internalize a linked targeted agent may be used in the context of this invention.
  • Members of the FGF peptide family including FGF-1 to FGF-9, are preferred.
  • Modified peptides, especially those lacking proliferative function, and chimeric peptides, which retain the specific binding and internalizing activities are also contemplated for use herein.
  • a modification that is effected substantially near the N-terminus of a polypeptide is generally effected within the first about ten residues of the protein.
  • Such modifications include the addition or deletion of residues, such as the addition of a cysteine to facilitate conjugation and form conjugates that contain a defined molar ratio, preferably a ratio of 1 : 1 of the polypeptides.
  • DNA encoding one of the receptor-binding internalized ligands discussed above may be mutagenized using standard methodologies to delete or replace any cysteine residues that are responsible for aggregate formation. If necessary, the identity of cysteine residues that contribute to aggregate formation may be determined empirically, by deleting and/or replacing a cysteine residue and ascertaining whether the resulting protein aggregates in solutions containing physiologically acceptable buffers and salts. In addition, fragments of these receptor-binding internalized ligands may be constructed and used. The binding region of many of these ligands have been delineated. Fragments may also be shown to bind and internalize by any one of the tests described herein.
  • Modification of the polypeptide may be effected by any means known to those of skill in this art.
  • the preferred methods herein rely on modification of DNA encoding the polypeptide and expression of the modified DNA.
  • DNA encoding the FGF polypeptide may be isolated, synthesized or obtained from commercial sources (the amino acid sequences of FGF-1 - FGF-9 are set forth in SEQ ID NOs. 10-18; DNA sequences may be based on these amino acid sequences or may be obtained from public DNA databases and references (see, e.g., GenBank, see also U.S. Patent No. 4,956,455, U.S. Patent No. 5,126,323, U.S. Patent No. 5,155,217, U.S. Patent No. 4,868,113, PCT Application WO 90/08771, EP Application 0 488 196 A2, and Miyamoto et al., Mol. Cell. Biol. 75:4251-4259, 1993).
  • GenBank see also U.S. Patent No. 4,956,455, U.S. Patent No. 5,126,323, U.S. Patent No. 5,155,217, U.S. Patent No. 4,868,113, PCT Application WO 90/08771, EP Application 0 4
  • DNA encoding any of the other receptor-binding internalized ligands may also be isolated, synthesized, or obtained from commercial sources.
  • DNA sequences are available in public databases, such as GenBank. Based on these sequences, oligonucleotide primers may be designed and used to amplify the gene from cDNA or mRNA by polymerase chain reaction technique as one means of obtaining DNA.
  • Mutations may be made by any method known to those of skill in the art, including site-specific or site-directed mutagenesis of DNA encoding the protein and the use of DNA amplification methods using primers to introduce and amplify alterations in the DNA template, such as PCR splicing by overlap extension (SOE).
  • Site-directed mutagenesis is typically effected using a phage vector that has single- and double-stranded forms, such as Ml 3 phage vectors, which are well-known and commercially available.
  • Other suitable vectors that contain a single-stranded phage origin of replication may be used (see, e.g., Veira et al., Meth. Enzymol. 15:3, 1987).
  • site-directed mutagenesis is performed by preparing a single-stranded vector that encodes the protein of interest (i.e., a member of the FGF family or a cytotoxic molecule, such as a saporin).
  • An oligonucleotide primer that contains the desired mutation within a region of homology to the DNA in the single-stranded vector is annealed to the vector followed by addition of a DNA polymerase, such as E. coli DNA polymerase I (Klenow fragment), which uses the double stranded region as a primer to produce a heteroduplex in which one strand encodes the altered sequence and the other the original sequence.
  • the heteroduplex is introduced into appropriate bacterial cells and clones that include the desired mutation are selected.
  • the resulting altered DNA molecules may be expressed recombinantly in appropriate host cells to produce the modified protein.
  • nucleic acid binding domains interact with the target nucleic acid either in a sequence-specific manner or a sequence-nonspecific manner.
  • the nucleic acid binding domain binds nucleic acid regardless of the sequence.
  • poly-L-lysine is a basic polypeptide that binds to oppositely charged DNA.
  • HTH helix-turn-helix
  • HHLH helix-loop-helix
  • ⁇ -sheets Other classes or subclasses may eventually be delineated as more factors are discovered and defined. Proteins from those classes or proteins that do not fit within one of these classes but bind nucleic acid in a sequence-specific manner, such as SV40 T antigen and p53 may also be used.
  • Helix-turn-helix proteins include the well studied ⁇ Cro protein, ⁇ cl, and E. coli CAP proteins (see Steitz et al., Proc. Natl. Acad. Sci. USA 79:3097-3100, 1982; Ohlendorf et al., J. Mol. Biol. 769:757-769, 1983).
  • the lac repressor Kerin et al., J. Mol. Biol. 752:179-182, 1985
  • Trp repressor Scheritz et al., Nature 577:782-786, 1985
  • Members of the homeodomain family include the Drosophila protein Antennapaedia (Qian et al., Cell.
  • Zinc finger proteins include TFIIIA (Miller et al., EMBO J. 4: 1609- 1614, 1985), Sp- 1 , zif 268, and many others (see generally Krizek et al., J. Am. Chem. Soc. 775:4518-4523, 1991).
  • Steroid receptor proteins include receptors for steroid hormones, retinoids, vitamin D, thyroid hormones, as well as other compounds. Specific examples include retinoic acid, knirps, progesterone, androgen, glucocosteroid and estrogen receptor proteins.
  • the leucine zipper family was defined by a heptad repeat of leucines over a region of 30 to 40 residues. Specific members of this family include C/ ⁇ BP, c-fos, c-jun, GCN4, sis-A, and CR ⁇ B (see generally O'Shea et al., Science 254:539-544, 1991).
  • the helix-loop- helix (HLH) family of proteins appears to have some similarities to the leucine zipper family.
  • Well-known members of this family include myoD (Weintraub et al., Science 257:761-766, 1991); c-myc; and AP-2 (Williams and Tijan, Science 257:1067-1071, 1991).
  • the ⁇ -sheet family uses an antiparallel ⁇ -sheet for DNA binding, rather than the more common ⁇ -helix.
  • the family contains the MeU (Phillips, Curr. Opin. Struc. Biol. 7:89-98, 1991), Arc (Breg et al., Nature 546:586-589, 1990) and Mnt repressors.
  • Other motifs are used for DNA binding, such as the cysteine-rich motif in yeast GAL4 repressor, and the GATA factor.
  • Viruses also contain gene products that bind specific sequences.
  • One of the most-studied such viral genes is the rev gene from HIV.
  • the rev gene product binds a sequence called RR ⁇ (rev responsive element) found in the env gene.
  • the inserted DNA sequences may be randomly generated or variants of a known DNA-binding domain. Generally, the inserts encode from 6 to 20 amino acids.
  • the peptide encoded by the inserted sequence is displayed on the surface of the bacteriophage. Bacteriophage expressing a desired nucleic acid- binding domain are selected for by binding to the cytocide-encoding agent. This target molecule may be single stranded or double stranded DNA or RNA.
  • the appropriate target is single-stranded.
  • the target molecule is preferably double-stranded.
  • the entire coding region of the cytocide-encoding agent is used as the target.
  • elements necessary for transcription that are included for in vivo or in vitro delivery may be present in the target DNA molecule. Bacteriophage that bind the target are recovered and propagated. Subsequent rounds of selection may be performed. The final selected bacteriophage are propagated and the DNA sequence of the insert is determined.
  • sufficient peptide for use herein as an nucleic acid binding domain may be made either by recombinant means or synthetically. Recombinant means is used when the receptor-binding internalized ligand/nucleic acid binding domain is produced as a fusion protein.
  • the peptide may be generated as a tandem array of two or more peptides, in order to maximize affinity or binding of multiple DNA molecules to a single polypeptide.
  • DNA-binding domain/peptide that recognizes the coding region of saporin is isolated.
  • DNA fragments encoding saporin may be isolated from a plasmid containing these sequences.
  • the plasmid FPFS1 contains the entire coding region of saporin. Digestion of the plasmid with Ncol and EcoRI restriction enzymes liberates the saporin specific sequence as a single fragment of approximately 780 bp. This fragment may be purified by any one of a number of methods, such as agarose gel electrophoresis and subsequent elution from the gel.
  • the saporin fragment is fixed to a solid support, such as in the wells of a 96-well plate.
  • a coating such as a positively charged molecule, may be used to promote D ⁇ A adherence.
  • the phage library is added to the wells and an incubation period allows for binding of the phage to the D ⁇ A. Unbound phage are removed by a wash, typically containing 10 mM Tris, 1 mM ⁇ DTA, and without salt or with a low salt concentration. Bound phage are eluted starting at a 0.1 M ⁇ aCl containing buffer. The ⁇ aCl concentration is increased in a step-wise fashion until all the phage are eluted. Typically, phage binding with higher affinity will only be released by higher salt concentrations.
  • Eluted phage are propagated in the bacteria host. Further rounds of selection may be performed to select for a few phage binding with high affinity. The D ⁇ A sequence of the insert in the binding phage is then determined. In addition, peptides having a higher affinity may be isolated by making variants of the insert sequence and subjecting these variants to further rounds of selection.
  • a cytocide-encoding agent is a nucleic acid molecule (D ⁇ A or R ⁇ A) that, upon internalization by a cell, and subsequent transcription (if D ⁇ A) and[/or] translation into a cytocidal agent, is cytotoxic to a cell or inhibits cell growth by inhibiting protein synthesis.
  • Cytocides include saporin, the ricins, abrin and other ribosome inactivating proteins, Pseudomonas exotoxin, diphtheria toxin, angiogenin, tritin, dianthins 32 and 30, momordin, pokeweed antiviral protein, mirabilis antiviral protein, bryodin, angiogenin, and shiga exotoxin, as well as other cytocides that are known to those of skill in the art.
  • cytocide gene products may be noncytotoxic but activate a compound, which is endogenously produced or exogenously applied, from a nontoxic form to a toxic product that inhibits protein synthesis.
  • DNA molecules that encode an enzyme that results in cell death or renders a cell susceptible to cell death upon the addition of another product.
  • saporin is an enzyme that cleaves rRNA and inhibits protein synthesis.
  • Other enzymes that inhibit protein synthesis are especially well suited for use in the present invention.
  • enzymes may be used where the enzyme activates a compound with little or no cytotoxicity into a toxic product that inhibits protein synthesis.
  • Ribosome-inactivating proteins which include ricin, abrin, and saporin, are plant proteins that catalytically inactivate eukaryotic ribosomes. Ribosome- inactivating proteins inactivate ribosomes by interfering with the protein elongation step of protein synthesis.
  • the ribosome-inactivating protein saporin hereinafter also referred to as SAP
  • SAP ribosome-inactivating protein saporin
  • a 4324 in 28S rRNA corresponds to A 2660 in E. coli 23 S rRNA.
  • ribosome inactivating proteins also appear to interfere with protein synthesis in prokaryotes, such as E. coli.
  • Saporin is preferred as a cytocide, but other suitable ribosome inactivating proteins (RIPs) and toxins may be used.
  • suitable RIPs include, but are not limited to, ricin, ricin A chain, maize ribosome inactivating protein, gelonin, diphtheria toxin, diphtheria toxin A chain, trichosanthin, tritin, pokeweed antiviral protein (PAP), mirabilis antiviral protein (MAP), Dianthins 32 and 30, abrin, monordin, bryodin, shiga (see, e.g., WO 93/24620) and others (see, e.g., Barbieri et al., Cancer Surveys 7:489-520, 1982, and European patent application No.
  • ribosome inactivating proteins such as abrin and ricin
  • Some ribosome inactivating proteins contain two constituent chains: a cell- binding chain that mediates binding to cell surface receptors and internalization of the molecule and a chain responsible for toxicity.
  • Single chain ribosome inactivating proteins such as the saporins, do not have a cell-binding chain. As a result, unless internalized, they are substantially less toxic to whole cells than the ribosome inactivating proteins that have two chains.
  • Saponaria officinalis Several structurally related ribosome inactivating proteins have been isolated from seeds and leaves of the plant Saponaria officinalis (soapwort) (GB Patent 2,194,241 B; GP Patent 2,216,891; EP Patent 89306016).
  • Saporin proteins for use in this invention have amino acid sequences found in the natural plant host Saponaria officinalis or modified sequences, having amino acid substitutions, deletions, insertions or additions, but which still express substantial ribosome inactivating activity. Purified preparations of saporin are frequently observed to include several molecular isoforms of the protein. It is understood that differences in amino acid sequences can occur in saporin from different species as well as between saporin molecules from individual organisms of the same species.
  • SO-6 is the most active and abundant, representing 7% of total seed proteins.
  • Saporin is very stable, has a high isoelectric point, does not contain carbohydrates, and is resistant to denaturing agents, such as sodium dodecyl sulfate (SDS), and a variety of proteases.
  • SDS sodium dodecyl sulfate
  • the amino acid sequences of several saporin-6 isoforms from seeds are known, and there appear to be families of saporin ribosome inactivating proteins differing in few amino acid residues. Any of these saporin proteins or modified proteins that are cytotoxic may be used in the present invention.
  • saporin polypeptides include other members of the multi-gene family coding for isoforms of saporin-type ribosome inactivating proteins including SO-1 and SO-3 (Fordham- Skelton et al., Mol. Gen. Genet. 227:134-138, 1990), SO-2 (see, e.g., U.S. Application Serial No. 07/885,242; GB 2,216,891; see also Fordham-Skelton et al., Mol. Gen. Genet. 229:460-466, 1991), SO-4 (see, e.g., GB 2,194,241 B; see also Lappi et al., Biochem. Biophys. Res. Commun. 129:934-942, 1985) and SO-5 (see, e.g., GB 2,194,241 B; see also Montecucchi et al., 7 «t. J. Peptide Protein Res. 55:263-267, 1989).
  • SO-1 and SO-3 Forms
  • the saporin polypeptides for use in this invention include any of the isoforms of saporin that may be isolated from Saponaria officinalis or related species or modified forms that retain cytotoxic activity.
  • modified saporin may be produced by modifying the DNA encoding the protein (see, e.g., International PCT Application Serial No. PCT/US93/05702, and United States Application Serial No. 07/901,718; see also U.S. Patent Application No. 07/885,242, and Italian Patent No. 1,231,914) by altering one or more amino acids or deleting or inserting one or more amino acids.
  • Any such protein, or portion thereof, that exhibits cytotoxicity in standard in vitro or in vivo assays within at least about an order of magnitude of the saporin conjugates described herein is contemplated for use herein.
  • the saporin DNA sequence contains mammalian-preferred codons (SEQ. ID NO. 79). Preferred codon usage as exemplified in Current Protocols in Molecular Biology, infra, and Zhang et al. (Gene 705:61, 1991) for mammals, yeast, Drosophila, E. coli, and primates is established for saporin sequence.
  • the cytocide-encoding agent such as saporin DNA sequence
  • the cytocide-encoding agent is introduced into a plasmid in operative linkage to an appropriate promoter for expression of polypeptides in the organism.
  • the presently preferred saporin proteins are SO-6 and SO-4.
  • the DNA can optionally include sequences, such as origins of replication that allow for the extrachromosomal maintenance of the saporin-containing plasmid, or can be designed to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host).
  • cytocides that inhibit protein synthesis are useful in the present invention.
  • the gene sequences for these cytocides may be isolated by standard methods, such as PCR, probe hybridization of genomic or cDNA libraries, antibody screenings of expression libraries, or clones may be obtained from commercial or other sources.
  • the DNA sequences of many of these cytocides are well known, including ricin A chain (GenBank Accession No. X02388); maize ribosome inactivating protein (GenBank Accession No. L26305); gelonin (GenBank Accession No. LI 2243; PCT Application WO 92/03155; U.S. Patent No. 5,376,546; diphtheria toxin (GenBank Accession No.
  • DNA molecules encoding these proteins may be synthesized, and preferably contain mammalian- preferred codons.
  • a nucleic acid molecule encoding a prodrug may alternatively be used within the context of the present invention.
  • Prodrugs are inactive in the host cell until either a substrate is provided or an activating molecule is provided. Most typically, a prodrug activates a compound with little or no cytotoxicity into a toxic product.
  • Two of the more often used prodrug molecules, both of which may be used in the present invention, are HSV thymidine kinase and E. coli cytosine deaminase.
  • gene products which either directly or indirectly activate a compound with little or no cytotoxicity into a toxic product may be utilized within the context of the present invention.
  • Representative examples of such gene products include HSVTK (herpes simplex virus thymidine kinase) and VZVTK (varicella zoster virus thymidine kinase), which selectively phosphorylate certain purine arabinosides and substituted pyrimidine compounds. Phosphoryation converts these compounds to metabolites that are cytotoxic or cytostatic.
  • ganciclovir for example, exposure of the drugs ganciclovir, acyclovir, or any of their analogues (e.g., FIAU, FIAC, DHPG) to cells expressing HSVTK allows conversion of the drug into its corresponding active nucleotide triphosphate form.
  • analogues e.g., FIAU, FIAC, DHPG
  • E. coli guanine phosphoribosyl transferase which converts thioxanthine into toxic thioxanthine monophosphate (Besnard et al., Mol. Cell. Biol.
  • alkaline phosphatase which converts inactive phosphorylated compounds such as mitomycin phosphate and doxorubicin-phosphate to toxic dephosphorylated compounds
  • fungal e.g., Fusarium oxysporum
  • bacterial cytosine deaminase which converts 5-fluorocytosine to the toxic compound 5-fluorouracil
  • carboxypeptidase G2 which cleaves glutamic acid from para-N-bis (2-chloroethyl) aminobenzoyl glutamic acid, thereby creating a toxic benzoic acid mustard
  • Penicillin-V amidase which converts phenoxyacetabide derivatives of doxorubicin and melphalan to toxic compounds (see generally, Vrudhula et al., J.
  • Herpesviridae thymidine kinases including both primate and non-primate he ⁇ esviruses, are suitable.
  • Such herpesviruses include He ⁇ es Simplex Virus Type 1 (McKnight et al., Nuc. Acids Res 5:5949-5964, 1980), He ⁇ es Simplex Virus Type 2 (Swain and Galloway, J Virol. 46:1045-1050, 1983), Varicella Zoster Virus (Davison and Scott, J. Gen. Virol.
  • thymidine kinase can phosphorylate nucleosides (e.g., dT) and nucleoside analogues such as ganciclovir (9- ⁇ [2-hydroxy-l-(hydroxymethyl)ethoxyl methyl ⁇ guanosine), famciclovir, buciclovir, penciclovir, valciclovir, acyclovir (9-[2-hydroxy ethoxy)methyl] guanosine), trifluorothymidine, l-[2-deoxy, 2-fluoro, beta-D-arabino furanosyl]-5-iodouracil, ara-A (adenosine arabinoside, vivarabine), 1-beta-D-arabinofuranoxyl thymine, 5-ethyl-2'- deoxyuridine, 5-iodo-5'-amino
  • nucleosides e.g., dT
  • the conjugates provided herein may also be used to deliver other types of nucleic acids to targeted cells.
  • nucleic acids include antisense RNA, antisense DNA, ribozymes, triplex-forming oligonucleotides, and oligonucleotides that bind proteins.
  • the nucleic acids can also include RNA trafficking signals, such as viral packaging sequences (see, e.g., Sullenger et al. (1994) Science 262:1566-1569).
  • the nucleic acids also include DNA molecules that encode proteins that replace defective genes, such as the gene associated with cystic fibrosis (see, e.g., PCT Application WO 93/03709, U.S. Application Serial No.
  • DNA molecules may encode tumor-specific cytotoxic molecules, such as tumor necrosis factor, viral antigens and other proteins to render a cell susceptible to anti-cancer agents.
  • Nucleic acids and oligonucleotides for use as described herein can be synthesized by any method known to those of skill in this art (see, e.g., WO 93/01286, U.S. Application Serial No. 07/723,454; U.S.. Patent No. 5,218,088; U.S. Patent No. 5,175,269; U.S. Patent No. 5,109,124).
  • Identification of oligonucleotides and ribozymes for use as antisense agents and DNA encoding genes for targeted delivery for genetic therapy involve methods well known in the art. For example, the desirable properties, lengths and other characteristics of such oligonucleotides are well known.
  • Antisense oligonucleotides are typically designed to resist degradation by endogenous nucleolytic enzymes and include, but are not limited to: phosphorothioate, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and other such linkages (see, e.g., Agrwal et al., Tetrehedron Lett. 25:3539-3542 (1987); Miller et al., J. Am. Chem. Soc. 95:6657-6665 (1971); Stec et al., Tetrehedron Lett. 26:2191-2194 (1985); Moody et al., Nucl.
  • Antisense nucleotides are oligonucleotides that bind in a sequence- specific manner to nucleic acids, such as mRNA or DNA. When bound to mRNA that has complementary sequences, antisense prevents translation of the mRNA (see, e.g., U.S. Patent No. 5,168,053 to Altman et al.; U.S. Patent No. 5,190,931 to Inouye, U.S. Patent No. 5,135,917 to Burch; U.S. Patent No. 5,087,617 to Smith and Clusel et al. (1993) Nucl. Acids Res. 27:3405-3411, which describes dumbbell antisense oligonucleotides).
  • Triplex molecules refer to single DNA strands that bind duplex DNA forming a colinear triplex molecule and thereby prevent transcription (see, e.g., U.S. Patent No. 5,176,996 to Hogan et al., which describes methods for making synthetic oligonucleotides that bind to target sites on duplex DNA).
  • Particularly useful antisense nucleotides and triplex molecules are molecules that are complementary or bind to the sense strand of DNA or mRNA that encodes an oncogene, such as bFGF, int-2, hst-1/K-FGF, FGF-5, hst-2/FGF-6, FGF-8.
  • an oncogene such as bFGF, int-2, hst-1/K-FGF, FGF-5, hst-2/FGF-6, FGF-8.
  • Other useful antisense oligonucleotides include those that are specific for IL-8 (see, e.g., U.S. Patent No.
  • a ribozyme is an RNA molecule that specifically cleaves RNA substrates, such mRNA, .and thus inhibits or interferes with cell growth or expression.
  • RNA substrates such mRNA
  • Ribozymes can be targeted to any RNA transcript and can catalytically cleave such transcript (see, e.g., U.S. Patent No. 5,272,262; U.S. Patent No. 5,144,019; and U.S. Patent Nos. 5,168,053, 5,180,818, 5,116,742 and 5,093,246 to Cech et al., which described ribozymes and methods for production thereof).
  • Any such ribosome may be linked to the growth factor for delivery to a cell bearing a receptor for a receptor-internalized binding ligand.
  • the ribozymes may be delivered to the targeted cells by DNA encoding the ribozyme linked to a eukaryotic promoter, such as a eukaryotic viral promoter, such that upon introduction into the nucleus, the ribozyme will be directly transcribed.
  • a eukaryotic promoter such as a eukaryotic viral promoter
  • the construct will also include a nuclear translocation sequence, generally as part of the ligand or as part of a linker between the ligand and nucleic acid binding domain.
  • DNA that encodes a therapeutic product contemplated for use includes DNA encoding correct copies of defective genes, such as the defective gene (CFTR) associated with cystic fibrosis (see, e.g., International Application WO 93/03709, U.S. Application Serial No. 07/745,900; and Riordan et al. (1989) Science 245:1066-1073), and anticancer agents, such as tumor necrosis factors.
  • the conjugate preferably includes an NTS. If the conjugate is designed such that the ligand and nucleic acid binding domain are cleaved in the cytoplasm, then the NTS should be included in a portion of the conjugate or linker that remains bound to the DNA.
  • the nuclear translocation sequence (NTS) may be a heterologous sequence or a may be derived from the selected growth factor.
  • F. Construct containing cytocidal-encoding agent In the case of cytotocide molecules such as the ribosome inactivating proteins, very few molecules may need to be expressed to effect cell killing. Indeed, only a single molecule of diphtheria toxoid introduced into a cell was sufficient to kill the cell. With other cytocides or prodrugs, it may be that propagation or stable maintenance of the construct is necessary to attain a sufficient amount or concentration of the gene product for effective gene therapy. Examples of replicating and stable eukaryotic plasmids may be found in the scientific literature.
  • constructs will also contain elements necessary for transcription and translation. If the cytocide-encoding agent is DNA, then it must contain a promoter.
  • the choice of the promoter will depend upon the cell type to be transformed and the degree or type of control desired. Promoters can be constitutive or active in any cell type, tissue specific, cell specific, event specific temporal-specific or inducible. Cell-type specific promoters and event type specific promoters are preferred. Examples of constitutive or nonspecific promoters include the SV40 early promoter (U.S. Patent No. 5,118,627), the SV40 late promoter (U.S. Patent No. 5,118,627), CMV early gene promoter (U.S. Patent No. 5,168,062), and adenovirus promoter.
  • cellular promoters are also amenable within the context of this invention.
  • cellular promoters for the so-called housekeeping genes are useful.
  • Viral promoters are preferred, because generally they are stronger promoters than cellular promoters.
  • Tissue specific promoters are particularly useful when a certain tissue type is to be targeted for transformation. By using one of this class of promoters, an extra margin of specificity can be attained.
  • the indication to be treated is ophthalmological (e.g., secondary lens clouding)
  • either the alpha-crystalline promoter or gamma-crystalline promoter is preferred.
  • cellular promoters for specific tumor markers or promoters more active in tumor cells should be chosen.
  • the prostate-specific antigen promoter is especially useful.
  • the tyrosinase promoter or tyrosinase- related protein promoter is a preferred promoter for melanoma treatment.
  • the VEGF receptor promoter is preferred.
  • the VEGF receptor is expressed in developing capillaries.
  • the promoter from heat shock protein 27 is preferred; for treatment of colon or lung cancer, the promoter from carcinoembryonic antigen is preferred; for treatment of restenosis or other diseases involving smooth muscle cells, the promoter from ⁇ -actin or myosin heavy chain is preferred.
  • tissue specific promoters For B lymphocytes, the immunoglobulin variable region gene promoter; for T lymphocytes, the TCR receptor variable region promoter; for helper T lymphocytes, the CD4 promoter; for liver, the albumin or ⁇ -fetoprotein promoter, are a few additional examples of tissue specific promoters. Many other examples of tissue specific promoters are readily available to one skilled in the art. Some of these promoters are temporally regulated, such as c-myc and cyclin D. Inducible promoters may also be used. These promoters include the
  • MMTV LTR PCT WO 91/13160
  • dexamethasone metallothionein
  • promoters with cAMP response elements which are inducible by cAMP.
  • Event-type specific promoters are active or up-regulated only upon the occurrence of an event, such as tumorigenecity or viral infection.
  • the HIV LTR is a well known example of an event-specific promoter.
  • the promoter is inactive unless the tat gene product is present, which occurs upon viral infection.
  • Another promoter is c-myc.
  • promoters that are coordinately regulated with a particular cellular gene may be used.
  • promoters of genes that are coordinately expressed when a particular FGF receptor gene is expressed may be used. Then, the nucleic acid will be transcribed when the FGF receptor, such as FGFRl, is expressed, and not when FGFR2 is expressed.
  • This type of promoter is especially useful when one knows the pattern of FGF receptor expression in a particular tissue, so that specific cells within that tissue may be killed upon transcription of a cytotoxic agent gene without affecting the surrounding tissues. If the domain binds in a sequence specific manner, the construct must contain the sequence that binds to the nucleic acid binding domain.
  • the target nucleotide sequence may be contained within the coding region of the cytocide, in which case, no additional sequence need be inco ⁇ orated. Additionally, it may be desirable to have multiple copies of target sequence. If the target sequence is coding sequence, the additional copies must be located in non-coding regions of the cytocide-encoding agent.
  • the target sequences of the nucleic acid binding domains are typically generally known. If unknown, the target sequence may be readily determined. Techniques are generally available for establishing the target sequence (e.g., see PCT Application WO 92/05285 and U.S. Serial No. 586,769).
  • NTS nuclear translocation or targeting sequence
  • Table 2 Examples of NTSs are set forth in Table 2 below. Comparison with known NTSs, and if necessary testing of candidate sequences, should permit those of skill in the art to readily identify other amino acid sequences that function as NTSs.
  • a heterologous NTS refers to an NTS that is different from the NTS that occurs in the wild-type peptide, polypeptide, or protein.
  • the NTS may be derived from another polypeptide, it may be synthesized, or it may be derived from another region in the same polypeptide.
  • the conjugate In order to deliver the nucleic acid to the nucleus, the conjugate should include an NTS. If the conjugate is designed such that the receptor-binding internalized ligand and linked nucleic acid binding domain is cleaved or dissociated in the cytoplasm, then the NTS should be included in a portion of the complex that remains bound to the nucleic acid, so that, upon internalization, the conjugate will be trafficked to the nucleus. Thus, the NTS is preferably included in the nucleic acid binding domain, but may additionally be included in the ligand. An NTS is preferred if the cytocide-encoding agent is DNA. If the cytocide-encoding agent is mRNA, an NTS may be omitted.
  • the nuclear translocation sequence may be a heterologous sequence or a may be derived from the selected growth factor. All presently identified members of the FGF family of peptides contain an NTS (see, e.g., International Application WO 91/15229 and Table 2).
  • a typical consensus NTS sequence contains an amino-terminal proline or glycine followed by at least three basic residues in a array of seven to nine amino acids (see, e.g., Dang et al., J. Biol. Chem. 264:18019-18023, 1989; Dang et al., Mol. Cell. Biol 5:4049-4058, 1988, and Table 2).
  • Cytoplasm-translocation signal sequence is a sequence of amino acids in a protein that cause retention of proteins in the lumen of the endoplasmic reticulum and/or translocate proteins to the cytosol.
  • the signal sequence in mammalian cells is KDEL (Lys-Asp-Glu-Leu) (SEQ ID NO. 42) (Munro and Pelham, Cell 45:899-907, 1987). Some modifications of this sequence have been made without loss of activity. For example, the sequences RDEL (Arg-Asp-Glu-Leu) (SEQ ID NO. 43) and KEEL (Lys-Glu-Glu-Leu) (SEQ ID NO. 44) confer efficient or partial retention, respectively, in plants (Denecke et al., Embo. J. 77:2345-2355, 1992).
  • a cytoplasm-translocation signal sequence may be included in either the receptor-internalized binding ligand or the nucleic acid binding domain part or both. If cleavable linkers are used to link the ligand with the nucleic acid binding domain, the cytoplasm-translocation signal is preferably included in the nucleic acid binding domain, which will stay bound to the cytocide-encoding agent. Additionally, a cytoplasmic-translocation signal sequence may be included in the receptor-internalized binding ligand, as long as it does not interfere with receptor binding. Similarly, the signal sequence placed in the nucleic acid binding domain should not interfere with binding to the cytocide-encoding agent.
  • membrane-disruptive peptides may be inco ⁇ orated into the complexes.
  • adenoviruses are known to enhance disruption of endosomes.
  • Virus-free viral proteins such as influenza virus hemagglutinin HA-2, also disrupt endosomes and are useful in the present invention.
  • Other proteins may be tested in the assays described herein to find specific endosome disrupting agents that enhance gene delivery. In general, these proteins and peptides are amphipathic (see Wagner et al., Adv. Drug. Del. Rev. 14: 113-135, 1994).
  • Endosome-disruptive peptides may be inco ⁇ orated into the complex of receptor-internalized binding ligand, nucleic acid binding domain, and cytocide-encoding agent.
  • Two such peptides derived from influenza virus are: GLFEAIEGFIENGWEGMIDGGGC (SEQ. ID NO. 45) and GLFEAIEGFIENGWEGMIDGWYGC (SEQ. ID NO. 46).
  • Other peptides useful for disrupting endosomes may be identified by general characteristics: 25-30 residues in length, contain an alternating pattern of hydrophobic domains and acidic domains, and at low pH (e.g., pH 5) from amphipathic ⁇ -helices.
  • a candidate endosome-disrupting peptide is tested by inco ⁇ orating it into the complex and determining whether it increases the total number of cells expressing the target gene.
  • the peptides are added to a complex having excess negative charge.
  • a DNA construct is complexed with an FGF-poly-L-lysine chemical conjugate so that only a portion of the negative charge of the DNA is neutralized.
  • Poly-L-lysine is added to further bind the DNA and a fusogenic peptide is then added.
  • Optional ratios of DNA, poly-L-lysine and fusogenic peptide are determined using assays, such as gene expression and cell viability.
  • the fusogenic peptides may alternatively be inco ⁇ orated into the complex as a fusion protein with either the ligand or the nucleic acid binding domain or both.
  • the endosome-disruptive peptide may be present as single or multiple copies at the N- or C- terminus of the ligand.
  • a single fusion protein of the endosome-disruptive peptide, nucleic acid binding domain, and receptor-internalized binding ligand may be constructed and expressed.
  • DNA encoding the endosome-disruptive peptide may be synthesized by PCR using overlapping oligonucleotides and inco ⁇ orating a restriction site at the 5' and 3' end to facilitate cloning. The sequence may be verified by sequence analysis. 4.
  • a "linker” is an extension that links the receptor-binding internalized ligand or fragment thereof and the nucleic acid binding domain. In certain instances, the linker is used to conjugate the ligand directly to the nucleic acid.
  • the linkers provided herein confer specificity, enhance intracellular availability, serum stability and/or solubility on the conjugate and may serve to promote condensation of the nucleic acid.
  • the linkers provided herein confer specificity and serum stability on the cytotoxic conjugate, for example, by conferring specificity for certain proteases, particularly proteases that are present in only certain subcellular compartments or that are present at higher levels in tumor cells than normal cells. Specificity for proteases present in intracellular compartments and absent in blood is particularly preferred.
  • the linkers may also include sorting signals that direct the conjugate to particular intracellular loci or compartments. Additionally, the linkers may reduce steric hindrance between the growth factor and other protein or linked nucleic acid by distancing the components of the conjugate. Linkers may also condense the nucleic acid. For this pu ⁇ ose, the linker comprises highly basic amino acids (e.g., Lys, Arg) and may even by poly-L-lysine.
  • linkers In order to increase the serum stability, solubility and/or intracellular concentration or condense the targeted agent, one or more linkers (are) inserted between the receptor-binding internalized ligand and the nucleic acid binding domain.
  • linkers include peptide linkers, such as intracellular protease substrates, and chemical linkers, such as acid labile linkers, ribozyme substrate linkers and others.
  • Peptides linkers may be inserted using heterobifunctional reagents, described below, or, preferably, are linked to FGF, other growth factors, including heparin-binding growth factors, or cytokines by linking DNA encoding the ligand to the DNA encoding the nucleic acid binding domain.
  • Chemical linkers may be inserted by covalently coupling the linker to the
  • FGF FGF
  • other growth factor protein or cytokine and the nucleic acid binding domain.
  • the linker may be bound via the N- or C-terminus or an internal residue.
  • the heterobifunctional agents, described below, may be used to effect such covalent coupling.
  • protease-specific substrates may be introduced between the ligand and the nucleic acid binding domain.
  • the peptides may be inserted using heterobifunctional reagents, as described below, or preferably inserted by recombinant means and expression of the resulting chimera.
  • Any protease specific substrate may be introduced as a linker as long as the substrate is cleaved in an intracellular compartment.
  • Preferred substrates include those that are specific for proteases that are expressed at higher levels in tumor cells, that are preferentially expressed in the endosome, or that are absent in blood. The following substrates are among those contemplated for use in accord with the methods herein: cathepsin B substrate, cathepsin D substrate, trypsin substrate, thrombin substrate, and recombinant subtilisin substrate.
  • linkers which reduce steric hindrance, and linkers that increase solubility of the conjugates are contemplated for use, either alone or with other linkers, such as the protease specific substrate linkers.
  • these linkers are simple polymers of small amino acids (i.e., small side groups) with uncharged polar side groups. These amino acids (Gly, Ser, Thr, Cys, Tyr, Asn, Gin) are more soluble in water. Of these amino acids, Gly and Ser are preferred.
  • Such linkers include, but are not limited to, (Gly 4 Ser) n , (Ser 4 Gly) n and (AlaAlaProAla) n in which n is 1 to 6, preferably 1-4, such as: a .
  • heterobifunctional cross-linking reagents Numerous heterobifunctional cross-linking reagents that are used to form covalent bonds between amino groups and thiol groups and to introduce thiol groups into proteins, are known to those of skill in this art (see, e.g., the PIERCE CATALOG, ImmunoTechnology Catalog & Handbook, 1992-1993, which describes the preparation of and use of such reagents and provides a commercial source for such reagents; see also, e.g., Cumber et al., Bioconjugate Chem. 5:397-401, 1992; Tho ⁇ e et al., Cancer Res. 47:5924-5931, 1987; Gordon et al., Proc. Natl.
  • reagents include, but are not limited to: N-succu ⁇ imidyl-3-(2- pyridyldithio)propionate (SPDP; disulfide linker); sulfosuccinimidyl 6-[3-(2- pyridyldithio)propionamido]hexanoate (sulfo-LC-SPDP); succinimidyloxycarbonyl- ⁇ - methyl benzyl thiosulfate (SMBT, hindered disulfate linker); succinimidyl 6-[3-(2- pyridyldithio) propionamido]hexanoate (LC-SPDP); sulfosuccmimidyl
  • sulfo-SMCC 4-(N-maleimidomethyl)cyclohexane- 1 -carboxylate
  • SPDB succinimidyl 3-(2-pyridyldithio)butyrate
  • SPED hindered disulfide bond linker
  • SAED sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamide) ethyl- l,3'-dithiopropionate
  • SAED sulfosuccinimidyl 7-azido-4-methylcoumarin-3-acetate
  • SAMCA sulfosuccinimidyl 6-[alpha-methyl-alpha-(2-pvridyldithio)toluamido]hexanoate
  • sulfo-LC-SMPT 4-(N-maleimidomethyl)cyclohexane- 1 -carboxylate
  • SPDB succinimidyl 3-(
  • Acid cleavable linkers include, but are not limited to, bismaleimideothoxy propane, adipic acid dihydrazide linkers (see, e.g., Fattom et al., Infection & Immun. 60:584-589, 1992) and acid labile transferrin conjugates that contain a sufficient portion of transferrin to permit entry into the intracellular transferrin cycling pathway (see, e.g., Welh ⁇ ner et al., J. Biol. Chem. 266:4309-4314, 1991). Conjugates linked via acid cleavable linkers should be preferentially cleaved in acidic intracellular compartments, such as the endosome.
  • Photocleavable linkers are linkers that are cleaved upon exposure to light (see, e.g., Goldmacher et al, Bioconj. Chem. 5:104-107, 1992), thereby releasing the targeted agent upon exposure to light.
  • Goldmacher et al, Bioconj. Chem. 5:104-107, 1992 thereby releasing the targeted agent upon exposure to light.
  • nitrobenzyl group as a photocleavable protective group for cysteine; Yen et al., Makromol.
  • the eye or skin or other body part can be exposed to light, resulting in release of the targeted moiety from the conjugate.
  • Heat sensitive linkers would also have similar applicability.
  • Host organisms include those organisms in which recombinant production of heterologous proteins have been carried out, such as bacteria (for example, E. coli), yeast (for example, Saccharomyces cerevisiae and Pichia pastoris), mammalian cells, and insect cells.
  • bacteria for example, E. coli
  • yeast for example, Saccharomyces cerevisiae and Pichia pastoris
  • mammalian cells for example, E. coli bacterial strains.
  • Presently preferred host organisms are E. coli bacterial strains.
  • the DNA construct encoding the desired protein is introduced into a plasmid for expression in an appropriate host.
  • the host is a bacterial host.
  • the sequence encoding the ligand or nucleic acid binding domain is preferably codon-optimized for expression in the particular host.
  • the codons would be optimized for bacterial usage.
  • the gene can be synthesized as a single oligonucleotide.
  • splicing of multiple oligonucleotides, mutagenesis, or other techniques known to those in the art may be used.
  • sequence of a bacterial-codon preferred FGF-SAP fusion is shown in SEQ. ID NO. 80.
  • the sequences of nucleotides in the plasmids that are regulatory regions, such as promoters and operators, are operationally associated with one another for transcription.
  • the sequence of nucleotides encoding the growth factor or growth factor-chimera may also include DNA encoding a secretion signal, whereby the resulting peptide is a precursor protein.
  • the resulting processed protein may be recovered from the periplasmic space or the fermentation medium.
  • the DNA plasmids also include a transcription terminator sequence.
  • a "transcription terminator region" has either (a) a subsegment that encodes a polyadenylation signal and polyadenylation site in the transcript, and or (b) a subsegment that provides a transcription termination signal that terminates transcription by the polymerase that recognizes the selected promoter.
  • the entire transcription terminator may be obtained from a protein-encoding gene, which may be the same or different from the inserted gene or the source of the promoter. Transcription terminators are optional components of the expression systems herein, but are employed in preferred embodiments.
  • the plasmids used herein include a promoter in operable association with the DNA encoding the protein or polypeptide of interest and are designed for expression of proteins in a bacterial host. It has been found that tightly regulatable promoters are preferred for expression of saporin. Suitable promoters for expression of proteins and polypeptides herein are widely available and are well known in the art. Inducible promoters or constitutive promoters that are linked to regulatory regions are preferred. Such promoters include, but are not limited to, the T7 phage promoter and other T7-like phage promoters, such as the T3, T5 and SP6 promoters, the t ⁇ , lpp, and lac promoters, such as the lacUV5, from E.
  • coli the PI 0 or polyhedron gene promoter of baculovirus/insect cell expression systems (see, e.g., U.S. Patent Nos. 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784) and inducible promoters from other eukaryotic expression systems.
  • promoters are inserted in a plasmid in operative linkage with a control region such as the lac operon.
  • Preferred promoter regions are those that are inducible and functional in
  • E. coli E. coli.
  • suitable inducible promoters and promoter regions include, but are not limited to: the E. coli lac operator responsive to isopropyl ⁇
  • IPTG -D-thiogalactopyranoside
  • the metallothionein promoter metal-regulatory-elements responsive to heavy-metal (e.g., zinc) induction see, e.g., U.S. Patent No. 4,870,009 to Evans et al.
  • the phage T71ac promoter responsive to IPTG see, e.g., U.S. Patent No. 4,952,496; and Studier et al., Meth. Enzymol. 755:60-89, 1990
  • the TAC promoter see, et al. Nakamura et al., Cell 75:1109-1117, 1979
  • heavy-metal e.g., zinc
  • the phage T71ac promoter responsive to IPTG see, e.g., U.S. Patent No. 4,952,496; and Studier et al., Meth. Enzymol. 755:60-89, 1990
  • TAC promoter see, e
  • the plasmids also preferably include a selectable marker gene or genes that are functional in the host.
  • a selectable marker gene includes any gene that confers a phenotype on bacteria that allows transformed bacterial cells to be identified and selectively grown from among a vast majority of untransformed cells.
  • Suitable selectable marker genes for bacterial hosts include the ampicillin resistance gene (Amp r ), tetracycline resistance gene (Tc r ) and the kanamycin resistance gene (Kan r ). The kanamycin resistance gene is presently preferred.
  • the plasmids may also include DNA encoding a signal for secretion of the operably linked protein.
  • Secretion signals suitable for use are widely available and are well known in the art. Prokaryotic and eukaryotic secretion signals functional in E. coli may be employed. The presently preferred secretion signals include, but are not limited to, those encoded by the following E. coli genes: ompA, ompT, ompF, ompC, beta-lactamase, and alkaline phosphatase, and the like (von Heijne, J. Mol. Biol. 754:99-105, 1985).
  • the bacterial pelB gene secretion signal (Lei et al., J.
  • Bacteriol 169:4379, 1987), the phoA secretion signal, and the cek2 functional in insect cell may be employed.
  • the most preferred secretion signal is the E. coli ompA secretion signal.
  • Other prokaryotic and eukaryotic secretion signals known to those of skill in the art may also be employed (see, e.g., von Heijne, J. Mol. Biol. 754:99-105, 1985).
  • one of skill in the art can substitute secretion signals that are functional in either yeast, insect or mammalian cells to secrete proteins from those cells.
  • coli cells include the p ⁇ T expression vectors (see U.S patent 4,952,496; available from Novagen, Madison, WI; see also literature published by Novagen describing the system).
  • Such plasmids include p ⁇ T l la, which contains the T71ac promoter, T7 terminator, the inducible E. coli lac operator, and the lac repressor gene; p ⁇ T 12a-c, which contains the T7 promoter, T7 terminator, and the E.
  • coli ompT secretion signal and p ⁇ T 15b (Novagen, Madison, WI), which contains a His-TagTM leader sequence for use in purification with a His column and a thrombin cleavage site that permits cleavage following purification over the column, the T7-lac promoter region and the T7 terminator.
  • Other preferred plasmids include the pKK plasmids, particularly pKK 223-3, which contains the tac promoter, (available from Pharmacia; see also Brosius et al., Proc. Natl. Acad. Sci. 57:6929, 1984; Ausubel et al., Current Protocols in Molecular Biology; U.S. Patent Nos.
  • Plasmid pKK has been modified by replacement of the ampicillin resistance marker gene, by digestion with EcoRI, with a kanamycin resistance cassette with EcoRI sticky ends (purchased from Pharmacia; obtained from pUC4K, see, e.g., Vieira et al. (Gene 79:259-268, 1982; and U.S. Patent No. 4,719,179).
  • Baculovirus vectors such as pBlueBac (also called pJV ⁇ TL and derivatives thereof), particularly pBlueBac III, (see, e.g., U.S. Patent Nos. 5,278,050, 5,244,805, 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784; available from Invitrogen, San Diego) may also be used for expression of the polypeptides in insect cells.
  • pBlueBac also called pJV ⁇ TL and derivatives thereof
  • pBlueBac III see, e.g., U.S. Patent Nos. 5,278,050, 5,244,805, 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784; available from Invitrogen, San Diego
  • the pBlueBacIII vector is a dual promoter vector and provides for the selection of recombinants by blue/white screening as this plasmid contains the ⁇ -galactosidase gene (lacZ) under the control of the insect recognizable ⁇ TL promoter and is inducible with IPTG.
  • a DNA construct may be made in baculovirus vector pBluebac III and then co-transfected with wild type virus into insect cells Spodoptera frugiperda (sf9 cells; see, e.g., Luckow et al., Bio/technology 6:47-55, 1988, and U.S. Patent No. 4,745,051).
  • Other plasmids include the pIN-IIIompA plasmids (see U.S. Patent
  • the pIN-IIIompA plasmids include an insertion site for heterologous DNA linked in transcriptional reading frame with four functional fragments derived from the lipoprotein gene of E. coli.
  • the plasmids also include a DNA fragment coding for the signal peptide of the ompA protein of E. coli, positioned such that the desired polypeptide is expressed with the ompA signal peptide at its amino terminus, thereby allowing efficient secretion across the cytoplasmic membrane.
  • the plasmids further include DNA encoding a specific segment of the E. coli lac promoter-operator, which is positioned in the proper orientation for transcriptional expression of the desired polypeptide, as well as a separate functional E. coli lad gene encoding the associated repressor molecule that, in the absence of lac operon inducer, interacts with the lac promoter-operator to prevent transcription therefrom.
  • Expression of the desired polypeptide is under the control of the lipoprotein (lpp) promoter and the lac promoter-operator, although transcription from either promoter is normally blocked by the repressor molecule.
  • the repressor is selectively inactivated by means of an inducer molecule thereby inducing transcriptional expression of the desired polypeptide from both promoters.
  • the DNA fragment is replicated in bacterial cells, preferably in E. coli.
  • the preferred DNA fragment also includes a bacterial origin of replication, to ensure the maintenance of the DNA fragment from generation to generation of the bacteria. In this way, large quantities of the DNA fragment can be produced by replication in bacteria.
  • Preferred bacterial origins of replication include, but are not limited to, the fl-ori and col El origins of replication.
  • Preferred hosts contain chromosomal copies of DNA encoding T7 RNA polymerase operably linked to an inducible promoter, such as the lacUV promoter (see U.S. Patent No. 4,952,496). Such hosts include, but are not limited to, lysogens E.
  • the pLys strains provide low levels of T7 lysozyme, a natural inhibitor of T7 RNA polymerase.
  • the DNA fragments provided may also contain a gene coding for a repressor protein.
  • the repressor protein is capable of repressing the transcription of a promoter that contains sequences of nucleotides to which the repressor protein binds. The promoter can be derepressed by altering the physiological conditions of the cell.
  • the alteration can be accomplished by adding to the growth medium a molecule that inhibits the ability to interact with the operator or with regulatory proteins or other regions of the DNA or by altering the temperature of the growth media.
  • Preferred repressor proteins include, but are not limited to the E. coli lad repressor responsive to IPTG induction, the temperature sensitive ⁇ cI857 repressor, and the like.
  • the E. coli lad repressor is preferred.
  • DNA encoding full-length FGF-2 or FGF-2 mutein is linked to DNA encoding an nucleic acid binding domain, such as protamine, and introduced into the pET vectors, including pET-l la and pET-12a expression vectors (Novagen, Madison,
  • WI for intracellular and periplasmic expression, respectively, of FGF-protamine fusion proteins.
  • a nucleic acid binding domain is coupled to a receptor- binding internalized ligand, either by chemical conjugation or as a fusion protein.
  • the ligand may alternatively be coupled directly to the nucleic acid and then complexed with a nucleic acid binding protein, such as poly-lysine, which serves to condense the nucleic acid.
  • Linkers as described above may optionally be used.
  • the receptor-binding internalized ligand confers specificity of delivery in a cell-specific manner. The choice of the receptor-binding internalized ligand to use will depend upon the receptor expressed by the target cells.
  • the receptor type of the target cell population may be determined by conventional techniques such as antibody staining, PCR of cDNA using receptor-specific primers, and biochemical or functional receptor binding assays. It is preferable that the receptor be cell type-specific or have increased expression or activity (i.e., higher rate of internalization) within the target cell population.
  • the nucleic acid binding domain can be of two types, non-specific in its ability to bind nucleic acid, or highly specific so that the amino acid residues bind only the desired nucleic acid sequence.
  • Nonspecific binding proteins, polypeptides, or compounds are generally polycationic or highly basic. Lys and Arg are the most basic of the 20 common amino acids; proteins enriched for these residues are candidates for nucleic acid binding domains. Examples of basic proteins include histones, protamines, and repeating units of lysine and arginine.
  • Poly-L-lysine is an often-used nucleic acid binding domain (see U.S. Patent Nos. 5,166,320 and 5,354,844). Poly-L-lysine and protamine are preferred.
  • nucleic acids such as spermine and spermidine
  • sequence-specific proteins including gal4, Sp-1, AP-1, myoD and the rev gene product from HIV, may be used.
  • Specific nucleic acid binding domains can be cloned in tandem, individually, or multiply to a desired region of the receptor-binding internalized ligand of interest. Alternatively, the ligand and binding domain can be chemically conjugated to each other.
  • the corresponding sequence that binds a sequence-specific domain is inco ⁇ orated into the construct to be delivered.
  • Complexing the cytocidal-encoding agent to the receptor-binding internalized ligand/nucleic acid binding domain allows specific binding to the nucleic acid binding domain. Even greater specificity of binding may be achieved by identifying and using the minimal amino acid sequence that binds to the cytocidal-encoding agent of interest.
  • phage display methods can be used to identify amino acids residues of varying length that will bind to specific nucleic acid sequences with high affinity. (See U.S. Patent No. 5,223,409.)
  • the peptide sequence can then be cloned into the receptor-binding internalized ligand as a single copy or multiple copies.
  • the peptide may be chemically conjugated to the receptor-binding internalized ligand. Incubation of the cytocide-encoding agent with the conjugated proteins will result in a specific binding between the two.
  • cytocide gene is cloned downstream of a mammalian promoter such as c-myc, SV40 early or late gene, CMV-IE, TK or adenovirus promoter.
  • promoters of interest may be active in any cell type, active only in a tissue-specific manner, such as ⁇ -crystalline or tyrosinase, event specific, or inducible, such as the MMTV LTR.
  • Receptor-binding internalized ligands are prepared as discussed by any suitable method, including recombinant DNA technology, isolation from a suitable source, purchase from a commercial source, or chemical synthesis.
  • the selected linker or linkers is (are) linked to the receptor-binding internalized ligands by chemical reaction, generally relying on an available thiol or amine group on the receptor-binding internalized ligands.
  • Heterobifunctional linkers are particularly suited for chemical conjugation.
  • the linker is a peptide linker, then the receptor-binding internalized ligands, linker and nucleic acid binding domain can be expressed recombinantly as a fusion protein.
  • any protein that binds and internalizes through a receptor interaction may be used herein.
  • any member of the FGF family of peptides or portion thereof that binds to an FGF receptor and internalizes a linked agent may be used herein.
  • the protein may be produced recombinantly, produced synthetically or obtained from commercial or other sources.
  • the DNA encoding the FGF may be obtained from any known source or synthesized according to its DNA or amino acid sequences (see discussion above). Although any of the growth factors may be conjugated in this manner,
  • FGF FGF, VEGF, and HBEGF conjugation are discussed merely by way of example and not by way of limitation.
  • the heterogeneity of preparations of ligand (e.g., FGF) containing chemical conjugates and fusion proteins can be reduced by modifying the ligand by deleting or replacing a site(s) that causes the heterogeneity.
  • sites in FGF are typically cysteine residues that upon folding of the protein remain available for interaction with other cysteines or for interaction with more than one cytotoxic molecule per molecule of FGF peptide.
  • cysteine residues do not include any cysteine residue that is required for proper folding of the FGF peptide or for binding to an FGF receptor and internalization.
  • one cysteine residue that in physiological conditions is available for interaction is not replaced but is used as the site for linking the cytotoxic moiety.
  • the resulting modified FGF is thus conjugated with a single species of nucleic acid binding domain (or nucleic acid).
  • the polypeptide reactive with an FGF receptor may be modified by removing one or more reactive cysteines that are not required for receptor binding, but that are available for reaction with appropriately derivatized cytotoxic agent, so that the resulting FGF protein has only one cysteine residue available for conjugation with the cytotoxic agent. If necessary, the contribution of each cysteine to the ability to bind to FGF receptors may be determined empirically. Each cysteine residue may be systematically replaced with a conservative amino acid change (see Table 1, above) or deleted. The resulting mutein is tested for the requisite biological activity, the ability to bind to FGF receptors and internalize linked cytotoxic moieties. If the mutein retains at least 50% of wild-type activity, then the cysteine residue is not required.
  • cysteines are systematically deleted and replaced and the resulting muteins are tested for activity. In this manner the minimum number and identity of the cysteines needed to retain the ability to bind to an FGF receptor and internalize may be determined.
  • the resulting mutant FGF is then tested for retention of the ability to target a cytotoxic agent to a cell that expresses an FGF receptor and to internalize the cytotoxic agent into such cells. Retention of proliferative activity is indicative, though not definitive, of the retention of such activities.
  • Proliferative activity may be measured by any suitable proliferation assay, such as the assay, exemplified below, that measures the increase in cell number of bovine aortic endothelial cells.
  • modified or mutant FGFs may exhibit reduced or no proliferative activity, but may be suitable for use herein, if they retain the ability to target cytocide-encoding agent to cells bearing FGF receptors and result in internalization.
  • Certain residues of FGF-2 have been associated with proliferative activity. Modification of these residues arg 116, lys 119, tyr 120, t ⁇ 123 to ile 116, glu 119, ala 120, ala 123 may be made individually (see SEQ ID NOs. 81-84) to remove this function. The resulting protein is tested for proliferative activity by a standard assay. Any of FGF-1 - FGF-9 may be used.
  • FGF-1 - FGF- 9 The complete amino acid sequence of each of FGF-1 - FGF- 9 is known (see, e.g., SEQ ID NO. 10 (FGF-1) and SEQ ID NOs. 12-18 (FGF-3 - FGF-9, respectively)). Comparison among the amino acid sequences of FGF-1 -FGF-9 reveals that one Cys is conserved among FGF family of peptides (see Table 3). These cysteine residues may be required for secondary structure and are not preferred residues to be altered. Each of the remaining cysteine residues may be systematically deleted and/or replaced by a serine residue or other residue that would not be expected to alter the structure of the protein. The resulting peptide is tested for biological activity. If the cysteine residue is necessary for retention of biological activity it is not deleted; if it not necessary, then it is preferably replaced with a serine or other residue that should not alter the secondary structure of the resulting protein.
  • cysteine residues from each of FGF-1 - FGF-9 that appear to be essential for retention of biological activity and that are not preferred residues for deletion or replacement are as follows:
  • FGF-1 has cysteines at positions 31, 98 and 132; FGF-2 has cysteines at positions 34, 78, 96 and 101; FGF-3 has cysteines at positions 50 and 115; FGF-4 has cysteines at positions 88 and 155; FGF-5 has cysteines at positions 19, 93, 160 and 202; FGF-6 has cysteines at positions 80 and 147; FGF-7 has cysteines at positions 18, 23, 32, 46, 71, 133 and 137; FGF-8 has cysteines at positions 10, 19, 109 and 127; and FGF-9 has cysteines at positions 68 and 134.
  • FGF-3, FGF-4 and FGF-6 have only two cysteines, for pu ⁇ oses of chemical conjugation, preferably neither cysteine is deleted or replaced, unless another residue, preferably one near either terminus, is replaced with a cysteine.
  • cysteine With respect to the other FGF family members, at least one cysteine must remain available for conjugation with the cytotoxic conjugate and probably two cysteines, but at least the cysteine residues set forth in Table 3.
  • a second cysteine may be required to form a disulfide bond.
  • any FGF peptide that has more than three cysteines is be modified for chemical conjugation by deleting or replacing the other cysteine residues.
  • FGF peptides that have three cysteine residues are modified by elimination of one cysteine, conjugated to a cytotoxic moiety and tested for the ability to bind to FGF receptors and internalize the cytotoxic moiety.
  • DNA obtained from pFC80 (see PCT Application Serial No. PCT/US93/05702; United States Application Serial No. 07/901,718; see also SEQ ID NO. 52) encoding basic FGF has been mutagenized.
  • cysteine 78 of basic FGF (FGF-2) to serine ([C78S]FGF) or cysteine 96 to serine ([C96SJFGF) produced two mutants that retain virtually complete proliferative activity of native basic FGF as judged by the ability to stimulate endothelial cell proliferation in culture.
  • the activities of the two mutants and the native protein do not significantly differ as assessed by efficacy or maximal response.
  • Sequence analysis of the modified DNA verified that each of the mutants has one codon for cysteine converted to that for serine.
  • the construction and biological activity of FGF-1 with cysteine substitutions of one, two or all three cysteines has been disclosed (U.S. Patent No. 5,223,483).
  • the mitogenic activity of the mutants was similar to or increased over the native protein.
  • any of the cysteines may be mutated and FGF-1 will still bind and internalize.
  • the resulting mutein FGF or unmodified FGF is reacted with a nucleic acid binding domain.
  • the bFGF muteins may react with a single species of derivatized nucleic acid binding domain (mono-derivatized nucleic acid binding domain), thereby resulting in monogenous preparations of FGF-nucleic acid binding domain conjugates and homogeneous compositions of FGF-nucleic acid binding domain chemical conjugates.
  • the resulting chemical conjugates do not aggregate and retain the requisite biological activities.
  • VEGF or HBEGF may be isolated from a suitable source or may be produced using recombinant DNA methodology, discussed below.
  • the growth factor protein is conjugated generally via a reactive amine group or thiol group to the nucleic acid binding domain directly or through a linker to the nucleic acid binding domain.
  • the growth factor protein is conjugated either via its N-terminus, C-terminus, or elsewhere in the polypeptide.
  • the growth factor protein is conjugated via a reactive cysteine residue to the linker or to the nucleic acid binding domain.
  • the growth factor can also be modified by addition of a cysteine residue, either by replacing a residue or by inserting the cysteine, at or near the amino or carboxyl terminus, within about 20, preferably 10 residues from either end, and preferably at or near the amino terminus.
  • the heterogeneity of preparations may be reduced by mutagenizing the growth factor protein to replace reactive cysteines, leaving, preferably, only one available cysteine for reaction.
  • the growth factor protein is modified by deleting or replacing a site(s) on the growth factor that causes the heterogeneity.
  • sites are typically cysteine residues that, upon folding of the protein, remain available for interaction with other cysteines or for interaction with more than one cytotoxic molecule per molecule of heparin-binding growth factor peptide.
  • cysteine residues do not include any cysteine residue that are required for proper folding of the growth factor or for retention of the ability to bind to a growth factor receptor and internalize.
  • cysteine residue that, in physiological conditions, is available for interaction, is not replaced because it is used as the site for linking the cytotoxic moiety.
  • the resulting modified heparin-binding growth factor is conjugated with a single species of cytotoxic conjugate.
  • each cysteine residue may be systematically replaced with a conservative amino acid change (see Table 1 , above) or deleted.
  • the resulting mutein is tested for the requisite biological activity: the ability to bind to growth factor receptors and internalize linked nucleic acid binding domain and agents. If the mutein retains this activity, then the cysteine residue is not required. Additional cysteines are systematically deleted and replaced and the resulting muteins are tested for activity.
  • Each of the remaining cysteine residues may be systematically deleted and/or replaced by a serine residue or other residue that would not be expected to alter the structure of the protein.
  • the resulting peptide is tested for biological activity. If the cysteine residue is necessary for retention of biological activity it is not deleted; if it not necessary, then it is preferably replaced with a serine or other residue that should not alter the secondary structure of the resulting protein. In this manner the minimum number and identity of the cysteines needed to retain the ability to bind to a heparin-binding growth factor receptor and internalize may be determined.
  • modified or mutant heparin-binding growth factors may exhibit reduced or no proliferative activity, but may be suitable for use herein, if they retain the ability to target a linked cytotoxic agent to cells bearing receptors to which the unmodified heparin-binding growth factor binds and result in internalization of the cytotoxic moiety.
  • VEGF 121 contains 9 cysteines and each of VEGF ]65 , VEGF 189 and VEGF 206 contain 7 additional residues in the region not present in VEGF 121 . Any of the 7 are likely to be non-essential for targeting and internalization of linked cytotoxic agents.
  • the VEGF monomers are preferably linked via non-essential cysteine residues to the linkers or to the targeted agent.
  • VEGF that has been modified by introduction of a Cys residue at or near one terminus, preferably the N-terminus is preferred for use in chemical conjugation.
  • the VEGF is dimerized prior to linkage to the linker and/or targeted agent.
  • cysteines in the HBEGF polypeptide that are not required for biological activity can be deleted or replaced.
  • all except one of these cysteines which will be used for chemical conjugation to the cytotoxic agent, can be deleted or replaced.
  • Each of the HBEGF polypeptides described herein have six cysteine residues.
  • Each of the six cysteines may independently be replaced and the resulting mutein tested for the ability to bind to HBEGF receptors and to be internalized.
  • the resulting mutein-encoding DNA is used as part of a construct containing DNA encoding the nucleic acid binding domain linked to the HBEGF-encoding DNA. The construct is expressed in a suitable host cell and the resulting protein tested for the ability to bind to HBEGF receptors and internalize. As long as this ability is retained the mutein is suitable for use herein.
  • Methods for chemical conjugation of proteins are known to those of skill in the art.
  • the preferred methods for chemical conjugation depend on the selected components, but preferably rely on disulfide bond formation.
  • the targeted agent is SPDP-derivatized saporin
  • VEGF is modified to include a cysteine residue at or near the N-, preferably, or C- terminus, then dimerization should follow coupling to the nucleic acid binding domain.
  • the HBEGF polypeptide is linked via one or more selected linkers or directly to the nucleic acid binding domain.
  • a nucleic acid binding domain is prepared for chemical conjugation.
  • a nucleic acid binding domain may be derivatized with SPDP or other suitable chemicals. If the binding domain does not have a Cys residue available for reaction, one can be either inserted or substituted for another amino acid. If desired, mono-derivatized species may be isolated, essentially as described.
  • nucleic acid binding domain may be derivatized or modified such that it includes a cysteine residue for conjugation to the receptor-binding internalized ligand.
  • derivatization proceeds by reaction with SPDP. This results in a heterogeneous population.
  • nucleic acid binding domain that is derivatized by SPDP to a level of 0.9 moles pyridine-disulfide per mole of nucleic acid binding domain includes a population of non-derivatized, mono-derivatized and di-derivatized SAP.
  • nucleic acid binding domain proteins which are overly derivatized with SPDP, may lose ability to bind nucleic acid because of reaction with sensitive lysines (Lambert et al., Cancer Treat. Res. 57:175-209, 1988).
  • the quantity of non-derivatized nucleic acid binding domain in the preparation of the non-purified material can be difficult to judge and this may lead to errors in being able to estimate the correct proportion of derivatized nucleic acid binding domain to add to the reaction mixture.
  • the methods herein rely on this charge difference for purification of mono-derivatized nucleic acid binding domain by Mono-S cation exchange chromatography.
  • the use of purified mono- derivatized nucleic acid binding domain has distinct advantages over the non-purified material.
  • the amount of receptor-binding internalized ligand that can react with nucleic acid binding domain is limited to one molecule with the mono-derivatized material, and it is seen in the results presented herein that a more homogeneous conjugate is produced.
  • nucleic acid binding domain may react with the succinimidyl moiety, it is possible that more than one amino group on the surface of the protein is reactive. This creates potential for heterogeneity in the mono-derivatized nucleic acid binding domain.
  • the nucleic acid binding domain can be modified by the introduction of a cysteine residue.
  • Preferred loci for introduction of a cysteine residue include the N-terminus region, preferably within about one to twenty residues from the N-terminus of the nucleic acid binding domain.
  • compositions containing the conjugates also appear to be free of aggregates.
  • Fusion protein of receptor-binding internalized ligands and nucleic acid binding domain As a preferred alternative, heterogeneity can be avoided by producing a fusion protein of receptor-binding internalized ligand and nucleic acid binding domain, as described below. Expression of DNA encoding a fusion of a receptor-binding internalized ligand polypeptide linked to the nucleic acid binding domain results in a more homogeneous preparation of cytotoxic conjugates. Aggregate formation can be reduced in preparations containing the fusion proteins by modifying the receptor- binding internalized ligand, such as by removal of nonessential cysteines, and/or the nucleic acid binding domain to prevent interactions between conjugates via free cysteines.
  • one or more coding regions for endosome-disruptive peptide may be constructed as part of the fusion protein.
  • DNA encoding the polypeptides may be isolated, synthesized or obtained from commercial sources or prepared as described herein. Expression of recombinant polypeptides may be performed as described herein; and DNA encoding these polypeptides may be used as the starting materials for the methods herein.
  • DNA encoding FGF, VEGF, HBEGF hepatocyte growth factor, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-10, IL-11, IL-13, TNF, GM- CSF, IFN and IGF polypeptides and/or the amino acid sequences of these factors are described above.
  • DNA may be prepared synthetically based on the amino acid or DNA sequence or may be isolated using methods known to those of skill in the art, such as PCR, probe hybridization of libraries, and the like or obtained from commercial or other sources. For example, suitable methods are described in the Examples for amplifying FGF encoding cDNA from plasmids containing FGF encoding cDNA.
  • cysteine residues may be mutagenized using standard methodologies to delete or replace any cysteine residues that are responsible for aggregate formation.
  • identity of cysteine residues that contribute to aggregate formation may be determined empirically, by deleting and/or replacing a cysteine residue and ascertaining whether the resulting growth factor with the deleted cysteine forms aggregates in solutions containing physiologically acceptable buffers and salts.
  • Loci for insertion of cysteine residues may also be determined empirically. Generally, regions at or near (within 20, preferably 10 amino acids) the C- or, preferably, the N-terminus are preferred.
  • the DNA construct encoding the fusion protein can be inserted into a plasmid and expressed in a selected host, as described above, to produce a recombinant receptor-binding internalized Kenya — nucleic acid binding domain conjugate. Multiple copies of the chimera can be inserted into a single plasmid in operative linkage with one promoter. When expressed, the resulting protein will then be a multimer. Typically, two to six copies of the chimera are inserted, preferably in a head to tail fashion, into one plasmid.
  • FGF peptides such as FGF-3, FGF-4 and FGF-6, that have two cysteines can be modified by replacing the second cysteine, which is not listed in Table 3, and the resulting mutein used as part of a construct containing DNA encoding the cytotoxic agent linked to the FGF-encoding DNA.
  • the construct is expressed in a suitable host cell and the resulting protein tested for the ability to bind to FGF receptors and internalize the cytotoxic agent.
  • conjugates containing bFGF muteins in which Cys 78 and Cys 96 have been replaced with serine residues have been prepared.
  • DNA encoding the FGF protein or other receptor-binding internalized ligand is modified so that, upon expression, the resulting FGF portion of the fusion protein does not include any cysteines available for reaction.
  • DNA encoding an FGF polypeptide is linked to DNA encoding a nucleic acid binding domain.
  • the DNA encoding the FGF polypeptide or other receptor-binding internalized ligand is modified in order to remove the translation stop codon and other transcriptional or translational stop signals that may be present and to remove or replace DNA encoding the available cysteines.
  • the DNA is then ligated to the DNA encoding the nucleic acid binding domain polypeptide directly or via a linker region of one or more codons between the first codon of the nucleic acid binding domain and the last codon of the FGF.
  • the size of the linker region may be any length as long as the resulting conjugate binds and is internalized by a target cell. Presently, spacer regions of from about one to about seventy-five to ninety codons are preferred.
  • the order of the receptor-binding internalized ligand and nucleic acid binding domain in the fusion protein may be reversed. If the nucleic acid binding domain is N-terminal, then it is modified to remove the stop codon and any stop signals.
  • any heparin-binding protein including FGF, VEGF,
  • HBEGF, cytokine, growth factor and the like may be modified and expressed in accord with the methods herein. Binding to an FGF receptor followed by internalization are the only activities required for an FGF protein to be suitable for use herein. All of the FGF proteins induce mitogenic activity in a wide variety of normal diploid mesoderm- derived and neural crest-derived cells and this activity is mediated by binding to an FGF cell surface receptor followed by internalization.
  • a test of such "FGF mitogenic activity” which reflects the ability to bind to FGF receptors and to be internalized, is the ability to stimulate proliferation of cultured bovine aortic endothelial cells (see, e.g., Gospodarowicz et al., J. Biol. Chem. 257:12266-12278, 1982; Gospodarowicz et al., Proc. Natl. Acad. Sci. USA 75:4120-4124, 1976).
  • FGF FGF may be fluorescently labeled with FITC or radiolabeled with 125 I. Fluorescein-conjugated FGF is incubated with cells and examined microscopically by fluorescence microscopy or confocal microscopy for internalization. When FGF is labeled with 125 I, the labeled FGF is incubated with cells at 4°C.
  • the ligand can be conjugated with an nucleic acid binding domain by any of the methods described herein and complexed with a plasmid encoding saporin. As discussed below, the complex may be used to transfect cells and cytotoxicity measured.
  • the DNA encoding the resulting receptor-binding internalized ligand — ucleic acid binding domain can be inserted into a plasmid and expressed in a selected host, as described above, to produce a monogenous preparation. Fusion proteins of FGF-2 and protamine are especially suitable for use in the present invention.
  • modified receptor-binding internalized ligand/nucleic acid binding domain chimera can be inserted into a single plasmid in operative linkage with one promoter. When expressed, the resulting protein will be a multimer. Typically two to six copies of the chimera are inserted, preferably in a head to tail fashion, into one plasmid.
  • SEQ ID NO. 52 has been mutagenized as described in the Examples using splicing by overlap extension (SOE).
  • SOE overlap extension
  • Another preferred coding region is set forth in SEQ ID NO. 53.
  • the DNA is modified by replacing the cysteines at positions 78 and 96 with serine.
  • the codons encoding cysteine residues at positions 78 and 96 of FGF were converted to serine codons by SOE.
  • Each application of the SOE method uses two amplified oligonucleotide products, which have complementary ends as primers and which include an altered codon at the locus at which the mutation is desired, to produce a hybrid product.
  • a second amplification reaction that uses two primers that anneal at the non-overlapping ends amplify the hybrid to produce DNA that has the desired alteration.
  • the receptor-binding internalized ligand/nucleic acid binding domain is incubated with the cytocide-encoding agent, preferably a linear DNA molecule, to be delivered under conditions that allow binding of the nucleic acid binding domain to the agent.
  • Conditions will vary somewhat depending on the nature of the nucleic acid binding domain, but will typically occur in 0.1M NaCl and 20 mM HEPES or other similar buffer. Alternatively, salt conditions can be varied to increase the packing or condensation of DNA. The extent of binding is preferably tested for each preparation. After complexing, additional nucleic acid binding domain, such as poly-L-lysine, may be added to further condense the nucleic acid.
  • test constructs have been made and tested.
  • One construct is a chemical conjugate of bFGF and poly-L-lysine.
  • the bFGF molecule is a variant in which the Cys residue at position 96 has been changed to a serine; thus, only the Cys at position 78 is available for conjugation.
  • This bFGF is called FGF2-3.
  • the poly-L-lysine was derivatized with SPDP and coupled to FGF2-3.
  • This FGF2- 3/poly-L-lysine conjugate was used to deliver a plasmid able to express the ⁇ -galactosidase gene.
  • the ability of a construct to bind nucleic acid molecules may be conveniently assessed by agarose gel electrophoresis.
  • a plasmid such as pSV ⁇
  • restriction enzymes to yield a variety of fragment sizes.
  • the fragments may be labeled with 32 P either by filling in of the ends with DNA polymerase I or by phosphorylation of the 5 '-end with polynucleotide kinase following dephosphorylation by alkaline phosphatase.
  • the plasmid fragments are then incubated with the receptor-binding internalized ligand/nucleic acid binding domain in this case, FGF2-3/poly-L-lysine in a buffered saline solution, such as 20 mM HEPES, pH 7.3, 0.1M NaCl.
  • the reaction mixture is electrophoresed on an agarose gel alongside similarly digested, but nonreacted fragments. If a radioactive label was inco ⁇ orated, the gel may be dried and autoradiographed. If no radioactive label is present, the gel may be stained with ethidium bromide and the DNA visualized through appropriate red filters after excitation with UV. Binding has occurred if the mobility of the fragments is retarded compared to the control. In the example case, the mobility of the fragments was retarded after binding with the FGF2-3/poly-L-lysine conjugate. If there is insufficient binding, poly-L-lysine may be additionally added until binding is observed.
  • the conjugate binds to the cell surface receptor and is internalized into the cell. It is not necessary that the receptor-binding internalized ligand part of the conjugate retain complete biological activity. For example, FGF is mitogenic on certain cell types. As discussed above, this activity may not always be desirable. If this activity is present, a proliferation assay is performed. Likewise, for each desirable activity, an appropriate assay may be performed. However, for application of the subject invention, the only criteria that need be met are receptor binding and internalization. Receptor binding and internalization may be measured by the following three assays. (1) A competitive inhibition assay of the complex to cells expressing the appropriate receptor demonstrates receptor binding.
  • Receptor binding and internalization may be assayed by measuring expression of a reporter gene, such as ⁇ -gal (e.g., enzymatic activity), in cells that have been transformed with a complex of a plasmid encoding a reporter gene and a conjugate of a receptor-binding internalized ligand and nucleic acid binding domain.
  • a reporter gene such as ⁇ -gal (e.g., enzymatic activity)
  • ⁇ -gal e.g., enzymatic activity
  • This assay is particularly useful for optimizing conditions to give maximal transformation.
  • the optimum ratio of receptor- binding internalized ligand/nucleic acid binding domain to nucleic acid and the amount of DNA per cell may readily be determined by assaying and comparing the enzymatic activity of ⁇ -gal.
  • the preferred assay is a cytotoxicity assay performed on cells transformed with a cytocide-encoding agent bound by receptor-binding internalized ligand/nucleic acid binding domain. While, in general, any cytocidal molecule may be used, ribosome inactivating proteins are preferred and saporin, or another type I ribosome inactivating protein, is particularly preferred. A statistically significant reduction in cell number demonstrates the ability of the receptor-binding internalized ligand/nucleic acid binding domain conjugate or fusion to deliver nucleic acids into a cell.
  • the receptor-internalized binding ligand may be conjugated to the nucleic acid, either directly or through a linker.
  • Methods for conjugating nucleic acids, at the 5' ends, 3' ends and elsewhere, to the amino and carboxyl termini and other sites in proteins are known to those of skill in the art (for a review see, e.g., Goodchild, (1993) In: Perspectives in Bioconjugate Chemistry, Mears, Ed., American Chemical Society, Washington, D.C. pp. 77-99).
  • proteins have been linked to nucleic acids using ultraviolet irradiation (Sperling et al. (1978) Nucleic Acids Res. 5:2755-2773; Fiser et al.
  • the reagents N-acetyl-N'-(p-glyoxylylbenzolyl)cystamine and 2-iminothiolane have been used to couple DNA to proteins, such as ⁇ -macroglobulin (C M) via mixed disulfide formation (see Cheng et al., Nucleic Acids Res. 77:659-669, 1983).
  • N-acetyl-N'-(p-glyoxylylbenzolyl)cystamine reacts specifically with nonpaired guaninine residues and, upon reduction, generates a free sulfhydryl group.
  • 2-iminothiolane reacts with proteins to generate sulfhydryl groups that are then conjugated to the derivatized DNA by an intermolecular disulfide interchange reaction.
  • Any linkage may be used provided that the targeted nucleic acid is active upon internalization of the conjugate.
  • cleavage of the linkage may be necessary, although it is contemplated that for some reagents, such as DNA encoding ribozymes linked to promoters or DNA encoding therapeutic agents for delivery to the nucleus, such cleavage may not be necessary.
  • Thiol linkages which are preferred, can be readily formed using heterbiofunctional reagents.
  • Amines have also been attached to the terminal 5' phosphate of unprotected oligonucleotides or nucleic acids in aqueous solutions by reacting the nucleic acid with a water-soluble carbodiimide, such as l-ethyl-3'[3- dimethylaminopropyljcarbodiimide (EDC) or N-ethyl-N'(3-dimethylaminopropylcar- bodiimidehydrochloride (EDCI), in imidazole buffer at pH 6 to produce the 5'phosphorimidazolide.
  • a water-soluble carbodiimide such as l-ethyl-3'[3- dimethylaminopropyljcarbodiimide (EDC) or N-ethyl-N'(3-dimethylaminopropylcar- bodiimidehydrochloride (EDCI)
  • the unreacted protein may be removed from the mixture by column chromatography using, for example, Sephadex G75 (Pharmacia) using 0.1 M ammonium carbonate solution, pH 7.0 as an eluting buffer.
  • the isolated conjugate may be lyophilized and stored until used.
  • U.S. Patent No. 5,237,016 provides methods for preparing nucleotides that are bromacetylated at their 5' termini and reacting the resulting oligonucleotides with thiol groups. Oligonucleotides derivatized at their 5'-termini bromoacetyl groups can be prepared by reacting 5'-aminohexyl-phosphoramidate oligonucleotides with bromoacetic acid-N-hydroxysuccinimide ester as described in U.S. Patent No. 5,237,016. This patent also describes methods for preparing thiol-derivatized nucleotides, which can then be reacted with thiol groups on the selected growth factor.
  • thiol-derivatized nucleotides are prepared using a 5 '-phosphorylated nucleotide in two steps: (1) reaction of the phosphate group with imidazole in the presence of a diimide and displacement of the imidazole leaving group with cystamine in one reaction step; and reduction of the disulfide bond of the cystamine linker with dithiothreitol (see, also, Orgel et al. ((1986) Nucl. Acids Res. 74:651, which describes a similar procedure).
  • the 5'-phosphorylated starting oligonucleotides can be prepared by methods known to those of skill in the art (see, e.g., Maniatis et al. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, p. 122).
  • the nucleic acid such as a methylphosphonate oligonucleotide (MP- oligomer)
  • MP- oligomer may be derivatized by reaction with SPDP or SMPB.
  • the resulting MP- oligomer may be purified by HPLC and then coupled to an FGF, such as an FGF or FGF mutein, modified by replacement of one or more cysteine residues, as described above.
  • the MP-oligomer (about 0.1 ⁇ M) is dissolved in about 40-50 ⁇ l of 1 :1 acetonitrile/water to which phosphate buffer (pH 7.5, final concentration 0.1 M) and a 1 mg MP-oligomer in about 1 ml phosphate buffered saline is added.
  • FGF-oligonucleotide conjugates can be purified on heparin sepharose Hi Trap columns (1 ml, Pharmacia) and eluted with a linear or step gradient. The conjugate should elute in 0.6 M NaCl.
  • the ligand may be conjugated to the nucleic acid construct encoding the cytocide or cytotoxic agent or may be conjugated to a mixture of oligonucleotides complementary to one strand of the construct.
  • the oligonucleotides are then added to single stranded construct produced by melting a double-stranded construct or grown and isolated as single-stranded.
  • the oligonucleotides should hybridize at a higher temperature than the construct alone, if a double-stranded construct is used as the starting material.
  • the gaps are filled in by DNA polymerase I to generate a construct with one strand conjugated to ligand and one strand unconjugated.
  • Oligonucleotides conjugated to ligand and complementary to the other strand may be used in addition to generate a mixture of constructs with different strands linked to ligand.
  • Any remaining single stranded plasmid may be digested with a single strand specific endonuclease.
  • the ligand-conjugated constructs are then mixed with a nucleic acid binding domain, such as protamine or polylysine, to effect condensation of the construct for delivery.
  • Optimal ratios of ligand to DNA may be determined experimentally by receptor-mediated transfection of a construct containing a reporter gene.
  • treatment means any manner in which the symptoms of a conditions, disorder or disease are ameliorated or otherwise beneficially altered. Treatment also encompasses any pharmaceutical use of the compositions herein.
  • amelioration of the symptoms of a particular disorder by administration of a particular pharmaceutical composition refers to any lessening, whether permanent or temporary, lasting or transient that can be attributed to or associated with administration of the composition.
  • these conjugates and complexes may be used to treat complications of the eye following laser surgery, glaucoma surgery, and removal of pterygii.
  • the conjugates and complexes inhibit the proliferation of these cells.
  • the conjugates and complexes may be used in general to treat pathophysiological conditions, especially FGF-, VEGF-, or HBEGF-mediated pathophysiological conditions by specifically targeting to cells having corresponding receptors.
  • FGF-mediated pathophysiological condition refers to a deleterious condition characterized by or caused by proliferation of cells that are sensitive to FGF mitogenic stimulation.
  • Basic FGF-mediated pathophysiological conditions include, but are not limited to, melanoma, other tumors, rheumatoid arthritis, restenosis, Dupuytren's Contracture and certain complications of diabetes, such as proliferative retinopathy.
  • HBEGF-mediated pathophysiological condition refers to a deleterious condition characterized by or caused by proliferation of cells that are sensitive to HBEGF mitogenic stimulation.
  • HBEGF-mediated pathophysiological conditions include conditions involving pathophysiological proliferation of smooth muscle cells, such as restenosis, certain tumors, such as solid tumors including breast and bladder tumors, tumors involving pathophysiological expression of EGF receptors, dermatological disorders, such as psoriasis, and ophthalmic disorders involving epithelial cells, such as recurrence of pterygii and secondary lens clouding.
  • cytokine receptors or growth factor receptors may be eliminated.
  • diseases include restenosis, Dupuytren's Contracture, diabetic retinopathies, rheumatoid arthritis, Kaposi's sarcoma, lymphomas, leukemias, tumors such as renal cell carcinoma, colon carcinoma, breast cancer, bladder cancer, disorders with underlying vascular proliferation, such as diseases in the back of the eye (e.g., proliferative vitreoritinopathy, inacular degeneration and diabetic retinopathy).
  • diseases in the back of the eye e.g., proliferative vitreoritinopathy, inacular degeneration and diabetic retinopathy.
  • use of the VEGF-receptor promoter to control expression of the cytocide or cytotoxic agent is preferred.
  • the conjugates may be used to prevent corneal haze or clouding that results from exposure of the cornea to laser radiation during eye surgery, particularly LRK.
  • the haze or clouding appears to result from fibroblastic keratocyte proliferation in the subepithelial zone following photoablation of the cornea.
  • the conjugates may be used to treat a "hype ⁇ roliferative skin disorder.”
  • a "hype ⁇ roliferative skin disorder” is a disorder that is manifested by a proliferation of endothelial cells of the skin coupled with an underlying vascular proliferation, resulting in a localized patch of scaly or horny or thickened skin or a tumor of endothelial origin.
  • disorders include actinic and atopic dermatitis, toxic eczema, allergic eczema, psoriasis, skin cancers and other tumors, such as Kaposi's sarcoma, angiosarcoma, hemangiomas, and other highly vascularized tumors, and vascular proliferative responses, such as varicose veins.
  • the conjugates may be used to treat or prevent restenosis, a process and the resulting condition that occurs following angioplasty in which the arteries become reclogged.
  • denudation of the interior wall of the vessel occurs, including removal of the endothelial cells that constitute the lining of the blood vessels.
  • smooth muscle cells SMCs
  • This process and the resulting condition is restenosis.
  • compositions suitable for administration of the conjugates and complexes provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.
  • the conjugates and complexes may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients.
  • the conjugates and complexes can be administered by any appropriate route, for example, orally, parenterally, including intravenously, intradermally, subcutaneously, or topically, in liquid, semi-liquid or solid form and are formulated in a manner suitable for each route of administration.
  • Preferred modes of administration depend upon the indication treated. Dermatological and ophthalmologic indications will typically be treated locally; whereas, tumors and restenosis, will typically be treated by systemic, intradermal, or intramuscular modes of administration.
  • conjugates and complexes herein may be formulated into pharmaceutical compositions suitable for topical, local, intravenous and systemic application.
  • local administration either by topical administration or by injection is preferred.
  • Time release formulations are also desirable.
  • an "effective amount" of a compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease. Such amount may be administered as a single dosage or may be administered according to a regimen, whereby it is effective. The amount may cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration may be required to achieve the desired amelioration of symptoms.
  • an ophthalmically effective amount is that amount which, in the composition administered and by the technique administered, provides an amount of therapeutic agent to the involved eye tissues sufficient to prevent or reduce corneal haze following excimer laser surgery, prevent closure of a trabeculectomy, prevent or substantially slow the recurrence of pterygii, and other conditions.
  • concentrations or amounts of the conjugates and complexes that are effective requires delivery of an amount, upon administration, that ameliorates the symptoms or treats the disease.
  • the compositions are formulated for single dosage administration.
  • Therapeutically effective concentrations and amounts may be determined empirically by testing the conjugates and complexes in known in vitro and in vivo systems, such as those described here; dosages for humans or other animals may then be extrapolated therefrom.
  • the conjugate is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated.
  • the conjugates may be delivered as pharmaceutically acceptable salts, esters or other derivatives of the conjugates include any salts, esters or derivatives that may be readily prepared by those of skill in this art using known methods for such derivatization and that produce compounds that may be administered to animals or humans without substantial toxic effects. It is understood that number and degree of side effects depends upon the condition for which the conjugates and complexes are administered. For example, certain toxic and undesirable side effects are tolerated when treating life-threatening illnesses, such as tumors, that would not be tolerated when treating disorders of lesser consequence.
  • concentration of conjugate in the composition will depend on abso ⁇ tion, inactivation and excretion rates thereof, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
  • the conjugate and complex are substantially pure.
  • substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis, high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
  • TLC thin layer chromatography
  • HPLC high performance liquid chromatography
  • a therapeutically effective dosage should produce a serum concentration of active ingredient of from about 0.1 ng/ml to about 50-100 ⁇ g/ml.
  • the pharmaceutical compositions typically should provide a dosage of from about 0.01 mg to about 100 - 2000 mg of conjugate, depending upon the conjugate selected, per kilogram of body weight per day. For example, for treatment of restenosis a daily dosage of about between 0.05 and 0.5 mg/kg (based on FGF-SAP chemical conjugate or an amount of conjugate provided herein equivalent on a molar basis thereto) should be sufficient.
  • Local application for ophthalmic disorders and dermatological disorders should provide about 1 ng up to 100 ⁇ g, preferably about 1 ng to about 10 ⁇ g, per single dosage administration.
  • the amount to administer will be a function of the conjugate selected, the indication treated, and possibly the side effects that will be tolerated.
  • Therapeutically effective concentrations and amounts may be determined for each application herein empirically by testing the conjugates and complexes in known in vitro and in vivo systems (e.g., murine, rat, rabbit, or baboon models), such as those described herein; dosages for humans or other animals may then be extrapolated therefrom.
  • Demonstration that the conjugates and complexes prevent or inhibit proliferation of serum stimulated corneal keratocytes or fibroblasts explanted from eyes, as shown herein, and demonstration of any inhibition of proliferation of such tissues in rabbits should establish human efficacy.
  • the rabbit eye model is a recognized model for studying the effects of topically and locally applied drugs (see, e.g., U.S. Patent Nos. 5,288,735, 5,263,992, 5,262,178, 5,256,408, 5,252,319, 5,238,925, 5,165,952; see also Mirate et al., Curr. Eye Res. 7:491-493, 1981).
  • the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions.
  • the conjugates and complexes may be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracistemal or intraspinal application.
  • solutions particularly those intended for ophthalmic use, may be formulated as 0.01% -10% isotonic solutions, pH about 5-7, with appropriate salts.
  • the ophthalmic compositions may also include additional components, such as hyaluronic acid.
  • the conjugates and complexes may be formulated as aerosols for topical application (see, e.g., U.S. Patent Nos. 4,044,126, 4,414,209, and 4,364,923).
  • Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include any of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; and agents for the adjustment of toxicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent
  • antimicrobial agents such as benzyl alcohol and methyl parabens
  • antioxidants such as ascorbic acid and sodium bisulfit
  • parental preparations can be enclosed in ampules, disposable syringes or multiple dose vials made of glass, plastic or other suitable material.
  • suitable carriers include physiological saline or phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof.
  • PBS physiological saline or phosphate buffered saline
  • Liposomal suspensions may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art.
  • the resulting mixture may be a solution, suspension, emulsion or the like.
  • the form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the conjugate in the selected carrier or vehicle.
  • the effective concentration is sufficient for ameliorating the symptoms of the disease, disorder or condition treated and may be empirically determined based upon in vitro and/or in vivo data, such as the data from the mouse xenograft model for tumors or rabbit ophthalmic model. If necessary, pharmaceutically acceptable salts or other derivatives of the conjugates and complexes may be prepared.
  • the active materials can also be mixed with other active materials, that do not impair the desired action, or with materials that supplement the desired action, including viscoelastic materials, such as hyaluronic acid, which is sold under the trademark HEALON (solution of a high molecular weight (MW of about 3 millions) fraction of sodium hyaluronate; manufactured by Pharmacia, Inc. see, e.g., U.S. Patent Nos.
  • HEALON solution of a high molecular weight (MW of about 3 millions) fraction of sodium hyaluronate
  • VISCOAT fluorine-containing (meth)acrylates, such as, lH,lH,2H,2H-hepta- decafluorodecylmethacrylate; see, e.g., U.S. Patent Nos. 5,278,126, 5,273,751 and 5,214,080; commercially available from Alcon Surgical, Inc.), ORCOLON (see, e.g., U.S. Patent Nos.
  • the viscoelastic materials are present generally in amounts ranging from about 0.5 to 5.0%, preferably 1 to 3% by weight of the conjugate material and serve to coat and protect the treated tissues.
  • the compositions may also include a dye, such as methylene blue or other inert dye, so that the composition can be seen when injected into the eye or contacted with the surgical site during surgery.
  • the conjugates and complexes may be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye.
  • Such solutions particularly those intended for ophthalmic use, may be formulated as 0.01%- 10% isotonic solutions, pH about 5-7, with appropriate salts.
  • Suitable ophthalmic solutions are known (see, e.g., U.S. Patent No. 5,116,868, which describes typical compositions of ophthalmic irrigation solutions and solutions for topical application).
  • Such solutions which have a pH adjusted to about 7.4, contain, for example, 90-100 mM sodium chloride, 4-6 mM dibasic potassium phosphate, 4-6 mM dibasic sodium phosphate, 8-12 mM sodium citrate, 0.5-1.5 mM magnesium chloride, 1.5-2.5 mM calcium chloride, 15-25 mM sodium acetate, 10-20 mM D.L.-sodium ⁇ - hydroxybutyrate and 5-5.5 mM glucose.
  • the conjugates and complexes may be prepared with carriers that protect them against rapid elimination from the body, such as time release formulations or coatings.
  • Such carriers include controlled release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others.
  • the composition may be applied during surgery using a sponge, such as a commercially available surgical sponges (see, e.g., U.S. Patent Nos. 3,956,044 and 4,045,238; available from Week, Alcon, and Mentor), that has been soaked in the composition and that releases the composition upon contact with the eye.
  • a sponge such as a commercially available surgical sponges (see, e.g., U.S. Patent Nos. 3,956,044 and 4,045,238; available from Week, Alcon, and Mentor), that has been soaked in the composition and that releases the composition upon contact with the eye.
  • compositions may also be applied in pellets (such as Elvax pellets(ethylene- vinyl acetate copolymer resin); about 1- 5 ⁇ g of conjugate per 1 mg resin) that can be implanted in the eye during surgery.
  • Ophthalmologically effective concentrations or amounts of one or more of the conjugates and complexes are mixed with a suitable pharmaceutical carrier or vehicle.
  • concentrations or amounts of the conjugates and complexes that are effective requires delivery of an amount, upon administration, that prevents or substantially reduces corneal clouding, trabeculectomy closure, or pterygii recurrence.
  • the conjugates and complexes herein are formulated into ophthalmologically acceptable compositions and are applied to the affected area of the eye during or immediately after surgery.
  • the composition is applied to the cornea; following trabeculectomy the composition is applied to the fistula; and following removal of pterygii the composition is applied to the cornea.
  • the compositions may also be used to treat pterygii.
  • the conjugates and complexes are applied during and immediately following surgery and may, if possible be applied post-operatively, until healing is complete.
  • the compositions are applied as drops for topical and subconjunctival application or are injected into the eye for intraocular application.
  • the compositions may also be absorbed to a biocompatible support, such as a cellulosic sponge or other polymer delivery device, and contacted with the affected area.
  • the ophthalmologic indications herein are typically be treated locally either by the application of drops to the affected tissue(s), contacting with a biocompatible sponge that has absorbed a solution of the conjugates and complexes or by injection of a composition.
  • the composition will be applied during or immediately after surgery in order to prevent closure of the trabeculectomy, prevent a proliferation of keratocytes following excimer laser surgery, or to prevent a recurrence of pterygii.
  • the composition may also be injected into the affected tissue following surgery and applied in drops following surgery until healing is completed. For example, to administer the formulations to the eye, it can be slowly injected into the bulbar conjunctiva of the eye.
  • Conjugates and complexes with photocleavable linkers are among those preferred for use in the methods herein.
  • the eye Upon administration of such composition to the affected area of the eye, the eye is exposed to light of a wavelength, typically visible or UV that cleaves the linker, thereby releasing the cytotoxic agent.
  • the conjugate should be provided in a composition that protects it from the acidic environment of the stomach.
  • the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine.
  • the composition may also be formulated in combination with an antacid or other such ingredient.
  • Oral compositions will generally include an inert diluent or an edible carrier and may be compressed into tablets or enclosed in gelatin capsules.
  • the active compound or compounds can be inco ⁇ orated with excipients and used in the form of tablets, capsules or troches.
  • compositions can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder, such as microcrystalline cellulose, gum tragacanth and gelatin; an excipient such as starch and lactose, a disintegrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, magnesium stearate; a glidant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; and a flavoring agent such as peppermint, methyl salicylate, and fruit flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth and gelatin
  • an excipient such as starch and lactose, a disintegrating agent such as, but not limited to, alginic acid and corn starch
  • a lubricant such as, but not limited to, magnesium stearate
  • the dosage unit form When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil.
  • dosage unit forms can contain various other materials which modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents.
  • the conjugates and complexes can also be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like.
  • a syrup may contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
  • the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as cis-platin for treatment of tumors.
  • the compounds may be packaged as articles of manufacture containing packaging material, one or more conjugates and complexes or compositions as provided herein within the packaging material, and a label that indicates the indication for which the conjugate is provided.
  • Many methods have been developed to deliver nucleic acid into cells including retroviral vectors, electroporation, CaPO 4 precipitation and microinjection, but each of these methods has distinct disadvantages. Microinjecting nucleic acid into cells is very time consuming because each cell must be manipulated individually. Retroviral vectors can only hold a limited length of nucleic acid and can activate oncogenes depending upon the insertion site in the target chromosome. Conditions for electroporation and CaP0 4 -mediated transfection are harsh and cause much cell death.
  • receptor mediated gene delivery as described herein is a more desirable method of selectively targeting toxic genes into cells that have "more active" receptors or that overexpress the specific receptor on the cell surface.
  • a receptor may be more active because it has a higher rate of internalization or higher cycling rate through the endosome to the cell surface.
  • Advantages of this method over other gene delivery methods include increased specificity of delivery, the absence of nucleic acid length limitations, reduced toxicity, and reduced immunogenicity of the conjugate. These characteristics allow for repeated administration of the material with minimal harm to cells and may allow increased level of expression of the toxic protein.
  • primary cultures can also be treated using this method.
  • E. coli strain JA221 (lpp- hdsM+ t ⁇ E5 leuB6 lacY recAl F'[lacl ⁇ e lac + pro + ]) is publicly available from the American Type Culture Collection (ATCC), Rockville, MD 20852, under the accession number ATCC 33875. (JA221 is also available from the Northern Regional Research Center (NRRL), Agricultural Research Service, U.S. Department of Agriculture, Peoria, IL 61604, under the accession number NRRL B-15211; see also U.S. Patent No. 4,757,013 to Inouye; and Nakamura et al., Cell 75:1109-1117, 1979). Strain INVl ⁇ is commercially available from Invitrogen, San Diego, CA.
  • restriction and modification enzymes employed herein are commercially available in the U.S. Native saporin and rabbit polyclonal antiserum to saporin were obtained as previously described in Lappi et al., Biochem. Biophys. Res.
  • Western blotting was accomplished by transfer of the electrophoresed protein to nitrocellulose using the PhastTransfer system, as described by the manufacturer.
  • the antiserum to SAP was used at a dilution of 1:1000.
  • Horseradish peroxidase labeled anti-IgG was used as the second antibody (see Davis et al., Basic Methods In Molecular Biology, New York, Elsevier Science Publishing Co., pp 1-338, 1986).
  • One cycle included a denaturation step (94°C for 1 min), an annealing step (60°C for 2 min), and an elongation step (72°C for 3 min). After 30 cycles, a 10 ⁇ l aliquot of each reaction was run on a 1.5% agarose gel to verify the structure of the amplified product.
  • the amplified DNA was digested with EcoRI and subcloned into EcoRI- restricted M13mpl8 (New England Biolabs, Beverly, MA; see also Yanisch-Perron et al. (1985), "Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mpl8 and pUC19 vectors", Gene 55:103).
  • Single-stranded DNA from recombinant phages was sequenced using oligonucleotides based on internal points in the coding sequence of saporin (see Bennati et al., Eur. J. Biochem. 755:465- 470, 1989).
  • Nine of the M13mpl8 derivatives were sequenced and compared.
  • the clones were designated M13mpl8-G4, -Gl, -G2, -G7, and -G9. Each of these clones contains all of the saporin coding sequence and 45 nucleotides of DNA encoding the native saporin N-terminal leader peptide. Saporin DNA sequence was also cloned in the pETl la vector. Briefly, the DNA encoding SAP-6 was amplified by polymerase chain reaction (PCR) from the parental plasmid pZlBl .
  • PCR polymerase chain reaction
  • the plasmid pZlBl contains the DNA sequence for human FGF-2 linked to SAP-6 by a two-amino-acid linker (Ala-Met). PZlBl also includes the T7 promoter, lac operator, ribosomal binding site, and T7 terminator present in the pET- l la vector.
  • the 5' primer 5'
  • the digested SAP-6 DNA fragment was subcloned into the Nc /if ⁇ mHI-digested pZlBl. This digestion removed FGF-2 and the 5' portion of SAP-6 (up to nucleotide position 650) from the parental rFGF2- SAP vector (pZlBl) and replaced this portion with a SAP-6 molecule containing a Cys at position -1 relative to the start site of the native mature SAP-6 protein. The resultant plasmid was designated as pZ50B.
  • pZ50B was transformed into E. coli strain ⁇ ovaBlue for restriction and sequencing analysis. The appropriate clone was then transformed into E. coli strain BL21(DE3) for expression and large-scale production.
  • SAP plant protein saporin
  • restriction enzyme sites were added to the ends of each fragment, and added or removed within each fragment without changing the corresponding amino acid sequence.
  • the 5' end of the cD ⁇ A was modified to include a Kozak sequence for optimal expression in mammalian cells.
  • Fragments A, B, and D were each synthesized by annealing 4 oligos (2 sense, 2 antisense) with 20 base overlaps and using PCR to fill-in and amplify the fragments.
  • PCR products were then purified using GeneClean (Biol 01), digested with restriction enzymes recognizing the sites in the primers, and subcloned into pBluescript (SK+) (Stratagene). The sequence of the inserts was verified using Sequenase Version 2.0 (United States Biochemical/Amersham). Fragment C was synthesized in two steps: The 5' and 3' halves of the fragment were independently synthesized by PCR using 2 overlapping oligos. The products of these using 2 reactions were then purified and combined and the full-length fragment C was generated by PCR using the outermost oligos as primers. Full-length fragment C was subcloned into pBluescript for sequencing.
  • Fragments A and B were ligated together in pBluescript at an overlapping Kspl site.
  • Fragments C and D were ligated together in pBluescript at an overlapping RvuII site.
  • Fragments A-B and C-D were then joined in pBluescript at an overlapping Aval site to give the full-length mammalian optimized SAP cDNA.
  • ⁇ -gal sequences were excised from the plasmids pNASS- ⁇ and pSV- ⁇ (Clontech) by digestion with NotI and replaced with the synthetic SAP gene, which has NotI ends. Orientation of the insert was confirmed by restriction enzyme digestion. Large scale plasmid preparations were performed using Qiagen Maxi 500 columns. The oligos used to synthesize each SAP fragment are (5 '-3'):
  • Ml 3 mpl8-G4 was digested with EcoR I, and the resulting fragment was ligated into the EcoR I site of the vector pIN-IIIompA2 (see, e.g., see, U.S. Patent No. 4,575,013 to Inouye; and Duffaud et al., Meth. Enz. 153:492-507, 1987) using the methods described herein.
  • the ligation was accomplished such that the DNA encoding saporin, including the N-terminal extension, was fused to the leader peptide segment of the bacterial ompA gene.
  • the resulting plasmid pOMPAG4 contains the Ipp promoter (Nakamura et al., Cell 75:1109-1117, 1987), the E. coli lac promoter operator sequence (lac O) and the E. coli ompA gene secretion signal in operative association with each other and with the saporin and native N-terminal leader-encoding DNA listed in S ⁇ Q ID NO. 19.
  • the plasmid also includes the E. coli lac repressor gene (lac I).
  • the Ml 3 mpl8-Gl, -G2, -G7, and -G9 clones, containing S ⁇ Q ID NOs. 20-23, respectively, are digested with EcoR I and ligated into EcoR I digested pIN- IIIompA2 as described for Ml 3 mpl8-G4 above in this example.
  • the resulting plasmids, labeled pOMPAGl, ⁇ OMPAG2, pOMPAG7, pOMPA9, are screened, expressed, purified, and characterized as described for the plasmid pOMPAG4.
  • INVl ⁇ competent cells were transformed with pOMPAG4 and cultures containing the desired plasmid structure were grown further in order to obtain a large preparation of isolated pOMPAG4 plasmid using methods described herein.
  • the pOMPAG4 transformed E. coli cells were grown under conditions in which the expression of the saporin-containing protein is repressed by the lac repressor until the end of the log phase of growth, at which time IPTG was added to induce expression of the saporin-encoding DNA.
  • IPTG IPTG was added to induce expression of the saporin-encoding DNA.
  • an overnight culture approximately 16 hours growth of JA221 E.
  • coli cells transformed with the plasmid pOMPAG4 in LB broth (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) containing 125 mg/ml ampicillin was diluted 1 :100 into a flask containing 750 ml LB broth with 125 mg/ml ampicillin. Cells were grown at logarithmic phase with shaking at 37°C until the optical density at 550 nm reached 0.9 measured in a spectrophotometer.
  • the E. coli cells containing C-SAP construct in p ⁇ Tl la were grown in a high-cell density fed-batch fermentation with the temperature and pH controlled at 30°C and 6.9, respectively.
  • a glycerol stock (1 ml) was grown in 50 ml Luria broth until the A 600 reached 0.6 Inoculum (10 ml) was injected into a 7-1-Applikon (Foster City CA) fermentor containing 21 complex batch medium consisting of 5 g/1 of glucose, 1.25 g/1 each of yeast extract and tryptone (Difco Laboratories), 7 g/1 of K 2 HPO 4 , 8 g/1 of KH 2 P0 4 , 1.66 g/1 of (NH 4 ) 2 SO 4 , 1 g/1 of MgS0 4 • 7H 2 O, 2 ml/1 of a trace metal solution (74 g/1 of trisodium citrate, 27 g/1 of FeCl 3 • 6H 2 O, 2.0 g/1 of CoCl 2
  • the culture was fed with a solution containing 100 g/1 of glucose, 100 g/1 of yeast extract, and 200 g/1 of tryptone.
  • the cells were harvested by centrifugation (8000xg, 10 min) and frozen at -80°C until further processed.
  • the cell pellet ( «400 g wet mass) containing C-SAP was resuspended in
  • Buffer B (10 mM sodium phosphate pH 7.0, 5 mM EDTA, 5 mM EGTA, and 1 mM dithiothreitol). The suspension was passed through a microfluidizer three times at
  • the diluted lysate was loaded onto an expanded bed of Streamline SP cation-exchange resin (300 ml) equilibrated with buffer C (20 mM sodium phosphate pH 7.0, 1 mM EDTA) at 100 ml/min upwards flow.
  • the resin was washed with buffer C until it appeared clear.
  • the plunger was then lowered at 2 cm/min while washing continued at 70 ml/min. Upwards flow was stopped when the plunger was approximately 8 cm away from the bed and the plunger was allowed to move to within 0.5 cm of the packed bed.
  • the resin was further washed at 70 ml/min downwards flow until A 28o reached baseline. Buffer C plus 0.25 M NaCl was then used to elute proteins containing C-SAP at the same flow rate.
  • the eluate was buffer exchanged into buffer D (50 mM sodium borate pH 8.5, 1 mM EDTA) using the Sartocon Mini crossflow filtration system with a 10000
  • the ribosome inactivating protein activity of recombinant saporin was compared to the ribosome inactivating protein activity of native SAP in an in vitro assay measuring cell-free protein synthesis in a nuclease-treated rabbit reticulocyte lysate (Promega).
  • Samples of immunoaffinity-purified saporin were diluted in PBS and 5 ⁇ l of sample was added on ice to 35 ⁇ l of rabbit reticulocyte lysate and 10 ⁇ l of a reaction mixture containing 0.5 ⁇ l of Brome Mosaic Virus RNA, 1 mM amino acid mixture minus leucine, 5 ⁇ Ci of tritiated leucine and 3 ⁇ l of water.
  • Assay tubes were incubated 1 hour in a 30°C water bath. The reaction was stopped by transferring the tubes to ice and adding 5 ⁇ l of the assay mixture, in triplicate, to 75 ⁇ l of 1 N sodium hydroxide, 2.5% hydrogen peroxide in the wells of a Millititer HA 96-well filtration plate (Millipore). When the red color had bleached from the samples, 300 ⁇ l of ice cold 25% trichloroacetic acid (TCA) were added to each well and the plate left on ice for another 30 min. Vacuum filtration was performed with a Millipore vacuum holder. The wells were washed three times with 300 ⁇ l of ice cold 8% TCA. After drying, the filter paper circles were punched out of the 96-well plate and counted by liquid scintillation techniques.
  • TCA trichloroacetic acid
  • the IC 50 for the recombinant and native saporin were approximately 20 pM. Therefore, recombinant saporin-containing protein has full protein synthesis inhibition activity when compared to native saporin.
  • Restriction and modification enzymes were purchased from BRL (Gaithersburg, MD), Stratagene (La Jolla, CA) and New England Biolabs (Beverly, MA).
  • Plasmid pFC80 containing the basic FGF coding sequence, was a gift of
  • Plasmid pFC80 has been described in the PCT Application Serial No. WO 90/02800 and PCT Application Serial No. PCT/US93/05702, which are herein inco ⁇ orated in their entirety by reference.
  • the sequence of DNA encoding bFGF in pFC80 is that set forth in PCT Application Serial No. PCT/US 93/05702 and in SEQ ID NO. 52.
  • SDS gel electrophoresis was performed on a PhastSystem utilizing 20% gels (Pharmacia). Western blotting was accomplished by transfer of electrophoresed protein to nitrocellulose using the PhastTransfer system (Pharmacia), as described by the manufacturer. The antisera to SAP and basic FGF were used at a dilution of 1 : 1000. Horseradish peroxidase labeled anti-IgG was used as the second antibody as described (Davis, L., Dibner et al. (1986) Basic Methods in Molecular Biology, p. 1, Elsevier Science Publishing Co., New York).
  • Cysteine to serine substitutions were made by oligonucleotide-directed mutagenesis using the Amersham (Arlington Heights, IL) in v tro-mutagenesis system 2.1. Oligonucleotides encoding the new amino acid were synthesized using a 380B automatic DNA synthesizer (Applied Biosystems, Foster City, CA).
  • the oligonucleotide used for in vitro mutagenesis of cysteine 78 was
  • the oligonucleotide for mutagenesis of cysteine 96 was TTCTAAATCGGTTACCGATGACTG (SEQ ID NO. 57), which spans nucleotides
  • the mutated replicative form DNA was transformed into E. coli strain JM109 and single plaques were picked and sequenced for verification of the mutation.
  • the FGF mutated gene was then cut out of Ml 3, ligated into the expression vector pFC80, which had the non-mutated form of the gene removed, and transformed into E. coli strain JM109. Single colonies were picked and the plasmids sequenced to verify the mutation was present. Plasmids with correct mutation were then transformed into the E. coli strain FIC ⁇ 2 and single colonies from these transformations were used to obtain the mutant basic FGFs. Approximately 20 mg protein per liter of fermentation broth was obtained.
  • Cells were grown overnight in 20 ml of LB broth containing 100 ⁇ g/ml ampicillin. The next morning the cells were pelleted and transferred to 500 ml of M9 medium with 100 ⁇ g/ml ampicillin and grown for 7 hours. The cells were pelleted and resuspended in lysis solution (10 mM TRIS, pH 7.4, 150 mM NaCl, lysozyme, 10 ⁇ g/mL, aprotinin, 10 ⁇ g/mL, leupeptin, 10 ⁇ g/mL, pepstatin A, 10 ⁇ g/mL and 1 mM PMSF; 45-60 ml per 16 g of pellet) and incubated while stirring for 1 hour at room temperature.
  • lysis solution 10 mM TRIS, pH 7.4, 150 mM NaCl, lysozyme, 10 ⁇ g/mL, aprotinin, 10 ⁇ g/mL, leupeptin, 10 ⁇ g/mL,
  • Extract volumes (40 ml) were diluted to 50 ml with lO mM TRIS, pH 7.4 (buffer A). Pools were loaded onto a 5 ml Hi-Trap heparin- Sepharose column (Pharmacia, Uppsala, Sweden) equilibrated in 150 mM sodium chloride in buffer A.
  • MyoD at a concentration of 4.1 mg/ml is dialyzed against 0.1 M sodium phosphate, 0.1 M sodium chloride, pH 7.5.
  • a 1.1 molar excess (563 ⁇ g in 156 ⁇ l of anhydrous ethanol) of SPDP (Pharmacia, Uppsala, Sweden) is added and the reaction mixture immediately agitated and put on a rocker platform for 30 minutes.
  • the solution is then dialyzed against the same buffer.
  • An aliquot of the dialyzed solution is examined for extent of derivatization according to the Pharmacia instruction sheet.
  • the extent of derivatization is typically 0.79 to 0.86 moles of SPDP per mole of nucleic acid binding domain.
  • Derivatized myoD (32.3 mg) is dialyzed in 0.1 M sodium borate, pH 9.0 and applied to a Mono S 16/10 column equilibrated with 25 mM sodium chloride in dialysis buffer. A gradient of 25 mM to 125 mM sodium chloride in dialysis buffer elutes free and derivatized nucleic acid binding domain. The flow rate is 4.0 ml/min, 4 ml fractions are collected. Aliquots of fractions were assayed for protein concentration (BCA Protein Assay, Pierce Chemical, Chicago, IL) and for pyridylthione released by reducing agent. Individual fractions (25 to 37) are analyzed for protein concentration and pyridyl-disulfide concentration.
  • the data indicate a separation according to the level of derivatization by SPDP.
  • the initial eluting peak is composed of myoD that is approximately di-derivatized; the second peak is mono-derivatized and the third peak shows no derivatization.
  • the di-derivatized material accounts for approximately 20% of the three peaks; the second accounts for approximately 48% and the third peak contains approximately 32%.
  • Material from the second peak is pooled and gives an average ratio of pyridyl-disulfide to myoD of 0.95. Fraction 33, which showed a divergent ratio of pyridine-2-thione to protein, was excluded from the pool.
  • Fractions that showed a ratio of SPDP to myoD greater than 0.85 but less than 1.05 are pooled, dialyzed against 0.1 M sodium chloride, 0.1 M sodium phosphate, pH 7.5 and used for derivatization with basic FGF.
  • myoD is modified by addition of a cysteine residue at or near the N-terminus-encoding portion of the DNA.
  • the resulting myoD can then react with an available cysteine on an FGF or react with a linker or a linker attached to an FGF to produce conjugates that are linked via the added Cys.
  • Modified myoD is prepared by modifying DNA encoding the myoD (GenBank Accession No. X56677). DNA encoding Cys is inserted at position -1 or at a codon within 10 or fewer residues of the N-terminus. The resulting DNA is inserted into pETl 1 a and pETl 5b and expressed in BL21 cells (NOVAGEN, Madison, WI).
  • Primer #2 is an antisense primer complementing the coding sequence of nucleic acid binding domain spanning nucleotides 1054-1077 and contains a BamHI site. 5 * -GGATCCGAGCACCTGGTATATCGGTGGGGG-3' (SEQ ID NO. 59)
  • MyoD DNA is amplified by PCR as follows using the above primers.
  • a clone containing a full-length DNA (or cDNA) for myoD (1 ⁇ l) is mixed in a final volume of 100 ⁇ l containing lO mM Tris-HCl (pH 8.3), 50 mM KCl, 0.01% gelatin, 2 mM MgCl 2 , 0.2 mM dNTPs, 0.8 ⁇ g of each primer.
  • 2.5 U TaqI DNA polymerase (Boehringer Mannheim) is added and the mixture is overlaid with 30 ⁇ l of mineral oil (Sigma). Incubations are done in a DNA Thermal Cycler.
  • Cycles include a denaturation step (94°C for 1 min), an annealing step (60°C for 2 min), and an elongation step (72°C for 3 min). After 35 cycles, a 10 ⁇ l aliquot of each reaction is run on a 1.5% agarose gel to verify the correct structure of the amplified product.
  • the amplified DNA is gel purified and digested with Ndel .and BamHI and subcloned into Ndel and Tf ⁇ mHI-digested plasmid containing FGF/myoD. This digestion and subcloning step removes the FGF-encoding DNA and 5' portion of SAP up to the BamHI site at nucleotides 555-560 (SEQ ID NO. 52) and replaces this portion with DNA encoding a myoD molecule that contains a cysteine residue at position -1 relative to the start site of the native mature SAP protein.
  • MyoD is amplified by polymerase chain reaction (PCR) from the parental plasmid encoding the FGF-nucleic acid binding domain fusion protein using primers that inco ⁇ orate a TGT or TGC codon at position 4 or 10.
  • PCR polymerase chain reaction
  • the PCR conditions are performed as described above, using the following cycles: denaturation step 94°C for 1 minute, annealing for 2 minutes at 60°C, and extension for 2 minutes at 72°C for 35 cycles.
  • the amplified DNA is gel purified, digested with Ndel and BamHI, and subcloned into Ndel and BamHI digested pETl la. This digestion removes the FGF and 5' portion of nucleic acid binding domain (up to the newly added BamHI) from the parental FGF- myoD vector and replaces this portion with a myoD molecule containing a Cys at position 4 or 10 relative to the start site of the native protein.
  • the resulting plasmid is digested with NdellBamHl and inserted into pET15b (NOVAGEN, Madison, WI), which has a His-TagTM leader sequence (SEQ ID NO. 60), that has also been digested NdellBamHl.
  • DNA encoding unmodified myoD can be similarly inserted into a pET5b or pETl 1 A and expressed as described below for the modified SAP-encoding DNA.
  • BL21(DE3) cells are transformed with the resulting plasmids and cultured as described in Example 2, except that all incubations were conducted at 30°C instead of 37°C. Briefly, a single colony is grown in LB AMP 100 to and OD 600 of 1.0-1.5 and then induced with IPTG (final concentration 0.1 mM) for 2 h. The bacteria are spun down.
  • Lysis buffer (20 mM NaPO 4 , pH 7.0, 5 mM EDTA, 5 mM EGTA, 1 mM DTT, 0.5 ⁇ g/ml leupeptin, 1 ⁇ g/ml aprotinin, 0.7 ⁇ g/ml pepstatin) was added to the myoD cell paste (produced from pZ50Bl in BL21 cells, as described above) in a ratio of 1.5 ml buffer/g cells. This mixture is evenly suspended via a Polytron homogenizer and passed through a microfluidizer twice.
  • the resulting lysate is centrifuged at 50,000 rpm for 45 min.
  • the supernatant is diluted with SP Buffer. A (20 mM NaPO 4 , 1 mM EDTA, pH 7.0) so that the conductivity is below 2.5 mS/cm.
  • the diluted lysate supernatant is then loaded onto a SP-Sepharose column, and a linear gradient of 0 to 30% SP Buffer B (1 M NaCl, 20 mM NaP0 4 , 1 mM EDTA, pH 7.0) in SP Buffer A with a total of 6 column volumes is applied. Fractions containing myoD are combined and the resulting rnucleic acid binding domain had a purity of greater than 90%.
  • a buffer exchange step is used to get the SP eluate into a buffer containing 50 mM NaB0 3 , 1 mM EDTA, pH 8.5 (S Buffer A). This sample is then applied to a Resource S column (Pharmacia, Sweden) pre- equilibrated with S Buffer A. Pure nucleic acid binding domain is eluted off the column by 10 column volumes of a linear gradient of 0 to 300 mM NaCl in SP Buffer A.
  • ultracentrifugation is used clarify the lysate; other methods, such as filtration and using floculents also can be used.
  • Streamline S (PHARMACIA, Sweden) may also be used for large scale preparations.
  • FC78S FGF-nucleic acid binding domain rCCFN2 and l " C96SlFGF-nucleic acid binding domain CCCFN3 [C78SJTGF or [C96SJFGF (1 mg; 56 nmol) that had been dialyzed against phosphate-buffered saline is added to 2.5 mg mono-derivatized nucleic acid binding domain (a 1.5 molar excess over the basic FGF mutants) and left on a rocker platform overnight. The next morning the ultraviolet-visible wavelength spectrum is taken to determine the extent of reaction by the release of pyridylthione, which adsorbs at 343 nm with a known extinction coefficient.
  • reaction mixtures are treated identically for purification in the following manner: reaction mixture is passed over a HiTrap heparin- Sepharose column (1 ml) equilibrated with 0.15 M sodium chloride in buffer A at a flow rate of 0.5 ml/min. The column is washed with 0.6 M NaCl and 1.0 M NaCl in buffer A and the product eluted with 2.0 M NaCl in buffer A. Fractions (0.5 ml) are analyzed by gel electrophoresis and absorbance at 280 nm.
  • Peak tubes are pooled and dialyzed versus 10 mM sodium phosphate, pH 7.5 and applied to a Mono-S 5/5 column equilibrated with the same buffer. A 10 ml gradient between 0 and 1.0 M sodium chloride in equilibration buffer is used to elute the product. Purity is determined by gel electrophoresis and peak fractions were pooled. Under these conditions, virtually 100%) of the mutant FGFs reacts with mono-derivatized myoD. Because the free surface cysteine of each mutant acts as a free sulfhydryl, it is unnecessary to reduce cysteines after purification from the bacteria.
  • the resulting product is purified by heparin-Sepharose (data not shown), thus establish- ing that heparin binding activity of the conjugate is retained.
  • a two-stage method is used to produce recombinant FGF[C78/96S]- myoD protein (hereinafter FPFN4).
  • FPFN4 recombinant FGF[C78/96S]- myoD protein
  • E. coli strains BL21(DE3), BL21(DE3)pLysS, HMS174(DE3) and HMS174(DE3)pLysS were purchased from NOVAGEN, Madison, WI.
  • Plasmid pFC80, described below, has been described in the WIPO International Patent Application No. WO 90/02800, except that the bFGF coding sequence in the plasmid designated pFC80 herein has the sequence set forth as SEQ ID NO. 52, nucleotides 1-465.
  • the plasmids described herein may be prepared using pFC80 as a starting material or, alternatively, by starting with a fragment containing the ell ribosome binding site (SEQ ID NO. 61) linked to the FGF-encoding DNA (SEQ ID NO. 52).
  • E. coli strain JA221 (lpp- hdsM+ tipE5 leuB6 lacY recAl F'[lacl ⁇ - lac + pro + ]) is publicly available from the American Type Culture Collection (ATCC), Rockville, MD 20852, under the accession number ATCC 33875. (JA221 is also available from the Northern Regional Research Center (NRRL), Agricultural Research Service, U.S. Department of Agriculture, Peoria, IL 61604, under the accession number NRRL B-15211; see also U.S. Patent No. 4,757,013 to Inouye; and Nakamura et al., Cell 75:1109-1117, 1979). Strain INVl ⁇ is commercially available from Invitrogen, San Diego, CA.
  • a Nco I restriction site is introduced into the nucleic acid binding domain-encoding DNA by site-directed mutagenesis using the Amersham in vitro- mutagenesis system 2.1.
  • the oligonucleotide employed to create the Nco I restriction site is synthesized using a 380B automatic DNA synthesizer (Applied Biosystems). This oligonucleotide containing the Nco I site replaces the original nucleic acid binding domain-containing coding sequence.
  • Plasmid pFC80 is a derivative of pDS20 (see, e.g., Duester et al., Cell 50:855-864, 1982; see also U.S. Patent Nos. 4,914,027, 5,037,744, 5,100,784, and 5,187,261; see also PCT International Application No. WO 90/02800; and European Patent Application No.
  • Plasmid pKG1800 includes the 2880 bp EcoR l-Pvu II of pBR322 that contains the contains the ampicillin resistance gene and an origin of replication.
  • Plasmid pFC80 is prepared from pDS20 by replacing the entire galK gene with the FGF-encoding DNA of S ⁇ Q ID NO. 52, inserting the t ⁇ promoter (S ⁇ Q ID NO. 62) and the bacteriophage lambda ell ribosome binding site (S ⁇ Q. ID No. 61; see, e.g., Schwarz et al., Nature 272:410, 1978) upstream of and operatively linked to the FGF-encoding DNA.
  • the T ⁇ promoter can be obtained from plasmid pDR720 (Pharmacia PL Biochemicals) or synthesized according to S ⁇ Q ID NO. 62.
  • Plasmid pFC80 contains the 2880 bp EcoR 1-BamH I fragment of plasmid pSD20, a synthetic Sal l-Nde I fragment that encodes the T ⁇ promoter region:
  • the FGF-encoding DNA is removed from pFC80 by treating it as follows.
  • the pFC80 plasmid was digested by Hga l and Sai l, which produces a fragment containing the CII ribosome binding site linked to the FGF-encoding DNA.
  • the resulting fragment is blunt ended with Klenow's reagent and inserted into M13mpl8 that has been opened by Sma l and treated with alkaline phosphatase for blunt-end ligation.
  • an insert in the ORI minus direction is mutagenized using the Amersham kit, as described above, using the following oligonucleotide (S ⁇ Q ID NO.
  • GCTAAGAGCGCCATGGAGA which contains one nucleotide between the FGF carboxy terminal serine codon and a Nco I restriction site; it replaces the following wild type FGF encoding DNA having SEQ ID NO. 64:
  • FGFM13 The resulting mutant derivative of M13mpl8, lacking a native stop codon after the carboxy terminal serine codon of bFGF, was designated FGFM13.
  • the mutagenized region of FGFM13 contained the correct sequence (SEQ ID NO. 65).
  • Plasmid FGFM13 is cut with Nco I and S c I to yield a fragment containing the CII ribosome binding site linked to the bFGF coding sequence with the stop codon replaced.
  • An M13mpl8 derivative containing the myoD coding sequence is also cut with restriction endonucleases Nco I and Sac I, and the bFGF coding fragment from FGFM13 was inserted by ligation to D ⁇ A encoding the fusion protein bFGF- myoD into the M13mpl8 derivative to produce mpFGF- myoD, which contains the CII ribosome binding site linked to the FGF-nucleic acid binding domain fusion gene.
  • Plasmid mpFGF- myoD is digested with Xba I and EcoR I and the resulting fragment containing the bFGF- myoD coding sequence is isolated and ligated into plasmid p ⁇ T-l la (available from ⁇ OVAG ⁇ , Madison, WI; for a description of the plasmids see U.S. Patent No. 4,952,496; see also Studier et al., Meth. Enz. 755:60- 89, 1990; Studier et al., J. Mol. Biol. 759:113-130, 1986; Rosenberg et al., Gene 56: 125- 135, 1987) that has also been treated with EcoR I and Xba I.
  • E. coli strain BL21(D ⁇ 3)pLysS (NOVAGEN, Madison WI) may be transformed with the plasmid containing the fusion gene.
  • Plasmid FGF/myoD may be digested with EcoR I, the ends repaired by adding nucleoside triphosphates and Klenow DNA polymerase, and then digested with Nde I to release the FGF-encoding DNA without the CII ribosome binding site.
  • This fragment is ligated into p ⁇ T 1 la, which is BamH I digested, treated to repair the ends, and digested with Nde I.
  • the resulting plasmid includes the T7 transcription terminator and the pET-1 la ribosome binding site.
  • Plasmid FGF/myoD may be digested with EcoR I and Nde I to release the FGF-encoding DNA without the CII ribosome binding site and ends are repaired as described above. This fragment may be ligated into p ⁇ T 12a, which had been BamH I digested and treated to repair the ends. The resulting plasmid includes DNA encoding the OMP T secretion signal operatively linked to DNA encoding the fusion protein.
  • Protamines are small basic DNA binding proteins, approximately 6.8 kD in molecular weight with a isoelectric point of 12.175. Twenty-four of the fifty one amino acids are strongly basic. Human protamine has been shown to condense genomic DNA for packaging into the sperm head. The positive charges of the protamine react with the negative charges of the phosphate backbone of the DNA.
  • a FGF-protamine fusion protein that has the ability to bind to the FGF receptor and bind DNA with high affinity is constructed for expression in E. coli.
  • the sequence for the human protamine gene is obtained from GenBank (accession no. Y00443). Four overlapping oligonucleotides (60mers) are generated and used to amplify the protamine gene.
  • the amplified product is purified and ligated into the bacterial expression vector p ⁇ Tl la (Novagen). To facilitate subcloning, a Ncol and BamHI site are inco ⁇ orated into the primers.
  • the fragment is synthesized by annealing the 4 oligos (2 sense and 2 antisense) with 20 base overlaps and using PCR to fill-in and amplify the fragments.
  • the PCR products are digested with Ncol and BamHI, and subcloned into pBluescript SK+. The insert sequence is verified. The sequenced product is then cloned downstream and in-frame with FGF2, which has been previously cloned into the p ⁇ Tl la expression plasmid.
  • the oligos used to generate fragment A are (5'-3'):
  • Competent bacterial cells BL21 (DE3) are transformed with the pETl 1- FGF2-protamine construct.
  • the cells are initially plated on LB agar plates containing 100 ⁇ g/ml ampicillin.
  • a glycerol stock made from an individual colony added to 1 ml fresh LB broth and then to 250 ml of LB broth.
  • the cells are grown to an OD 600 of 0.7 and induced with IPTG.
  • the culture is harvested 4 hours after induction. The suspension is centrifuged; the supernatant is saved and the pellet is resuspended in lysis buffer, centrifuged again and the supernatants pooled.
  • Soluble protein is purified. Briefly, the cells are pelleted and resuspended in buffer A (10 mM sodium phosphate, pH 6.0, containing 10 mM EDTA, 10 mM EGTA and 50 mM NaCl) and passed through a microfluidizer (Microfluidics Co ⁇ ., Newton, MA) to break open the bacteria and shear DNA. The resultant mixture is diluted and loaded onto an expanded bed Streamline SP cation-exchange resin. The column is washed with step gradients of increasing concentrations of NaCl.
  • buffer A 10 mM sodium phosphate, pH 6.0, containing 10 mM EDTA, 10 mM EGTA and 50 mM NaCl
  • a microfluidizer Microfluidics Co ⁇ ., Newton, MA
  • the eluted material is analyzed by Western analysis for fractions containing the fusion protein. These fractions are pooled, diluted, and loaded onto a Heparin-Sepharose affinity column. After washing, the bound proteins are eluted in a batch-wise manner in buffer containing 1 M NaCl and then in buffer containing 2 M NaCl. Peak fractions of the 2M elution, as determined by optical density at 280 nm, are pooled and the purity determined by gel electrophoresis and Western analysis. The final pool of material will be loaded onto a column of Sephacryl S-100 equilibrated with 20 mM HEPES pH 7.4, 150 mM NaCl.
  • Fusion protein located in the pellet is isolated, solubilized and refolded. Briefly, each culture pellet is thawed completely and resuspended in buffer A (10 mM Tris, 1 mM EDTA, pH 8.0 + 0.1 mg/ml lyzozyme). The mixture is sonicated on ice, centrifuged at 16,000 X g, and the supernatant discarded.
  • buffer A 10 mM Tris, 1 mM EDTA, pH 8.0 + 0.1 mg/ml lyzozyme
  • Inclusion bodies are solubilized with solubilization buffer: (6 M guanidine-HCl, 100 mM Tris, 150 mM NaCl, 50 mM EDTA, 50 mM EGTA, pH 9.5,), vortexed, incubated for 30 minutes at room temperature, and centrifuged at 35,000 X g for 15 minutes. The supernatant is saved and diluted 1:10 in dilution buffer (100 mM Tris, 10 mM EDTA, 1% monothioglycerol, 0.25 M L-arginine, pH 9.5). The material is stirred, covered, at 4°C for 2 hours and then centrifuged at 35,000 X g for 20 minutes.
  • solubilization buffer 6 M guanidine-HCl, 100 mM Tris, 150 mM NaCl, 50 mM EDTA, 50 mM EGTA, pH 9.5,
  • the supernatant is dialyzed in against 5 liters PBS, pH 8.8, for 24 hours at 4°C with 3 changes of fresh PBS.
  • the material is concentrated approximately 10-fold using size-exclusion spin columns.
  • the soluble refolded material is then analyzed by gel electrophoresis.
  • FGF-protamine fusion protein can be achieved in mammalian cells by excising the insert with restriction enzymes Ndel and BamHI and ligating into a mammalian expression vector.
  • bFGF-nucleic acid binding domain fusion protein (hereinafter bFGF-nucleic acid binding domain fusion protein).
  • pFS92 plasmid-containing bacterial cells (strain BL21(DE3)pLysS) from an overnight culture (1 :100 dilution). Cells are grown at 37°C in an incubator shaker to an OD 600 of 0.7. IPTG (Sigma Chemical, St. Louis, MO) is added to a final concentration of 0.2 mM and growth was continued for 1.5 hours at which time cells were centrifuged.
  • the pellet is resuspended in lysis solution (45-60 ml per 16 g of pellet; 20 mM TRIS, pH 7.4, 5 mM EDTA, 10% sucrose, 150 mM NaCl, lysozyme, 100 ⁇ g/ml, aprotinin, 10 ⁇ g/ml, leupeptin, 10 ⁇ g/ml, pepstatin A, 10 ⁇ g/ml and 1 mM PMSF) and incubated with stirring for 1 hour at room temperature. The solution is frozen and thawed three times and sonicated for 2.5 minutes.
  • the suspension is centrifuged at 12,000 X g for 1 hour; the resulting first-supernatant saved and the pellet is resuspended in another volume of lysis solution without lysozyme.
  • the resuspended material is centrifuged again to produce a second-supernatant, and the two supernatants are pooled and dialyzed against borate buffered saline, pH 8.3.
  • bFGF-nucleic acid binding domain fusion protein elutes from the heparin-Sepharose column at the same concentration (2 M NaCl) as native and recombinantly-produced bFGF, indicating that the heparin affinity is retained in the bFGF-SAP fusion protein.
  • SDS gel electrophoresis is performed on a Phastsystem utilizing 20% acrylamide gels (Pharmacia).
  • Western blotting is accomplished by transfer of the electrophoresed protein to nitrocellulose using the PhastTransfer system (Pharmacia), as described by the manufacturer.
  • Antisera to bFGF is used at a dilution of 1 :1000.
  • Horseradish peroxidase labeled anti-IgG is used as the second antibody (Davis et al.,
  • Anti-FGF antisera should bind to a protein with an approximate molecular weight of 53,000, which corresponds to the sum of the independent molecular weights of nucleic acid binding domain (35,000) and bFGF (18,000).
  • oligos encoding protease substrates Complementary single-stranded oligos in which the sense strand encodes a protease substrate, have been synthesized either using a cyclone machine (Millipore, MA) according the instructions provided by the manufacturer, or were made by Midland Certified Reagent Co. (Midland, TX) or by National BioscienceSj, Inc. (MN). The following oligos have been synthesized.
  • the complementary oligos are annealed by heating at 95 °C for 15 min., cooled to room temperature, and then incubated at 4°C for a minute to about an hour.
  • the oligos are digested with Ncol and ligated overnight at a 3:1 (insert: vector) ratio at 15°C to Ncol-digested plasmid which has been treated with alkaline phosphatase (Boehringer Mannheim).
  • Bacteria ( ⁇ ovablue ( ⁇ OVAGE ⁇ , Madison, WI)) are transformed with the ligation mixture (1 ⁇ l) and plated on LB-amp or LB-Kan, depending upon the plasmid). Colonies are selected, clones isolated and sequenced to determine orientation of the insert. Clones with correct orientation are used to transform strain expression strain BL21(DE3) (NOVAGEN, Madison, WI). Glycerol stocks are generated from single transformed colonies. The transformed strains are cultured as described in Example 2 and fusion proteins with linkers were expressed.
  • exemplary fusion proteins containing cathepsin B substrate (FPFS9), cathepsin D substrate (FPFS5), Gly 4 Ser (FPFS7), (Gly 4 Ser) 2 (FPFS8), trypsin substrate (FPFS6), (Ser 4 Gly) 4 (FPFS12) and (Ser 4 Gly) 2 (FPFS11) linkers, respectively, are set forth in SEQ ID NOs. 72-78.
  • Polylysine polymer with average lengths of 13, 39, 89, 152, and 265 (K 13 , K 39 , K ⁇ , K 152 , K 265 ) are purchased from a commercial vendor (Sigma, St. Louis, MO) and dissolved in 0.1 M NaPO4, 0.1 M NaCl, 1 mM EDTA, pH 7.5 (buffer A) at 3-5 mg/ml.
  • poly-L-lysine solution Approximately 30 mg of poly-L-lysine solution is mixed with 0.187 ml of 3 mg/ml N-succinimidyl-3(pyridyldithio)proprionate (SPDP) in anhydrous ethanol resulting in a molar ratio of SPDP/poly-L-lysine of 1.5 and incubated at room temperature for 30 minutes. The reaction mixture is then dialyzed against 4 liters of buffer A for 4 hours at room temperature.
  • SPDP N-succinimidyl-3(pyridyldithio)proprionate
  • a solution containing 28.5 mg of poly-L-lysine-SPDP is added to 12.9 mg of FGF2-3 ([C96SJ-FGF2) in buffer A and incubated overnight at 4°C.
  • the molar ratio of poly-L-lysine-SPDP/FGF2-3 is approximately 1.5.
  • the conjugation reaction mixture is applied to a 6 ml Resource S (Pharmacia, Uppsala, Sweden) column.
  • a gradient of 0.15 M to 2.1 M NaCl in 20 mM NaPO4, 1 mM EDTA, pH 8.0 (Buffer B) over 24 column volumes is used for elution.
  • the FGF2- 3/poly-L-lysine conjugate is eluted off the column at approximately 1.8-2 M NaCl concentration. Unreacted FGF2-3 is eluted off by 0.5-0.6 M NaCl.
  • the fractions containing FGF2-K are concentrated and loaded onto a gel- filtration column (Sephacryl SI 00) for buffer exchange into 20 mM HEPES, 0.1 M NaCl, pH 7.3.
  • the molecular weight of FGF-K152 as determined by size exclusion HPLC is approximately 42 kD.
  • the chemical conjugate FGF2-K is loaded onto a heparin column and eluted off the column at 1.8- 2.0 M NaCl.
  • unconjugated FGF2-3 is eluted off heparin at 1.4 - 1.6 M NaCl.
  • poly-L-lysine contributes to FGF2-3 ability to bind heparin.
  • the ability of poly-L- lysine 152 to bind heparin is not determined; poly-L-lysine 84 elutes at approximately 1.6 M NaCl.
  • Histone Hl-polylysine was purchased and cytochrome C was conjugated to polylysine as described herein.
  • FGF2-K A sample of FGF2-K is electrophoresed on SDS-PAGE under non- reducing and reducing conditions.
  • the protein migrates at the same molecular weight as FGF.
  • the conjugate does not enter the gel because of its high charge density ( Figure 1, lanes 1, 2, non-reducing; lanes 3, 4, reducing).
  • Optimal conditions for complex formation are established. Varying quantities (0.2 to 200 ⁇ g) of ⁇ -galactosidase encoding plasmid nucleic acid pSV ⁇ or pNASS- ⁇ (lacking a promoter) are slowly mixed with 100 ⁇ g of FGF2-K in 20 mM HEPES pH 7.3, 0.15 M NaCl. The reaction is incubated for 1 hour at room temperature. Nucleic acid binding to the FGF-lysine conjugate is confirmed by gel mobility shift assay using 32 P-labeled SV40- ⁇ -gal nucleic acid cut with Hindi restriction endonuclease.
  • SV40 ⁇ -gal nucleic acid is digested with Hindi restriction endonucleases; ends are labeled by T 4 PNK following dephosphorylation with calf intestinal alkaline phosphatase.
  • To each sample of 35 ng of 32 P-labeled nucleic acid increasing amounts of FGF-polylysine conjugate is added to the mixture.
  • the protein/nucleic acid mixture is electrophoresed in an agarose gel with 1 X TAE buffer. Binding of the conjugate to the radiolabeled DNA is shown by a shift in the complex to the top of the well. (Figure 3.)
  • As seen in Figure 3D as little as 10 ng of K 84 causes a complete shift of restriction fragments indicating binding.
  • With K 13 100 ng of poly-L-lysine was required ( Figure 3C).
  • With K 265 10 ng was required ( Figure 3E).
  • the optimal length of poly-L-lysine and weight ratios is determined by conjugation of FGF2-3 to poly-lysine of different lengths.
  • DNA encoding ⁇ -galactosidase was complexed with the conjugates at 10:1, 5:1, 2:1, 1:1, and 0.5:1 ( Figure 4, lanes 1-5, respectively) (w/w) ratios.
  • the ability of these FGF2-K complexes to bind DNA was determined by measuring the ability of FGF to promote the uptake of plasmid DNA into cells.
  • FGF2-K conjugates were evaluated at various protein to DNA ratios for their ability to deliver pSV ⁇ -gal DNA into cells ( Figure 4).
  • toroid formation which correlates with increased gene expression, was assessed by electron microscopy.
  • a representative toroid at a protein to DNA ratio of 2:1 is shown in Figure 5, upper panel. Toroidal structures are absent, or only partially formed, at low ratios (e.g., 0.5:1) ( Figure 5, lower panel).
  • a proliferation assay is performed to determine if the condensed nucleic acid had an effect on the ability of FGF2-K to bind to cognate receptor and stimulate mitogenesis. The proliferation assay shows that only the highest dose of nucleic acid (200 ⁇ g) has a slightly inhibitory effect on proliferation as compared to FGF2-3 plus poly-L-lysine + DNA (Figure 6).
  • a FGF2-K84-DNA at a protein:DNA ratio of 2:1 is introduced into COS cells and an endothelial cell line, ABAE, both of which express FGF receptors.
  • the cells are subsequently assayed for ⁇ -galactosidase enzyme activity.
  • COS and ABAE cells are grown on coverslips and incubated with the different ratios of FGF2-K:DNA for 48 hours. The cells are then fixed and stained with X-gal. Maximal ⁇ -galactosidase enzyme activity is seen when 50 ⁇ g of pSV ⁇ per 100 ⁇ g of FGF2-3 -polylysine conjugate is used.
  • FGF2-K84- ⁇ SV ⁇ -gal at a protein to DNA ratio of 2:1 was added to various cell lines and incubated for 48 hr.
  • Cell extracts were prepared, assayed for ⁇ -gal activity and total protein.
  • COS, B16, NIH3T3, and BHK cell lines were all able to take up complex and express ⁇ -gal.
  • ⁇ -gal requires FGF2 for targeting into cells.
  • pS V ⁇ or pNASS ⁇ plasmid DNA was incubated with ( Figure 7B, lanes 1, 2) or without (lanes 3, 4) FGF2-K84 for 1 hr at room temperature. Complexes were added to COS cells for 48 hr. Cell extracts were assayed for ⁇ -gal activity and normalized to total protein. Only background ⁇ -gal activity was seen unless the plasmid was complexed with FGF2/K84. Expression of ⁇ -gal is seen to be both time and dose-dependent ( Figures 7C and 7D).
  • Sensitivity of the receptor mediated gene delivery system is determined using the optimized FGF2-K/DNA ratio for complex formation.
  • Increasing amounts of the FGF2-K DNA complex is added to cells.
  • 100 ⁇ g of FGF2-K was mixed with 50 ug of pS V ⁇ for 1 hour at room temperature.
  • the COS and endothelial cells are incubated with increasing amounts of condensed material (0 ng, 1 ng, 10 ng, 100 ng, 1000 ng and 10,000 ng).
  • the cells are incubated for 48 hours and then were assayed for ⁇ -galactosidase activity.
  • cells grown on cover slips are treated with 1000 ng of FGF2-K-DNA for 48 hours, then fixed and stained using X-gal.
  • the ⁇ -gal enzyme assay reveals that with increasing amounts of material there is an increase in enzyme activity.
  • Figure 7D Cells incubated with X-gal show blue staining throughout the cytoplasm in approximately 3% of the cells on the coverslip.
  • FGF2-K84-pSV ⁇ -gal resulted in enzyme activity (lane 1), while only background levels of activity were seen with FGF2+K84+DNA (lane 2), FGF2+DNA (lane 3), K84+DNA (lane 4), DNA (lane 5), FGF2-K84 (lane 6), FGF2 alone (lane 7) and K84 alone (lane 8).
  • the expression of ⁇ -gal is specifically inhibited if free FGF2 is added during transfection (Figure 8B).
  • the addition of heparin attenuates the expression of ⁇ -gal ( Figure 8C).
  • histone HI and cytochrome C were ineffective in delivering pSV ⁇ -gal ( Figure 8C).
  • the peptide INF7 GLF EAIEGFIEN GWEGMIDGWYGC, derived from influenza virus, was synthesized.
  • the INF7 peptide was added 30 minutes later.
  • the complex is added to COS cells and ⁇ -gal activity is assayed 48 or 72 hr later.
  • the amount of free polylysine necessary to neutralize the DNA and allow INF7 to complex was determined. Polylysine was added at 4, 10, or 25 ⁇ g to the FGF2-K84/pSV ⁇ -gal complex. To each of these complexes four different concentrations of INF7 were added. Maximal ⁇ -gal expression was seen with 4 ⁇ g of K84 and 12 ⁇ g of INF7 ( Figure 13 A). When higher amounts of poly-lysine were used, more cell death resulted. The optimal amount of INF7 was determined using 4 ⁇ g of polylysine. As seen in Figure 13B, 24 ⁇ g of INF7 gave maximal ⁇ -gal activity. At 72 hr, 48 ⁇ g of INF7 gave maximal ⁇ -gal activity (approximately 20-32 fold enhancement) (Figure 13C).
  • the cytotoxicity assay measures viable cells after transfection with a cytocide-encoding agent.
  • FGF-2 is the receptor-binding internalized ligand
  • COS7 cells which express FGFR, may be used as targets, and T47D, which does not express a receptor for FGF-2 at detectable levels, may be used as negative control cells.
  • FGF2- K pZ200M a plasmid which expresses saporin
  • Controls include FGF2-K alone, pZ200M alone, and FGF-2 plus poly-L-lysine plus pZ200M.
  • cells are rinsed in PBS lacking Mg 4-1" and Ca "1-1" . Trypsin at 0.1% is added for 10 min and cells are harvested and washed. Cell number from each well is determined by a Coulter particle counter (or equivalent method). A statistically significant decrease in cell number for cells incubated with FGF2-K/pZ200M compared to FGF2-K or pZ200M alone indicates sufficient cytotoxicity.
  • FGF2-polylysine-DNASAP complexes show selective cytotoxicity.
  • saporin in mammalian cells, a synthetic saporin gene using preferred mammalian codons and introduced a "Kozak" sequence for translation initiation. The synthetic gene was then cloned into SV40 promoter and promoterless expression vectors. Because the expression of SAP from SAP-encoding DNA would only be feasible if the mammalian ribosome can synthesize the protein (SAP) prior to its inactivation by the SAP synthesized, the enzymatic activity of saporin encoded by the synthetic gene was tested.
  • SAP mammalian ribosome can synthesize the protein
  • SAP was cloned into a T7/SP6 promoter plasmid and sense RNA was generated using T7 RNA polymerase. The RNA was then added to a mammalian in vitro translation assay. The results from this cell-free in vitro translation assay clearly show that the saporin expressed in a mammalian system can inhibit the expression of protein mutagenesis ( Figure 10).
  • SAP mRNA When added above to the lysate, SAP mRNA is translated into a protein that has the anticipated molecular weight of the saporin protein (lane 2).
  • luciferase mRNA is added to the lysate, a molecule consistent with the luciferase protein is detected (lane 3).
  • FGF2-K was condensed with the pSV40-SAP plasmid DNA at a ratio of 2:1 (w:w).
  • BHK 21 .and NIH 3T3 cells were used as the target cells.
  • the cells (24,000 cells/well) were incubated with either FGF2-K-DNASAP or an FGF2-K-DNA ⁇ -gal complex. After 72 hours of incubation, cell number was determined. As shown in Figure 12, there is a significant decrease in cell number when cells are incubated with the FGF2-K-DNASAP complex compared to cells incubated with the FGF2-K-DNA ⁇ -gal complex.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Botany (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
EP96920274A 1995-05-16 1996-05-16 Nukleinsäuren und ligander enthaltende zusammensetzungen zur therapeutische behandlung Withdrawn EP0833665A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US441979 1982-11-15
US44197995A 1995-05-16 1995-05-16
PCT/US1996/007164 WO1996036362A1 (en) 1995-05-16 1996-05-16 Compositions containing nucleic acids and ligands for therapeutic treatment

Publications (1)

Publication Number Publication Date
EP0833665A1 true EP0833665A1 (de) 1998-04-08

Family

ID=23755069

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96920274A Withdrawn EP0833665A1 (de) 1995-05-16 1996-05-16 Nukleinsäuren und ligander enthaltende zusammensetzungen zur therapeutische behandlung

Country Status (5)

Country Link
EP (1) EP0833665A1 (de)
JP (1) JPH11505805A (de)
AU (1) AU710309B2 (de)
CA (1) CA2221269A1 (de)
WO (1) WO1996036362A1 (de)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995024928A2 (en) * 1994-03-15 1995-09-21 Prizm Pharmaceuticals, Inc. Heparin-binding growth factors for gene therapy and anterior eye disorders
US7153943B2 (en) 1997-07-14 2006-12-26 Bolder Biotechnology, Inc. Derivatives of growth hormone and related proteins, and methods of use thereof
US20080076706A1 (en) 1997-07-14 2008-03-27 Bolder Biotechnology, Inc. Derivatives of Growth Hormone and Related Proteins, and Methods of Use Thereof
US7495087B2 (en) 1997-07-14 2009-02-24 Bolder Biotechnology, Inc. Cysteine muteins in the C-D loop of human interleukin-11
ATE375363T1 (de) 1997-07-14 2007-10-15 Bolder Biotechnology Inc Derivate des wachstumshormons und verwandte proteine
AU2868099A (en) 1998-02-13 1999-08-30 Selective Genetics, Inc. Concurrent flow mixing methods and apparatuses for the preparation of gene therapy vectors and compositions prepared thereby
US6903077B1 (en) 1999-01-04 2005-06-07 University Of Vermont And State Agricultural College Methods and products for delivering nucleic acids
WO2000040723A2 (en) * 1999-01-04 2000-07-13 University Of Vermont And State Agricultural College Methods and products for delivering nucleic acids
US8288126B2 (en) 1999-01-14 2012-10-16 Bolder Biotechnology, Inc. Methods for making proteins containing free cysteine residues
IL144259A0 (en) * 1999-01-14 2002-05-23 Bolder Biotechnology Inc Methods for making proteins containing free cysteine residues
JP2003501402A (ja) * 1999-06-03 2003-01-14 バイオイノベイション・リミテッド 遺伝子治療用生成物
US6506365B1 (en) * 2000-09-25 2003-01-14 Baxter Aktiengesellschaft Fibrin/fibrinogen binding conjugate
JP2002161049A (ja) * 2000-11-28 2002-06-04 Terumo Corp 血管内膜肥厚抑制剤
GB0209896D0 (en) 2002-04-30 2002-06-05 Molmed Spa Conjugate
US7270983B1 (en) * 2004-02-19 2007-09-18 Research Foundation Of The University Of Central Florida, Inc. Messenger RNA profiling: body fluid identification using multiplex reverse transcription-polymerase chain reaction (RT-PCR)
PL2043662T3 (pl) * 2006-07-26 2016-03-31 Intrexon Corp Sposoby i kompozycje do leczenia choroby
EP2558115B1 (de) 2010-04-16 2019-07-31 The Salk Institute for Biological Studies Verfahren zur behandlung von stoffwechselstörungen mittels fgf
WO2015061331A1 (en) 2013-10-21 2015-04-30 Salk Institute For Biological Studies Chimeric fibroblast growth factor (fgf) 2/fgf1 peptides and methods of use
WO2017127493A1 (en) * 2016-01-22 2017-07-27 Salk Institute For Biological Studies Fgf2 truncations and mutants and uses thereof
WO2021261996A2 (en) * 2020-06-24 2021-12-30 Sapreme Technologies B.V. Nhs-based saponin conjugates
CA3184041A1 (en) * 2020-06-24 2021-12-30 Sapreme Technologies B.V. Saponin derivatives for use in medicine
CH716377B1 (it) * 2020-08-05 2020-12-30 Contrad Swiss Sa Idrogel ad applicazione topica efficace nel prevenire e/o attenuare la degenerazione della cartilagine.

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5916772A (en) * 1992-06-16 1999-06-29 Whittier Institute For Diabetes And Endocrinology Recombinant production of saporin-containing proteins
WO1995024928A2 (en) * 1994-03-15 1995-09-21 Prizm Pharmaceuticals, Inc. Heparin-binding growth factors for gene therapy and anterior eye disorders
WO1995028494A1 (en) * 1994-04-15 1995-10-26 Targeted Genetics Corporation Gene delivery fusion proteins
AU3374795A (en) * 1994-08-29 1996-03-22 Prizm Pharmaceuticals, Inc. Conjugates of vascular endothelial growth factor with targeted agents
AU3724495A (en) * 1994-09-13 1996-03-29 Prizm Pharmaceuticals, Inc. Conjugates of heparin-binding epidermal growth factor-like growth factor with targeted agents

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9636362A1 *

Also Published As

Publication number Publication date
WO1996036362A1 (en) 1996-11-21
CA2221269A1 (en) 1996-11-21
AU5862896A (en) 1996-11-29
JPH11505805A (ja) 1999-05-25
AU710309B2 (en) 1999-09-16

Similar Documents

Publication Publication Date Title
US6503886B1 (en) Compositions containing nucleic acids and ligands for therapeutic treatment
AU710309B2 (en) Compositions containing nucleic acids and ligands for therapeutic treatment
AU702323B2 (en) Heparin-binding growth factors for gene therapy and anterior eye disorders
WO1996006641A1 (en) Conjugates of vascular endothelial growth factor with targeted agents
AU3724495A (en) Conjugates of heparin-binding epidermal growth factor-like growth factor with targeted agents
US6054312A (en) Receptor-mediated gene delivery using bacteriophage vectors
AU767195B2 (en) Delivery of substances to cells
AU2002252867C1 (en) Fusion proteins
AU7475694A (en) Monogenous preparations of cytotoxic conjugates
AU2002252867A1 (en) Fusion proteins
AU685058B2 (en) Recombinant production of saporin-containing proteins
US20030040496A1 (en) Methods for halting unwanted cell growth, such as using ligand-directed nucleic acid delivery vehicles
EP0923387B1 (de) Heparin-beschichtete medizinische geräte zum intravenösen gebrauch, die heparin-bindende wachstumfaktor-konjugate enthalten
WO1997049434A9 (en) Heparinized medical devices containing heparin-binding growth factor conjugates
HUT77263A (hu) Kémiai anyagok bejuttatása egy specifikus sejttípus sejtjeinek belsejébe
CA2342970A1 (en) Fusion proteins

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19971212

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20000222

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20000704