CA2221269A1 - Compositions containing nucleic acids and ligands for therapeutic treatment - Google Patents

Compositions containing nucleic acids and ligands for therapeutic treatment Download PDF

Info

Publication number
CA2221269A1
CA2221269A1 CA002221269A CA2221269A CA2221269A1 CA 2221269 A1 CA2221269 A1 CA 2221269A1 CA 002221269 A CA002221269 A CA 002221269A CA 2221269 A CA2221269 A CA 2221269A CA 2221269 A1 CA2221269 A1 CA 2221269A1
Authority
CA
Canada
Prior art keywords
receptor
nucleic acid
fgf
dna
binding domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002221269A
Other languages
French (fr)
Inventor
Lois A. Chandler
J. Andrew Baird
Barbara A. Sosnowski
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Selective Genetics Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of CA2221269A1 publication Critical patent/CA2221269A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/168—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
    • A61K41/0042—Photocleavage of drugs in vivo, e.g. cleavage of photolabile linkers in vivo by UV radiation for releasing the pharmacologically-active agent from the administered agent; photothrombosis or photoocclusion
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/642—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a cytokine, e.g. IL2, chemokine, growth factors or interferons being the inactive part of the conjugate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/6425—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the peptide or protein in the drug conjugate being a receptor, e.g. CD4, a cell surface antigen, i.e. not a peptide ligand targeting the antigen, or a cell surface determinant, i.e. a part of the surface of a cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/50—Fibroblast growth factor [FGF]
    • C07K14/503—Fibroblast growth factor [FGF] basic FGF [bFGF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/04—Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/55—Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Preparations of conjugates of a receptor-binding internalized ligand and a cytocide-encoding agent and compositions containing such preparations are provided. The conjugates contain a polypeptide that is reactive with an FGF receptor, such as bFGF, or another heparin-binding growth factor, cytokine, or growth factor coupled to a nucleic acid binding domain. One or more linkers may be used in the conjugation. The linker is selected to increase the specificity, toxicity, solubility, serum stability, or intracellular availability, and promote nucleic acid condensation of the targeted moiety. The conjugates are complexed with a cytocide-encoding agent, such as DNA encoding saporin. Conjugates of a receptor-binding internalized ligand to a nucleic acid molecule are also provided.

Description

Description ,. COMPOSITIONS CONTAINING NUCLEIC
ACIDS AND LIGANDS FOR THERAPEUTIC TREATMENT

Technical Field The present invention relates generally to the trezltment of diseases, and more specifically, to the p,~dLion and use of complexes CO~ g receptor-binding intern~li7~1 ligands NABD and cytocide-encoding agents to alter the function, gene 10 expression, or viability of a cell in a therapeutic manner.

Back~round of the Invention A major goal of tre~tment of neoplastic diseases and hyperproliL~,dliv~
disorders is to ablate the abnormally growing cells while leaving normal cells 15 untouched. Various methods are under development for providing tre~tment but none provide the requisite degree of specificity.
One method of tre~tment is to provide toxins. Tmmnnotoxins and cytotoxins are protein conjugates of toxin molecules with either antibodies or factors which bind to receptors on target cells. Three major problems may limit the usefulness 20 of immunotoxins. First, the antibodies may react with more than one cell surface molecule, thereby effecting delivery to multiple cell types, possibly including normal cells. Second, even if the antibody is specific, the antibody reactive molecule may be present on normal cells. Third, the toxin molecule may be toxic to cells prior to delivery and inttorn~li7~tion. Cytotoxins suffer from similar disadvantages of specificity 25 and toxicity. Another limitation in the therapeutic use of immunotoxins and cytotoxins is the relatively low ratio of therapeutic to toxic dosage. Additionally, it may be difficult to direct sufficient concentrations of the toxin into the cytoplasm and . intracellular col~ a. Llllents in which the agent can exert its desired activity.
Given these limitations, cytotoxic therapy has been attempted using viral 30 vectors to deliver DNA encoding the toxins into cells. If eukaryotic viruses are used, such as the retroviruses currently in use, they may recombine with host DNA to produce infectious virus. Moreover, because retroviral vectors are often inactivated by the =

-WO 96/36;~62 PCT/US96/07164 complement system, use in vivo is limitf~d Retroviral vectors also lack specificity in delivery; receptors for most viral vectors are present on a large fraction, if not all, cells.
Thus, infection with such a viral vector will infect normal as well as abnormal cells.
Because of this general infection mech~ni~m, it is not desirable for the viral vector to 5 directly encode a cytotoxic molecule.
While delivery of nucleic acids offers advantages over delivery of cytotoxic proteins such as reduced toxicity prior to int~rn~li7~tion~ there is a need for high specificity of delivery, which is ~ull~nlly unavailable with the present systems.
In view of the problems associated with gene therapy, there is a 10 compelling need for h~ )ved trÇ~tment~ which are more effective and are not associated with such disadvantages. The present invention exploits the use of conjugates which have increased specificity and deliver higher amounts of nucleic acids to targeted cells, while providing other related adv~nt~g~?s 1~ Summarv of the Invention The present invention generally provides therapeutic cunll)osilions~ In one aspect, the composition has the formula: receptor-binding intem~li7~fl ligand--nucleic acid binding domain--cytocide-encoding agent. The receptor-binding intlorn~li7l?d ligand is a polypeptide reactive with a cell surface receptor, the nucleic acid 20 binding domain binds to a nucleic acid, the cytocide-encoding agent is a nucleic acid molecule encoding a cytocide and which binds to the nucleic acid binding domain, and the composition binds to the cell surface receptor and intern~li7~c the cytocide-encoding agent in cells bearing the receptor. In another aspect, the composition has the formula:
receptor-binding int~m~ d ligand-nucleic acid binding comain-prodrug-encoding 2~ agent.
In certain embofliment~, the receptor-binding intern~li7t-d ligand is a polypeptide reactive with an FGF receptor, VEGF receptor, HBEGF receptor, or a cytokine. In other embo-liment~, the cytocide-encoding agent encodes a protein that inhibits protein synthesis and is preferably a ribosome inactivating protein, most 30 preferably saporin. The protein is gelonin or diphtheria toxin in other embo~1iment~ In other embodiments, the prodrug-encoding agent encodes HSV-thymidine kinase.

The nucleic acid binding domain is poly-L-lysine in one embodiment. In other embo~liments, the nucleic acid binding domain is a transcription factor selected from the group con.~i~tin~ of helix-turn-helix motif proteins, homeodomain proteins, zinc finger motif proteins, steroid receptor proteins, leucine zipper motif proteins, helix-5 loop-helix motif proteins, and 13-sheet motif proteins. In other embodiments, the nucleic acid binding domain binds nonspecifically to nucleic acids and is selected from the group con.~i~ting of poly-L-lysine, protamine, histone and spermine. In a pl~r~led embodiment, the nucleic acid binding domain binds the coding region of a ribosome inactivating protein such as saporin. In another pl~er~;.led embodiment, FGF is 10 conjugated to poly-L-lysine.
In yet other embo~liment~, the cytocide-encoding agent contains a tissue-specific promoter, such as alpha-crystalline, gamma-cryst~lline, a-fetoprotein, CEA, prostate-specific antigen, erbB-2, tyrosinase, a-actin, c-myc, VEGF receptor, FGF
receptor or cyclin D.
In another aspect, the composition also contains a linker. In various embo-liment.c, the linker increases the flexibility of the conjugate and is (GlymSerp)n, (Ala Ala Pro Ala)n, wherein n is 1 to 6, m is 1 to 6 and p is 1 to 4, or the linker is a disulfide bond.
In yet another aspect, the composition has the formula: receptor-binding 20 int~rn~li7t?~1 ligand-cytocide encoding agent-nucleic acid binding domain, wherein the receptor-binding intern~li7.-cl ligand is conjugated to the cytocide-encoding agent, which is bound to the nucleic acid binding domain to form a complex.
In other aspects, the invention provides methods for preventing excessive cell proliferation in the anterior eye following surgery, treating corneal clouding 25 following excimer laser surgery, preventing closure of a trabeculectomy, preventing pterygii recurrence, treating hyperproliferative diseases in the back of the eye, such as macular degeneration, diabetic retinopathy and proliferative virtreal retinopathy, treating smooth muscle cell hyperplasia after a wound healing response to a procedure, e.g, vein grafting, endarterectomies and arteriovenous shunts and treating cancer. In these aspects, an effective amount of the compositions described above are ~t1mini~tered.

5 Brief DescriPtion of the Drawin~s Figure 1 is a photograph of an SDS-PAGE of FGF2-K152 under non-re~ ing (left) and re~lllcing (right) conditions. Lane 1, FGF2-K152; lane 2, FGF2;
lane 3, FGF2-K152: lane 4, FGF2. The open arrow identifies m~t~n~l unable to enter the gel. The closed arrow identifies a protein band corresponding to FGF2.
Figure 2 is a graph depicting the proliferation of bovine aortic endothelial cells in response to FGF2 (closed box) and FGF2-K152 (open circle) conjugate.
Figure 3 is a photograph of a gel showing the effects of various lengths of poly-L-lysine on the ability to interact with DNA. Thirty-five ng of labeled DNA
were added to increasing concentrations of either FGF2 or FGF2-K: lanes 1, 0 ng;lanes 2, 0.1 ng; lanes 3, 1 ng; lanes 4, 10 ng; lanes 5, 20 ng; lanes 6, 35 ng; lanes 7, 100 ng. Panel A: FGF2; panel B, FGF2-K152; panel C, FGF2-K13; panel D, FGF2-K84; panel E, EGF2-K267; panel F, FGF2-K39. The lengths of the digested DNA are indicated.
Figure 4 is a chart depicting the activity of ,B-gal following transfection of FGF2/poly-L-lysine/DNA,B-gal into COS cells. Lane 1, 10:1 (w/w) ratio of FGF2/poly-L-lysine conjugate to DNA; lane 2, 5:1 ratio; lane 3, 2:1 ratio; lane 4, 1:1 ratio; lane 5, 0.5:1 ratio. The five bars, from left to right, are FGF2, FGF2-K13, FGF2-K39, FGF2-K84, and FGF2-K152.
Figure 5 are photographs of toroid format observed by electron microscopy. The upper panel shows an example of a toroid; the lower panel shows an incomplete toroid.
Figure 6 is a graph depicting proliferation of bovine aortic-endothelial cells. In the upper panel, cells were treated with FGF2-K152-DNA; in the lower panel, cells were treated with a mixture of FGF2, K152, and DNA.

CA 0222l269 l997-ll-l4 S

Figure 7A is a graph displaying ,B-gal activity after transfection of FGF2/poly-L-lysine/pSV~-gal into COS cells (lane 1), B16 cells (lane 2), NIH 3T3cells (lane 3), and BHK cells (lane 4).
Figure 7B is a graph depicting ~-gal expression in COS cells, pSV,B-gal S (lanes 1, 3) or pNASS~-gal (lanes 2, 4) were incubated with (lanes 1, 2) or without (lanes 3, 4) FGF2-K84 and the complexes incubated on COS cells for 48 hrs.
Figure 7C is a graph showing activity of ,B-gal activity at various times following transfection with either plasmid alone or with complexes of FGF2/K84/pSV
,~3-gal. -A-, DNA alone; ----, FGF2-K84-DNA.
Figure 7D is a graph showing 13-gal activity after transfection of various concentrations of FGF2/K84/pSV13-gal. Lane 1, O~lg; lane 2, 0,l,~Lg; lane 3, l,ug; lane 4, S,ug; lane 5, lO,ug.
Figure 8A is a graph showing 13-gal activity in COS cells following transfection of FGF2-K84-pSV,B-gal (lane 1), FGF2+K84+pSV,13-gal (lane 2), FGF2+pSV,B-gal (lane 3), K84+pSV,~-gal (lane 4); pSV,~-gal (lane 5), FGF2-K84 (lane 6), FGF2 (lane 7) and K84 (lane 8).
Figure 8B is a graph showing completion for cell bin~1ing~ Lane 1, FGF2-K84-pSV,B-gal complex transfected into COS cells; lane 2, FGF2-K84-pSV,B-gal plus 100 ,ug FGF2; lane 3, no complex.
Figure 8C is a graph showing the attenuation of ,B-gal activity upon the addition of heparin during transfection. Lane 1, FGF2-K84-pSV~-gal+lO,ug heparin;
lane 2, FGF2-K84-pSV~3-gal; lane 3, heparin alone; lane 4, pSV,B-gal alone.
Figure 8D is a graph showing ligand targeting of DNA, pSV~-gal DNA
alone (lane 1), FGF2-K84 (lane 2), histone Hl-K84 (lane 3) and cytochrome C-K84 (lane 4) were conclen~ecl with pSV~-gal DNA and added to BHK cells. 13-gal activity was measured 48 hr later.
Figure 9A is a graph showing the effect of chloroquine on ~-gal expression, pSV13-gal and FGF2-K84 were mixed in the absence (lane 1) or presence (lane 2) of 100 ~LM chloroquine and incubated for 1 hr at room temperature prior to addition of the complexes to COS cells. Lane 3, chloroquine alone; lane 4, DNA alone.

Figure 9B is a graph showing the effect of endosome disruptive peptide on ,B-gal t~ s~ion. Lane 1, control; lane 2, FGF2-K84-pSV~13-gal; lane 3, FGF2-K84-pSV,B-gal+EDP.
Figure 9C are photographs of cells stained for ,B-gal activity following 5 transfection of COS cells with (right panel) or without (left panel) endosome disruptive peptide and FGF2-K84-pSV,[~-gal.
Figure 10 is a photograph of a fluorograph analyzing cell-free translation products. Lane 1, no RNA; lane 2, saporin RNA; lane 3, luciferase RNA; lane 4, saporin RNA and luciferase RNA; lane 5, saporin RNA followed 30 min later with 10 luciferase RNA.
Figure 11 is a graph depicting direct ~;yLolo2~icity of cells transfected by a CaPO4 with an expression vector encoding saporin. Lane 1, mock transfection; lane 2, transfection with pSV~-gal; lane 3, transfection with saporin-co~ g vector.
Figure 12 is a pair of graphs showing cytotoxicity of cells transfected 15 with FGF2-K84-pSVSAP. Left panel, BHK21 cells; right panel, NIH 3T3 cells. Lane 1, FGF2-K84-pSV~-gal; lane 2, FGF2-K84-pSVSAP.
Figure 13A is a graph showing 13-gal activity with an endosome disruptive peptide in the complex.
Figure 13B is a graph showing ,B-gal activity with an endosome 20 disruptive peptide in the complex.
Figure 13C is a graph showing ,B-gal activity with an endosome disruptive peptide in the complex.

Detailed Description of the Invention 25 Definitions All U.S. patents and all publications mentioned herein are incorporated in their entirety by reference thereto.
The "amino acids," which occur in the various amino acid sequences appearing herein, are identified according to their well known, three letter or one letter abbreviations. The nucleotides, which occur in the various DNA fragments, are ~le~ign~ted with the standard single letter designations used routinely in the art.
As used herein, to "bind to a receptor" refers to the ability of a ligand to specifically recognize and detectably bind to such receptors, as assayed by standard in vitro assays. For example, as used herein, binding measures the capacity of a VEGF
conjugate, VEGF monomer, or VEGF dimer to recognize a VEGF receptor on a vascular endothelial cell, such as an aortic vascular endothelial cell line, using a procedure substantially as described in Moscatelli, J. Cell Physiol. 131:123-130, 1987.
As used herein, "biological activity" refers to the in vivo activities of a compound or physiological responses that result upon in vivo sl~lmini~tration of a c~mpound, composition or other ~ Lure. Biological activity thus encompasses therapeutic effects and ph~rm~ce.utical activity of such compounds, compositions and mixtures. Such biological activity may be defined with reference to particular in vitro activities as measured in a defined assay. For example, reference herein to the biological activity of FGF, or fr~gment~ of FGF, refers to the ability of FGF to bind to cells bearing FGF receptors and int~rn~li7P a linked agent. Such activity is typically zleses.~e-1 in vitro by linking the FGF to a cytotoxic agent, such as saporin, contacting cells bearing FGF receptors, such as fibroblasts, with the conjugate and ~ses~in~ cell proliferation or growth. In vivo activity may be determined using recognized animal models, such as the mouse xenograft model for anti-tumor activity (see, e.g, Beitz et al., Cancer Research 52:227-230, 1992; Houghton et al., Cancer Res. 42:535-539, 1982; Bogden et al., Cancer (Philadelphia) 48:10-20, 1981; Hoogenhout et al., Int. J.
Radiat. Oncol., Biol. Phys. 9:871-879, 1983; Stastny et al., Cancer Res. 53:5740-5744, 1993).
As used herein, reference to the "biological activity of a cytocide-encoding agent," such as DNA encoding saporin, refers to the ability of such agent to interfere with the metabolism of the cell by inhibiting protein synthesis. Such biological or cytotoxic activity may be assayed by any method known to those of skill in the art including, but not limited to, in vitro assays that measure protein synthesis and in vivo assays that assess cytotoxicity by measuring the effect of a test compound on cell proliferation or on protein synthesis. Assays that assess cytotoxicity in targeted cells are particularly plc;r~,..ed.
As used herein, a "conjugate" refers to a molecule that contains at least one receptor-int~rn~1i7l?~1 binding ligand and at least one nucleic acid binding domain 5 that are linked directly or via a linker and that are produced by chemical coupling methods or by recombinant expression of chimeric DNA molecules to produce fusionproteins.
A "cytocide-encoding agent" is a nucleic acid molecule that encodes a protein that inhibits protein synthesis. Such a protein may act by cleaving rRNA or 10 ribonucloprotein, inhibiting an elongation factor, cleaving mRNA, or other mech~ni~m that reduces protein synthesis to a level such that the cell cannot survive. The cytocide-encoding agent may contain additional elements besides the cytocide gene. Such element~ include a promoter, enh~n-~t?r, splice sites, transcription termin~t- r, poly(A) signal sequence, b~''tlori~l or m~mm~ n origins of replication, selection markers, and 15 the like.
As used herein, the term "cytotoxic agent" refers to a molecule capable of inhibiting cell function. The agent may inhibit proliferation or may be toxic to cells.
A variety of cytotoxic agents can be used and include those that inhibit proteinsynthesis and those that inhibit expression of certain genes essential for cellular growth 20 or survival. Cytotoxic agents include those that result in cell death and those that inhibit cell growth, proliferation and/or dirre.~llLiation.
As used herein, cytotoxic agents include, but are not limited to, saporin, the ricins, abrin and other ribosome inactivating proteins (RIPs), aquatic-derived cytotoxins, Pseudomonas exotoxin, inhibitors of DNA, RNA or protein synthesis, such 25 as antisense nucleic acids, other metabolic inhibitors, such as DNA cleaving molecules, prodrugs, such as thymidine kinase from HSV and bacterial cytosine ~lczlrnin~ce, and light activated porphyrin. While saporin is the ~lefc,l~d RIP, other suitable RlPs include ricin, ricin A chain, maize RIP, gelonin, diphtheria toxin, diphtheria toxin A
chain, trichos~nthin, tritin, pokeweed antiviral protein (PAP), mirabilis antiviral protein 30 (MAP), Di~nthin~ 32 and 30, abrin. monordin, bryodin, shiga, a catalytic inhibitor of protein biosynthesis from cucumber seeds (see, e.g, WO 93/24620), Pseudomonas exotoxin, biologically active fragments of cytotoxins and others known to those of skill in this art. Suitable cytotoxic agents also include cytotoxic molecules that inhibit cellular metabolic processes, including transcription, translation, biosynthetic or degradative ~dLhwdy~, DNA synthesis, and other such processes that kill cells or inhibit cell proliferation.
"Heparin-binding growth factor" refers to any member of a family of heparin-binding growth factor proteins, in which at least one member of the family binds heparin. Plt;f~ d growth factors in this regard include FGF, VEGF, and HBEGF. Such growth factors encompass isoforms, peptide fr~E~ment.~ derived from a family member, splice variants, and single or multiple exons, some forms of which may not bind heparin.
As used herein, to "hybridize" under conditions of a specified stringency is used to describe the stability of hybrids formed between two single-stranded nucleic acid molecules. Stringency of hybridization is typically expressed in conditions of ionic strength and telll~;ldLule at which such hybrids are annealed and washed. Typically high, medium and low stringency encompass the following conditions or equivalentconditions thereto:
1) high stringency: 0.1 x SSPE or SSC, 0.1% SDS, 65~C
2) medium stringency: 0.2 x SSPE or SSC, 0.1% SDS, 50~C
3) low stringency: 1.0 x SSPE or SSC, 0.1% SDS, 50~C.
"Nucleic acid binding domain" (NABD) refers to a molecule, usually a protein, polypeptide, or peptide (but may also be a polycation) that binds nucleic acids, such as DNA or RNA. The NABD may bind to single or double strands of RNA or DNA or mixed RNA/DNA hybrids. The nucleic acid binding domain may bind to a specific sequence or bind irrespective of the sequence.
As used herein, "nucleic acids" refer to RNA or DNA that are inten(let1 for internalization into a cell and includes, but are not limited to, DNA encoding a therapeutic protein, DNA encoding a cytotoxic protein, DNA encoding a prodrug, DNA
encoding a cytocide, the complement of these DNAs, an antisense nucleic acid and CA 0222l269 l997-ll-l4 other such molecules. Reference to nucleic acids includes duplex DNA, single-stranded DNA, RNA in any form, including triplex, duplex or single-stranded RNA, anti-sense RNA, polynucleotides, oligonucleotides, single nucleotides, chimeras, and derivatives thereof. ,, Nucleic acids may be composed of the well-known deoxyribonucleotides and ribonucleotides composed of the bases adenosine, cytosine, guanine, thymi~iin~ and uridine. As well, various other nucleotide derivatives and non-phosphate backbones or phosphate-derivative backbones may be used. For example, because norrnal phosphodiester oligonucleotides (referred to as PO oligonucleotides) are sensitive to 10 DNA- and RNA-specific nucleases, several resistant types of oligonucleotides have been developed in which the phosphate group has been altered to a phosphotriester, methylphosphonate, or phosphorothioate (see U.S. Patent No. 5,218,088).
As used herein, "operative linkage" or operative association of heterologous DNA to regulatory and effector sequences of nucleotides, such as 15 promoters, enhancers, transcriptional and translational stop sites, refers to the functional relationship between such DNA and such sequences of nucleotides. For exarnple, operative linkage of heterologous DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initi~tt-rl from the promoter by an RNA polymerase that specifically20 recognizes, binds to and transcribes the DNA in reading frame.
As used herein, the term "polypeptide reactive with an FGF receptor"
refers to any polypeptide that specifically interacts with an FGF receptor, preferably the high-affinity FGF receptor and that is transported into the cell by virtue of its interaction with the FGF receptor. Polypeptides reactive with an FGF receptor are also 25 called FGF proteins. Such polypeptides include, but are not limited to, FGF-l to FGF-9. For example, bFGF (FGF-2) should be generally understood to refer to polypeptides having substantially the same amino acid sequences and receptor-targeting activity as that of bovine bFGF or human bFGF. It is understood that differences in amino acid sequences can occur among FGFs of different species as well as among FGFs *om 30 individual org~ni~mc or species. In addition, chimeras or hybrids of any of FGF-l through FGF-9, or FGFs that have deletions (see, e.g, PCT Application No. WO
90/02800), insertions or substitutions of amino acids are within the scope of FGF
proteins, as long as the resulting peptide or protein specifically interacts with an FGF
receptor and is int~rn~li7~cl by virtue of this interaction.
As used herein, a "prodrug" is a compound that metabolizes or otherwise converts an inactive, nontoxic compound to a biologically, rhz~rm~ eutically, therapeutically, of toxic active form of the compound. A prodrug may also be a ph~rm~reutically inactive compound that is modified upon ~lmini~tration to yield an active compound through metabolic or other processes. The prodrug may alter the metabolic stability or the transport characteristics of a drug, mask side effects or toxicity, improve or alter other characteristics or properties of a drug. By virtue of knowledge of rh~rm~odynamic processes and drug metabolism in vivo, those of skill in this art, once a rhz~rm~e~ltically active compound is known, can design inactive forms of the compound (see, e.g, Nogrady, Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, pages 388-392, 1985).
As used herein, "receptor-binding intçrn~li7~(1 ligand" or "ligand" refers to any peptide, polypeptide, protein or non-protein, such as a peptidomimetic, that is capable of binding to a cell-surface molecule and is intern~li7t-~l Within the context of this invention, the receptor-binding int~rn~li7t?rl ligand is conjugated to a nucleic acid binding domain, either as a fusion protein or through chemical conjugation, and is used to deliver a cytocide-encoding or pro-drug encoding agent to a cell. In one aspect, the ligand is directly conjugated to a nucleic acid molecule, which may be further complexed with a nucleic acid binding domain. Such ligands include growth factors, cytokines, antibodies or fragments thereof, hormones, and the like.
As used herein, "saporin" (abbreviated herein as SAP) refers to polypeptides that are isolated from the leaves or seeds of Saponaria off cinalis, as well as modified forms that have amino acid substitutions, deletions, insertions or additions, which still express substantial ribosome inactivating activity. Purified preparations of saporin are frequently observed to include several molecular isoforms of the protein. It is understood that differences in amino acid sequences can occur in saporin from WO 96136362 PCrlUS96/07164 different species as well as between saporin molecules from individual or~ni~m~ of the same species. Saporin for use herein may be purified from leaves, chemically synthe~i7P~I, or synthesized by e~plession of DNA encoding a saporin polypeptide.
AS used herein, a "targeted agent" is a nucleic acid molecule that is S intPn~ 1 for intt?rn~li7~tion by complexing or linkage to a receptor-binding intern~li7P~1 ligand, and nucleic acid binding domain, and that upon intprn~li7~tion in some manner alters or affects cellular metabolism, growth, activity, viability or other property or characteristic of the cell.
AS used herein, a "therapeutic nucleic acid" describes any nucleic acid molecule used in the context of the invention that modifies gene transcription or translation. This term also includes nucleic acids that bind to sites on proteins. It includes, but is not limited to, the following types of nucleic acids: nucleic acids encoding a protein, ~nti~.?n~e RNA, DNA intended to form triplex molecules, extracellular protein binding oligonucleotides, and small nucleotide molecules. A
therapeutic nucleic acid may be used to effect genetic therapy by serving as a repl~cemP.nt for a defective gene, by encoding a therapeutic product, such as I~NF, or by encoding a cytotoxic molecule, especially an enzyme, such as saporin. The thc~eutic nucleic acid may encode all or a portion of a gene, and may function by recombining with DNA already present in a cell, thereby replacing a defective portion of a gene. It may also encode a portion of a protein and exert its effect by virtue of co-suppression of a gene product.

PREPARATION OF RECEPTOR-BINDING INTERNALIZED LIGAND, NUCLEIC ACID BINDING
DOMAIN AND CYTOCIDE_ENCODING AGENT COMPLEXES
AS noted above, the present invention provides cytocide-encoding agents complexed with a conjugate of a receptor-binding internzlli7~d ligand and a nucleic acid binding domain. Upon binding to an a~ o~liate receptor, the complex is intern~li7.?~1 by the cell and is trafficked through the cell via the endosomal compartment, where at least a portion of the complex may be cleaved.

CA 0222l269 l997-ll-l4 A. Receptor-bindin~ intern~li7~?rl li~ands As noted above, receptor-binding intern~li7~cl ligands are used to deliver a cytocide-encoding agent to a cell ~x~les~ g an ~plupfiate receptor on its cell. surface. Numerous molecules that bind specific receptors have been identified and are suitable for use in the present invention. Such molecules include growth factors, cytokines, and antibodies. Many growth factors and families of growth factors share structural and functional features and may be used in the present invention. One such family of growth factors specifically binds to hep~rin The ability of heparin-binding growth factors to interact with heparin appears in general to be a reflection of a physiologically more relevant interaction occurring in vivo between these factors and heparin sulfate proteoglycan molecules, which are found on the surface of cells and in extracellular matrix. Heparin-binding growth factors include the fibroblast growth factors FGF-l through FGF-9, vascular endothelial growth factor (VEGF), and heparin binding-epidermal growth factor (HBEGF). Antibodies that are specific to cell surface molecules expressed by a selected cell type are readily generated as monoclonals or polyclonal antisera. Many such antibodies are available (e.g, American Type Culture Collection, Rockville, MD). Other growth factors, such as PDGF (platelet-derivedgrowth factor), EGF (epidermal growth factor), TGF-a (tumor growth factor), TGF-~, IGF-I (insulin-like growth factor), and IGF-II also bind to specific identified receptors on cell surfaces and may be used in the present invention. Cytokines, including interleukins, CSFs (colony stimulating factors), and h,lelrelolls, have specific receptors, which are mostly found on hematopoeitic cells, and may be used as described herein.
These ligands are discussed in more detail below.
Fragments of these ligands may be used within the present invention, so long as the fragment retains the ability to bind to the ~lvpliate cell surface molecule.
Likewise, ligands with substitutions or other alterations, but which retain binding ability, may also be used.

1. Fibroblast ~rowth factors One family of growth factors that has a broad spectrum of activities is the fibroblast growth factor (FGF) family. These proteins share the ability to bind to = ~

heparin, induce intracellular receptor-mediated tyrosine phosphorylation and the~res~ion of the c-fos mRNA transcript, and stimulate DNA synthesis and cell proliferation. This farnily of proteins includes FGFs ~lecign~te~l FGF-1 (acidic FGF
(aFGF)), FGF-2 (basic FGF (bFGF)), FGF-3 (int-2) (see, e.g, Moore et al., EMBO
5 5:919-924, 1986), FGF-4 (hst-1/K-FGF) (see, e.g, !~k~moto et al., Proc. Natl. Acad.
Sci. USA 86:1836-1840, 1986; U.S. PatentNo. 5,126,323), FGF-5 (see, e.g., U.S. Patent No. 5,155,217), FGF-6 (hst-2) (see, e.g, published European Application EP 0 488 196 A2; Uda et al., Oncogene 7:303-309, 1992), FGF-7 (keratinocyte growth factor) (KGF) (see, e.g, Finch et al., Science 245:752-755, 1985; Rubin et al., Proc. Natl. Acad. Sci.
0 USA ~6:802-806, 1989; and Tnt~rn~tional Application WO 90/08771), FGF-8 (see, e.g, Tanaka et al., Proc Natl. Acad. Sci. USA 89:8528-8532, 1992); and FGF-9 (see, Miyarnotoetal., Mol. Cell.Biol. 13:4251-4259, 1993).
DNA encoding FGF peptides and/or the arnino acid sequences of FGFs are known to those of skill in the art. DNA encoding an FGF may be prepared 15 synthetically based on a known arnino acid or DNA sequence, isolated using methods known to those of skill in the art, or obtained ~om cornmercial or other sources. DNA
encoding virtually all of the FGF family of peptides is known. For example, DNA
encoding human FGF-1 (Jaye et al., Science 233:541-545, 1986; U.S. Patent No. 5,223,483), bovine FGF-2 (Abraharn et al., Science 233:545-548, 1986; Esch et al., 20 Proc. Natl. Acad. Sci. USA 82:6507-6511, 1985; and U.S. Patent No. 4,956,455), human FGF-2 (Abraham et al., EMBO J. 5:2523-2528, 1986; U.S. Patent No. 4,994,559; U.S. Patent No. 5,155,214; EP 470,183B; and Abraham et al., Quant.
Biol. 51:657-668, 1986) and rat FGF-2 (see Shim~ ki et al., Biochem. Biophys. Res.
Comm., 1988, and Kurokawa et al., N7lcleic Acids Res. 16:5201, 1988), FGF-3, FGF-6, 25 FGF-7 and FGF-9 are known (see also U.S. Patent No. 5,155,214; U.S. Patent No. 4,956,455; U.S. Patent No. 5,026,839; U.S. Patent No. 4,994,559, EP 0,488,196 A2, DNASTAR, EMBL or GenBank databases, and references discussed above and below). DNA encoding an FGF may be produced from any of the prece-lingDNA fragments by substitution of degenerate codons. It is understood that once the 30 complete amino acid sequence of a peptide, such as an FGF peptide, and the DNA

=

fragment encoding such peptide are available to those of skill in this art, it is routine to substitute degenerate codons and produce any of the possible DNA fr~gment~ that encode such peptide. It is also generally possible to synthesi7~ DNA encoding such peptide based on the amino acid sequence.
Thus, as used herein, "FGF" refers to polypeptides having amino acid - sequences of native FGF proteins, as well as modified sequences, having amino acid substitutions, deletions, insertions or additions in the native protein but ~ the ability to bind to FGF receptors and to be intt?rn~li7Ptl It is Imflerstood that differences in amino acid sequences can occur among FGFs of different species as well as among FGFs from individual org~ni~m~ or species.
Reference to FGFs is intende~l to encompass proteins isolated from natural sources as well as those made synthetically, as by recombinant means or possibly by chemical synthesis. FGF also encompasses muteins that possess the ability to bind to FGF-receptor expressing cells. Such muteins inchl~le, but are not limited to, those produced by replacing one or more of the cysteines with serine as described herein or that have any other amino acids deleted or replaced as long as the resulting protein has the ability to bind to FGF-receptor bearing cells and int~rn~li7~- the linked targeted agent. Typically, such mlltein~ will have conservative amino acid changes, such as those set forth below in Table 1. DNA encoding such muteins will, unlessmodified by replacement of degenerate codons, hybridize under conditions of at least low stringency to native DNA sequence encoding the starting FGF.
Acidic and basic FGF are about 55% identical at the amino acid level and are highly conserved among species. The other members of the FGF i~amily have a high degree of amino acid sequence similarities and common physical and biological properties with FGF-l and FGF-2, including the ability to bind to one or more FGF
receptors. Basic FGF, int-2, hst-l/K-FGF, FGF-5, hst-2/FGF-6 and FGF-8 may have oncogenic potential; bFGF is expressed in melanomas, int-2 is expressed in m~mm~ry tumor virus and hst-l/K-FGF is expressed in angiogenic tumors. Acidic FGF, bFGF,KGF and FGF-9 are expressed in normal cells and tissues.

-W 096/36362 PCT~US96/07164 FGFs exhibit a mitogenic effect on a wide variety of mesenchymal, endocrine and neural cells and are also important in differentiation and development.
Of particular interest is their stimulatory effect on collateral vasc~ n7~ion and angiogenesis. In some instances, FGF-in~ re~ mitogenic stimlll~tion may be S detrimental. For example, cell proliferation and angiogenesis are an integral aspect of tumor growth. Members of the FGF family, including bFGF, are thought to play a pathophysiological role, for example, in tumor development, rheumatoid arthritis, proliferative diabetic retinopathies and other complications of diabetes.
The effects of FGFs are m~ tt?d by high affinity receptor tyrosine 10 kinases present on the cell surface of FGF-responsive cells (see, e.g., PCT WO
91/00916, WO 90/05522, PCT WO 92/12948; Imamura et al., Biochem. Biophys. Res.
Comm. 155:583-590, 1988, Huang et al., J. Biol. Chem. 261:9568-9571, 1986; Partanen etal.,EMBO~ 10:1347, l991,andMoscatelli,J. Cell. P~ysiol. 131:123, 1987). Lower affinity receptors also appear to play a role in me~ ting FGF activities. The high 15 affinity receptor proteins are single chain polypeptides with molecular weights ranging from 110 to 150 kD, depending on cell type that constitute a family of structurally related FGF receptors. Four FGF receptor genes have been identified, and three of these genes generate multiple mRNA transcripts via alternative splicing of the primary transcript.
2. Vascular endothelial ~rowth factors Vascular endothelial growth factors (VEGFs) were identified by their ability to directly stimulate endothelial cell growth, but do not appear to have mitogenic effects on other types of cells. VEGFs also cause a rapid and reversible increase in 25 blood vessel permeability. The members of this family have been referred to variously as vascular endothelial growth factor (VEGF), vascular permeability factor (VPF) and vasculotropin (see, e.g, Plouet et al., EMBO ~ 8:3801-3806, 1989). Herein, they are collectively referred to as VEGF.
VEGF was originally isolated from a guinea pig heptocarcinoma cell 30 line, line 10 (see, e.g., U.S. Patent No. 4,456,550), and has subsequently been identified in humans and in normal cells. It is expressed during normal development and in certain normal adult organs. Purified VEGF is a basic, heparin-binding, homodimeric glyco~ tehl that is heat-stable, acid-stable and may be inactivated by ret11l~inp; agents.
DNA sequences encoding VEGF and methods to isolate these sequences . may be found primarily in U.S. Patent No. 5,240,848, U.S. Patent No. 5,332,671, U.S.
5 Patent No.5,219,739, U.S. Patent No.5,194,596, and Houch etal., Mol. Endocrin.5:180, 1991. As used herein, "DNA encoding a VEGF peptide or polypeptide" refers to any of the DNA fr~gment~ set forth herein as coding such peptides, to any such DNA
fr~gments known to those of skill in the art, any DNA fragment that encodes a VEGF
that binds to a VEGF receptor and is intern~li7~1 thereby. VEGF DNA may be isolated 10 from a human cell library, for example, using any of the precet1in~ DNA fr~gment~ as a probe or any DNA fragment that encodes any of the VEGF peptides set forth in SEQ ID
NOs. 1-4. It is understood that once the complete amino acid sequence of a peptide, such as a VEGF peptide, and the DNA fragment encoding such peptide are available to those of skill in this art, it is routine to substitute degenerate codons and produce any of 15 the possible DNA fr~gment~ that encode such peptide. It is also generally possible to synthe~i7~ DNA encoding such peptide based on the amino acid sequence.
VEGF family members arise from a single gene org~ni7~o~1 as eight exons and ~ g approximately 14 kb in the human genome. Four molecular species of VEGF result from alternative splicing of mRNA and contain 121, 165, 189 and 206 20 amino acids. The four species have similar biological activities, but differ markedly in their secretion patterns. The predominant isoform secreted by a variety of normal and transformed cells is VEGFI65. Transcripts encoding VEGFl2~ and VEGFl89 are detectable in most cells and tissues that express the VEGF gene. In contrast, VEGF206 is less abundant and has been identified only in a human fetal liver cDNA library.
25 VEGFl2l is a weakly acidic polypeptide that lacks the heparin binding domain and, consequently, does not bind to heparin. VEGFl89 and VEGF206 are more basic than VEGFl65 and bind to heparin with greater affinity. Although not every identified VEGF
isoform binds heparin, all isoforms are considered to be heparin-binding growth factors within the context of this invention.

The secreted isoforms, VEGFI2, and VEGFI65 are plcrellcd VEGF
proteins. The longer isoforms, VEGFI89 and VEGF206, are almost completely bound to the extracellular matrix and need to be released by an agent, such as sllr~rnin, heparin or hep~rin~ce7 or plasmin. Other ~lcrellcd VEGF proteins contain various combinations S of VEGF exons, such that the protein still binds VEGF receptor and is int~ rrl~li7~1 It is not necessary that a VEGF protein used in the context of this invention either retain any of its in vivo biological activities, such as stim~ ting endothelial cell growth, or bind heparin. It is only n~cPss~ry that the VEGF protein or fragment thereof bind the VEGF
receptor and be intern~li7.o~1 into the cell bearing the receptor. However, it may be 10 desirable in certain contexts for VEGF to m~nifest certain of its biological activities.
For example, if VEGF is used as a carrier for DNA encoding a molecule useful in wound healing, it would be desirable that VEGF exhibit vessel permeability activity and promotion of fibroblast migration and angiogenesis. It will be a~ clll from the tç~ching.c provided within the subject application which of the activities of VEGF are 15 desirable to m~int~in VEGF promotes an array of responses in endothelium, including blood vessel hyperpermeability, endothelial cell growth, angiogenesis, and enhanced glucose transport. VEGF stimulates the growth of endothelial cells from a variety of sources (including brain capillaries, fetal and adult aortas, and urnbilical veins) at low 20 concentrations, but is reported to have no effect on the growth of vascular smooth muscle cells, adrenal cortex cells, keratinocytes, lens epithelial cells, or BHK-2 1 fibroblasts. VEGF also is a potent polypeptide regulator of blood vessel function; it causes a rapid but transient increase in microvascular permeability without c~llcing endothelial cell damage or mast cell degranulation, and its action is not blocked by 25 ~ntihict:~min~c VEGF has also been reported to induce monocyte migration and activation and has been implicated as a tumor angiogenesis factor in some human gliomas. Also, VEGF is a chemoattractant for monocytes and VEGF has been shown to enhance the activity of the infl~mm~tory mediator tumor necrosis factor (TNF).
Quiescent and proliferating endothelial cells display high-affinity 30 binding to VEGF, and endothelial cell responses to VEGF appear to be mediated by high affinity cell surface receptors (see, e.g, Tntern~tional Application WO 92/14748, which is based on U.S. Applications Serial No. 08/657,236, de Vries et al., Science 255:989-91, 1992, Terman et al., Biochem. Biophys. Res. Commun. 187:1579-1586, 1992, Kendall et al., Proc. Natl. Acad. Sci. USA 90:10705-10709, 1993; and Peters et 5 al., Proc. Natl. Acad. Sci. USA 90:8915-8919, 1993). Two tyrosine kinases have been identified as VEGF receptors. The first, known as fms-like tyrosine kinase or FLT is a receptor tyrosine kinase that is specific for VEGF. In adult and embryonic tissues, expression of FLT mRNA is localized to the endothelium and to populations of cells that give rise to endothelium. The second receptor, KDR (human kinase insert domain-10 co.~ receptor), and its mouse homologue FLK-l, are closely related to FLT. The KDR/FLK-l receptor is expressed in endothelium during the fetal growth stage, during earlier embryonic development, and in adult tissues. In addition, messenger RNA
encoding FLT ar d KDR have been identified in tumor blood vessels and specifically by endothelial cells of blood vessels supplying glioblastomas. Similarly, FLT and KDR
15 mRNAs are upregulated in tumor blood vessels in invasive human colon adenocarcinoma, but not in the blood vessels of adjacent normal tissues.

3. Heparin-bindin~ epidermal ~rowth factors Several new mitogens in the epidermal growth factor protein family have 20 recently been identified that display the ability to bind the glycosaminoglycan heparin.
Among these is the mitogen known as heparin-binding EGF-like growth factor (HBEGF), which elutes from heparin-SepharoseTM columns at about 1.0 - 1.2 M NaCland which was first identified as a secreted product of cultured human monocytes, macrophages, and the macrophage-like U-937 cell line (Higashiyama et al., ~Science 25 251:936-939, 1991, Besner et al., Cell Regul. 1:811-19, 1990). HBEGF has beenshown to interact with the same high affinity receptors as EGF on bovine aortic smooth muscle cells and human A431 epidermoid carcinoma cells (Higashiyama, Science 251:936-939, 1991).
HBEGFs exhibit a mitogenic effect on a wide variety of cells including 30 BALB/c 3T3 fibroblast cells and smooth muscle cells, but unlike VEGFs, are not mitogenic for endothelial cells (Higashiyama et al., Science 251:936-939, 1991).

WO 96/36362 PCTfUS96/07164 HBEGF also has a ~tim~ tQry effect on collateral vasc~ n7~tion and angiogenesis.Members of the HBEGF family are thought to play a pathophysiological role, for example, in a variety of tumors, such as bladder carcinomas, breast tumors and non-small cell lung tumors. Thus, these cell types are likely candidates for delivery of 5 cytocide-encoded agents.
HBEGF isolated from U-937 cells is heterogeneous in structure and contains at least 86 amino acids and two sites of O-linked glycosyl groups (Higashiyama et al., J. Biol. Chem. 267:6205-6212, 1992). The carboxyl-termin~l half of the secreted HBEGF shares approximately 35% sequence identity with human EGF,10 including six cysteines spaced in the pattern characteristic of members of the EGF
protein family. In contrast, the amino-tt?rmin~l portion of the mature factor ischar~cteri7~1 by stretches of hydrophilic residues and has no structural equivalent in EGF. Site-directed mutagenesis of HBEGF and studies with peptide fr~gment~ have indicated that the heparin-binding sequences of HBEGF reside primarily in a 21 amino 15 acid stretch upstream of and slightly overlapping the EGF-like domain.
The effects of HBEGFs are mediated by EGF receptor tyrosine kinases expressed on cell surfaces of HBEGF-responsive cells (see, e.g, U.S. Patent Nos.5,183,884 and 5,218,090, and Ullrich et al., Nature 309:4113-425, 1984). The EGFreceptor proteins, which are single chain polypeptides with molecular weights 170 kD, 20 constitute a family of structurally related EGF receptors. Cells known to express the EGF receptors include smooth muscle cells, fibroblasts, keratinocytes, and numerous human cancer cell lines, such as the: A431 (epidermoid); KB3-1 (epidermoid); COLO
205 (colon); CRL 1739 (gastric); HEP G2 (hepatoma); LNCAP (prostate); MCF-7 (breast); MDA-MB-468 (breast); NCI 417D (lung); MG63 (osteosarcoma); U-251 25 (glioblastoma); D-54MB (glioma); and SW-13 (adrenal).
For the purposes of this invention, HBEGF need only bind a specific HBEGF receptor and be intern~li7~1 Any member of the HBEGF family, whether or not it binds heparin, is useful within the context of this invention as long as it meets the requirements set forth above. Members of the HBEGF family are those that have 30 sufficient nucleotide identity to hybridize under nolmal stringency conditions (typically greater than 75% nucleotide identity). Subfragments or subportions of a full-length HBEGF may also be desirable. One skilled in the art may find from the te~chin~s provided within that certain biological activities are more or less desirable, depending upon the application.
DNA encoding an HBEGF peptide or polypeptide refers to any DNA
fragment encoding an HBEGF, as defined above. Exemplary DNA fr~gmentc include:
any such DNA fr~gment~ known to those of skill in the art; any DNA fragment thatencodes an HBEGF or fragment that binds to an HBEGF receptor and is int~?rn~li7~cl thereby, and any DNA fragment that encodes any of the HBEGF polypeptides set forth in SEQ ID NOs. 5-8. Such DNA sequences encoding HBEGF friqEment~ are available from publicly ~ccessihle ~l~t~h~es, such as: EMBL, GenBank (Accession Nos. M93012 (monkey) and M60278 (human)), the plasmid pMTN-HBEGF (ATCC #40900) and pAX-HBEGF (ATCC #40899) (described in PCT Application WO/92/06705), and Abraham et al., Biochem. Biophys. Res. Comm. 190:125-133, 1993). Unless modifiedby repl~ m~nt of degenerate codons, DNA encoding HBEGF polypeptides will hybridize under conditions of at least low stringency to DNA encoding a native human HBEGF (e g, SEQ ID NO. 9). In addition, any DNA fragment that may be produced from any of the prece~lin~ DNA fragments by substitution of degenerate codons is also contemplated for use herein. It is understood that since the complete amino acidsequence of HBEGF polypeptides, and DNA frs-gment~ encoding such peptides, are available to those of skill in this art, it is routine to substitute degenerate codons and produce any of the possible DNA fragments that encode such HBEGF polypeptides. It is also generally possible to synthe~i7~ DNA encoding such peptides based on theamino acid sequence.
4. Other receptor-bindin~ intern~li7~ d li~ands Other receptor-binding ligands may be used in the present invention.
Any protein, polypeptide, analogue, or fragment that binds to a cell-surface receptor and is intern~li7t?t1 may be used. In general, in addition to the specific heparin-binding growth factors discussed above, other growth factors and cytokines are especially well suited for use. These ligands may be produced by recombinant or other means in WO 9''36362 PCT/US96/07164 preparation for conjugation to the nucleic acid binding domain. The DNA sequences and methods to obtain the sequences of these receptor-binding intf~ i7~ ligands are well known. For example, these ligands include CSF-l (GenBank Accession Nos.
M11038, M37435; Kawasaki et al., Science 230:291-296, 1985; Wong et al., Science5 235:1504-1508, 1987); GM-CSF (GenBank Accession No.X03021; Miyatake et al., EMBO J: 4:2561-2568, 1985); IFN-a (interferon) (GenBank Accession No. A02076;
Patent No. WO 8502862-A, July 4, 1985); IFN-~ (GenBank Accession No. A02137;
Patent No. WO 8502624-A, June 20, 1985); hepatoc,vte growth factor (GenBank Accession No. X16323, S80567, X57574; Nakamura, et al., Nature 342:440-443, 1989;
10 Nakamura et al., Prog Growth FactorRes. 3:67-85, 1991; Miyazawa et al., Eur. J.
Biochem. 197:15-22, 1991); IGF-Ia (Insulin-like growth factor Ia) (GenBank Accession No. X56773, S61841; Sandberg-Nordqvist et al., Brain Res. Mol. Brain Res. 12:275-277, 1992; Sandberg, Sandberg-Nordqvist et al., Cancer Res. 53:2475-2478, 1993);IGF-Ib (GenBank Accession No. X56774 S61860; Sandberg-Nordqvist et al., Brain 15 Res. Mol. Brain Res. 12:275-277, 1992; Sandberg-Nordqvist, A.C., Cancer Res.
53:2475-2478, 1993); IGF-I (GenBank Accession No. X03563, M29644; Dull et al., Nature 310:771-781, 1984; Rall et al., Meth. Enymol. 146:239-248, 1987); IGF-II
(GenBank Accession No. J03242; Shen et al., Proc. Natl. Acad. Sci. USA 85:1947-1951, 1988); IL-l-a (interleukin 1 alpha) (GenBank Accession No. X02531, M15329;20 March et al., Nature 315:641-647, 1985; Nishida et al., Biochem. Biophys. Res.
Commun. 143:345-352, 1987); IL-l-~ (interleukin 1 beta) (GenBank Accession No. X02532, M15330, M15840; March et al., Nature 315:641-647, 1985; Nishida et al., Biochem. Biophys. Res. Commun. 143:345-352, 1987; Bensi et al., Gene 52:95-101, 1987); IL-l (GenBank Accession No. K02770, M54933, M38756; Auron et al., Proc.
25 Natl. Acad. Sci. USA 81:7907-7911, 1984; Webb et al., Adv. Gene Technol. 22:339-340, 1985); IL-2 (GenBank Accession No. A14844, A21785, X00695, X00200, X00201, X00202; Lupker et al., Patent No. EP 0307285-A, March 15, 1989; Perez et al., Patent No. EP 0416673-A, March 13, 1991; Holbrook et al., Nucleic Acids Res. 12:5005-5013, 1984; Degrave et al., EMBO J. 2:2349-2353, 1983; Taniguchi et al., Nature 302:305-30 310, 1983); IL-3 (GenBank Accession No. M14743, M20137; Yang et al., Cell 47:3-10, CA 0222l269 l997-ll-l4 1986, Otsuka et al., J. Immunol. 140:2288-2295, 1988); IL-4 (GenBank Accession No. M13982; Yokota et al., Proc. Natl. Acad. Sci. USA 83:5894-5898, 1986); IL-5 (GenBank Accession No. X04688, J03478; Azuma et al., Nucleic Acids Res. 14:9149-9158, 1986; Tanabe et al., J. Biol. Chem. 262:16580-16584, 1987); IL-6 (GenBank 5 Accession No. Y00081, X04602, M54894, M38669, M14584; Yasukawa et al., EMBO
J. 6:2939-2945, 1987; Hirano et al., Nature 324:73-76, 1986; Wong et al., Behring Inst.
Mitt. 83:40-47, 1988, May et al., Proc. Natl. Acad. Sci. USA 83:8957-8961, 1986); IL-7 (GenBank Accession No. J04156; Goodwin et al., Proc. Natl. Acad. Sci. USA 86:302-306, 1989); IL-8 (GenBank Accession No. Z11686; Kusner et al., Kidney lnt. 39:1240-1248, 1991); IL-10 (GenBank Accession No. X78437, M57627; Vieira et al., Proc.
Natl. Acad. Sci. USA 88:1172-1176, 1991); IL-l l (GenBank Accession No. M57765 M37006; Paul et al., Proc. Natl. Acad. Sci. USA 87:7512-7516, 1990); IL-13 (GenBank Accession No. X69079, U10307; Minty et al., Nature 362:248-250, 1993; Smirnov, Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, June 2, 1994); TNF-a (Tumor necrosis factor) (GenBank Accession No. A21522; Patent No. GB 2246569-Al,February 5, 1992); TNF-~ (GenBank Accession No. D12614; M~l~uy~la et al., FEBS
LETTERS 302:141-144, 1992). DNA sequences of other suitable receptor-binding intern~li7Pcl ligands may be obtained from GenBank or EMBL DNA databases, reverse-synthesized from protein sequence obtained from PIR database or isolated by standard methods (Sambrook et al., supra) from cDNA or genomic libraries.

5. Modifications of receptor-bindin~ internalized li~ands These ligands may be customized for a particular application. Means for modifying proteins is provided below. Briefly, additions, substitutions and deletions of amino acids may be produced by an~ commonly employed recombinant DNA method.
An amino acid residue of FGF, VEGF, HBEGF or other receptor-binding intern~li7~cl ligand is non-essential if the polypeptide that has been modified by deletion of the residue possesses substantially the same ability to bind to its receptor and intern~li7~ a linked agent as the unmodified polypeptide.
As noted above, any polypeptide or peptide analogue, including peptidomimetics, that is reactive with an FGF receptor, a VEGF receptor, an HBEGF

receptor, other growth factor receptor (e.g, PDGF receptor), cytokine receptor or other cell surface molecule including members of the families and fr~gm~nt~ thereof, or constrained analogs of such peptides that bind to the receptor and intern~li7P a linked targeted agent may be used in the context of this invention. Members of the FGF
5 peptide family, including FGF-1 to FGF-9, are preferred. Modified peptides, especially those lacking proliferative function, and chimeric peptides, which retain the specific binding and int~?rn~li7ing activities are also contemplated for use herein.
A modification that is effected substantially near the N-tçrrninll~ of a polypeptide is generally effected within the first about ten residues of the protein. Such 10 modifications include the addition or deletion of rç~idlle~, such as the addition of a cysteine to facilitate conjugation and form conjugates that contain a defined molar ratio, preferably a ratio of 1:1 of the polypeptides.
DNA encoding one of the receptor-binding int~rn~li7e~1 ligands discussed above may be mutagenized using standard methodologies to delete or replace 15 any cysteine residues that are responsible for aggregate formation. If necessary, the identity of cysteine residues that contribute to aggregate formation may be cl~t~rrnin~-l empirically, by deleting and/or replacing a cysteine residue and ascertaining whether the resulting protein aggregates in solutions cont~ining physiologically acceptable buffers and salts. In addition, fragments of these receptor-binding intt?rn~ l ligands may be 20 constructed and used. The binding region of many of these ligands have been delineated. Fragments may also be shown to bind and internz~li7~ by any one of the tests described herein.
Modification of the polypeptide may be effected by any means known to those of skill in this art. The preferred methods herein rely on modification of DNA
25 encoding the polypeptide and expression of the modified DNA.
Merely by way of example, DNA encoding the FGF polypeptide may be isolated, synthe~i7~?~1 or obtained from commercial sources (the amino acid sequences of FGF-1 - FGF-9 are set forth in SEQ ID NOs. 10-18; DNA sequences may be based on these amino acid sequences or may be obtained from public DNA databases and 30 references (see, e.g, GenBank, see also U.S. Patent No. 4,956,455, U.S. Patent No. 5,126,323, U.S. Patent No. 5,155,217, U.S. Patent No. 4,868,113, PCT Application WO 90/08771, EP Application 0 488 196 A2, and Miyamoto et al., Mol. Cell. Biol.
13:4251-4259, 1993). Expression of a recombinant FGF-2 protein in yeast and E. coli is described in Barr et al., J. Biol. Chem. 263:16471-16478, 1988, in PCT Application S Serial No. PCT/US93/05702 and United States Application Serial No. 07/901,718.Expression of recombinant FGF proteins may be performed as described herein or using methods known to those of skill in the art.
Similarly, DNA encoding any of the other receptor-binding inte~rn~li7~?(1 lig~nclc, including VEGF, HBEGF, IL-l, IL-2, and other cytokines and growth factors 10 may also be isolated, synth~i7~ ~l or obtained from commercial sources. As noted above, DNA sequences are available in public databases, such as GenBank. Based on these sequences, oligonucleotide primers may be designed and used to amplify the gene from cDNA or mRNA by polymerase chain reaction technique as one means of obtaining DNA.
Mutations may be made by any method known to those of skill in the art, including site-specific or site-directed mutagenesis of DNA encoding the protein and the use of DNA amplification methods using primers to introduce and amplify alterations in the DNA template, such as PCR splicing by overlap extension (SOE).
Site-directed mutagenesis is typically effected using a phage vector that has single- and 20 double-stranded forms, such as M13 phage vectors, which are well-known and commercially available. Other suitable vectors that contain a single-stranded phage origin of replication may be used (see, e.g, Veira et al., Meth. Enzymol. 15:3, 1987). In general, site-directed mutagenesis is performed by plep~ lg a single-stranded vector that encodes the protein of interest (i.e., a member of the FGF family or a cytotoxic 25 molecule, such as a saporin). An oligonucleotide primer that contains the desired mutation within a region of homology to the DNA in the single-stranded vector isannealed to the vector followed by addition of a DNA polymerase, such as E. coli DNA
polymerase I (Klenow fragment), which uses the double stranded region as a primer to produce a heteroduplex in which one strand encodes the altered sequence and the other 30 the original sequence. The heteroduplex is introduced into a~Lopliate bacterial cells and clones that include the desired mutation are selected. The resulting altered DNA
molecules may be expressed recombinantly in a~plopl;ate host cells to produce the modified protein.
Suitable conservative substitutions of amino acids are well-known and f 5 may be made generally without altering the biological activity of the resulting molecule.
For example, such substitutions may be made in accordance with those set forth in TABLE 1 as follows:

CQ val;~
Original residue su~:,i ' -Ala (A) Gly; Ser Arg (R) Lys Asn (N) Gln; His Cys (C) Ser Gln (Q) Asn Glu (E) Asp Gly (G) Ala; Pro His (H) Asn; Gln Ile (I) Leu; Val Leu (L) Ile; Val Lys (K) Arg; Gln; Glu Met (M) Leu; Tyr; Ile Phe (F) Met; Leu; Tyr Ser (S) Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) Trp; Phe Val (V) Ile; Leu Other similarly conservative substitutions may be made. If necessary, such substitutions may be determined empirically merely by testing the resulting modified protein for the ability to bind to and int~rnali7:~ upon binding to the a~plopliate receptors. Those that retain this ability are suitable for use in the eonjugates and methods herein. In addition, muteins of the FGFs are known to those of skill in the art (see, e.g., U.S. Patent No. 5,175,147; PCT Application No. WO 89/00198, U.S. Serial . No. 07/070,797; PCT Applieation No. WO 91/15229, and U.S. Serial No. 07/505,124).

B. Nucleic acid bindin~ domains As previously noted, nucleic acid binding domains (NABD) interaet with the target nucleic acid either in a sequence-specific manner or a sequence-nonspecific manner. When the interaetion is non-specific, the nucleie aeid binding domain binds 10 nucleic acid regardless of the sequenee. For example, poly-L-lysine is a basic polypeptide that binds to oppositely eharged DNA. Other highly basie proteins orpolycationic compounds, such as histones, prot~min~s, and spermidine, also bind to nucleic acids in a nonspecific manner.
Many proteins have been identified that bind speeifie sequenees of DNA.
15 These proteins are responsible for genome replieation, transcription and repair of damaged DNA. The transcription factors regulate gene e~ ession and are a diversegroup of proteins. These factors are especially well suited for purposes of the subject invention beeause of their sequence-specific recognition. Host transeription faetors have been grouped into seven well-established elasses based upon the structural motif 20 used for recognition. The major families include helix-turn-helix (HTH) proteins, homeodomains, zinc finger proteins, steroid receptors, leucine zipper proteins, the helix-loop-helix (HLH) proteins, and ~-sheets. Other classes or subclasses may eventually be deline~tç~l as more factors are discovered and defined. Proteins from those classes or proteins that do not fit within one of these classes but bind nucleic acid 25 in a sequence-specific manner, such as SV40 T antigen and p53 may also be used.
These families of transcription factors are generally well-known (see GenBank; Pabo and Sauer, Ann. Re-~. Biochem. 61:1053-1095, 1992; and references below). Many of these factors are cloned and the precise DNA-binding region deline~t~?~l in certain instances. When the sequence of the DNA-binding domain is 30 known, a gene encoding it may be synthesized if the region is short. Alternatively, the genes may be cloned from the host genomic libraries or from cDNA libraries using oligonucleotides as probes or from genomic DNA or cDNA by polymerase chain reaction methods. Such methods may be found in Sambrook et al., supra.
Helix-turn-helix proteins include the well studied ~ Cro protein, ~cI, and E. coli CAP proteins (see Steitz et al., Proc. Natl. Acad. Sci. USA 79:3097-3100, 1982, 5 Ohlendorf et al., J. Mol. Biol. 169:757-769, 1983). In addition, the lac repressor (Kaptein et al., ~ Mol. Biol. 182:179-182, 1985) and Trp repressor (Scheritz et al., Nature 317:782-786, 1985) belong to this family. Members of the homeodomain family include the Drosophila protein Ant~nn~p~e~ (Qian et al., Cell. 59:573-580, 1989) and yeast MATa2 (Wolberger et al., Cell. 67:517-528, 1991). Zinc finger 10 proteins include TFIIIA (Miller et al., EMBO J. 4:1609-1614, 1985), Sp-l, zif268, and many others (see generally Krizek et al., J. Am. Chem. Soc. 113:4518-4523, 1991).
Steroid receptor proteins include receptors for steroid honnon~, retinoids, vitamin D, thyroid hormones, as well as other compounds. Specific examples include retinoic acid, knirps, progesterone, androgen, glucocosteroid and estrogen receptor proteins. The 15 leucine zipper family was defined by a heptad repeat of leucines over a region of 30 to 40 residues. Specific members of this family include C/EBP, c-fos, c jun, GCN4, sis-A, and CREB (see generally O'Shea et al., Science 254:539-544, 1991). The helix-loop-helix (HLH) family of proteins appears to have some ~imil~ritie~ to the leucine zipper family. Well-known members of this family include myoD (Weintraub et al., Science 20 251:761-766, 1991); c-myc; and AP-2 (Williams and Tijan, Science 251:1067-1071, 1991). The ,B-sheet family uses an antiparallel ,13-sheet for DNA binding, rather than the more common oc-helix. The family contains the MetJ (Phillips, Curr. Opin. Struc. Biol.
1:89-98, 1991), Arc (Breg et al., Nature 346:586-589, 1990) and Mnt repressors. In addition, other motifs are used for DNA binding, such as the cysteine-rich motif in yeast 25 GAL4 repressor, and the GATA factor. Viruses also contain gene products that bind specific sequences. One of the most-studied such viral genes is the rev gene from HIV.
The rev gene product binds a sequence called RRE (rev responsive element) found in the env gene. Other proteins or peptides that bind DNA may be discovered on the basis of sequence similarity to the known classes or functionally by selection.

Several techniques may be used to select other nucleic acid binding domains (see U.S. Patent No. 5,270,170; PCT Application WO 93/14108; and U.S.
Patent No. 5,223,409). One of these techniques is phage display. (See, for example, U.S. Patent No. 5,223,409.) In this method, DNA sequences are inserted into the 5 gene III or gene VIII gene of a fil~mentous phage, such as M13. Several vectors with multicloning sites have been developed for insertion (McLafferty et al., Gene 128:29-36, 1993, Scott and Smith, Science 249:386-390, 1990; Smith and Scott, Methods Enzymol. 21 7:228-257, 1993). The inserted DNA sequences may be randomly generated or variants of a known DNA-binding domain. Generally, the inserts encode 10 from 6 to 20 amino acids. The peptide encoded by the inserted sequence is displayed on the surface of the bacteriophage. Bacteriophage ~x~l~s~ g a desired nucleic acid-binding domain are selected for by binding to the cytocide-encoding agent. This target molecule may be single stranded or double stranded DNA or RNA. When the cytocide-encoding agent to be delivered is single-stranded, such as RNA, the a~p,~liate target is 15 single-stranded. When the molecule to be delivered is double-stranded, the target molecule is preferably double-stranded. Preferably, the entire coding region of the cytocide-encoding agent is used as the target. In addition, elements necessary for transcription that are included for in vivo or in vitro delivery may be present in the target DNA molecule. Bacteriophage that bind the target are recovered and propagated.
20 Subsequent rounds of selection may be performed. The final selected bacteriophage are propagated and the DNA sequence of the insert is determine-l Once the predicted amino acid sequence of the binding peptide is known, sufficient peptide for use herein as an nucleic acid binding domain may be made either by recombinant means or synthetically. Recombinant means is used when the receptor-binding internalized 25 ligand/nucleic acid binding domain is produced as a fusion protein. In addition, the peptide may be generated as a tandem array of two or more peptides, in order to m~imi71~ affinity or binding of multiple DNA molecules to a single polypeptide.
As an example of the phage display selection technique, a DNA-binding domain/peptide that recognizes the coding region of saporin is isolated. Briefly, DNA
30 fragments encoding saporin may be isolated from a plasmid cont~inin~ these sequences.

The plasmid FPFSl contains the entire coding region of saporin. Digestion of theplasmid with NcoI and EcoRI restriction en7ymes liberates the saporin specific tsequence as a single fragment of approximately 780 bp. This fragment may be purified by any one of a number of methods, such as agarose gel electrophoresis and subsequent S elution from the gel. The saporin fragment is fixed to a solid support, such as in the wells of a 96-well plate. If the double-stranded fragment does not bind well to the plate, a coating such as a positively charged molecule, may be used to promote DNA
adherence. The phage library is added to the wells and an incubation period allows for binding of the phage to the DNA. Unbound phage are removed by a wash, typically 10 co~ i..;..g 10 mM Tris, 1 mM EDTA, and without salt or with a low salt concentration.
Bound phage are eluted starting at a 0.1 M NaCl cont~inin~ buffer. The NaCl concentration is increased in a step-wise fashion until all the phage are eluted.
Typically, phage binding with higher affinity will only be released by higher salt concentrations.
Eluted phage are propagated in the b~cteri~ host. Further rounds of selection may be performed to select for a few phage binding with high affinity. The DNA sequence of the insert in the binding phage is then clet~rrnined. In addition, peptides having a higher affinity may be isolated by making variants of the insert sequence and subjecting these variants to further rounds of selection.
C. Cytocide-encodin~2 a~ents A cytocide-encoding agent is a nucleic acid molecule (DNA or RNA) that, upon internzlli7~tion by a cell, and subsequent transcription (if DNA) and[/or]
translation into a cytocidal agent, is cytotoxic to a cell or inhibits cell growth by 25 inhibiting protein synthesis.
Cytocides include saporin, the ricins, abrin and other ribosome inactivating proteins, Pseudomonas exotoxin, ~liphtheria toxin, angiogenin, tritin, nthin~ 32 and 30, momordin, pokeweed antiviral protein, mirabilis antiviral protein, bryodin. angiogenin, and shiga exotoxin, as well as other cytocides that are known to 30 those of skill in the art. Alternatively, cytocide gene products may be noncytotoxic but activate a compound, which is endogenously produced or exogenously applied, from a nontoxic form to a toxic product that inhibits protein synthesis.
Especially of interest are DNA molecules that encode an enzyme that results in cell death or renders a cell susceptible to cell death upon the addition of 5 another product. For example, saporin is an enzyme that cleaves rRNA and inhibits protein synthesis. Other enzymes that inhibit protein synthesis are especially well suited for use in the present invention. In addition, enzymes may be used where the enzyme activates a compound with little or no cytotoxicity into a toxic product that inhibits protein synthesis.
1. Ribosome inactivatin~ proteins Ribosome-inactivating proteins (RIPs), which include ricin, abrin, and saporin, are plant proteins that catalytically inactivate eukaryotic ribosomes. Ribosome-inactivating proteins inactivate ribosomes by interfering with the protein elongation step 15 of protein synthesis. For example, the ribosome-inactivating protein saporin (hereinafter also referred to as SAP) has been shown to inactivate 60S ribosomes by cleavage of the N-glycosidic bond of the ~lenine at position 4324 in the rat 28Sribosomal RNA (rRNA). The particular region in which A4324 is located in the rRNA is highly conserved among prokaryotes and eukaryotes, A4324 in 28S rRNA corresponds to 20 A2660 in E. coli 23S rRNA. Several of the ribosome inactivating proteins also appear to interfere with protein synthesis in prokaryotes, such as E. coli.
Saporin is preferred as a cytocide, but other suitable ribosome inactivating proteins (RIPs) and toxins may be used. Other suitable RIPs include, but are not limited to, ricin, ricin A chain, maize ribosome inactivating protein, gelonin, 25 diphtheria toxin, diphtheria toxin A chain, trichos~nthin, tritin, pokeweed antiviral protein (PAP), mirabilis antiviral protein (MAP), Di~nthin~ 32 and 30, abrin, monordin, bryodin, shiga (see, e.g, WO 93/24620) and others (see, e.g, Barbieri et al., Cancer Surveys 1:489-520, 1982, and European patent application No. 0466 222, incorporated herein by reference, which provide lists of numerous ribosome inactivating proteins and 30 their sources; see also U.S. Patent No. 5,248,608 to Walsh et al.). Some ribosome inactivating proteins, such as abrin and ricin, contain two constituent chains: a cell-binding chain that me~ tes binding to cell surface receptors and int~rn~li7~tion of the molecule and a chain responsible for toxicity. Single chain ribosome inactivating proteins (type I RIPS), such as the saporins, do not have a cell-binding chain. As a result, unless int~rn~li7~1, they are substantially less toxic to whole cells than the S ribosome inactivating proteins that have two chains.
Several structurally related ribosome inactivating proteins have been isolated from seeds and leaves of the plant Saponaria o~icinalis (soapwort) (GB Patent 2,194,241 B, GP Patent 2,216,891; EP Patent 89306016). Saporin proteins for use in this invention have amino acid sequences found in the natural plant host Saponaria off'cinalis or modified sequences, having amino acid substitutions, deletions, insertions or additions, but which still express substantial ribosome inactivating activity. Purified udlions of saporin are frequently observed to include several molecular isoforms of the protein. It is understood that differences in amino acid sequences can occur in saporin from different species as well as between saporin molecules from individual org~ni~m~ of the same species. Among these, S0-6 is the most active and abundant, representing 7% of total seed proteins. Saporin is very stable, has a high isoelectric point, does not contain carbohydrates, and is resistant to denaturing agents, such as sodium dodecyl sulfate (SDS), and a variety of proteases. The amino acid sequences of several saporin-6 isoforms from seeds are known, and there appear to be families of saporin ribosome inactivating proteins differing in few amino acid residues. Any of these saporin proteins or modified proteins that are cytotoxic may be used in the present invention.

a. Isolation of DNA encodin~ saporin Some of the DNA molecules provided herein encode saporin that has substantially the same amino acid sequence and ribosome inactivating activity as that of saporin-6 (S0-6), including any of four isoforms, which have heterogeneity at amino acid positions 48 and 91 (see, e.g, Maras et al., Biochem. Internat. 21:631-638, 1990, and Barra et al., Biotechnol. Appl. Biochem. 13:48-53, 1991, GB Patent 2,216,891 B
and EP Patent 89306106, and SEQ ID NOs. 19-23). Other suitable saporin polypeptides include other members of the multi-gene family coding for isoforms of CA 02221269 I gg7 - l l - l4 WO 96/36362 PCT/USg6/07164 saporin-type ribosome inactivating proteins including SO-l and S0-3 (Fordham-Skelton et al., Mol. Gen. Genet. 221:134-138, 1990), S0-2 (see, e.g, U.S. Application Serial No. 07/885,242, GB 2,216,891, see also Fordham-Skelton et al., Mol. Gen.
Genet. 229:460-466, 1991), S0-4 (see, e.g, GB 2,194,241 B; see also Lappi et al., 5 Biochem. Biophys. Res. Commun. 129:934-942, 1985) and SO-5 (see, e.g, GB
2,194,241 B, see also Montecucchi et al., Int. J. Peptide Protein Res. 33:263-267, 1989).
The saporin polypeptides for use in this invention include any of the isoforms of saporin that may be isolated from Saponaria officinalis or related species or 10 modified forms that retain cytotoxic activity. In particular, such modified saporin may be produced by modifying the DNA encoding the protein (see, e.g, Tntern~tional PCT
Application Serial No. PCT/US93/05702, and United States Application Serial No. 07/901,718; see also U.S. Patent Application No. 07/885,242, and Italian Patent No. 1,231,914) by altering one or more amino acids or deleting or inserting one or more 15 amino acids. Any such protein, or portion thereof, that exhibits cytotoxicity in standard in vitro or in vivo assays within at least about an order of magnitude of the saporin conjugates described herein is contemplated for use herein.
Preferably, the saporin DNA sequence contains m~mm~ n-preferred codons (SEQ. ID NO. 79). Preferred codon usage as exemplified in Current Protocols 20 in Molecular Biology, infra, and Zhang et al. (Gene 105:61, 1991) for m~mm:~ls, yeast, Drosophila, E. coli, and prim~t~s is established for saporin sequence.
The cytocide-encoding agent, such as saporin DNA sequence, is introduced into a plasmid in operative linkage to an a~plol,l;ate promoter for expression of polypeptides in the org~ni~m The presently preferred saporin proteins are S0-6 and 25 S0-4. The DNA can optionally include sequences, such as origins of replication that allow for the extrachromosomal maintenance of the saporin-cont~ining plasmid, or can be designed to integrate into the genome of the host (as an alternative means to ensure stable m~inten~nce in the host).

b. Nucleic acids encodin~ other ribosome inactivatin~ proteins and c,vtocides In addition to saporin discussed above, other cytocides that inhibit protein synthesis are useful in the present invention. The gene sequences for these 5 cytocides may be isolated by standard methods, such as PCR, probe hybridization of genomic or cDNA libraries, antibody screenings of expression libraries, or clones may be obtained from commercial or other sources. The DNA sequences of many of thesecytocides are well known, including ricin A chain (GenBank Accession No. X02388);
maize ribosome inactivating protein (GçnR~nk Accession No. L26305); gelonin 10 (GenBank Accession No. L12243; PCT Application WO 92/03155; U.S. Patent No. 5,376,546; riirhtheri~ toxin (GenBank Accession No. K01722); trichosanthin (GenBank Accession No. M34858); tritin (GenBank Accession No. D13795);
pokeweed antiviral protein (GenBank Accession No. X78628); mirabilis antiviral protein (GenBank Accession No. D90347); ~ nthin 30 (GenBank Accession 15 No. X59260); abrin (GenBank Accession No. X55667); shiga (GenBank Accession No. M19437) and Pseudomonas exotoxin (GenBank Accession Nos. K01397, M23348). When DNA sequences or amino acid sequences are known, DNA molecules encoding these proteins may be synthesi7t?-1, and preferably contain m~mm~ n-~-~f~ ;d codons.
D. Prodru~-encodin~ a~ent A nucleic acid molecule encoding a prodrug may ~ltPrn~tively be used within the context of the present invention. Prodrugs are inactive in the host cell until either a substrate is provided or an activating molecule is provided. Most typically, a 25 prodrug activates a compound with little or no cytotoxicity into a toxic product. Two of the more often used prodrug molecules, both of which may be used in the present invention, are HSV thymidine kinase and E. coli cytosine cle~min~e.
Briefly, a wide variety of gene products which either directly or indirectly activate a compound with little or no cytotoxicity into a toxic product may be 30 utilized within the context of the present invention. Representative examples of such gene products include HSVTK (heIpes simplex virus thymidine kinase) and VZVTK

(varicella zoster virus thymidine kmase), which selectively phosphorylate certain purine arabinosides and substituted pyrimidine compounds. Phosphoryation converts thesecompounds to metabolites that are cytotoxic or cytostatic. For example, exposure of the drugs ganciclovir, acyclovir, or any of their analogues (e.g, FIAU, FIAC, DHPG) to 5 cells expressing HSVTK allows conversion of the drug into its corresponding active nucleotide triphosphate form.
Other gene products that may be utilized within the context of the present invention include E. coli guanine phosphoribosyl transferase, which converts thiox~n~hine into toxic thiox~nthin~ monophosphate (Besnard et al., MoZ. Cell. Biol.
7:4139-4141, 1987); ~lk~line phosph~t~e, which converts inactive phosphorylated compounds such as mitomycin phosphate and doxorubicin-phosphate to toxic dephosphorylated compounds; fungal (e.g, Fusarium oxysporum) or bacterial cytosine ~le~min~e7 which converts 5-fluorocytosine to the toxic compound 5-fluorouracil (Mullen, PNAS 89:33, 1992); carboxypeptidase G2, which cleaves glutamic acid from para-N-bis (2-chloroethyl) aminobenzoyl glutamic acid, thereby creating a toxic benzoic acid mu~ l; and Penicillin-V amidase, which converts phenoxyacetabide derivatives of doxorubicin and melphalan to toxic compounds (see generally, Vrudhula et al., J. of Med. Chem. 36(7):919-923, 1993; Kern et al., Canc. Immun. Immunother.
31(4):202-206, 1990). Moreover, a wide variety of Herpesviridae thymidine kin~ec, including both primate and non-primate herpesviruses, are suitable. Such herpesviruses include Herpes Simplex Virus Type 1 (McKnight et al., Nuc. Acids Res 8:5949-5964, 1980), Herpes Simplex Virus Type 2 (Swain and Galloway, J: Virol. 46:1045-1050, 1983), Varicella Zoster Virus (Davison and Scott, J. Gen. Virol. 67:1759-1816, 1986), marmoset herpesvirus (Otsuka and Kit, Virology 135:316-330, 1984), feline herpesvirus type 1 (Nunberg et al., J. Virol. 63:3240-3249, 1989), pseudorabies virus (Kit and Kit, U.S. Patent No. 4,514,497, 1985), equine herpesvirus type 1 (Robertson and Whalley, Nuc. Acids Res. 16:11303-11317, 1988), bovine herpesvirus type 1 (Mittal and Field, J
Virol 70:2901-2918, 1989), turkey herpesvirus (Martin et al., J. Virol. 63:2847-2852, 1989), Marek's disease virus (Scott et al., J. Gen. Virol. 70:3055-3065, 1989), herpesvirus saimiri (Honess et al., J. Gen. Virol. 70:3003-3013, 1989) and Epstein-Barr WO 96/36362 PCI'IUS96/07164 virus (Baer et al., Nature (London) 310:207-311, 1984). Such herpesviruses may be readily obtained from commercial sources such as the American Type Culture Collection ("ATCC", Rockville, Maryland).
Furthermore, as indicated above, a wide variety of inactive precursors 5 may be converted into active inhibitors. For example, thymidine kinase can phosphorylate nucleosides (e.g, dT) and nucleoside analogues such as ganciclovir (9-{ [2-hydroxy- 1 -(hydroxymethyl)ethoxyl methyl } guanosine), famciclovir, buciclovir, penciclovir, valciclovir, acyclovir (9-[2-hydroxy ethoxy)methyl] guanosine), trifluo.~lLhyll idine, 1-[2-deoxy, 2-fluoro, beta-D-arabino furanosyl]-5-iodouracil, ara-A
10 (adenosine arabinoside, vivarabine), 1 -beta-D-arabinofuranoxyl thymine, 5-ethyl-2'-deoxyuridine, 5-iodo-5'-amino-2,5'-dideoxyuridine, idoxuridine (5-iodo-2'-deoxyuridine), AZT (3' azido-3' thymidine), ddC (dideoxycytidine), AIU (5-iodo-5' amino 2', 5'-dideoxyuridine) and AraC (cytidine arabinoside).

15 E. Other nucleic acid molecules The conjugates provided herein may also be used to deliver other types of nucleic acids to targeted cells. Such other nucleic acids include antisense RNA, antisense DNA, ribozymes, triplex-forming oligonucleotides, and oligonucleotides that bind proteins. The nucleic acids can also include RNA tr~fficking .si~n~l.c, such as viral 20 par~gin~ sequences (see, e.g, Sullenger et al. (1994) Science 262:1566-1569). The nucleic acids also include DNA molecules that encode proteins that replace defective genes, such as the gene associated with cystic fibrosis (see, e.g, PCT Application WO
93/03709, U.S. Application Serial No. 07/745,900; and Riordan et al. (1989) Science 245: 1066-1073). Other DNA molecules may encode tumor-specific cytotoxic 25 molecules, such as tumor necrosis factor, viral antigens and other proteins to render a cell susceptible to anti-cancer agents.
Nucleic acids and oligonucleotides for use as described herein can be synthesized by any method known to those of skill in this art (see, e.g, WO 93/01286, U.S. Application Serial No. 07/723,454; U.S.. Patent No. 5,218,088; U.S. Patent No.
30 5,175,269; U.S. Patent No. 5,109,124). Identification of oligonucleotides and ribozymes for use as antisense agents and DNA encoding genes for targeted delivery for genetic therapy involve methods well known in the art. For example, the desirable properties, lengths and other characteristics of such oligonucleotides are well known.
Anti~n~ç oligonucleotides are typically designed to resist degradation by endogenous nucleolytic enzymes and include, but are not limited to: phosphorothioate, 5 methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and other such linkages (see, e.g, Agrwal et al., Tetrehedron Lett.
28:3539-3542 (1987); Miller et al., J: Am. Chem. Soc. 93:6657-6665 (1971); Stec et al., Tetrehedron Lett. 26:2191-2194 (1985); Moody et al., Nucl. Acids Res. 12:4769-4782 (1989), Um~n~ki et al., NucZ. Acids Res. (1989); Letsinger et al., Tetrahedron 40:137-143 (1984); Eckstein, Annu. Rev. Biochem. 54:367-402 (1985); Fçketçin, Trends Biol.
Sci. 14:97-100 (1989); Stein In: Oligodeoxynucleofides. Antisense Inhibitors of Gene Expression, Cohen, Ed, Macmillan Press, London, pp. 97-117 (1989); Jager et al.,Biochemistry 27:7237-7246 (1988)).
.Antisçn~e nucleotides are oligonucleotides that bind in a sequence-15 specific manner to nucleic acids, such as mRNA or DNA. When bound to mRNA thathas compl~ment~ry sequences, ~nti~çn~e prevents translation of the mRNA (see, e.g, U.S. Patent No. 5,168,053 to Altman et al.; U.S. Patent No. 5,190,931 to Inouye, U.S.
Patent No. 5,135,917 to Burch; U.S. Patent No. 5,087,617 to Smith and Clusel et al.
(1993) Nucl. Acids Res. 21:3405-3411, which describes dumbbell ~nti~çn~e 20 oligonucleotides). Triplex molecules refer to single DNA strands that bind duplex DNA forming a colinear triplex molecule and thereby prevent transcription (see, e.g, U.S. Patent No. 5,176,996 to Hogan et al., which describes methods for m:~king synthetic oligonucleotides that bind to target sites on duplex DNA).
Particularly useful antisense nucleotides and triplex molecules are 25 molecules that are complementary or bind to the sense strand of DNA or mRNA that encodes an oncogene, such as bFGF, int-2, hst-1/K-FGF, FGF-5, hst-2/FGF-6, FGF-8.
Other useful ~nticçn~e oligonucleotides include those that are specific for IL-8 (see, e.g., U.S. Patent No. 5,241,049; and PCT Applications WO 89/004836; WO 90/06321; WO
89/10962; WO 90/00563; and WO 91/08483), which can be linked to bFGF for the 30 treatment of psoriasis, anti-sense oligonucleotides that are specific for nonmuscle myosin heavy chain and/or c-myb (see, e.g, Simons et al. (1992) Circ. Res. 70:835-843;
PCT Application WO 93/01286, U.S. application Serial No. 07/723,454: LeClerc et al.
(1991) J. Am. Coll. Cardiol. 17 (2Suppl. A):105A; Ebbecke et al. (1992) Basic Res.
Cardiol. 87:585-591), which can be targeted by an FGF to inhibit smooth muscle cell 5 proliferation, such as that following angioplasty and thereby prevent restenosis or inhibit viral gene expression in transformed or infected cells.
A ribozyme is an RNA molecule that specifically cleaves RNA
substrates, such mRNA, and thus inhibits or hlL~lrel~;s with cell growth or ~2s~res~ion.
There are at least five classes of ribozymes that are known that are involved in the 10 cleavage and/or ligation of RNA chains. Ribozymes can be targeted to any RNA
transcript and can catalytically cleave such transcript (see, e.g, U.S. Patent No.
5,272,262; U.S. Patent No. 5,144,019; and U.S. Patent Nos. 5,168,053, 5,180,818,5,116,742 and 5,093,246 to Cech et al., which described ribozymes and methods for production thereof). Any such ribosome may be linked to the growth factor for delivery 15 to a cell bearing a receptor for a receptor-intt-rn~ 1 binding ligand.
The ribozymes may be delivered to the targeted cells by DNA encoding the ribozyme linked to a eukaryotic promoter, such as a eukaryotic viral promoter, such that upon introduction into the nucleus, the ribozyme will be directly transcribed. In such instances, the construct will also include a nuclear translocation sequence, 20 generally as part of the ligand or as part of a linker between the ligand and nucleic acid binding domain.
DNA that encodes a therapeutic product contemplated for use includes DNA encoding correct copies of defective genes, such as the defective gene (CFTR) associated with cystic fibrosis (see, e.g, Tntern~tional Application WO 93/03709, U.S.
25 Application Serial No. 07/745,900; and Riordan et al. (1989) Science 245:1066-1073), and anticancer agents, such as tumor necrosis factors. The conjugate preferably includes an NTS. If the conjugate is designed such that the ligand and nucleic acid binding domain are cleaved in the cytoplasm, then the NTS should be included in a portion of the conjugate or linker that remains bound to the DNA. The nuclear .

translocation sequence (NTS) may be a heterologous sequence or a may be derived from the selected growth factor.

F. Construct co.,~ i..g cvtocidal-encodin~ agent In the case of cytotocide molecules such as the ribosome inactivating proteins, very few molecules may need to be expressed to effect cell killing. Indeed, only a single molecule of ~1iphth~ri~ toxoid introduced into a cell was sufficient to kill the cell. With other cytocides or prodrugs, it may be that propagation or stablem~ "ce of the construct is neces~ry to attain a sufficient amount or concentration of the gene product for effective gene therapy. Examples of replicating and stable eukaryotic plasmids may be found in the scientific lil~"dLulc.
In general, constructs will also contain elements necess~ry for transcription and translation. If the cytocide-encoding agent is DNA, then it must contain a promoter. The choice of the promoter will depend upon the cell type to be transformed and the degree or type of control desired. Promoters can be constitutive or active in any cell type, tissue specific, cell specific, event specific temporal-specific or inducible. Cell-type specific promoters and event type specific promoters are preferred.
Examples of constitutive or nonspecific promoters include the SV40 early promoter (U.S. Patent No. 5,118,627), the SV40 late promoter (U.S. Patent No. 5,118,627), CMV
early gene promoter (U.S. Patent No. 5,168,062), and adenovirus promoter. In addition to viral promoters, cellular promoters are also amenable within the context of this invention. In particular, cellular promoters for the so-called housekeeping genes are useful. Viral promoters are preferred, because generally they are stronger promoters than cellular promoters.
Tissue specific promoters are particularly useful when a certain tissue type is to be targeted for transformation. By using one of this class of promoters, an extra margin of specificity can be attained. For example, when the indication to be treated is ophth~lm~logical (e.g, secondary lens clouding), either the alpha-crystalline promoter or gamma-crystalline promoter is ~l~f~ d. When a tumor is the target ofgene delivery, cellular promoters for specific tumor markers or promoters more active in tumor cells should be chosen. Thus, to treat prostate tumor, the prostate-specific antigen promoter is especially useful. Similarly, the tyrosinase promoter or tyrosinase-related protein promoter is a ~l~ft:lled promoter for melanoma tre~tment For tre~tment of ~ ç~es that are angiogenic or exacerbated by angiogenesis, the VEGF receptor promoter is ~l~r.,ll.,d. The VEGF receptor is expressed in developing capillaries. For 5 tre~tment of breast cancer, the promoter from heat shock protein 27 is pl~r~,.led; for tre~tment of colon or lung cancer, the promoter from carcinoembryonic antigen isplefclled; for tre~tment of restenosis or other diseases involving smooth muscle cells, the promoter from a-actin or myosin heavy chain is pler~l,ed. For B lymphocytes, the immlmoglobulin variable region gene promoter; for T lymphocytes, the TCR receptor 10 variable region promoter; for helper T lymphocytes, the CD4 promoter; for liver, the albumin or a-fetoprotein promoter, are a few additional examples of tissue specific promoters. Many other examples of tissue specific promoters are readily available to one skilled in the art. Some of these promoters are temporally regulated, such as c-myc and cyclin D.
Inducible promoters may also be used. These promoters include the MMTV LTR (PCT WO 91/13160), which is inducible by dexamethasone, metallothionein, which is inducible by heavy metals, and promoters with cAMP
response elements, which are inducible by cAMP. By using an inducible promoter, the nucleic acid may be delivered to a cell and will remain quiescent until the addition of 20 the inducer. This allows further control on the timing of production of the therapeutic gene.
Event-type specific promoters are active or up-regulated only upon the occurrence of an event, such as tumorigenecity or viral infection. The HIV LTR is a well known example of an event-specific promoter. The promoter is inactive unless the 25 tat gene product is present, which occurs upon viral infection. Another promoter is c-myc.
Additionally, promoters that are coordinately regulated with a particular cellular gene may be used. For example, promoters of genes that are coordinatelyexpressed when a particular FGF receptor gene is expressed may be used. Then, the 30 nucleic acid will be transcribed when the FGF receptor, such as FGFRl, is expressed, CA 0222l269 l997-ll-l4 and not when FGFR2 is expressed. This type of promoter is especially useful when one knows the pattern of FGF receptor expression in a particular tissue, so that specific cells within that tissue may be killed upon transcription of a cytotoxic agent gene without affecting the surrounding tissues.
If the domain binds in a sequence specific manner, the construct must contain the sequence that binds to the nucleic acid binding domain. As describedbelow, the target nucleotide sequence may be contained within the coding region of the cytocide, in which case, no additional sequence need be incorporated. Additionally, it may be desirable to have multiple copies of target sequence. If the target sequence is coding sequence, the additional copies must be located in non-coding regions of the cytocide-encoding agent. The target sequences of the nucleic acid binding domains are typically generally known. If unknown, the target sequence may be readily determined.
Techniques are generally available for establishing the target sequence (e.g., see PCT
Application WO 92/05285 and U.S. Serial No. 586,769).
G. Other Elements 1. Nuclear translocation si~nal As used herein, a "nuclear translocation or targeting sequence" (NTS) is a sequence of amino acids in a protein that are required for translocation of the protein into a cell nucleus. Examples of NTSs are set forth in Table 2 below. Comparison with known NTSs, and if necessary testing of c~n~ tc sequences, should permit those of skill in the art to readily identify other amino acid sequences that function as NTSs. A
heterologous NTS refers to an NTS that is different from the NTS that occurs in the wild-type peptide, polypeptide, or protein. For example, the NTS may be derived from another polypeptide, it may be synthesized, or it may be derived from another region in the same polypeptide.

W O 96/36362 PCTrUS96107164 SourceSeql-t?n~* SEQ ID
NO.
SV40 large TProl26LysLysArgLysValGlu 24 Polyoma large T Pro279 ProLysLysAlaArgGluVal 25 Humarl c-MycProl20AlaAlaLysArgValLysLeuAsp 26 Adenovirus EIA Lys281ArgProArgPro 27 Yeast mat a2Lys311eProlleLys 28 c-Er~-AA. Gly22 LysArgLysArgLysSer 29 B. Ser~27LysArgValAlaLysArgLysLeu 3Q
C. Serl81HisTrpLysGlnLysArgLysPhe 31 c-MybPros21LeuLeuLysLyslleLysGln 32 p53Pro3l6GlnProLysLysLysPro 33 NucleolinPro277GlyLysArgLysLysGluMetThrLysGlnLysGluValPro 34 HIV TatGly48ArgLysLysArgArgGlnArgArgArgAlaPro 35 FGF-IAsnTyrLysLysProLysLeu 36 FGF-2HisPheLysAspProLysArg 37 FGF-3AlaProArgArgArgLysLeu 38 FGF-4IleLysArgLeuArgArg 39 FGF-S GlyArgArg FGF-6lleLysArgGlnArgArg 40 ~GF-7 IleArgValArgArg 41 *Superscript indicates position in protein In order to deliver the nucleic acid to the nucleus, the conjugate should include an NTS. If the conjugate is designed such that the receptor-binding intf rn~ ec~
ligand and linked nucleic acid binding domain is cleaved or dissociated in the cytoplasm, then the NTS should be included in a portion of the complex that remains bound to the nucleic acid, so that, upon intern~li7~tion, the conjugate will be trafficked to the nucleus. Thus, the NTS is preferably included in the nucleic acid bindingdomain, but may additionally be included in the ligand. An NTS is preferred if the cytocide-encoding agent is DNA. If the cytocide-encoding agent is mRNA, an NTS

W096/36362 PCTrUS96/07164 may be omitted. The nuclear translocation sequence (NTS) may be a heterologous sequence or a may be derived from the selected growth factor. All presently identified members of the FGF family of peptides contain an NTS (see, e.g, Tntern~tional Application WO 91/15229 and Table 2). A typical consensus NTS sequence contains 5 an amino-t~rmin~l proline or glycine followed by at least three basic residues in a array of seven to nine amino acids (see, e.g, Dang et al., J. Biol. Chem. 264:18019-18023, 1989, Dang et al., Mol. Cell. Biol. 8:4049-4058,1988, and Table 2).

2. CYtoplasm-translocation si~nal Cytoplasm-translocation signal sequence is a sequence of amino acids in a protein that cause retention of proteins in the lumen of the endoplasmic reticulum and/or translocate proteins to the cytosol. The signal sequence in m~mm~ n cells is KDEL (Lys-Asp-Glu-Leu) (SEQ ID NO. 42) (Munro and Pelham, Cell 48:899-907, 1987). Some modifications of this sequence have been made without loss of activity.
lS For example, the sequences RDEL (Arg-Asp-Glu-Leu) (SEQ ID NO. 43) and KEEL
(Lys-Glu-Glu-Leu) (SEQ ID NO. 44) confer efficient or partial retention, respectively, in plants (Denecke et al., Embo. J. 11:2345-2355,1992).
A cytoplasm-translocation signal sequence may be included in either the receptor-int~rn~1i7~d binding ligand or the nucleic acid binding domain part or both. If 20 cleavable linkers are used to link the ligand with the nucleic acid binding domain, the cytoplasm-translocation signal is preferably included in the nucleic acid binding domain, which will stay bound to the cytocide-encoding agent. Additionally, a cytoplasmic-translocation signal sequence may be included in the receptor-int~rn~1i7~
binding ligand, as long as it does not interfere with receptor binding. Similarly, the 25 signal sequence placed in the nucleic acid binding domain should not interfere with binding to the cytocide-encoding agent.

3. Endosome-disruptive peptides In addition, or alternatively, membrane-disruptive peptides may be 30 incorporated into the complexes. For example~ adenoviruses are known to enhance -disruption of endosomes. Virus-free viral proteins, such as influenza virus hem:~glutinin HA-2, also disrupt endosomes and are useful in the present invention.
Other proteins may be tested in the assays described herein to find specific endosome disrupting agents that enhance gene delivery. In general, these proteins and peptides are 5 amphipathic (see Wagner et al., Adv. Drug Del. Rev. 14:1 l3-l35, l994).
Endosome-disruptive peptides7 sometimes called fusogenic peptides, may be incorporated into the complex of receptor-int~rn~1i7t?tl binding ligand7 nucleic acid binding domain, and cytocide-encoding agent. Two such peptides derived frominfluenza virus are: GLFEAIEGFIENGWEGMIDGGGC (SEQ. ID NO. 45) and 10 GLFEAIEGFIENGWEGMIDGWYGC (SEQ. ID NO. 46). Other peptides useful for disrupting endosomes may be i-l~ntified by general characteristics: 25-30 residues in length, contain an ~ltern~ting pattern of hydrophobic domains and acidic domains, and at low pH (e.g, pH 5) from amphipathic a-helices. A c~n~ t~ endosome-disrupting peptide is tçsted by incorporating it into the complex and deterrnining whether it l5 increases the total number of cells expressing the target gene. The peptides are added to a complex having excess negative charge. For example, a DNA construct is complexed with an FGF-poly-L-lysine chemical conjugate so that only a portion of the negative charge of the DNA is neutralized. Poly-L-lysine is added to further bind the DNA and a fusogenic peptide is then added. Optional ratios of DNA, poly-L-lysine and fusogenic 20 peptide are ~leterrnined using assays, such as gene expression and cell viability.
The fusogenic peptides may alternatively be incorporated into the complex as a fusion protein with either the ligand or the nucleic acid binding domain or both. The endosome-disruptive peptide may be present as single or multiple copies at the N- or C- t~ of the ligand. A single fusion protein of the endosome-disruptive 25 peptide, nucleic acid binding domain, and receptor-intern~1i7~cl binding ligand may be constructed and expressed. For insertion into a construct, DNA encoding the endosome-disruptive peptide may be synthe~i7ed by PCR using overlapping oligonucleotides and incorporating a restriction site at the 5' and 3' end to facilitate cloning. The sequence may be verified by sequence analysis.

4. Linkers As used herein, a "linker" is an extension that links the receptor-binding intt~rn~li7~1 ligand or fragment thereof and the nucleic acid binding domain. In certain instances, the linker is used to conjugate the ligand directly to the nucleic acid. The S linkers provided herein confer specificity, enh~n~e intracellular availability, serum stability and/or solubility on the conjugate and may serve to promote conclen~?,tion of the nucleic acid.
The linkers provided herein confer specificity and serum stability on the cytotoxic conjugate, for example, by conferring specificity for certain proteases, 10 particularly proteases that are present in only certain subcellular co~ ~Llllents or that are present at higher levels in tumor cells than normal cells. Specificity for proteases present in intracellular colllp~Llllents and absent in blood is particularly plc~r~;lled. The linkers may also include sorting signals that direct the conjugate to particularintracellular loci or COlll~ Llllents. Additionally, the linkers may reduce steric 15 hindrance between the grow~ factor and other protein or linked nucleic acid by distancing the components of the conjugate. Linkers may also condense the nucleic acid. For this purpose, the linker comprises highly basic amino acids (e.g, Lys, Arg) and may even by poly-L-lysine.
In order to increase the serum stabilit,v, solubility and/or intracellular 20 concentration or condense the targeted agent, one or more linkers (are) inserted between the receptor-binding intern~li7~cl ligand and the nucleic acid binding domain. These linkers include peptide linkers, such as intracellular protease substrates, and chemical linkers, such as acid labile linkers, ribozyme substrate linkers and others. Peptides linkers may be inserted using heterobifunctional reagents, described below, or, 25 preferably, are linked to FGF, other growth factors, including heparin-binding growth factors, or cytokines by linking DNA encoding the ligand to the DNA encoding thenucleic acid binding domain.
Chemical linkers may be inserted by covalently coupling the linker to the FGF, other growth factor protein. or cytokine and the nucleic acid binding domain. The 30 linker may be bound via the N- or C-terminll~ or an int~ l residue. The - =

heterobifunctional agents, described below, may be used to effect such covalent coupling.

a. Protease ~ubsLl~Les Peptides encoding protease-specific substrates may be introduced between the ligand and the nucleic acid binding domain. The peptides may be inserted using heterobifunctional reagents, as described below, or preferably inserted byrecombinant means and ~x~res~ion of the resulting chimera.
Any protease specific substrate (see, e.g, O'Hare et al., FEBS 273:200-204, 1990, Forsberg et al., J. Protein Chem. 10:517-526, 1991; Westby et al., Bioconjugate Chem. 3:375-381, 1992) may be introduced as a linker as long as thesubstrate is cleaved in an intracellular co~ ~Llllcnt. Preferred substrates include those that are specific for proteases that are expressed at higher levels in tumor cells, that are plc;~lelltially expressed in the endosome, or that are absent in blood. The following substrates are among those contemplated for use in accord with the methods herein:
ç~th~psin B ~Ub:iLldL~, cathepsin D :jUl):jLl~L~:, trypsin substrate, thrombin substrate, and recombinant subtilisin substrate.

b. Flexible linkers and linkers that increase the solubility of the conju~ates Flexible linkers, which reduce steric hindrance, and linkers that increase solubility of the conjugates are contemplated for use, either alone or with other linkers, such as the protease specific substrate linkers. Typically, these linkers are simple polymers of small amino acids (i.e., small side groups) with uncharged polar side groups. These amino acids (Gly, Ser, Thr, Cys, Tyr, Asn, Gln) are more soluble in water. Of these amino acids, Gly and Ser are preferred. Such linkers include, but are not limited to, (Gly4Ser)n, (Ser4Gly)n and (AlaAlaProAla)n in which n is 1 to 6,preferably 1-4, such as:
a. Gly4Ser SEQ ID NO: 47 CCATGGGCGG CGGCGGCTCT GCCATGG

b. (Gly4Ser)2 SEQ ID NO: 48 CCATGGGCGG CGGCGGCTCT GGCGGCGGCG GCTCTGCCAT GG
c. (Ser4Gly)4 SEQ ID NO: 49 CCATGGCCTC GTCGTCGTCG GGCTCGTCGT CGTCGGGCTC GTCGTCGTCG GGCTCGTCGT

d. (Ser4Gly)2 SEQ ID NO: 50 CCATGGCCTC GTCGTCGTCG GGCTCGTCGT CGTCGGGCGC CATGG
e. (AlaAlaProAla)n, where n is 1 to 4 preferably 2 (see SEQ I D NO: 51 ) c. Heterobifunctional cross-linkin~ rea~ents Numerous heterobifunctional cross-linking reagents that are used to form covalent bonds between amino groups and thiol groups and to introduce thiol groups into proteins, are known to those of skill in this art (see, e.g, the PIERCE CATALOG, 15 TmmllnoTechnology Catalog & Handbook, 1992-1993, which describes the pl~aldlion of and use of such reagents and provides a commercial source for such reagents; see also, e.g, Cumber et al., Bioconjugate Chem. 3:397-401, 1992; Thorpe et al., Cancer Res. 47:5924-5931, 1987; Gordon et al., Proc. Natl. Acad Sci. 84:308-312, 1987, Walden et al., J. Mol. Cell Immunol. 2:191-197, 1986; Carlsson et al., Bioc*em. J.
20 173:723-737, 1978, Mahan et al., Anal. Biochem. 162:163-170, 1987; Wawrym~c7~k et al., Br. J. Cancer 66:361-366, 1992; Fattom et al., Infection & Immun. 60:584-589, 1992). These reagents may be used to form covalent bonds between the receptor-binding intern~li7~tl ligands with protease substrate peptide linkers and nucleic acid binding domain. These reagents include, but are not limited to: N-succinimidyl-3-(2-25 pyridyldithio)propionate (SPDP; disulfide linker); sulfosuccinimidyl 6-[3-(2-pyridyldithio)propionamido]h~Y~nn~t~? (sulfo-LC-SPDP); succinimidyloxycarbonyl-a-methyl benzyl thiosulfate (SMBT, hindered ~ f~t~? linker); succinimidyl 6-[3-(2-pyridyldithio) propionamido]hexanoate (LC-SPDP); sulfosnrcinimiclyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate (sulfo-SMCC); succinimidyl 30 3-(2-pyridyldithio)butyrate (SPDB; hindered ~ lllficle bond linker); sulfosuccinimidyl 2-(7-a7ido4-methylcoumarin-3-acetamide) ethyl-1,3'-dithiopropionate (SAED);
sulfosuccinimidyl 7-azido4-methylcoulll~ill-3-acetate (SAMCA); sulfosuccinimidyl 6-~alpha-methyl-alpha-(2-pyridyldithio)toluamido]he~no~te(sulfo-LC-SMPT);
1,4-di-[3'-(2'-pyridyldithio)propionamido]butane (DPDPB);
4-sllcrinimit1ylo~syc~bonyl- -methyl- -(2-pyridylthio)toluene (SMPT, hindered ~ 1f~te linker); sulf ~surçinimidyl6[ -methyl- -(2-pyridyldithio)toluamido]hexanoate (sulfo-LC-5 SMPT); m-m~leimi-loben70yl-N-lly~ y~uccinimide ester (MBS); m-m:~leimi~loben70yl-N-hydroxyslllfosllccinimi(le ester (sulfo-MBS); N-succinimidyl(4-iodoacetyl)aminoben7l~te (SIAB; thioether linker); slllfosucrinimic1yl(4-iodoacetyl)amino bon70~t~ (sulfo-SIAB); sllcr-inimi~1yl4~z7-m~leimi~1ophenyl)lJuly~ (SMPB); sulfosuccini-midyl4-~z7-maleimidophenyl)l,ulyl~l~ (sulfo-SMPB); azidobenzoyl hydrazide (ABEI).
These linkers shoalld be particularly useful when used in combination with peptide linkers, such as those that increase flexibility.

d. Acid cleavable~ photocleavable. and heat sensitive linkers Acid cleavable linkers include, but are not limited to, 15 bismaleimideothoxy propane, adipic acid dihydrazide linkers (see, e.g, Fattom et al., Infection & Immun. 60:584-589, 1992) and acid labile transferrin conjugates thatcontain a sufficient portion of transferrin to permit entry into the intracellular transferrin cycling pathway (see, e.g., Welhoner et al., J. Biol. Chem. 266:4309-4314, 1991).
Conjugates linked via acid cleavable linkers should be pl~;f~rt;lllially cleaved in acidic 20 intracellular colllp~ ~llents, such as the endosome.
Photocleavable linkers are linkers that are cleaved upon exposure to light (see, e.g., Goldmacher et al., Bioconj. Chem. 3:104-107, 1992), thereby releasing the targeted agent upon exposure to light. (Hazum et al., Proc. Eur. Pept. Symp., 16th, Brunfeldt, K (Ed), pp. 105-110, 1981; nitrobenzyl group as a photocleavable protective 25 group for cysteine; Yen et al., Makromol. Chem 190:69-82, 1989; water solublephotocleavable copolymers, including hydroxy~lopylmethacrylamide copolymer, glycine copolymer, fluorescein copolymer and me~ylrhodamine copolymer; and Senter et al., Photochem. Photobiol. 42:231-237, 1985; nitrobenzyloxycarbonyl chloride cross linking reagents that produce photocleavable linkages). Such linkers are particularly 30 useful in treating clennz~tQlogical or ophthalmic conditions and other tissues, such as CA 0222l269 l997-ll-l4 blood vessels during angioplasty in the prevention or tre~tment of restenosis, that can be exposed to light using fiber optics. After ~-lmini~tration of the conjugate, the eye or skin or other body part can be exposed to light, resulting in release of the targeted moiety from the conjugate. This should permit ~-lminictration of higher dosages of such5 conjugates compared to conjugates that release a cytotoxic agent upon internalization.
Heat sensitive linkers would also have similar applicability.

H. Expression vectors and host cells for expression of receptor-bindin~ intern~li7.?~1 li~ands and nucleic acid bindinte domains Host org~ni~m~ include those org~ni~m~ in which recombinant production of heterologous proteins have been carried out, such as bacteria (forexample, E. coli), yeast (for example, Saccharomyces cerevisiae and Pichia pastoris), mslmm~ n cells, and insect cells. Presently ~ref~;l,ed host org~ni~m~ are E. coli bacterial strains.
The DNA construct encoding the desired protein is introduced into a plasmid for ~ lcs~ion in an ~pl~liate host. In pler~lled embo~1iment~, the host is a bacterial host. The sequence encoding the ligand or nucleic acid binding domain is preferably codon-optimized for expression in the particular host. Thus, for example, if human FGF-2 is expressed in bacteria, the codons would be optimized for bacterial usage. For small coding regions the gene can be synthesi7~d as a single oligonucleotide. For larger proteins, splicing of multiple oligonucleotides, mutagenesis, or other techniques known to those in the art may be used. For example, the sequence of a bacterial-codon preferred FGF-SAP fusion is shown in SEQ. ID NO. 80. The sequences of nucleotides in the plasmids that are regulatory regions, such as promoters and operators, are operationally associated with one another for transcription. The sequence of nucleotides encoding the growth factor or growth factor-chimera may also include DNA encoding a secretion signal, whereby the resulting peptide is a precursor protein. The resulting processed protein may be recovered from the periplasmic space or the fermentation medium.
In preferred embodiments, the DNA plasmids also include a transcription termin~tor sequence. As used herein, a "transcription terminator region" has either (a) a -WO 96/36362 PCI~/US96/07164 subsegment that encodes a polyadenylation signal and polyadenylation site in thetranscript, and/or (b) a subsegment that provides a transcription te-rmin~tion signal that t-ormin~t~s transcription by the polymerase that recognizes the selected promoter. The entire transcription t~rmin~t-~r may be obtained from a protein-encoding gene, which 5 may be the same or dirre.cl~ from the inserted gene or the source of the promoter.
Transcription t~rmin~tors are optional components of the expression systems herein, but are employed in ~ r~ d embotlim~nt~.
The plasmids used herein include a promoter in operable association with the DNA encoding the protein or polypeptide of interest and are designed for 10 expression of proteins in a b~ct~ri~l host. It has been found that tightly regulatable promoters are pler~,.led for e~re~ion of saporin. Suitable promoters for ~plession of proteins and polypeptides herein are widely available and are well known in the art.
Inducible promoters or constitutive promoters that are linked to regulatory regions are ~l~r~,llc:d. Such promoters include, but are not limited to, the T7 phage promoter and 15 other T7-like phage promoters, such as the T3, T5 and SP6 promoters, the trp, lpp, and lac promoters, such as the lacW5, from E. coli; the P10 or polyhedron gene promoter of baculovirusfinsect cell ~re~sion systems (see, e.g., U.S. Patent Nos. 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784) and inducible promoters from other eukaryotic ~ ression systems. For expression of the proteins such promoters are 20 inserted in a plasmid in operative linkage with a control region such as the lac operon.
Preferred promoter regions are those that are inducible and functional in E. coli. Examples of suitable inducible promoters and promoter regions include, but are not limited to: the E. coli lac operator responsive to isopropyl -D-thiogalactopyranoside (IPTG, see, et al. Nakamura et al., Cell 18: 1109-1117, 1979), 25 the metallothionein promoter metal-regulatory-elements responsive to heavy-metal (e.g, zinc) induction (see, e.g., U.S. Patent No. 4,870,009 to Evans et al.); the phage T71ac promoter responsive to IPT~ (see, e.g, U.S. Patent No. 4,952,496; and Studier et al., Meth. Enzymol. 185:60-89, 1990) and the TAC promoter.
The plasmids also preferably include a selectable marker gene or genes 30 that are functional in the host. A selectable marker gene includes any gene that confers W096/36362 PCTnUS96107164 a phenotype on bacteria that allows transformed bacterial cells to be identified and selectively grown from among a vast majority of untransformed cells. Suitable selectable marker genes for bacterial hosts, for example, include the ampicillinrecict~nce gene (Amp7, tetracycline resict~nce gene (Tcr) and the kanamycin recict~n~e gene (Kanr). The kanamycin resistance gene is presently pl~efelled.
The plasmids may also include DNA encoding a signal for secretion of the operably linked protein. Secretion signals suitable for use are widely available and are well known in the art. Prokaryotic and eukaryotic secretion signals functional in E. coli may be employed. The presently ~-~rell.,d secretion signals include, but are not limited to, those encoded by the following E. coli genes: ompA, ompT, ompF, ompC, beta~ t~m~ce, and ~lk~lint- phosph~t~ce, and the like (von Heijne, J Mol. Biol.
184:99-105, 1985). In addition, the bacterial pelB gene secretion signal (Lei et al., J.
Bacteriol. 169:4379, 1987), the phoA secretion signal, and the cek2 functional in insect cell may be employed. The most yrer~lled secretion signal is the E. coli ompA
secretion signal. Other prokaryotic and eukaryotic secretion signals known to those of skill in the art may also be employed (see, e.g, von Heijne, J. Mol. Biol. 184:99-105, 1985). Using the methods described herein, one of skill in the art can substitute secretion signals that are functional in either yeast, insect or ms~mm~ n cells to secrete proteins from those cells.
Particularly pl~rell~d plasmids for transformation of E. coli cells include the pET ~2~yles~ion vectors (see U.S patent 4,952,496, available from Novagen, Madison, WI; see also literature published by Novagen describing the system). Such pl~cmi(lc include pET lla, which contains the T71ac promoter, T7 termin~tor, theinducible E. coli lac operator, and the lac repressor gene; pET 12a-c, which contains the T7 promoter, T7 tcnnin~t~ r, and the E. coli ompT secretion signal; and pET l5b (Novagen, Madison, WI), which contains a His-TagTM leader sequence for use in purification with a His column and a thrombin cleavage site that permits cleavage following purification over the column, the ~7-lac promoter region and the T7 termin~tc r.

WO 96/36362 PCI'IUS96/07164 Other preferred plasmids include the pKK plasmids, particularly pKK
223-3, which contains the tac promoter, (available from ph~rm~ ; see also Brosius et al., Proc. Natl. Acad. Sci. 81:6929, 1984; Ausubel et al., Current Protocols in Molecular Biology, U.S. Patent Nos. 5,122,463, 5,173,403, 5,187,153, 5,204,254, 5,212,058, 5,212,286, 5,215,907, 5,220,013, 5,223,483, and 5,229,279). Plasmid pKK
has been modified by replacement of the ampicillin resistance marker gene, by digestion with EcoR:~, with a kanamycin resi~t~nce cassette with EcoRI sticky ends (purchased from Ph~rm~ci:~ obtained from pUC4K, see, e.g, Vieira et al. (Gene 19:259-268, 1982; and U.S. Patent No. 4,719,179). Baculovirus vectors, such as pBlueBac (also called pJVETL and derivatives thereof), particularly pBlueBac III, (see, e.g, U.S. Patent Nos. S,278,050, 5,244,805, 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784; available from Invitrogen, San Diego) may also be used for expression of the polypeptides in insect cells. The pBlueBacIII vector is a dualpromoter vector and provides for the selection of recombinants by blue/white screening as this plasmid contains the 13-galactosidase gene (lacZ) under the control of the insect recognizable ETL promoter and is inducible with IPTG. A DNA construct may be made in baculovirus vector pBluebac III and then co-transfected with wild type virus into insect cells Spodoptera fi ugiperda (sf9 cells; see, e.g, Luckow et al., Bio/technology 6:47-55, 1988, and U.S. Patent No. 4,745,051).
Other plasmids include the pIN-IIIompA plasmids (see U.S. Patent No. 4,575,013; see aZso Duffaud et al., Meth. Enz. 153:492-507, 1987), such as pIN-IIIompA2. The pIN-IIIompA plasmids include an insertion site for heterologous DNA
linked in transcriptional reading frame with four functional fr~gment~ derived from the lipoprotein gene of E. coli. The plasmids also include a DNA fragment coding for the signal peptide of the ompA protein of E coli, positioned such that the desired polypeptide is expressed with the ompA signal peptide at its amino terminus, thereby allowing eff1cient secretion across the cytoplasmic membrane. The plasmids further include DNA encoding a specific segment of the E. coli lac promoter-operator, which is positioned in the proper orientation for transcriptional expression of the desired polypeptide, as well as a separate functional E coli lacI gene encoding the associated repressor molecule that, in the absence of lac operon inducer, interacts with the lac promoter-operator to prevent transcription therefrom. Expression of the desired polypeptide is under the control of the lipoprotein (lpp) promoter and the lac promoter-operator, although transcription from either promoter is normally blocked by the repressor molecule. The repressor is selectively inactivated by means of an inducer molecule thereby inducing transcriptional expression of the desired polypeptide from both promoters.
Preferably, the DNA fragment is replicated in b~cteri~l cells, preferably in E. coli. The ~ler. ~led DNA fragment also includes a bacterial origin of replication, to ensure the m~int~n~nce of the DNA fragment from generation to generation of the bacteria. In this way, large quantities of the DNA fragment can be produced by replication in bacteria. Preferred bacterial origins of replication include, but are not limited to, the fl-ori and col El origins of replication. Preferred hosts contain chromosomal copies of DNA encoding T7 RNA polymerase operably linked to an inducible promoter, such as the lacW promoter (see U.S. Patent No. 4,952,496). Such hosts include, but are not limited to, lysogens E. coli strains HMS174(DE3)pLysS, BL21(DE3)pLysS, HMS174(DE3) and BL21(DE3). Strain BL21(DE3) is ~lerelled.
The pLys strains provide low levels of T7 lysozyme, a natural inhibitor of T7 RNA
polymerase.
The DNA fragments provided may also contain a gene coding for a repressor protein. The repressor protein is capable of leples~illg the transcription of a promoter that contains sequences of nucleotides to which the repressor protein binds.
The promoter can be derepressed by altering the physiological conditions of the cell.
For example, the alteration can be accomplished by adding to the growth medium amolecule that inhibits the ability to interact with the operator or with regulatory proteins or other regions of the DNA or by altering the temperature of the growth media.
Preferred repressor proteins include, but are not limited to the E. coli lacI repressor responsive to IPTG induction, the temperature sensitive ~ cI857 repressor, and the like.
The E. coli lacI repressor is preferred.

~ CA 02221269 1997-11-14 DNA encoding full-length FGF-2 or FGF-2 mutein is linked to DNA
encoding an nucleic acid binding domain, such as protamine, and introduced into the pET vectors, including pET-1 la and pET-12a expression vectors (Novagen, Madison, WI), for inkacellular and periplasmic expression, respectively, of FGF-protamine fusion 5 proteins.

I. Pl~pal~Llion of complexes cont~inin~ receptor-bindin~ intPrn~li7~-1 li~ands/nucleic acid bindin~ domain conju~ates and cytocide-encoding a~ents Within the context of this invention, specificity of delivery is achieved 10 through the ligand. Typically, a nucleic acid binding domain is coupled to a receptor-binding intern~li7~ ligand, either by chemical conjugation or as a fusion protein. As described below, the ligand may alternatively be coupled directly to the nucleic acid and then complexed with a nucleic acid binding protein, such as poly-lysine, which serves to condense the nucleic acid. Linkers as described above may optionally be used. The 15 receptor-binding int~rn~li7Pd ligand confers specificity of delivery in a cell-specific manner. The choice of the receptor-binding int~rn~li7t?-1 ligand to use will depend upon the receptor expressed by the target cells. The receptor type of the target cell population may be detertninerl by conventional techniques such as antibody stslining, PCR of cDNA using receptor-specific primers, and biochemical or functional receptor binding 20 assays. It is preferable that the receptor be cell type-specific or have increased expression or activity (i. e., higher rate of inttorn~li7~tion) within the target cell population.
As described herein, the nucleic acid binding domain can be of two types, non-specific in its ability to bind nucleic acid, or highly specific so that the amino 25 acid residues bind only the desired nucleic acid sequence. Nonspecific binding proteins, polypeptides, or compounds are generally polycationic or highly basic. Lys and Arg are the most basic of the 20 common amino acids; proteins enriched for these residues are candidates for nucleic acid binding domains. Examples of basic proteins include histones, protz~min~c, and repeating units of lysine and arginine. Poly-L-lysine 30 is an often-used nucleic acid binding domain (see U.S. Patent Nos. 5,166,320 and 5,354,844). Poly-L-lysine and prot~nine are ~i~r~ d. Other polycations, such as CA 0222l269 l997-ll-l4 le and spermidine, may also be used to bind nucleic acids. By way of example, the sequence-specific proteins, including gal4, Sp-l, AP-l, myoD and the rev gene product from HIV, may be used. Specific nucleic acid binding domains can be cloned in t~n~l~m, individually, or multiply to a desired region of the receptor-binding S intt-rn:~li7~cl ligand of interest. Alternatively, the ligand and binding domain can be chemically conjugated to each other.
The corresponding sequence that binds a sequence-specific domain is incorporated into the construct to be delivered. Complexing the cytocidal-encoding agent to the receptor-binding int~ li7-o-1 ligand/nucleic acid binding domain allows 10 specific binding to the nucleic acid binding domain. Even greater specificity of binding may be achieved by identifying and using the minim~l amino acid sequence that binds to the cytocidal-encoding agent of interest. For example, phage display methods can be used to identify amnino acids residues of varying length that will bind to specific nucleic acid sequences with high affinity. (See U.S. Patent No. 5,223,409.) The peptide 15 sequence can then be cloned into the receptor-binding intern~li7~1 ligand as a single copy or multiple copies. Alternatively, the peptide may be chemically conjugated to the receptor-binding int~rn~li7~cl ligand. Incubation of the cytocide-encoding agent with the conjugated proteins will result in a specific binding between the two.
These complexes may be used to deliver nucleic acids that encode 20 saporin, other cytocidal proteins, or prodrugs into cells with a~l,lo~,iate receptors that are expressed, over-expressed or more acti~e in int~rn~li7~tion upon binding. The cytocide gene is cloned downstream of a m~mm~ n promoter such as c-myc, SV40 early or late gene, CMV-IE, TK or adenovirus promoter. As described above, promoters of interest may be active in any cell type, active only in a tissue-specific 25 manner, such as a-crystalline or tyrosinase, event specific, or inducible, such as the MMTV LTR.

1. Chemical coniu~ation a. Pl~,u~dlion of receptor-binding internslli7~ ands Receptor-binding int~?rn~li7~d ligands are prepared as discussed by any suitable method, including recombinant DNA technology, isolation from a suitablesource, purchase from a commercial source, or chemical synthesis. The selected linker or linkers is (are) linked to the receptor-binding int~rn~li7tod ligands by chemical reaction, generally relying on an available thiol or amine group on the receptor-binding internzlli7~-1 lig~nrl~ Heterobifunctional linkers are particularly suited for chemical conjugation. Alternatively, if the linker is a peptide linker, then the receptor-binding int~rn~li7~cl lig~n-lc, linker and nucleic acid binding domain can be expressed recombinantly as a fusion protein.
Any protein that binds and int~rn~li7es through a receptor interaction may be used herein. In particular, any member of the FGF family of peptides or portion thereof that binds to an FGF receptor and int~rn~li7.?s a linked agent may be used herein. For the chemical conjugation methods the protein may be produced recombinantly, produced synthetically or obtained from commercial or other sources.
For the ~ udlion of fusion proteins, the DNA encoding the FGF may be obtained from any known source or synth~si7~1 according to its DNA or amino acid sequences (see flicc~ ion above).
Although any of the growth factors may be conjugated in this manner, FGF, VEGF, and HBEGF conjugation are discussed merely by way of example and not by way of limitation.
If necessary or desired, the heterogeneity of p~ep~dLions of ligand (e.g, FGF) cont~inin~ chemical conjugates and fusion proteins can be reduced by modifying the ligand by deleting or replacing a site(s) that causes the heterogeneity. Such sites in FGF are typically cysteine residues that upon folding of the protein remain available for interaction with other cysteines or for interaction with more than one cytotoxicmolecule per molecule of FGF peptide. Thus, such cysteine residues do not include any cysteine residue that is required for proper folding of the FGF peptide or for binding to 30 an FGF receptor and int~ rnz~ tion. For chemical conjugation, one cysteine residue CA 02221269 Igg7-ll-l4 WO 96/36362 PCTIUS96l07164 that in physiological conditions is available for interaction is not replaced but is used as the site for linking the cytotoxic moiety. The resulting modified FGFis thus conjugated with a single species of nucleic acid binding domain (or nucleic acid).
The polypeptide reactive with an FGF receptor may be modified by 5 removing one or more reactive cysteines that are not required for receptor binding, but that are available for reaction with a~uplu~l;ately derivatized cytotoxic agent, so that the resllltingFGF protein has only one cysteine residue available for conjugation with the cytotoxic agent. If necessary, the contribution of each cysteine to the ability to bind to FGF receptors may be determined empirically. Each cysteine residue may be 10 syst~-m~tic~lly replaced with a conservative amino acid change (see Table 1, above) or deleted. The resulting mutein is tested for the requisite biological activity, the ability to bind to FGF receptors and int~rn~li7e linked cytotoxic moieties. If the mutein retains at least 50% of wild-type activity, then the cysteine residue is not required. Additional cysteines are systematically deleted and replaced and the resulting muteins are tested for 15 activity. In this manner the mi.~i...-.~.~ number and identity of the cysteines needed to retain the ability to bind to an FGF receptor and int~rn~li7~- may be clet~rminP~l The resulting mutant FGFis then tested for retention of the ability to target a cytotoxic agent to a cell that expresses an FGF receptor and to internslli7~ the cytotoxic agent into such cells. Retention of proliferative activity is indicative, though not definitive, of the 20 retention of such activities. Proliferative activity may be measured by any suitable proliferation assay, such as the assay, exemplified below, that measures the increase in cell number of bovine aortic endothelial cells.
It is noted, however, that modified or mutant FGFs may exhibit reduced or no proliferative activity, but may be suitable for use herein, if they retain the ability 25 to target cytocide-encoding agent to cells bearing FGF receptors and result in intem~li7~tion. Certain residues of FGF-2 have been associated with proliferative activity. Modification of these residues arg 1 16, lys 1 19, tyr 120, trp 123 to ile 1 16, glu 119, ala 120, ala 123 may be made individually (see SEQ ID NOs. 81-84) to removethis function. The resulting protein is tested for proliferative activity by a standard 30 assay.

=

W 096/36362 PCTrUS96/07164 Any of FGF- 1 - FGF-9 may be used. The complete amino acid sequence of each of FGF-l - FGF- 9 is known (see, e.g., SEQ ID NO. 10 (FGF-l) and SEQ ID
NOs. 12-18 (FGF-3 - FGF-9, respectively)). Comparison among the amino acid sequences of FGF-l -FGF-9 reveals that one Cys is conserved among FGF family of 5 peptides (see Table 3). These cysteine residues may be required for secondary structure and are not plef~;.lcd residues to be altered. Each of the rem~inin?~ cysteine residues may be syst~m~tir~lly deleted and/or replaced by a serine residue or other residue that would not be expected to alter the structure of the protein. The resulting peptide is tested for biological activity. If the cysteine residue is necessary for retention of 10 biological activity it is not deleted; if it not necessary, then it is preferably replaced with a serine or other residue that should not alter the secondary structure of the resulting protein.
The cysteine residues from each of FGF-l - FGF-9 that appear to be ess~nti~l for retention of biological activity and that are not ~l~f~ d residues for 15 deletion or repl~r~ment are as follows:

FGF- 1 cys98 FGF-2 cys'~' FGF-3 cys' 15 FGF-4 cys~55 FGF-S cysl60 FGF-6 cys~4' FGF-7 cys'3' FGF-8 cys"' FGF-9 cysl34 For example, FGF-l has cysteines at positions 31, 98 and 132; FGF-2 has cysteines at positions 34, 78, 96 and 101; FGF-3 has cysteines at positions 50 and 115, FGF-4 has cysteines at positions 88 and 155; FGF-S has cysteines at positions 19, W 096/36362 PCTrUS96/07164 93,160 and 202;FGF-6 has cysteines at positions 80 and 147;FGF-7 has cysteines at positions 18,23,32,46,71,133 and 137;FGF-8 has cysteines at positions 10, 19, 109 and 127; and FGF-9 has cysteines at positions 68 and 134.
Since FGF-3,FGF-4 and FGF-6 have only two cysteines, for purposes of 5 chemical conjugation, preferably neither cysteine is deleted or replaced, unless another residue, preferably one near either terrninus, is replaced with a cysteine. With respect to the other FGF family members, at least one cysteine must remain available for conjugation with the cytotoxic conjugate and probably two cysteines, but at least the cysteine residues set forth in Table 3. A second cysteine may be required to form a 10 disulfide bond. Thus, any FGF peptide that has more than three cysteines is be modified for chPmic~l conjugation by deleting or replacing the other cysteine residues.
FGF peptides that have three cysteine residues are modified by elimin~tion of one cysteine, conjugated to a cytotoxic moiety and tested for the ability to bind to FGF
receptors and intern~li7t? the cytotoxic moiety.
In accord with the methods herein, several mutein~ of basic FGF for chemical conjugation have been produced (~,e~aL~lion of muteins for recombinant expression of the conjugate is described below). DNA, obtained from pFC80 (see PCT
Application Serial No. PCT/US93/05702; United States Application Serial No. 07/901,718; see also SEQ ID NO. 52) encoding basic FGF has been mutagenized.Mutagenesis of cysteine 78 of basic FGF(FGF-2) to serine ([C78S]FGF) or cysteine 96 to serine ([C96S]FGF) produced two mutants that retain virtually complete proliferative activity of native basic FGF as judged by the ability to stimulate endothelial cell proliferation in culture. The activities of the two ~llulant~ and the native protein do not significantly differ as ~c~çsse~l by efficacy or m~xim~l response. Sequence analysis of the modified DNA verified that each of the mutants has one codon for cysteine converted to that for serine. The construction and biological activity of FGF-l with cysteine substitutions of one, two or all three cysteines has been disclosed (U.S. Patent No. 5,223,483). The mitogenic activity of the mutants was similar to or increased over the native protein. Thus, any of the cysteines may be mllt~tç-l and FGF-lwill still bind 30 and int~rn~li7e The rçsnltin~ mutein FGF or unmodified FGF is reacted with a nucleic acid binding ~lomzlin The bFGF mntein~ may react with a single species of derivatized nucleic acid binding domain (mono-derivatized nucleic acid binding domain), thereby resulting in monogenous ~le~dlions of FGF-nucleic acid binding domain conjugates5 and homogeneous compositions of FGF-nucleic acid binding domain ch~mi~
conjugates. The resulting chemical conjugates do not aggregate and retain the requisite biological activities.
VEGF or HBEGF may be isolated from a suitable source or may be produced using recombinant DNA methodology, ~ c~l~eed below. To effect chemic~l 10 conjugation herein, the growth factor protein is conjugated generally via a reactive amine group or thiol group to the nucleic acid binding domain directly or through a linker to the nucleic acid binding domain. The growth factor protein is conjugated either via its N-terminllc, C-t~rrninll~, or elsewhere in the polypeptide. In ~lefe~ d embo-lim~nt~, the growth factor protein is conjugated via a reactive cysteine residue to 15 the linker or to the nucleic acid binding domain. The growth factor can also be modified by addition of a cysteine residue, either by replacing a residue or by inserting the cysteine, at or near the amino or carboxyl terminl~, within about 20, preferably 10 residues from either end, and preferably at or near the amino tlorminn~
In certain embodiments, the heterogeneity of preparations may be 20 reduced by mutagenizing the growth factor protein to replace reactive cysteines, leaving, preferably, only one available cysteine for reaction. The growth factor protein is modified by deleting or replacing a site(s) on the growth factor that causes the heterogeneity. Such sites are typically cysteine residues that, upon folding of the protein, remain available for interaction with other cysteines or for interaction with 25 more than one cytotoxic molecule per molecule of heparin-binding growth factor peptide. Thus, such cysteine residues do not include any cysteine residue that are required for proper folding of the growth factor or for retention of the ability to bind to a growth factor receptor and intt?rn~ P. For chemical conjugation, one cysteine residue that, in physiological conditions, is available for interaction, is not replaced because it is used as the site for linking the cytotoxic moiety. The resulting modified heparin-binding growth factor is conjugated with a single species of cytotoxic conjugate.
Alternatively, the contribution of each cysteine to the ability to bind to VEGF, HBEGF or other heparin-binding growth factor receptors may be determined 5 empirically as described herein. Each cysteine residue may be systematically replaced with a conservative amino acid change (see Table 1, above) or deleted. The resulting mutein is tested for the requisite biological activity: the ability to bind to growth factor receptors and internalize linked nucleic acid binding domain and agents. If the mutein retains this activity, then the cysteine residue is not required. Additional cysteines are 10 systematically deleted and replaced and the resulting mllt~in~ are tested for activity.
Each of the rem~ining cysteine residues may be systematically deleted and/or replaced by a serine residue or other residue that would not be expected to alter the structure of the protein. The resulting peptide is tested for biological activity. If the cysteine residue is necessary for retention of biological activity it is not deleted; if it not necessary, then 15 it is preferably replaced with a serine or other residue that should not alter the secondary structure of the resulting protein. In this manner the minimum number and identity of the cysteines needed to retain the ability to bind to a heparin-binding growth factor receptor and internalize may be determin~cl It is noted, however, that modified or mutant heparin-binding growth factors may exhibit reduced or no proliferative activity, 20 but may be suitable for use herein, if they retain the ability to target a linked cytotoxic agent to cells bearing receptors to which the unmodified heparin-binding growth factor binds and result in int~rn~li7~tion of the cytotoxic moiety. In the case of VEGF, VEGF~2l contains 9 cysteines and each of VEGF,65, VEGFI89 and VEGF206 contain 7 additional residues in the region not present in VEGFI2l. Any of the 7 are likely to be 25 non-essential for targeting and intern~li7~tion of linked cytotoxic agents. Recently, the role of Cys-25, Cys-56, Cys-67, Cys-101, and Cys-145 in dimerization and biological activity was assessed (Claffery et al., Biochem. Biophys. Acta 1246:1-9, 1995).
Dimerization requires Cys-25, Cys-56, and Cys-67. Substitution of any one of these cysteine residues resulted in secretion of a monomeric VEGF, which was inactive in 30 both vascular permeability and endothelial cell mitotic assays. In contrast, substitution CA 0222l269 l997-ll-l4 WO 96136362 PCI'/US96/07164 of Cys 145 had no effect on dimerization, although biological activities were somewhat reduced. Substitution of Cys-iOl did not result in the production of a secreted or cytoplasmic protein. Thus, substitution of Cys-145 is plc~r~c:d.
The VEGF monomers are preferably linked via non-essçnti~l cysteine L
S residues to the linkers or to the targeted agent. VEGF that has been modified by introduction of a Cys residue at or near one tt?rmin-l~, preferably the N-t~ is plc~felled for use in chemic~l conjugation. For use herein, preferably the VEGF is dimerized prior to linkage to the linker and/or targeted agent. Methods for coupling proteins to the linkers, such as the heterobifunctional agents, or to nucleic acids, or to 10 proteins are known to those of skill in the art and are also described herein.
For recombinant expression using the methods described herein, up to all cysteines in the HBEGF polypeptide that are not required for biological activity can be deleted or replaced. AlLclll~lively, for use in the chemical conjugation methods herein, all except one of these cysteines, which will be used for Ch.?Tni~l conjugation to the 15 cj~.otoxic ager.t, c~be de;e~ed or rep;aced. Each of the HBEGF polypeptides described herein have six cysteine residues. Each of the six cysteines may independently be replaced and the resulting mutein tested for the ability to bind to HBEGF receptors and to be intçrn~li7Prl Alternatively, the resulting mutein-encoding DNA is used as part of a construct cont~ining DNA encoding the nucleic acid binding domain linked to the 20 HBEGF-encoding DNA. The construct is expressed in a suitable host cell and the resulting protein tested for the ability to bind to HBEGF receptors and int~rn~li7t- As long as this ability is retained the mutein is suitable for use herein.
Methods for chemical conjugation of proteins are known to those of skill in the art. The pr~f~ d methods for chemical conjugation depend on the selected 25 components, but preferably rely on disulfide bond forrnation. For exarnple, if the targeted agent is SPDP-derivatized saporin, then it is advarltageous to dimerize the VEGF moiety prior coupling or conjugating to the derivatized saporin. If VEGF ismodified to include a cysteine residue at or near the N-, preferably, or ~- If?rrninu~, then dimerization should follow coupling to the nucleic acid binding domain. To effect chemical conjugation herein, the HBEGF polypeptide is linked via one or more selected linkers or directly to the nucleic acid binding domain.

b. Plep~dLion of nucleic acid bindin~ domains for chemical conju~ation A nucleic acid binding domain is prepared for chemical conjugation. For chemical conjugation, a nucleic acid binding domain may be derivatized with SPDP or other suitable chemicals. If the binding domain does not have a Cys residue available for reaction, one can be either inserted or substituted for another amino acid. If desired, mono-derivatized species may be isolated, essentially as described.
For chemical conjugation, the nucleic acid binding domain may be derivatized or modified such that it includes a cysteine residue for conjugation to the receptor-binding int~rn~ 1 ligand. Typically, derivatization proceeds by reaction with SPDP. This results in a heterogeneous population. For example, nucleic acidbinding domain that is derivatized by SPDP to a level of 0.9 moles pyridine-disulfide per mole of nucleic acid binding domain includes a population of non-dt;livdLi~;d, mono-derivatized and di-derivatized SAP. nucleic acid binding domain proteins, which are overly derivatized with SPDP, may lose ability to bind nucleic acid because of reaction with sensitive lysines (Lambert et al., Cancer Treat. Res. 37:175-209, 1988).
The quantity of non-derivatized nucleic acid binding domain in the preparation of the non-purified m~t~ri~l can be difficult to judge and this may lead to errors in being able to estim~te the correct proportion of derivatized nucleic acid binding domain to add to the reaction mixture.
Because of the removal of a negative charge by the reaction of SPDP
with lysine, the three species, however, have a charge difference. The methods herein rely on this charge difference for purification of mono-derivatized nucleic acid binding domain by Mono-S cation exchange chromatography. The use of purified mono-derivatized nucleic acid binding domain has distinct advantages over the non-purified material. The amount of receptor-binding internalized ligand that can react with nucleic acid binding domain is limited to one molecule with the mono-derivatized material, and it is seen in the results presented herein that a more homogeneous conjugate is produced. There may still be sources of heterogeneity with the mono-derivatized nucleic acid binding domain used here but is acceptable as long as binding to the cytocide-encoding agent is not impacted.
Because more than one amino group on the nucleic acid binding domain S may react with the succinimidyl moiety, it is possible that more than one amino group on the surface of the protein is reactive. This creates potential for heterogeneity in the mono-derivatized nucleic acid binding ~lom~in As an ~lt~rn~tive to deliv~Li~ g to introduce a sulfhydryl, the nucleic acid binding domain can be modified by the introduction of a cysteine residue.
Preferred loci for inkoduction of a cysteine residue include the N-t~rminll~ region, preferably within about one to twenty residues from the N-te~ of the nucleic acid binding clom~in Using either methodology (reacting mono-dc~;v~Li~d nucleic acid binding domain or introducing a Cys residue into nucleic acid binding domain), the resulting ~ Lions of ch~mic~l conjugates are monogenous; compositions colll~ g the conjugates also appear to be free of aggregates.

2. Fusion protein of receptor-bindin~ intern~li7~d li~ands and nucleic acid binding domain As a ~l~relled ~ltt?rn~tive, heterogeneity can be avoided by producing a fusion protein of receptor-binding intern~li7tod ligand and nucleic acid binding domain, as described below. Expression of DNA encoding a fusion of a receptor-binding intern~li7~-A ligand polypeptide linked to the nucleic acid binding domain results in a more homogeneous preparation of cytotoxic conjugates. Aggregate formation can bereduced in p,~dl~Lions cont~ining the fusion proteins by modifying the receptor-binding intern:~li7~cl ligand, such as by removal of nonessential cysteines, and/or the nucleic acid binding domain to prevent interactions between conjugates via free cysteines. Optionally, one or more coding regions for endosome-disruptive peptide may be constructed as part of the fusion protein.
DNA encoding the polypeptides may be isolated, synthe~i7~cl or obtained from commercial sources or prepared as described herein. Expression of WO 96/36362 PCT/USg6/07164 recombinant polypeptides may be performed as described herein; and DNA encoding these polypeptides may be used as the starting materials for the methods herein.As described above, DNA encoding FGF, VEGF, HBEGF hepatocyte growth factor, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-10, IL-11, IL-13, TNF, GM-CSF, IFN and IGF polypeptides and/or the amino acid sequences of these factors are described above. DNA may be prepared synthetically based on the amino acid or DNA
sequence or may be isolated using methods known to those of skill in the art, such as PCR, probe hybridization of libraries, and the like or obtained from commercial or other sources. For example, suitable methods are described in the Examples for amplifying FGF encoding cDNA from plasmids cont~ining FGF encoding cDNA.
As described herein, such DNA may then be mutagenized using standard methodologies to delete or replace any cysteine residues that are responsible for aggregate formation. If ntocess~ry, the identity of cysteine residues that contribute to aggregate formation may be ~leterTnint?~l empirically, by deleting and/or replacing a cysteine residue and ascertaining whether the res-llting growth factor with the deleted cysteine forms aggregates in solutions cont~ining physiologically acceptable buffers and salts. Loci for insertion of cysteine residues may also be dete~ninerl empirically.
Generally, regions at or near (within 20, preferably 10 amino acids) the C- or, preferably, the N-terTninll~ are pler~;lled.
The DNA construct encoding the fusion protein can be inserted into a plasmid and expressed in a selected host, as described above, to produce a recombinant receptor-binding intern~li7~d ligand--nucleic acid binding domain conjugate. Multiple copies of the chimera can be inserted into a single plasmid in operative linkage with one promoter. When expressed, the resulting protein will then be a multimer. Typically, two to six copies of the chimera are inserted, preferably in a head to tail fashion, into one plasmid.

a. Preparation of muteins for recombinant production of the fusion l~rotein Removal of cysteines not required for binding and intern~li7~tion is preferred for both chemical conjugation and recombinant methods in the chemical WO 96/36362 PCT/[JS96/07164 conjugation methods, all except one cysteine, which is n~ces~ry for chemical conjugation are deleted or replaced. In practice, it appears that for FGF polypeptides only two cysteines (including each of the cysteine residues set forth in Table 3), and perhaps only the cysteines set forth in Table 3, are required for retention of the requisite S biological activity of the FGF peptide. Thus, FGF peptides that have more than two cysteines are modified by replacing the remz~ining cysteines with serines. The resulting muteins may be tested for the requisite biological activity.
FGF peptides, such as FGF-3, FGF4 and FGF-6, that have two cysteines can be modified by replacing the second cysteine, which is not listed in Table 3, and the 10 resulting mutein used as part of a construct cont~ininp DNA encoding the cytotoxic agent linked to the FGF-encoding DNA. The construct is expressed in a suitable host cell and the resulting protein tested for the ability to bind to FGF receptors and intern~li7~ the cytotoxic agent. As exemplified herein, conjugates c~ g bFGFmlltein~ in which Cys78 and Cys96 have been replaced with serine residues have been 15 ~ d.

b. DNA constructs and expression of the DNA constructs To produce monogenous pl~epdldlions of fusion protein, DNA encoding the FGF protein or other receptor-binding intern~li7~-1 ligand is modified so that, upon 20 expression, the resllltin~ FGF portion of the fusion protein does not include any cysteines available for reaction. In ~ler~lled embodiments, DNA encoding an FGF
polypeptide is linked to DNA encoding a nucleic acid binding domain. The DNA
encoding the FGF polypeptide or other receptor-binding int~ li7~-1 ligand is modified in order to remove the translation stop codon and other transcriptional or translational 25 stop signals that may be present and to remove or replace DNA encoding the available cysteines. The DNA is then ligated to the DNA encoding the nucleic acid binding domain polypeptide directly or via a linker region of one or more codons between the first codon of the nucleic acid binding domain and the last codon of the FGF. The size of the linker region may be any length as long as the resulting conjugate binds and is 30 intern~li7Pfl by a target cell. Presently, spacer regions of from about one to about CA 02221269 I gg7 - l l - l4 WO 96/36362 PCT/USg6/07164 seventy-five to ninety codons are ~-er~l-ed. The order of the receptor-binding int~rn~li7.--l ligand and nucleic acid binding domain in the fusion protein may be reversed. If the nucleic acid binding domain is N-t~rrnin~l, then it is modified to ~ remove the stop codon and any stop signals.
S As discussed above, any heparin-binding protein, including FGF, VEGF, HBEGF, cytokine, growth factor and the like may be modified and expressed in accord with the methods herein. Binding to an FGF receptor followed by int~rn~li7~tion are the only activities required for an FGF protein to be suitable for use herein. All of the FGF proteins induce mitogenic activity in a wide variety of normal diploid mesoderm-derived and neural crest-derived cells and this activity is mediated by binding to an FGF
cell surface receptor followed by int~rn~li7~tion. A test of such "FGF mitogenicactivity", which reflects the ability to bind to FGF receptors and to be intern~li7~-1 is the ability to stim~ te proliferation of cultured bovine aortic endothelial cells (see, e.g, Gospodarowicz et al., J. Biol. C~tem. 257:12266-12278, 1982; Gospodarowicz et al., Proc. Natl. Acad. Sci. USA 73:4120-4124, 1976).
If the FGF or other ligand has been modified so as to lack mitogenic activity or other biological activities, binding and int.orn~li7~tion may still be readily assayed by any one of the following tests or other equivalent tests. Generally, these tests involve labeling the ligand, incubating it with target cells, and vi~ li7ing or measuring intracellular label. For example, briefly, FGF may be fluorescently labeled with FITC or radiolabeled with l25I. Fluorescein-conjugated FGF is incubated with cells and examined microscopically by fluorescence microscopy or confocal microscopy for internslli7~tion. When FGF is labeled with 125I, the labeled FGF is incubated with cells at 4~C. Cells are temperature shifted to 37~C and washed with 2 M
NaCl at low pH to remove any cell-bound FGF. Label is then counted and thereby measuring interrl:~li7~tion of FGF. Alternatively, the ligand can be conjugated with an nucleic acid binding domain by any of the methods described herein and complexedwith a plasmid encoding saporin. As discussed below, the complex may be used to transfect cells and cytotoxicity measured.

The DNA encoding the resulting receptor-binding inten~li7ecl ligand--nucleic acid binding domain can be inserted into a plasmid and expressed in a selected host, as described above, to produce a monogenous ~l~dLion. Fusion proteins of FGF-2 and protamine are especially suitable for use in the present invention.
S Multiple copies of the modified receptor-binding intern~li7e~1 ligand/nucleic acid binding domain chimera can be inserted into a single plasmid in operative linkage with one promoter. When expressed, the res-llting protein will be a multimer. Typically two to six copies of the chimera are inserted, preferably in a head to tail fashion, into one plasmid.
Merely by way of example, DNA encoding human bFGF-SAP having SEQ ID NO. 52 has been mutagenized as described in the Examples using splicing by overlap extension (SOE). Another ~ rcll~d coding region is set forth in SEQ ID
NO. 53. In both instances, in ~r~ ,d embo-liment~, the DNA is modified by replacing the cysteines at positions 78 and 96 with serine. The codons encoding cysteine residues at positions 78 and 96 of FGF were converted to serine codons by SOE. Each application of the SOE method uses two ~mplified oligonucleotide products, which have complementary ends as primers and which include an altered codon at the locus at which the mutation is desired, to produce a hybrid product. A
second amplification reaction that uses two primers that anneal at the non-overlapping ends amplify the hybrid to produce DNA that has the desired alteration.

3. Bindin~ of the receptor-bindin~ intern~li7~rl li~and/nucleic acid bindin~
domain conju~ate to cvtocide-encodin~ a~ents The receptor-binding intt?rn~li7e~1 ligand/nucleic acid binding domain is incubated with the cytocide-encoding agent, preferably a linear DNA molecule, to be delivered under conditions that allow binding of the nucleic acid binding domain to the agent. Conditions will vary somewhat depending on the nature of the nucleic acidbinding domain, but will typically occur in 0.1M NaCl and 20 mM HEPES or other similar buffer. Alternatively, salt conditions can be varied to increase the packing or condensation of DNA. The extent of binding is preferably tested for each preparation.

After complexing, additional nucleic acid binding domain, such as poly-L-lysine, may be added to further conclen~e the nucleic acid.
Merely by way of example, test constructs have been made and tested.
One construct is a chemical conjugate of bFGF and poly-L-lysine. The bFGF molecule S is a variant in which the Cys residue at position 96 has been changed to a serine; thus, only the Cys at position 78 is available for conjugation. This bFGF is called FGF2-3.
The poly-L-lysine was derivatized with SPDP and coupled to FGF2-3. This FGF2-3/poly-L-lysine conjugate was used to deliver a plasmid able to express the 13-galactosidase gene.
The ability of a construct to bind nucleic acid molecules may be conveniently ~se~ecl by agarose gel electrophoresis. Briefly, a plasmid, such as pSV,I~, is digested with restriction enzymes to yield a variety of fragment sizes. For ease of detection, the fr~ment~ may be labeled with 32p either by filling in of the ends with DNA polymerase I or by phosphor,vlation of the 5'-end with polynucleotide kinase15 following dephosphorylation by ~lk:~line phosphatase. The plasmid fragments are then incubated with the receptor-binding intern~li7t?-1 ligand/nucleic acid binding domain in this case, FGF2-3/poly-L-lysine in a buffered saline solution, such as 20 mM HEPES, pH 7.3, 0.1 M NaCl. The reaction mixture is electrophoresed on an agarose gel alongside similarly digested, but nonreacted frzlgment~ If a radioactive label was 20 incorporated, the gel may be dried and autoradiographed. If no radioactive label is present, the gel may be stained with ethidium bromide and the DNA vi~ li7et1 through a~ o~l;ate red filters after excitation with UV. Binding has occurred if the mobility of the fragments is retarded compared to the control. In the example case, the mobility of the fragments was retarded after binding with the FGF2-3/poly-L-lysine conjugate. If 25 there is insufficient binding, poly-L-lysine may be additionally added until binding is observed.
Further testing of the conjugate is performed to show that it binds to the cell surface receptor and is intern~li7~rl into the cell. It is not necessary that the receptor-binding intern~li7~ ligand part of the conjugate retain complete biological 30 activity. For example, FGF is mitogenic on certain cell types. As discussed above, this activity may not always be desirable. If this activity is present, a proliferation assay is performed. Likewise, for each desirable activity, an ~pn~pliate assay may be performed. However, for application of the subject invention, the only criteria that need be met are receptor binding and intPrn~1i7~tion.
Receptor binding and intern~li7~tion may be measured by the following three assays. (l) A competitive inhibition assay of the complex to cells ~x~les~illg the a~plo~liate receptor demonstrates receptor binding. (2) Receptor binding and intern~li7~tion may be assayed by me~llrin~ expression of a reporter gene, such as ~B-gal (e.g, en7ymatic activity), in cells that have been transformed with a complex of a plasmid encoding a reporter gene and a conjugate of a receptor-binding intern~1i7erl ligand and nucleic acid binding domain. This assay is particularly useful for opl;.ni7i,-~
conditions to give mzlxim~1 transformation. Thus, the optimum ratio of receptor-binding int~rn~li7ed ligand/nucleic acid binding domain to nucleic acid and the amount of DNA per cell may readily be clet~rmined by assaying and co...p~l ;..g the en7ymatic 15 activity of ,~-gal. As such, these first two assays are useful for preli...i..~ analysis and failure to show receptor binding or ,(3-gal activity does not per se elimin~te a candidate receptor-binding intern~li7~D~l Iigand/nucleic acid binding domain conjugate or fusion protein from further analysis. (3) The pler~ d assay is a cytotoxicity assay performed on cells transformed with a cytocide-encoding agent bound by receptor-binding 20 intern~1i7.?-1 ligand/nucleic acid binding domain. While, in general, any cytocidal molecule may be used, ribosome inactivating proteins are ~lefell~d and saporin, or another type I ribosome inactivating protein, is particularly preferred. A statistically significant reduction in cell number demonstrates the ability of the receptor-binding intern~li7~d ligand/nucleic acid binding domain conjugate or fusion to deliver nucleic 25 acids into a cell.

4. Conjugation of li~and to nucleic acid and bindin~ to nucleic acid bindin~
domain As an alternative, the receptor-intern~1i7e-1 binding ligand may be 30 conjugated to the nucleic acid, either directly or through a linker. Methods for conjugating nucleic acids, at the 5' ends, 3' ends and elsewhere, to the amino and - - -CA 0222l269 l997-ll-l4 carboxyl termini and other sites In proteins are known to those of skill in the art (for a review see, e.g., Goodchild, (1993) In: Perspectives in Bioconjugate Chemistry, Mears, Ed., American Chemical Society, Washington, D.C. pp. 77-99). For example, proteins have been linked to nucleic acids using ultraviolet irradiation (Sperling et al. (1978) 5 Nucleic Acids Res. 5:2755-2773; Fiser et al. (1975) FEBS Lett. 52:281-283), bifunctional chemicals (Baumert et al. (1978) Eur. J. Biochem. 89:353-359, and Oste et al. (1979) Mol. Gen. Genet. 168:81-86) and photochemical cross-linking (Vanin et al.
(1981) FEBS Lett. 124:89-92, Rinke et al. (1980) J. Mol. Biol. 137:301-314, Millon et al. (1980) Eur. J. Biochem. 110:485-454).
In particular, the reagents (N-acetyl-N'-(p-glyoxylylbenzolyl)cystamine and 2-iminothiolane have been used to couple DNA to proteins, such as a-macroglobulin (a2M) via mixed disulfide formation (see Cheng et al., Nucleic Acids Res. 11:659-669, 1983). N-acetyl-N'-(p-glyoxylylbenzolyl)cystamine reacts specifically with nonpaired gll~ninine residues and, upon reduction, generates a free 15 sulfhydryl group. 2-iminothiolane reacts with proteins to generate sulfhydryl groups that are then conjugated to the derivatized DNA by an intermolecular disulfide interchange reaction. Any linkage may be used provided that the targeted nucleic acid is active upon int~rn~li7~tion of the conjugate. Thus, it is expected that cleavage of the linkage may be necessary, although it is contemplated that for some reagents, such as 20 DNA encoding ribozymes linked to promoters or DNA encoding therapeutic agents for delivery to the nucleus, such cleavage may not be necessary.
Thiol linkages, which are preferred, can be readily forrned using heterbiofunctional reagents. Amines have also been attached to the terminal 5' phosphate of unprotected oligonucleotides or nucleic acids in aqueous solutions by 25 reacting the nucleic acid with a water-soluble carbodiimide, such as 1-ethyl-3'[3-dimethylaminopropyl]carbodiimide (EDC) or N-ethyl-N'(3-dimethylaminopropylcar-bodiimidehydrochloride (EDCI), in imidazole buffer at pH 6 to produce the 5'phosphorimidazolide. Contacting the 5'phosphorimidazolide with amine-contzlining molecules, such as an FGF, and ethylene~ min~, results in stable phosphoramidates 30 (see, e.g, Chu et al., Nucleic Acids Res. 11:6513-6529, 1983, and WO 88/05077). In WO 96/36362 PCTlUS96/07164 particular, a solution of DNA is saturated with EDC, at pH 6 and incubated with agitation at 4~C overnight. The resulting solution is then buffered to pH 8.5 by adding, for example about 3 volutes of 100 mM citrate buffer, and adding about 5 ~g - about 20 ,ug of an FGF, and ~git~tinp the resultin~ mixture at 4~C for about 48 hours. The 5 unreacted protein may be removed from the mixture by column chromatography using, for example, Sephadex G75 (Ph~ (ci~) using 0.1 M ammonium carbonate solution, pH 7.0 as an eluting buffer. The isolated conjugate may be lyophilized and stored until used.
U.S. Patent No. 5,237,016 provides methods for ~ uhlg nucleotides 10 that are bromacetylated at their 5' termini and reacting the resulting oligonucleotides with thiol groups. Oligonucleotides derivatized at their 5'-termini bromoacetyl groups can be prepared by reacting S'-aminohexyl-phosphoramidate oligonucleotides with bromoacetic acid-N-hydroxysuccinimicle ester as described in U.S. Patent No. 5,237,016. This patent also describes methods for p~illg thiol-deliv~ d 15 nucleotides, which can then be reacted with thiol groups on the selected growth factor.
Briefly, thiol-derivatized nucleotides are prepared using a S'-phosphorylated nucleotide in two steps: (1) reaction of the phosphate group with imidazole in the presence of a diimide and displacement of the imidazole leaving group with cystz-mine in one reaction step; and reduction of the disulfide bond of the cystamine linker with dithiothreitol (see, 20 also, Orgel et al. ((1986) Nucl. Acids Res. 14:651, which describes a similar procedure).
The S'-phosphorylated starting oligonucleotides can be prepared by methods known to those of skill in the art (see, e.g, Maniatis et al. (1982) Molecular Cloning: ,4 Laboratory Manual, Cold Spring Harbor Laboratory, New York, p. 122).
The nucleic acid, such as a methylphosphonate oligonucleotide (MP-25 oligomer), may be derivatized by reaction with SPDP or SMPB. The resulting MP-oligomer may be purified by HPLC and then coupled to an FGF, such as an FGF or FGF mutein, modified by replacement of one or more cysteine residues, as described above. The MP-oligomer (about 0.1 ,~LM) is dissolved in about 40-50 ~1 of 1: 1 acetonitrile/water to which phosphate buffer (pH 7.5, final concentration 0.1 M) and a 1 30 mg MP-oligomer in about 1 ml phosphate buffered saline is added. The reaction is allowed to proceed for about 5-10 hours at room temperature and is then quenched with about 15 ~lL 0.1 iodoacetamide. FGF-oligonucleotide conjugates can be purified on heparin sepharose Hi Trap columns (1 ml, Ph~rm~ ) and eluted with a linear or step gradient. The conjugate should elute in 0.6 M NaCl.
The ligand may be conjugated to the nucleic acid construct encoding the cytocide or cytotoxic agent or may be conjugated to a llliXLU~C~ of oligonucleotides complementary to one strand of the construct. The oligonucleotides are then added to single stranded construct produced by melting a double-stranded construct or grown and isolated as single-stranded. As a general guideline, the oligonucleotides shouldhybridize at a higher temperature than the construct alone, if a double-strandedconstruct is used as the starting material. The gaps are filled in by DNA polymerase I to generate a construct with one strand conjugated to ligand and one strand unconjugated.
Oligonucleotides conjugated to ligand and complement~ry to the other strand may be used in ~ 1ition to generate a mi~Lult; of constructs with different strands linked to ligand. Any rem~ining single stranded plasmid may be digested with a single strand specific endonuclease. The ligand-conjugated constructs are then mixed with a nucleic acid binding domain, such as protamine or polylysine, to effect con~len.~tion of the construct for delivery. Optimal ratios of ligand to DNA may be determined imentally by receptor-mediated transfection of a construct cont~ining a reportergene.

J. Formulation and ~lmini~tration of pharmaceutical compositions The conjugates and complexes provided herein are useful in the treatment and prevention of various diseases, syndromes, and hyperproliferative disorders. As used herein, "treatment" means any manner in which the symptoms of a conditions, disorder or disease are ameliorated or otherwise beneficially altered.
Treatment also encompasses any pharmaceutical use of the compositions herein. Asused herein, "amelioration" of the symptoms of a particular disorder by zlrimini~tration of a particular ph~rm:~çeutical composition refers to any lessening, whether permanent or temporary, lasting or transient that can be attributed to or associated with ~,~1mini~tration of the composition. For example, these conjugates and complexes may be used to treat complications of the eye following laser surgery, glaucoma surgery, and removal of ~lely~ii. Following these treatments, reoccurrence of the problem often ensues due to proliferation of cells in the cornea or eye. The conjugates and complexes 5 inhibit the proliferation of these cells. The conjugates and complexes may be used in general to treat pathophysiological conditions, especially FGF-, VEGF-, or HBEGF-mediated pathophysiological conditions by specifically l~g~ lg to cells having corresponding receptors.
As used herein, "FGF-mediated pathophysiological condition" refers to a 10 deleterious condition characterized by or caused by proliferation of cells that are sensitive to FGF mitogenic stim~ tion. Basic FGF-me~ te~l pathophysiological conditions include, but are not limited to, melanoma, other tumors, rheumatoid arthritis, restenosis, Dupuytren's Contracture and certain complications of diabetes, such as proliferative retinopathy.
As used herein, "HBEGF-mediated pathophysiological condition" refers to a deleterious condition char~(~teri7ed by or caused by proliferation of cells that are sensitive to HBEGF mitogenic ~timlll~tion. HBEGF-m~ te~1 pathophysiological conditions include conditions involving pathophysiological proliferation of smooth muscle cells, such as restencsi~, certain tumors, such as solid tumors including breast 20 and bladder tumors, tumors involving pathophysiological expression of EGF receptors, dermatological disorders, such as psoriasis, and ophth~lmic disorders involving epithelial cells, such as recurrence of pterygii and secondary lens clouding.
Similarly, tumors and hyperproliferating cells expressing cytokine receptors or growth factor receptors may be elimin:~te-l Such diseases include 25 restenosis, Du~uy~ 's Contracture, diabetic retinopathies, rheumatoid arthritis, Kaposi's sarcoma, lymphomas, lenkemi~c, tumors such as renal cell carcinoma, colon carcinoma, breast cancer, bladder cancer, disorders with underlying vascular proliferation, such as diseases in the back of the eye (e.g, proliferative vitreoritinopathy, inacular degeneration and diabetic retinopathy). For treatment of the 30 back of the eye especially, use of the VEGF-receptor promoter to control expression of WO 96/36362 PCT/USg6/07164 the cytocide or cytotoxic agent is ~lefel,ed. The conjugates may be used to prevent corneal haze or clouding that results from exposure of the cornea to laser radiation during eye surgery, particularly LRK. The haze or clouding appears to result from fibroblastic keratocyte proliferation in the subepithelial zone following photoablation of 5 the cornea.
The conjugates may be used to treat a "hyperproliferative skin disorder."
As used herein, it is a disorder that is manifested by a proliferation of endothelial cells of the skin coupled with an underlying vascular proliferation, resulting in a localized patch of scaly or horny or thickened skin or a tumor of endothelial origin. Such10 disorders include actinic and atopic dermatitis, toxic ec7~m~ allergic eç7~m~ psoriasis, skin cancers and other tumors, such as Kaposi's sarcoma, angiosarcoma, hem~ngiomas, and other highly vasc~ ri7~1 tumors, and vascular proliferative responses, such as varicose veins.
As well, the conjugates may be used to treat or prevent restenosis, a 15 process and the resulting condition that occurs following angioplasty in which the arteries become reclogged. After tre~tment of arteries by balloon catheter or other such device, den~ tion of the interior wall of the vessel occurs, including removal of the endothelial cells that constitute the lining of the blood vessels. As a result of this removal and the concomitant vascular injury, smooth muscle cells (SMCs), which form 20 the blood vessel structure, proliferate and fill the interior of the blood vessel. This process and the resulting condition is restenosis.
Ph~rm~eeutical carriers or vehicles suitable for ~t1mini~tration of the conjugates and complexes provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of ~-lmini~tration. In addition, 25 the conjugates and complexes may be formulated as the sole ph~rrn~el-tically active ingredient in the composition or may be combined with other active ingredients.
The conjugates and complexes can be ~-lministered by any ~L)plo~uliate route, for example, orally, parenterally, including intravenously, intr~derrn~lly, subcutaneously, or topically, in liquid, semi-liquid or solid form and are formulated in a 30 manner suitable for each route of ~lmini~tration. Preferred modes of ~tlministration depend upon the indication treated. Dermatological and ophth~lm~-logic indications will typically be treated locally; whereas, tumors and restenosis, will typically be treated by systemic, intr~ ?rm~l, or intramuscular modes of z~lminictration.
The conjugates and complexes herein may be formulated into S ph~rm~(~eutical compositions suitable for topical, local, illL-dvellous and systemic application. For the ophth~lmic uses herein, local ~lminictration, either by topieal ~tlminictration or by injection is ~l~r~lled. Time release formulations are also desirable.
Effective concentrations of one or more of the conjugates and complexes are mixed with a suitable ph~rm~eutical carrier or vehicle. As used herein an "effective amount"
10 of a compound for treating a partieular disease is an amount that is suffieient to ameliorate, or in some manner reduce the symptoms associated with the disease. Sueh amount may be ~-lmini~tered as a single dosage or may be ~11mini.ctered according to a regimen, whereby it is effective. The amount may cure the disease but, typically, is ~flmini ct~red in order to ameliorate the symptoms of the ~ e~ce Repeated 15 ~rlminictr~tion may be required to achieve the desired amelioration of symptoms.
As used herein, "an ophth~lmically effeetive amount" is that amount which, in the composition ~lmini~t~red and by the technique ~-lminictered, provides an amount of therapeutic agent to the involved eye tissues sufficient to prevent or reduce corneal haze following excimer laser surgery, prevent closure of a trabeculectomy, 20 prevent or subst~nti~lly slow the recurrence of pterygii, and other conditions.
The concentrations or amounts of the conjugates and complexes that are effective requires delivery of an amount, upon ~lmini~tration, that ameliorates the symptoms or treats the ~ ezlce Typically, the compositions are formulated for single dosage z~lminictration. Therapeutically effective concentrations and amounts may be 2~ determined empirically by testing the conjugates and complexes in known in vitro and in vivo systems, such as those described here; dosages for humans or other ~nim~lc may then be extrapolated tht;lerl~",.
The conjugate is included in the phz-rm~ceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of 30 undesirable side effects on the patient treated. The conjugates may be delivered as ph~rm~ceutically acceptable salts, esters or other derivatives of the conjugates include any salts, esters or derivatives that may be readily prepared by those of skill in this art using known methods for such derivatization and that produce compounds that may be ~1minictered to ~nim~lc or hnmzmc without substantial toxic effects. It is understood 5 that number and degree of side effects depends upon the condition for which the conjugates and complexes are a-lminictered. For example, certain toxic and undesirable side effects are tolerated when treating life~ ~~ g illnescec, such as tumors, that would not be tolerated when treating disorders of lesser consequence. The concentration of conjugate in the composition will depend on absorption, inactivation 10 and excretion rates thereof, the dosage schedule, and amount ~lminictered as well as other factors known to those of skill in the art.
Preferably, the conjugate and complex are subst~nti~lly pure. As used herein, "substantially pure" means sufficiently homogeneous to appear free of readily detectable i-~ iLies as ~let~rmin~cl by standard methods of analysis, such as thin layer 15 chromatography (TLC), gel electrophoresis, high p~.ro.l-lance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance. Methods for purification of the compounds to produce snhst~nti~lly chemically pure compounds are known to20 those of skill in the art. A substantially chemically pure compound may, however, be a mixture of stereoisomers. In such instances, further purification might increase the specific activity of the compound.
Typically a therapeutically effective dosage should produce a serum concentration of active ingredient of from about 0.1 ng/ml to about 50-100 ,ug/ml. The 25 ph~rm:~/ eutical compositions typically should provide a dosage of from about 0.01 mg to about 100 - 2000 mg of conjugate, depending upon the conjugate selected, per kilogram of body weight per day. For example, for tre~tment of restenosis a daily dosage of about between 0.05 and 0.5 mg/kg (based on FGF-SAP chemical conjugate or an amount of conjugate provided herein equivalent on a molar basis thereto) should be 30 sufficient. Local application for ophth~lmic disorders and dermatological disorders should provide about 1 ng up to 100 ~Lg, preferably about 1 ng to about 10 ~lg, per single dosage ~-lmini~tration. It is understood that the amount to ~-imini~ter will be a function of the conjugate selected, the indication treated, and possibly the side effects that will be tolerated.
Therapeutically effective concentrations and amounts may be determined for each application herein empirically by testing the conjugates and complexes in known in vitro and in vivo systems (e.g, mllrine, rat, rabbit, or baboon models), such as those described herein; dosages for hl-m~n~ or other ~nim~l~ may then be extrapolated thel~Iio,ll. Demonstration that the conjugates and complexes pl~;velll or inhibit proliferation of serum stim-ll~ted corneal keratocytes or fibroblasts explanted from eyes, as shown herein, and demonstration of any inhibition of proliferation of such tissues in rabbits should establish human efficacy. The rabbit eye model is a recognized model for studying the effects of topically and locally applied drugs (see, e.g, U.S. Patent Nos.
5,288,735, 5,263,992, 5,262,178, 5,256,408, 5,252,319, 5,238,925, 5,165,952; see also Mirate et al., Curr. Eye Res 1:491-493, 1981).
The active ingredient may be ~1mini~tered at once~ or may be divided into a number of smaller doses to be ~-lmini~tered at intervals of time. It is understood that the precise dosage and duration of tre~tment is a function of the disease being treated and may be d~le.,.-i"rd empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional jn~lgment of the person ~flmini~tçring or supervising the ~-lmini~tration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions.
The conjugates and complexes may be formnl~tç-1 for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracisternal or intraspinal application. Such solutions, particularly those inten(lçd for ophth~lmic use, may be formulated as 0.01% -10% isotonic solutions, pH about 5-7, with ~ropliate salts. The ophth~lmic compositions may also include additional components, such as hyaluronic acid. The conjugates and complexes may be form~ te~l as aerosols for topical application (see, e.g, U.S. Patent Nos. 4,044,126, 5 4,414,209, and 4,364,923).
Solutions or suspensions used for parenteral, intr~(lçrmz~l, subcutaneous, or topical application can include any of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol 10 and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chel~tin~
agents, such as ethylene~ minetetraacetic acid (EDTA); buffers, such as ~eetS~tes~
citrates and phosphates; and agents for the adjlletment of toxicity such as sodium chloride or dextrose. Parental ~l~aldlions can be enclosed in ampules, disposable syringes or multiple dose vials made of glass, plastic or other suitable m~teri~l If ~-1mini~tt-red intravenously, suitable carriers include physiological saline or phosphate buffered saline (PBS), and solutions co..~ ;l.g thickening and solubilizing agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures thereof. Liposomal suspensions may also be suitable as ph~rm~reuticallyacceptable carriers. These may be prepared according to methods known to those 20 skilled in the art.
Upon mixing or addition of the conjugate(s) with the vehicle, the resulting mixture may be a solution, suspension, emulsion or the like. The form of the resulting mixture depends upon a number of factors, including the intçn~1ç~1 mode of ~lmini~tration and the solubility of the conjugate in the selected carrier or vehicle. The 25 effective concentration is sufficient for ameliorating the symptoms of the disease, disorder or condition treated and may be empirically determined based upon in vitro and/or in vivo data, such as the data from the mouse xenograft model for tumors or rabbit ophth~lmic model. If necessary, ph~rmz-(~el-tically acceptable salts or other derivatives of the conjugates and complexes may be prepared.

The active m~t~-ri~l~ can'also be mixed with other active materials, that do not impair the desired action, or with m~terizlls that supplement the desired action, including viscoelastic materials, such as hyaluronic acid, which is sold under the tr~lçm~rk HEALON (solution of a high molecular weight (MW of about 3 millions) 5 fraction of sodium hyaluronate; m~mlf~c~tured by PhRrm~ Inc. see, e.g, U.S. Patent Nos 5,292,362, 5,282,851, 5,273,056, 5,229,127, 4,517,29~ and 4,328,803), VISCOAT
(fluorine-co..~ (meth)acrylates, such as, lH,lH,2H,2H-hepta-decafluorodecylmethacrylate; see, e.g, U.S. Patent Nos. 5,278,126, 5,273,751 and5,214,080, commercially available from Alcon Surgical, Inc.), ORCOLON (see, e.g,10 U.S. Patent Nos. 5,273,056, commercially available from Optical Radiation Corporation), methylcellulose, methyl hyaluronate, polyacrylamide and polymethacrylamide (see, e.g, U.S. Patent No. 5,273,751). The viscoelastic m~tçri~l~
are present generally in amounts ranging from about 0.5 to 5.0%, preferably 1 to 3% by weight of the conjugate m~t~ri~l and serve to coat and protect the treated tissues. The 15 compositions may also include a dye, such as methylene blue or other inert dye, so that the composition can be seen when injected into the eye or contacted with the surgical site during surgery.
The conjugates and complexes may be formlll~tefl for local or topical application, such as for topical application to the skin and mucous membranes, such as 20 in the eye, in the form of gels, creams, and lotions and for application to the eye. Such solutions, particularly those intçnrlçcl for ophth~lmic use, may be form~ te~1 as 0.01%-10% isotonic solutions, pH about 5-7, with ~ u~liate salts. Suitable ophth~lmic solutions are known (see, e.g, U.S. Patent No.5,116,868, which describes typicalcompositions of ophth~lmic irrigation solutions and solutions for topical application).
25 Such solutions, which have a pH adjusted to about 7.4, contain, for example, 90-100 mM sodium chloride, 4-6 mM dibasic potassium phosphate, 4-6 mM dibasic sodium phosphate, 8-12 mM sodium citrate, 0.5-1.5 mM magnesium chloride, 1.5-2.5 mM
calcium chloride, 15-25 mM sodium acetate, 10-20 mM D.L.-sodium ,B-hydroxybutyrate and ~-5.5 mM glucose.

CA 0222l269 l997-ll-l4 The conjugates and complexes may be prepared with carriers that protect them against rapid elimin~tion from the body, such as time release formulations or coatings. Such carriers include controlled release formulations, such as, but not limited to, implants and microenf ~rs~ t~-cl delivery systems, and biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others. For example, the composition may beapplied during surgery using a sponge, such as a commercially available surgicalsponges (see, e.g, U.S. Patent Nos. 3,956,044 and 4,045,238; available from Weck, Alcon, and Mentor), that has been soaked in the composition and that releases the composition upon contact with the eye. These are particularly useful for application to the eye for orhth~lmic indications following or during surgery in which only a single 7~lmini~tration is possible. The compositions may also be applied in pellets (such as Elvax pellets(ethylene-vinyl acetate copolymer resin); about 1- 5 ,ug of conjugate per 1 mg resin) that can be implanted in the eye during surgery.
Ophthzllmologically effective concentrations or amounts of one or more of the conjugates and complexes are mixed with a suitable ph~rm~eelltical carrier or vehicle. The concentrations or amounts of the conjugates and complexes that are effective requires delivery of an amount, upon ~1mini~tration, that prevents or sllbst~nti~lly reduces corneal clouding, trabeculectomy closure, or pterygii recurrence.
The conjugates and complexes herein are form~ tecl into ophth~lmologically acceptable compositions and are applied to the affected area of the eye during or imrnediately after surgery. In particular, following excimer laser surgery, the composition is applied to the cornea; following trabeculectomy the composition is applied to the fistula; and following removal of pterygii the composition is applied to the cornea. The compositions may also be used to treat pterygii. The conjugates and complexes are applied during and immediately following surgery and may, if possible be applied post-operatively, until healing is complete. The compositions are applied as drops for topical and subconjunctival application or are injected into the eye for intraocular application. The compositions may also be absorbed to a biocompatible support, such as a cellulosic sponge or other polymer delivery device, and contacted with the affected area.
The ophth~lmologic indications herein are typically be treated locally either by the application of drops to the affected tissue(s), contacting with a 5 biocompatible sponge that has absorbed a solution of the conjugates and complexes or by injection of a composition. For the indications herein, the composition will be applied during or immediately after surgery in order to prevent closure of the trabeculectomy, plC;Vt;ll~ a proliferation of keratocytes following excimer laser surgery, or to prevent a le~ nce of pterygii. The composition may also be injected into the 10 affected tissue following surgery and applied in drops following surgery until healing is completed. For example, to ~r1mini~ter the formulations to the eye, it can be slowly injected into the bulbar conjunctiva of the eye.
Conjugates and complexes with photocleavable linkers are among those r~led for use in the methods herein. Upon ~tlminictr~tion of such composition to15 the affected area of the eye, the eye is exposed to light of a wavelength, typically visible or W that cleaves the linker, thereby releasing the cytotoxic agent.
If oral ~lmini~tration is desired, the conjugate should be provided in a composition that protects it from the acidic environment of the stom~rh For ç~mple7 the composition can be fi rm~ tecl in an enteric coating that m~int~in~ its integrity in 20 the stomach and releases the active compound in the intestine. The composition may also be formulated in combination with an antacid or other such ingredient.
Oral compositions will generally include an inert diluent or an edible carrier and may be compressed into tablets or enclosed in gelatin capsules. For the purpose of oral therapeutic ~lmini~tration, the active compound or compounds can be 25 incorporated with excipients and used in the form of tablets, capsules or troches.
Pharmaceutically compatible binding agents and adjuvant m~teri~l~ can be included as part of the composition.
The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder, such as 30 microcrystalline cellulose, gum tr~g~c~nth and gelatin; an excipient such as starch and CA 0222l269 l997-ll-l4 lactose, a ~ integrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, m~ne~ium stearate; a glidant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin;
and a flavoring agent such as peppermint, methyl salicylate, and fruit flavoring.
When the dosage unit form is a capsule, it can contain, in addition to m~teri~l of the above type, a liquid carrier such as a fatty oil. In addition, dosage unit forms can contain various other m~teri~l~ which modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents. The conjugates and complexes can also be ~lmini~tered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like. A syrup may contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
The active m~teri~l~ can also be mixed with other active m~teri~l~ that do not impair the desired action, or with m~teri~l~ that supplement the desired action, such as cis-platin for trczltment of tumors.
Finally, the compounds may be packaged as articles of manufacture cont~ininp p~ck~ging material, one or more conjugates and complexes or compositions as provided herein within the p~cl~ging m~teri~l, and a label that indicates theindication for which the conjugate is provided.
Many methods have been developed to deliver nucleic acid into cells including retroviral vectors, electroporation, CaPO4 precipitation and microinjection, but each of these methods has distinct disadvantages. Microinjecting nucleic acid into cells is very time consuming because each cell must be manipulated individually.Retroviral vectors can only hold a limited length of nucleic acid and can activate oncogenes depending upon the insertion site in the target chromosome. Conditions for electroporation and CaPO4-mediated transfection are harsh and cause much cell death.
By comparison, receptor mediated gene delivery as described herein is a more desirable method of selectively targeting toxic genes into cells that have "more active" receptors or that ov~l~x~ress the specific receptor on the cell surface. A
receptor may be more active because it has a higher rate of int~rn~li7~tion or higher cycling rate through the endosome to the cell surface. Advantages of this method over other gene delivery methods include increased specificity of delivery, the absence of nucleic acid length lirnitations, reduced toxicity, and reduced immllnogenicity of the conjugate. These characteristics allow for repeated ~-lmini~tration of the material with 5 minim~l harm to cells and may allow increased level of expression of the toxic protein.
In addition, ~hllal~ cultures can also be treated using this method.

The following examples are included for illustrative purposes only and are not int~n~led to limit the scope of the invention.
EXAMPLES

ISOLATION OF DNA ENCODING SAPORIN

A. Materials and metbods cten~l Strains E. coli strain JA221 (lpp- hdsM+ trpE5 leuB6 lacY recAl F'[lacIq lac+
pro+]) is publicly available from the American Type Culture Collection (ATCC), 20 Rockville, MD 20852, under the accession number ATCC 33875. (JA221 is also available from the Northern Regional Research Center (NRRL), Agricultural Research Service, U.S. Department of Agriculture, Peoria, IL 61604, under the accession number NRRL B-15211, see also U.S. Patent No. 4,757,013 to Inouye, and Nakarnura et al., Cell 18:1109-1117, 1979). Strain INVla is commercially available from Invitrogen, 25 San Diego, CA.

2. DNA ManiPulations The restriction and modification enzymes employed herein are commercially available in the U.S. Native saporin and rabbit polyclonal antiserum to 30 saporin were obtained as previously described in Lappi et al., Biochem. Biophys. Res.
Comm. 129:934-942. Ricin A chain is commercially available from Sigma, Milwaukee, WI. Antiserum was linked to Affi-gel 10 (Bio-Rad, Emeryville, CA) according to the m~nllf~cturer's instructions. Sequencing was performed using the Sequenase kit of United States Biochemical Corporation (version 2.0) according to the m~nllf~-turer's instructions. Mi~ lc~aLion and m~iplc~aration of plasmids, ~lc~ar~Lion of 5 competent cells, transformation, M13 manipulation, bacterial media, Western blotting, and ELISA assays were according to Sambrook et al., (Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). The purification of DNA fr~gment~ was done using the Geneclean II kit (Bio 101) according to the m~nllf~ lrer's instructions. SDS gel electrophoresis was 10 performed on a Pha~L~y:jLclll (Ph~rm~
Western blotting was accomplished by transfer of the electrophoresed protein to nitrocellulose using the PhastTransfer system, as described by the m~nllf~-turer. The antiserum to SAP was used at a dilution of 1:1000. Horseradish peroxidase labeled anti-IgG was used as the second antibody (see Davis et al., Basic 5 Methods In Molecular Biology, New York, Elsevier Science Publishing Co., pp 1-338, 1986).

B. Isolation of DNA encodin~ saporin 1. Isolation of ~enomic DNA and ~lc~ lion of polvmerase chain reaction (PCR) primers Saponaria of~icinalis leaf genomic DNA was prepared as described in Bianchi et al., Plant Mol. Biol. 11:203-214, 1988. Primers for genomic DNA
amplifications were syntheci7e~1 in a 380B automatic DNA synthesi7~?r. The primer corresponding to the "sense" strand of saporin 5'-25 CTGCAGAATTCGCATGGATCCTGCTTCAAT-3' (SEQ ID NO. 54) includes an EcoR I restriction site adapter imrnediately upstream of the DNA codon for amino acid -15 of the native saporin N-t~rmin~l leader sequence. The primer 5'-CTGCAGAATTCGCCTCGTTTGACTACTTTG-3' (SEQ ID NO. 55) corresponds to ~ the "antisense" strand of saporin and complements the coding sequence of saporin 30 starting from the last 5 nucleotides of the DNA encoding the carboxyl end of the mature W 096/36362 PCT~US96/07164 peptide. Use of this primer introduced a translation stop codon and an EcoRI restriction site after the sequence encoding mature saporin.

2. Amplification of DNA encodin~ saporin -~Unfractionated Saponaria o~fcinalis leaf genomic DNA (1 ~11) was mi~ed in a final volume of 100 111 co~ ,p; 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.01% gelatin, 2 mM MgCl2, 0.2 mM dNTPs, 0.8 ~Lg of each primer. Next, 2.5 U TaqDNA polymerase (Perkin Elmer Cetus) were added and the mixture was overlaid with30 ~1 of mineral oil (Sigma). Incubations were done in a DNA Thermal Cycler (Ericomp). One cycle included a den~tllr~tion step (94~C for 1 min), an ~nn~ling step (60~C for 2 min), and an elong~tiQn step (72~C for 3 min). After 30 cycles, a 10 ,ul aliquot of each reaction was run on a 1.5% agarose gel to verify the structure of the amplified product.
The amplified DN~ was digested with EcoRI and subcloned into EcoR~-restricted M13mpl8 (New Fngl~n~ Biolabs, Beverly, MA; see also Yanisch-Perron etal. (1985), "Improved M13 phage cloning vectors and host strains: Nucleotide sequences of the M13mpl 8 and pUC l 9 vectors", Gene 33: 103). Single-stranded DNA
from recombinant phages was sequenced using oligonucleotides based on intern~l points in the coding sequence of saporin (see Bennati et al., Eur. ~ Biochem. 183:465-470, 1989). Nine of the M13mpl8 derivatives were sequenced and compared. Of the nine sequenced clones, five had unique sequences, set forth as SEQ ID NOs. 19-23, respectively. The clones were ~ ign~t~l M13mpl8-G4, -Gl, -G2, -G7, and -G9. Eachof these clones contains all of the saporin coding sequence and 45 nucleotides of DNA
encoding the native saporin N-tt-nnin~l leader peptide.
Saporin DNA sequence was also cloned in the pETl la vector. Briefly, the DNA encoding SAP-6 was amplified by polymerase chain reaction (PCR) from theparental plasmid pZlBl. The plasmid pZlBl contains the DNA sequence for human FGF-2 linked to SAP-6 by a two-amino-acid linker (Ala-Met). PZlBl also includes the T7 promoter, lac operator, ribosomal binding site, and T7 tennin~tor present in the pET-1 la vector. For SAP-6 DNA amplification, the 5' primer (5' CATATGTGTGTCACATCAATCACATTAGAT 3') (SEQ ID NO. 105), corresponding to the sense strand of SAP-6, incorporated a NdeI restriction enzyme site used for cloning. It also contained a Cys codon at position -1 relative to the start site of the mature protein sequence. No leader sequence was included. The 3' primer (5' e CAGGTTTGGATCCl l~ACGTT 3') (SEQ ID NO. 106) corresponding to the ~nti~çn~e strand of SAP-6 had a BamHI site used for cloning. The amplified DNA was gel-purified and digested with NdeI and BamHI. The digested SAP-6 DNA fragment was subcloned into the NdeI/BamHI-digested pZlBl. This digestion removed FGF-2 and the 5' portion of SAP-6 (up to nucleotide position 650) from the parental rFGF2-SAP vector (pZlBl) and replaced this portion with a SAP-6 molecule co.l~ g a Cysat position -1 relative to the start site of the native mature SAP-6 protein. The resultant plasmid was ~lesign~te~l as pZSOB. pZSOB was transformed into E coli strain NovaBlue for restriction and seqllencing analysis. The a~>pl~liate clone was then transformed into E. coli strain BL21(DE3) for ~ es~ion and large-scale production.

C. l\/r~mm~ n codon o~,Lill~ ion of saporin cDNA.
~mm~ n expression plasmids encoding ~-galactosidase (~-gal), pSV-13 and pNASS-,(3, were obtained from Clontech (Palo Alto, CA). Plasmid pSV~
expresses ~-gal from the SV40 early promoter. Plasmid pNASSb is a promoterless m~mm~ n reporter vector co--~ ,;--P the ~-gal gene.
The amino acid sequence for the plant protein saporin (SAP) was reverse tr~n~l~t~l using m:~mm~ n codons. The resulting m~mmz~ n optimized cDNA was divided into 4 fragments (~lesign~te~l 5'-3' A-D) for synthesis by PCR using overlapping oligos. To facilitate subcloning of each fragment and piecing together of the entire cDNA, restriction enzyme sites were added to the ends of each fragment, and added or removed within each fragment without ch~nping the corresponding amino acid sequence. In addition, the 5' end of the cDNA was modified to include a Kozak sequence for optimal expression in m~mm~ n cells. Fr:~gment~ A, B, and D were each synthesi7~rl by annealing 4 oligos (2 sense, 2 antisense) with 20 base overlaps and using PCR to fill-in and amplify the frz~gment~. The PCR products were then purified using GeneClean (BiolOl), digested with restriction enzymes recognizing the sites in the WO 96/36362 PCTfUS96/07164 primçrc, and subcloned into pBluescript (SK+) (Stratagene). The sequence of the inserts was verified using Sequenase Version 2.0 (United States Biochemical/Amersharn).
Fragment C was synth~si7~1 in two steps: The 5' and 3' halves of the fragment were independently synth~ci7~(1 by PCR using 2 overlapping oligos. The products of these 5 using 2 reactions were then purified and combined and the full-length fragment C was generated by PCR using the outer~nost oligos as primers. Full-length fragment C was subcloned into pBluescript for sequencing Fr~gment.~ A and B were ligated together in pBluescript at an overlapping ~spI site. Fr~ment~ C and D were ligated together in pBluescript at an overlapping PvuII site. Fr~Pment~ A-B and C-D were then joined in 10 pBluescript at an overlapping,qvaI site to give the full-length m~mm~ n o~Li.l~ized SAP cDNA. 13-gal sequences were excised from the plasmids pNASS-13 and pSV-,B
(Clontech) by digestion with NotI and replaced with the synthetic SAP gene, which has NotI ends. Orientation of the insert was confirmed by restriction enzyme digestion.
Large scale plasmid L,.~p~dlions were performed using Qiagen Maxi 500 columns.
The oligos used to synth~si7~ each SAP ~m~nt are (5'-3'):

Al (sense):CGTATCAGGCGGCCGCCGCCATGGTGACCTCCATCACCCTGGACC
TGGTGAACCCCACCGCCGGCC (SEQ ID NO.: 89) 20 A2(~nti.~n~e):TTGGGGTCCTTCACGTTGTTGCGGATCTTGTCCACGAAGGAGG
AGTACTGGCCGGCGGTGGGGTTCACC (SEQ ID NO.: 90) A3(sense):AACAACGTGAAGGACCCCAACCTGAAGTACGGCGGCACCGACAT
CGCCGTGATCGGCCCCCCCTC (SEQ ID NO.: 91) A4(antisense):GTGCCGCGGGAGGACTGGAAGTTGATGCGCAGGAACTTCTCCT
TGGAGGGGGGGCCGATCACGGC (SEQ ID NO.: 92) B 1 (sense):CTCCCGCGGCACCGTGTCCCTGGGCCTGAAGCGCGACAACCTGTA
30 CGTGGTGGCCTACCTGGCCATGGACAACAC (SEQ ID NO.: 93) B2(antisense):GCGGTCAGCTCGGCGGAGGTGATCTCGGACTTGAAGTAGTAGG
CGCGGTTCACGTTGGTGTTGTCCATGGCCAGGTA (SEQ ID NO.: 94) 5 B3(sense):GCCGAGCTGACCGCCCTGTTCCCTGAGGCCACCACCGCCAACCAG
AAGGCCCTGGAGTACACCGAGGACTACCAGTCC (SEQ ID NO.: 95) B4(antisense) :AGCCCGAGCTCCTTGCGGGACTTGTCGCCCTGGGTGATCTGGG
CGTTCTTCTCGATGGACTGGTAGTCCTCGGTGT (SEQ ID NO.: 96) C 1 (sense) :TATAGAATTCCTCGGGCTGGGCATCGACCTGCTGCTGACCTTCATG
GAGGCCGTGAACAAGAAGGCCCGCGTGG (SEQ ID NO.: 97) C2(~nti ~n~e) :CGGCGGTCATCTGGATGGCGATCAGCAGGAAGCGGGCCTCGTT
15 CTTCACCACGCGGGCCTTCTTGTTC (SEQ ID NO.: 98) C3(sense):CGCCATCCAGATGACCGCCGAGGTGGCCCGCTTCCGCTACATCCA
GAACCTGGTGACCAAGAACTTCCCC (SEQ ID NO.: 99) 20 C4(antisense~:GGCGGATCCCAGCTGACCTCGAACTGGATCACCTTGTTGTCGG
AGTCGAACTTGTTGGGGAAGTTCTTGGTCACCA (SEQ ID NO.: 100) D 1 (sense):CCGGGATCCGTCAGCTGGCGCAAGATCTCCACCGCCATCTACGGC
GACGCCAAGAACGGCG (SEQ ID NO.: 101) D2(~nti~en~e):GCACCTTGCCGAAGCCGAAGTCGTAGTCCTTGTTGAACACGCC
GTTCTTGGCGTCGCCGTAGAT (SEQ ID NO.: 102) D3 (sense) :TTCGGCTTCGGCAAGGTGCGCCAGGTGAAGGACCTGCAGATGGGC
30 CTGCTGATGTACC (SEQ ID NO.: 103) W O 96/36362 PCTrUS96/07164 D4(antisense):TGAACGTGGCGGCCGCCTACTTGGGCTTGCCCAGGTACATCAG
CAGGCCCAT (SEQ ID NO.: 104) D. pOMPAG4 Plasmid Construction M13 mpl 8-G4 was digested with EcoR I, and the resulting ~gment was ligated into the EcoR I site of the vector pIN-IIIompA2 (see, e.g., see, U.S. Patent No. 4,575,013 to Inouye, and Duffaud et al., Meth Enz. 153:492-507, 1987) using the 10 methods described herein. The ligation was accompli~hecl such that the DNA encoding saporin, including the N-terrnin~l çxt~n~ n, was fused to the leader peptide segment of the bacterial ompA gene. The resulting plasmid pOMPAG4 contains the lpp promoter(Nakamura et al., Cell 18:1109-1117, 1987), the E. coli lac promoter operator sequence (lac O) and the E. coli ompA gene secretion signal in operative association with each 15 other and with the saporin and native N-t~rrnin~l leader-encoding DNA listed in SEQ
ID NO. 19. The plasmid also includes the E. coli lac repressor gene (lac I).
The M13 mpl8-Gl, -G2, -G7, and -G9 clones, cont~ining SEQ ID NOs.
20-23, respectively, are digested with EcoR I and ligated into EcoR I digested pIN-IIIompA2 as described for M13 mpl8-G4 above in this example. The resulting 20 plasmids, labeled pOMPAGl, pOMPAG2, pOMPAG7, pOMPA9, are screened, expressed, purified, and characterized as described for the plasmid pOMPAG4.
INVla competent cells were transformed with pOMPAG4 and cultures cont~inin~; the desired plasmid structure were grown further in order to obtain a large ~l~dtion of isolated pOMPAG4 plasmid using methods described herein.
E. Saporin expression in E. coli The pOMPAG4 transformed E coli cells were grown under conditions in which the expression of the saporin-cont~inin~ protein is repressed by the lac repressor until the end of the log phase of growth, at which time IPTG was added to 30 induce expression of the saporin-encoding DNA.

To generate a large-batch culture of pOMPAG4 transformed E. coli cells, an overnight culture (approximately 16 hours growth) of JA221 E. coli cells transformed with the plasmid pOMPAG4 in LB broth (see, e.g, Sambrook et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory Press, ColdS Spring Harbor, NY, 1989) cont~ininp 125 mg/ml ampicillin was diluted 1:100 into a flask CO~ i..g 750 ml LB broth with 125 mg/ml ampicillin. Cells were grown at log~ill~ ic phase with ~h~king at 37~C until the optical density at 550 nm reached 0.9 measured in a spectrophotometer.
In the second step, saporin expression was intlllce~l by the addition of 10 IPTG (Sigma) to a final concentration of 0.2 mM. Tn(lllce~l cultures were grown for 2 additional hours and then harvested by centrifugation (25 min., 6500 x g). The cell pellet was resuspended in ice cold 1.0 M TRIS, pH 9.0, 2 mM EDTA (10 ml were added to each gram of pellet). The resuspended material was kept on ice for 20-60 min~ltec and then centrifuged (20 min., 6500 x g) to separate the periplasmic fraction of 15 E. coli, which corresponds to the ~u~ f, from the intracellular fraction corresponding to the pellet.
The E. coli cells co,.~ il.p C-SAP construct in pETl la were grown in a high-cell density fed-batch fç~nent~tion with the temperature and pH controlled at 30~C
and 6.9, respectively. A glycerol stock (1 ml) was grown in 50 ml Luria broth until the 20 A600 reached 0.6 Inoculum (10 ml) was injected into a 7-1-Applikon (Foster City CA) fermentor cont:~ining 21 complex batch medium con~i~finp of S g/l of glucose, 1.25 g/l each of yeast extract and tryptone (Difco Laboratories), 7 g/l of K2HPO4, 8 g/l of KH2PO4, 1.66 g/l of (NH4)2SO4, 1 g/l of MgSO4 ~ 7H2O, 2 ml/l of a trace metal solution (74 g/l of trisodium citrate, 27 g/l of FeCl3 ~ 6H2O, 2.0 g/l of CoCl2 ~ 6H2O, 2.0 g/l of 25 Na2MoO4 ~ 2H20, 1.9 g/l of CuSO~ ~ SH20, 1.6 g/l of MnCl2 ~ 4H20, 1.4 g/l of ZnCl2 ~ 4H2O, 1.0 g/l of CaCl2 ~ 2H2O, 0.5 g/l of H3BO3). 2 ml/l of a vitamin solution (6 g/l of thi~min ~ HCI, 3.05 g/l of niacin, 2.7 g/l of pantothenic acid, 0.7 g/l of pyridoxine ~ HCl, 0.21 g/l of riboflavin, 0.03 g/l of biotin, 0.02 g/l of folic acid), and 100 mg/l of carbenicillin. The culture was grown for 12 h before initiating the 30 continuous addition of a 40x solution of complex batch media lacking the phosphates = ~ ~ ~

and co~ g only 25 ml/l, each, of trace metal and vitamin solutions. The feed addition continl~p~l until the A600 of the culture reached 85, at which time (approximately 9 h) the culture was induced with 0.1 mM isopropyl ,B-D-thiogalactopyranoside. During 4 h of post-induction incubation, the culture was fed with a solution cont~ininp~ 100 g/l 5 of glucose, 100 g/l of yeast extract, and 200 g/l of tryptone. Finally, the cells were harvested by centrifugation (8000xg, 10 min) and frozen at -80~C until further processed.
The cell pellet (~400 g wet mass) cont~ining C-SAP was resuspended in 3 voI Buffer B (10 mM sodium phosphate pH 7.0, 5 mM EDTA, 5 mM EGTA, and 1 10 mM dithiothreitol). The suspension was passed through a microflllicli7~r three times at 124 Mpa on ice. The resultant lysate was diluted with NanoPure H2O until conductivity fell below 2.7 mS/cm. All subsequent procedures were performed at room temperature.
The diluted Iysate was loaded onto an exp~n-led bed of Stre~mline SP
cation-e~ch~nge resin (300 ml) equilibrated with buffer C (20 mM sodium phosphate 15 pH 7.0, 1 mM EDTA) at 100 ml/min upwards flow. The resin was washed with buffer C until it appeared clear. The plunger was then lowered at 2 cm/min while washing continl~cl at 70 ml/min. Upwards flow was stopped when the plunger was approximately 8 cm away from the bed and the plunger was allowed to move to within 0.5 cm of the packed bed. The resin was further washed at 70 ml/min downwards flow 20 until A280 reached baseline. Buffer C plus 0.25 M NaCl was then used to elute proteins c~ g C-SAP at the same flow rate.
The eluate was buffer exchanged into buffer D (50 mM sodium borate pH 8.5, 1 mM EDTA) using the Sartocon Mini crossflow filtration system with a 10000 NMolecular Massco module (Sartorius). The sample was then applied to a column of2~ Source 15S (30 ml) equilibrated with buffer D. A 10-column-volume linear gradient of 0-0.3 M NaC1 in buffer D was used to elute C-SAP at 30 ml/min.

F. Assav for CYtotoxic activitY
The ribosome inactivating protein activity of recombinant saporin was 30 compared to the ribosome inactivating protein activity of native SAP in an in vitro assay measuring cell-free protein synthesis in a nuclease-treated rabbit reticulocyte lysate (Promega). Samples of immlmoaffinity-purified saporin were diluted in PBS and 5 ~11 of sample was added on ice to 35 ~1l of rabbit reticulocyte lysate and 10 ~1 of a reaction ~ Lul~ cc",~ ;.,g 0.5 ,ul of Brome Mosaic Virus RNA, 1 mM amino acid mixture minus leucine, 5 ,uCi of triti~te~l leucine and 3 ~1l of water. Assay tubes were 5 incubated 1 hour in a 30~C water bath. The reaction was stopped by transferring the tubes to ice and adding S ,ul of the assay ~ , in triplicate, to 75 ~Ll of 1 N sodium hydroxide, 2.5% hydrogen peroxide in the wells of a Millititer HA 96-well filtration plate (Millipore). When the red color had bleached from the samples, 300 ,ul of ice cold 25% trichloroacetic acid (TCA) were added to each well and the plate left on ice for 10 another 30 min. Vacuum filtration was performed with a Millipore vacuum holder.
The wells were washed three times with 300 ~1l of ice cold 8% TCA. After drying, the filter paper circles were punched out of the 96-well plate and counted by liquidscintill~tion techniques.
The IC50 for the recombinant and native saporin were al,~loxi...~tely 20 pM. Therefore, recombinant saporin-cont~ining protein has full protein synthesisinhibition activity when compared to native saporin.

PREPARATION OF FGF MUTEINS

A. Materials and Methods 1. Rea~ents Restriction and modification enzymes were purchased from BRL
25 (Gaithcljb~ " MD), Stratagene (La Jolla, CA) and New Fngl~ncl Biolabs (Beverly, MA).
Plasmid pFC80, cont~ining the basic FGF coding sequence, was a gift of Drs. Paolo Sarmientos and Antonella Isacchi of Farmitalia Carlo Erba (Milan, Italy).
Plasmid pFC80, has been described in the PCT Application Serial No. WO 90/02800 30 and PCT Application Serial No. PCT/US93/05702, which are herein incorporated in -their entirety by reference. The sequence of DNA encoding bFGF in pFC80 is that set forth in PCT Application Serial No. PCT/US93/05702 and in SEQ ID NO. 52.
Plasmid isolation, production of competent cells, transformation and M13 manipulations were carried out according to published procedures (Sambrook et 5 al., Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Purification of DNA fragments was achieved using the Geneclean II kit, purchased from Bio 101 (LaJolla, CA). Sequencing of the dirr~ ll constructions was performed using the Sequenase kit (version 2.0) of USB
(Cleveland, OH).
2. Sodium dodecyl sulphate (SDS) ~el electrophoresis and Western blottin~
SDS gel electrophoresis was ~ rwll~ed on a PhastSystem ntili7in~ 20%
gels (Ph~rrn~ci~). Western bloffing was accomrli~h~cl by transfer of electrophoresed protein to nitrocellulose using the PhastTransfer system (Ph~nn~ ), as described by 15 the manufacturer. The antisera to SAP and basic FGF were used at a dilution of 1:1000.
Horseradish peroxidase labeled anti-IgG was used as the second antibody as described (Davis, L., Dibner et al. (1986) Basic Methods in Molecular Biology, p. 1, Elsevier Science Publishing Co., New York).

20 B. Ple"~udlion ofthe muta~enized FGF bv site-directed muta~enesis Cysteine to serine substitutions were made by oligonucleotide-directed mutagenesis using the Amersham (Arlington Heights, IL) in vitro-mutagenesis system 2.1. Oligonucleotides encoding the new amino acid were synth~si7~?~ using a 380Bautomatic DNA syntheci7~-r (Applied Biosystems, Foster City, CA).
1. Muta~enesis The oligonucleotide used for in vitro mutagenesis of cysteine 78 was AGGAGTGTCTGCTAACC (SEQ ID NO. 56), which spans nucleotides 225-241 of SEQ ID NO. 52). The oligonucleotide for mutagenesis of cysteine 96 was 30 TTCTAAATCGGTTACCGATGACTG (SEQ ID NO. 57), which spans nucleotides 279-302 of SEQ ID NO. 52). The mutated replicative form DNA was transformed into E. coli strain JM109 and single plaques were picked and sequenced for verification of the mutation. The FGF mllt~tçcl gene was then cut out of M13, ligated into the expression vector pFC80, which had the non-mllt~te~l form of the gene removed, and transformed into E. coli strain JM109. Single colonies were picked and the plasmids 5 sequenced to verify the mutation was present. Plasmids with correct mutation were then transformed into the E. coli strain FICE 2 and single colonies from these transformations were used to obtain the mutant basic FGFs. Approximately 20 mg protein per liter of fennent~tion broth was obtained.

2. Purification of muta~enized FGF
Cells were grown overnight in 20 ml of LB broth co.~ g 100 ~Lg/ml ampicillin. The next morning the cells were pelleted and transferred to 500 ml of M9 medium with 100 ,ug/ml ampicillin and grown for 7 hours. The cells were pelleted and resuspended in lysis solution (10 mM TRIS, pH 7.4, 150 mM NaCl, lysozyme, 10 ~
15 g/mL, a~ l, 10 ~Lg/mL, leupeptin, 10 ~Lg/mL, pepstatin A, 10 llg/mL and 1 mM
PMSF; 45-60 ml per 16 g of pellet) and incubated while stirring for 1 hour at room temperature. The solution was frozen and thawed three tirnes and sonicated for 2.5 minlltes The suspension was centrifuged; the supern~t~nt saved and the pellet resuspended in another volume of lysis solution without lysozyme, centrifuged again 20 and the supernzit:~nt~ pooled. Extract volumes (40 ml) were diluted to 50 ml with 10 mM TRlS, pH 7.4 (buffer A). Pools were loaded onto a S ml Hi-Trap heparin-Sepharose column (Pharmacia, Uppsala, Sweden) equilibrated in 150 mM sodium chloride in buffer A. The column was washed with 0.6 M sodium chloride and 1 M
sodium chloride in buffer A and then eluted with 2 M sodium chloride in buffer A.
25 Peak fractions of the 2 M elution, as cletermined by optical density at 280 nm, were pooled and purity determined by gel electrophoresis. Yields were 10.5 mg of purified protein for the Cys78 mutant and 10.9 mg for the Cys96 mutant.
The biological activity of [C78S]FGF and [C96S]FGF was measured on adrenal capillary endothelial cells in culture. Cells were plated at 3,000 per well in a 24 30 well plate in 1 ml of 10% calf serum-HDMEM. Cells were allowed to attach, andsamples were added in triplicate at the indicated concentration and incubated for 48 h at WO 96/36362 PCr~US96/07164 37~C. An equal quantity of samples was added and fur~er incubated for 48 h. Medium was aspirated; cells were treated with trypsin (1 ml volume) to remove cells to 9 ml of , Hematall diluent and counted in a Coulter Counter. The results show that the twothat retain virtually complete proliferative activity of native basic FGF as judged by the ability to stim~ te endothelial cell proliferation in culture.

PREPARATION OF MoNo-DERIvATIzED NUCLEIC ACID
1 0 BINDING DOMAIN (MYoD) MyoD at a concentration of 4.1 mg/ml is dialyzed against 0.1 M sodium phosphate, 0.1 M sodium chloride, pH 7.5. A 1.1 molar excess (563 ,ug in 156 ~11 of anhydrous ethanol) of SPDP (Ph~rm~ci~ Uppsala, Sweden) is added and the reaction llliXLUle imme~ t~ly ~Eit~te~l and put on a rocker platform for 30 lnilluLt;s. The solution is then dialyzed against the same buffer. An aliquot of the dialyzed solution is ex~minecl for extent of derivatization according to the Ph~rm~ instruction sheet. The extent of derivatization is typically 0.79 to 0.86 moles of SPDP per mole of nucleic acid binding domain.
D-fiv~ d myoD (32.3 mg) is dialyzed in 0.1 M sodium borate, pH 9.0 and applied to a Mono S 16/10 colurnn equilibrated with 25 mM sodium chloride indialysis buffer. A gradient of 25 mM to 125 mM sodiurn chloride in dialysis buffer elutes free and del;v~ d nucleic acid binding domain. The flow rate is 4.0 ml/min, 4 ml fractions are collected. Aliquots of fractions were assayed for protein concentration (BCA Protein Assay, Pierce Chemical, Chicago, IL) and for pyridylthione released by reducing agent. Individual fractions (25 to 37) are analyzed for protein concentration and pyridyl-disulfide concentration. The data indicate a separation according to the level of derivatization by SPDP. The initial eluting peak is composed of myoD that is ~loxhllately di-derivatized; the second peak is mono-derivatized and 30 the third peak shows no derivatization. The di-derivatized material accounts for approximately 20% of the three peaks; the second accounts for approximately 48% and the third peak contains approximately 32%. Material from the second peak is pooled and gives an average ratio of pyridyl-disulfide to myoD of 0.95. Fraction 33, which showed a divergent ratio of pyridine-2-thione to protein, was excluded from the pool.
5 Fractions that showed a ratio of SPDP to myoD greater than 0.85 but less than 1.05 are pooled, dialyzed against 0.1 M sodium chloride, 0.1 M sodiurn phosphate, pH 7.5 and used for derivatization with basic FGF.

PREPARATION OF MODIFIED NUCLEIC ACID BINDING DOMAIN (MYoD) As an ~ltern~tive to derivatization, myoD is modified by addition of a cysteine residue at or near the N-terminlls-encoding portion of the DNA. The resulting 15 myoD can then react with an available cysteine on an FGF or react with a linker or a linker ~tt~h~-1 to an FGF to produce conjugates that are linked via the added Cys.
Modified myoD is prepared by modifying DNA encoding the myoD
(GenBank Accession No. X56677). DNA encoding Cys is inserted at position -1 or at a codon within 10 or fewer residues of the N-t~ . The res-lltin~ DNA is inserted 20 into pET1 la and pET15b and expressed in BL21 cells (NOVAGEN, Madison, WI).

A. Plel~d~ion of mYoD with an added cvsteine residue at the N-trl "~i"lle Primer #1 corresponding to the sense strand of myoD, nucleotides 121-144, incorporates a NdeI site and adds a Cys codon 5' to the start site for the mature 25 protein 5'-CATATGTGTGAGCTACTGTCGCCACCGCTC-3' (SEQ ID NO. 58) Primer #2 is an antisense primer complementing the coding sequence of 30 nucleic acid binding domain sp~nning nucleotides 1054-1077 and contains a BamHI
site.

5'-GGATCCGAGCACCTGGTATATCGGTGGGGG-3' (SEQ ID NO. 59) MyoD DNA is amplified by PCR as follows using the above primers. A
5 clone co~ p; a full-length DNA (or cDNA) for myoD (1~1) is mixed in a final volume of 100 ,ul col~ 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.01% gelatin, 2 mM MgCl2, 0.2 mM dNTPs, 0.8 ,ug of each primer. Next, 2.5 U TaqI DNA
polymerase (Boehringer l\/r~nnheim) is added and the lllix,Lu~'~ is overlaid with 30 ~l of mineral oil (Sigma). Incubations are done in a DNA Therm~l Cycler. Cycles include a d~ Luldlion step (94~C for 1 min), an annealing step (60~C for 2 min), and an elongation step (72~C for 3 min). After 35 cycles, a 10 ~11 aliquot of each reaction is run on a 1.5% agarose gel to verify the correct structure of the amplified product.
The amplified DNA is gel purified and digested with NdeI and BamHI
and subcloned into NdeI and BamHI-digested plasmid co..l 1;..illg FGF/myoD. Thisdigestion and subcloning step removes the FGF-encoding DNA and 5' portion of SAPup to the BamHI site at nucleotides 555-560 (SEQ ID NO. 52) and replaces this portion with DNA encoding a myoD molecule that contains a cysteine residue at position -1 relative to the start site of the native mature SAP protein.

B. Pl~dlion of nucleic acid bindin~ domain with a cvsteine residue at position 4 or 10 of the native protein These constructs are designed to introduce a cysteine residue at position 4 or 10 of the native protein by replacing the Ser residue at position 4 or the Val residue at position 10 with cysteine.
MyoD is amplified by polymerase chain reaction (PCR) from the parental plasmid encoding the FGF-nucleic acid binding domain fusion protein using primers that incorporate a TGT or TGC codon at position 4 or 10.
The PCR conditions are performed as described above, using the following cycles: denaturation step 94~C for 1 minute, ~nnez~ling for 2 minutes at 60~C~
and extension for 2 minutes at 72~C for 35 cycles. The amplified DNA is gel purified, digested with NdeI and BamHl, and subcloned into NdeI and BamHI digested pET1 la.

99 .

This digestion removes the FGF and 5' portion of nucleic acid binding domain (up to the newly added BamHI) from the parental FGF- myoD vector and replaces this portion with a myoD molecule co.l~ a Cys at position 4 or 10 relative to the start site of , the native protein.
S The resulting plasmid is digested with NdeI/BamHI and inserted intopET15b (NOV ~AGEN, Madison, WI), which has a His-TagTM leader sequence (SEQ ID
NO. 60), that has also been digested NdeIlBamHJ~.
DNA encoding unmodified myoD can be similarly inserted into a pETSb or pETl lA and expressed as described below for the modified SAP-encoding DNA.
C. Expression of the modified nucleic acid bindin~ domain-encoding DNA
BL21(DE3) cells are transformed with the reslllting pl~micl~ and cultured as described in Example 2, except that all incubations were conducted at 30~C
instead of 37~C. Briefly, a single colony is grown in LB AMPloo to and OD600 of 1.0-1.5 and then in-lllse-l with IPTG (final concentration 0.1 mM) for 2 h. The bacteria are spun down.
D. Purification of modified nucleic acid bindin~ domain Lysis buffer (20 mM NaPO4, pH 7.0, 5 mM EDTA, 5 mM EGTA, 1 mM
DTT, 0.5 ~g/ml leupeptin, 1 ~Lg/ml aprotinin, 0.7 ~lg/ml pepstatin) was added to the myoD cell paste (produced from pZ50Bl in BL21 cells, as described above) in a ratio of 1.5 ml buffer/g cells. This nli~Lulc~ is evenly suspended via a Polytron homogenizer and passed through a microfluidizer twice.
The resulting lysate is centrifuged at 50,000 rpm for 45 min. The supern~t~nt is diluted with SP Buffer A (20 mM NaPO4, 1 mM EDTA, pH 7.0) so thatthe conductivity is below 2.5 mS/cm. The diluted lysate supern~t~nt is then loaded onto a SP-Sepharose column, and a linear gradient of 0 to 30% SP Buffer B (1 M NaCl, 20 mM NaPO4, 1 mM EDTA, pH 7.0) in SP Buffer A with a total of 6 column volumes is applied. Fractions cont~inin~; myoD are combined and the resllltin~?; rnucleic acid binding domain had a purity of greater than 90%. A buffer exchange step is used to get the SP eluate into a buffer cont~inin~ 50 mM NaBO3, 1 mM EDTA, pH 8.5 (S Buffer A). This sample is then applied to a Resource S column (Ph~rrn~ci~ Sweden) pre-equilibrated with S Buffer A. Pure nucleic acid binding domain is eluted off thecolumn by 10 colurnn volurnes of a linear gradient of 0 to 300 mM NaCl in SP Buffer A.
In this ~lcpdldLion, ultracentrifugation is used clarify the Iysate; other 5 methods, such as filtration and using floculents also can be used. In addition, Stre~mline S (PHARMACIA, Sweden) may also be used for large scale pl~alaLions.

PREPARATION OF CONJUGATES CONTAINrNG FGF MUTEINS

A. Couplin~; of FGF muteins to nucleic acid bindin~ domain 1. Chemical Svnthesis of ~C78SIFGF-nucleic acid bindin~ domain ¢CCFN2) and rC96SlFGF-nucleic acid binding domain (CCFN3~
[C78S]FGF or [C96S]FGF (1 mg; 56nrnol) that had been dialyzed against phosphate-buffered saline is added to 2.5 mg mono-derivatized nucleic acid binding ~1Om~in (a 1.5 molar excess over the basic FGF ~ ) and left on a rocker platform overnight. The next morning the ultraviolet-visible wavelength spectrum is taken to ~let~rmine the extent of reaction by the release of pyridylthione, which adsorbs 20 at 343 nm with a known extinction coefficient. The ratio of pyridylthione to basic FGF
mutant for [C78S]FGF is 1.05 and for ~C96S]FGF is 0.92. The reaction mixtures are treated identically for purification in the following manner: reaction nlixLu~e is passed over a HiTrap heparin-Sepharose column (1 ml) equilibrated with 0.15 M sodium chloride in buffer A at a flow rate of 0.5 ml/min. The column is washed with 0.6 M
25 NaCI and 1.0 M NaCI in buffer A and the product eluted with 2.0 M NaCI in buffer A.
Fractions (0.5 ml) are analyzed by gel electrophoresis and absorbance at 280 nm. Peak tubes are pooled and dialyzed versus 10 mM sodium phosphate, pH 7.5 and applied to a Mono-S 5/5 column equilibrated with the same buffer. A 10 ml gradient between 0 and 1.0 M sodium chloride in equilibration buffer is used to elute the product. Purity is 30 determined by gel electrophoresis and peak fractions were pooled.

Under these conditions, virtually 100% of the mutant FGFs reacts with mono-derivatized myoD. Because the free surface cysteine of each mutant acts as a free sulfhydryl, it is unnecese~ry to reduce cysteines after purification from the b~.terizl The resulting product is purified by heparin-Sepharose (data not shown), thus establish-5 ing that heparin binding activity of the conjugate is retained.

2. Expression of the recombinant FGFC78/96S-nucleic acid bindin~
domain fusion proteins (FPFN4) A two-stage method is used to produce recombinant FGF[C78/96S]-10 myoD protein (hereinafter FPFN4). Two hundred and fift,v ml of LB medium c~nt~inin~J ampicillin (100 ~lg/ml) are inoculated with a fresh glycerol stock of bacteria cont~ining the plasmid. Cells are grown at 30~C in an incubator shaker to an OD600 of 0.7 and stored overnight at 4~C. The following day, cells are pelleted and resuspended in fresh LB medium (no ampicillin). The cells are divided into 5 l-liter batches and 15 grown at 30~C in an incubator shaker to an OD600 of 1.5. IPTG is added to a final concentration of 0.1 mM and growth is continued for about 2 to 2.5 hours at which time cells were harvested by centrifugation.

RECOMBINANT PRODUCTION OF FGF-NucLEIc ACID
BrNDING DOMAIN FUSION PROTEIN

A. General Descriptions 1. Bacterial Strains and Plasmids E. coli strains BL21(DE3), BL21(DE3)pLysS, HMS174(DE3) and HMS 174(DE3)pLysS were purchased from NOVAGEN, Madison, WI. Plasmid pFC80, described below, has been described in the WIPO Tntern~tional Patent ApplicationNo. WO 90/02800, except that the bFGF coding sequence in the plasmid ~lecign~te~l 30 pFC80 herein has the sequence set forth as SEQ ID NO. 52, nucleotides 1-465. The plasmids described herein may be prepared using pFC80 as a starting m~teri~l or,s~lt~ tively, by starting with a ~agment contz~inin~ the cII ribosome binding site (SEQ
ID NO. 61) linked to the FGF-encoding DNA (SEQ ID NO. 52).
E. coZi strain JA221 (lpp- hdsM+ trpE5 leuB6 lacY recA1 F'[lacIq lac+
5 pro+]) is publicly available from the American Type Culture Collection ~TCC~, Rockville, MD 20852, under the accession number ATCC 33875. (JA221 is also available from the Northern Regional Research Center (NRRL), Agricultural Research Service, U.S. Department of Agriculture, Peoria, IL 61604, under the accession number NRRL B-15211, see also U.S. Patent No. 4,757,013 to Inouye; and Nakamura et al.,10 Cell 18:1109-1117, 1979). Strain INVla is commercially available from Invitrogen, San Diego, CA.

B. Construction of plasmids encodin~ FGF/nucleic acid bindin~ domain fusion proteins 1. Construction of FGFM13 that contains DNA encodin~ the cI ribosome bindin~ site linked to FGF
A Nco I restriction site is introduced into the nucleic acid binding domain-encoding DN~ by site-directed mutagenesis using the Amersham in vitro-mutagenesis system 2.1. The oligonucleotide employed to create the Nco I restriction 20 site is synthe~i7t?d using a 380B automatic nNA synth~?~i7~r (Applied Biosystems).
This oligonucleotide co~ the Nco I site replaces the original nucleic acid binding domain-cont~inin~ coding sequence.
In order to produce a bFGF coding sequence in which the stop codon was removed, the FGF-encoding DNA is subcloned into a M13 phage and subjected to25 site-directed mutagenesis. Plasmid pFC80 is a derivative of pDS20 (see, e.g., Duester et al., Cell 30:855-864, 1982; see also U.S. Patent Nos. 4,914,027, 5,037,744, 5,100,784, and 5,187,261; see also PCT Tntern~tional Application No. WO 90/02800;
and European Patent Application No. EP 267703 Al), which is almost the same as plasmid pKG1800 (see Bernardi et al., DNA Sequence 1:147-150, 1990; see also 30 McKenney et al. (1981) pp. 383-415 in Gene Amplification and Analysis 2: Analysis of Nucleic Acids by Enzymatic Methods, Chirikjian et al. (eds.), North Holland Publishing W096/36362 PCTrUS96/07164 Colllp~ly, Amsterdam) except that it contains an extra 440 bp at the distal end of galK
between nucleotides 2440 and 2880 in pDS20. Plasmid pKG1800 includes the 2880 bpEcoR I-Pvu II of pBR322 that contains the contains the ampicillin resistance gene and an origin of replication.
Plasmid pFC80 is prepared from pDS20 by replacing the entire galK
gene with the FGF-encoding DNA of SEQ ID NO. 52, inserting the trp promoter (SEQID NO. 62) and the bacteriophage lambda cII ribosome binding site (SEQ. ID No. 61, see, e.g, Schwarz et al., Nature 272:410, 1978) U~J~Lle~LIll of and operatively linked to the FGF-encoding DNA. The Trp promoter can be obtained from plasmid pDR720 (Pharmacia PL Biochemicals) or synthesized according to SEQ ID NO. 62. Plasmid pFC80, contains the 2880 bp EcoR I-BamH I fragment of plasmid pSD20, a syntheticSal I-Nde I fragment that encodes the Trp promoter region:

EcoR I
AATTCCCCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCAGCTTGGCTGCAG

and the cII ribosome binding site (SEQ ID NO. 61)):

Sal I Nde I

The FGF-encoding DNA is removed from pFC80 by treating it as follows. The pFC80 plasmid was digested by HgaI and Sal I, which produces a fragment co~ i"i~g the CII ribosome binding site linked to the FGF-encoding DNA.25 The resulting fragment is blunt ended with Klenow's reagent and inserted intoM13mpl8 that has been opened by SmaI and treated with alkaline phosphatase for blunt-end ligation. In order to remove the stop codon, an insert in the ORI minus direction is mutagenized using the Amersham kit, as described above, using the following oligonucleotide (SEQ ID NO. 63): GCTAAGAGCGCCATGGAGA, which 30 contains one nucleotide between the FGF carboxy terminal serine codon and a Nco I

WO 96/36362 PCI~/US96107164 restriction site, it replaces the following wild type FGF encoding DNA having SEQ ID
NO. 64:

GCT M G AGC TGA CCA TGG AGA
Ala Lys Ser STOP Pro Trp Arg The resulting mutant derivative of M13mpl8, lacking a native stop codon after the carboxy t~rrnin~l serine codon of bFGF, was ~iesign~te~l FGFM13. The mutagenized region of FGFM13 cont~intocl the correct sequence (SEQ ID NO. 65).
2. P~ cudLion of a plasmid that encodes the FGF/MvoD fusion protein Plasmid FGFM13 is cut with Nco I and Sac I to yield a fragment c~ t;1i"i.lg the CII ribosome binding site linked to the bFGF coding sequence with the stop codon replaced.
An M13mpl8 d~l;valiv~ C~ nt~ining the myoD coding sequence is also cut with restriction endonucleases Nco I and Sac I, and the bFGF coding fragment from FGFM13 was inserted by ligation to DNA encoding the fusion protein bFGF- myoD
into the M13mpl8 derivative to produce mpFGF- myoD, which contains the CII
ribosome binding site linked to the FGF-nucleic acid binding domain fusion gene.Plasmid mpFGF- myoD is digested with Xba I and EcoR I and the resulting fragment collt;~ g the bFGF- myoD coding sequence is isolated and ligated into plasmid pET-l la (available from NOVAGEN, Madison, WI; for a description ofthe plasmids see U.S. Patent No. 4,952,496; see also Studier et al., Meth. Enz. 185:60-89, 1990; Studier et al., J. Mol. Biol. 189:113-130, 1986; Rosenberg et al., Gene 25 56:125-135, 1987) that has also been treated with EcoR I andX~a I.
E. coli strain BL21(DE3)pLysS (NOVAGEN, Madison WI) may be transformed with the plasmid cont~ining the fusion gene. '~
Plasmid FGF/myoD may be digested with EcoR I, the ends repaired by adding nucleoside triphosphates and Klenow DNA polymerase, and then digested with 30 Nde I to release the FGF-encoding DNA without the CII ribosome binding site. This fragment is ligated into pET 1 la, which is BamH I digested, treated to repair the ends, and digested with Nde I. The resulting plasmid includes the T7 transcription terrnin~tor and the pET- 1 1 a ribosome binding site.
Plasmid FGF/myoD may be digested with EcoR I and Nde I to release ,, the FGF-encoding DNA without the CII ribosome binding site and ends are repaired as 5 described above. This fragment may be ligated into pET 12a, which had been BamH I
digested and treated to repair the ends. The resulting plasmid includes DNA encoding the OMP T secretion signal operatively linked to DNA encoding the fusion protein.
3. Pl~dlion of a plasmid that encodes FGF2-protamine fusion protein Plo~llines are small basic DNA binding proteins, approximately 6.8 kD
10 in molecular weight with a isoelectric point of 12.175. Twenty-four of the fifty one amino acids are strongly basic. Human ~lolalllhle has been shown to condense genomic DNA for p~ ging into the sperm head. The positive charges of the protamine reactwith the negative charges of the phosphate backbone of the DNA.
A FGF-protamine fusion protein that has the ability to bind to the FGF
15 receptor and bind DNA with high affinity is constructed for t;x~lc~ion in E. coli. The sequence for the human plot~llille gene is obtained from GenBank (accession no.
Y00443). Four overlapping oligonucleotides (60mers) are generated and used to amplify the protamine gene. The amplified product is purified and ligated into the b~ct~n~l ex~le~sion vector pET1la (Novagen). To facilitate subcloning, a NcoI and 20 BamHI site are incorporated into the primers. The fragment is syntheci7~-1 by ~nne~ling the 4 oligos (2 sense and 2 ~nti.~n~e) with 20 base overlaps and using PCR to fill-in and amplify the fragments. The PCR products are digested with NcoI and BamHI, and subcloned into pBluescript SK+. The insert sequence is verified. The sequenced product is then cloned downstream and in-frame with FGF2, which has been previously 25 cloned into the pET1 la ~x~lession plasmid. The oligos used to generate fragment A are (5 -3 '):

PTI:
TACATGCCATGGCCAGGTACAGATGCTGTCGCAGCCAGAGCCGGAGCAGAT
30 ATTACCGCC (SEQ ID NO.: 85) CA 0222l269 l997-ll-l4 PT2:
GCAGCTCCGCCTCCTTCGTCTGCGACTTCTTTGTCTCTGGCGGTAATATCTGC
TCCGGCT (SEQ ID NO.: 86) '' s PT3:
GACGAAGGAGGCGGAGCTGCCAGACACGGAGGAGAGCCATGAGGTGCTGC
CGCCCCAGGT (SEQ ID NO.: 87) 10 PT4:
ATATATCCTAGGTTAGTGTCTTCTACATCTCGGTCTGTACCTGGGGCGGCAG
CACCTCA (SEQ ID NO.: 88) Co.l.~;Le..L k~cteri~l cells, BL21 (DE3), are L,~.~ro....ed with the pET11-15 FGF2-protamine construct. The cells are initially plated on LB agar plates co~ g 100 ~g/ml ampicillin. A glycerol stock made from an individual colony added to 1 ml fresh LB broth and then to 250 ml of LB broth. The cells are grown to an OD60o of 0.7 and induced with IPTG. The culture is harvested 4 hours after induction. The suspension is centrifuged; the SupL~ nt is saved and the pellet is resuspended in Iysis 20 buffer, centrifuged again and the sup~ pooled. A sample of the pellet and the supern~t~nt are analyzed by Western analysis using antibodies to FGF2 to determine the percentage of fusion protein within each fraction. Soluble protein is purified. Briefly, the cells are pelleted and resuspended in buffer A (10 mM sodium phosphate, pH 6.0, cont~inin~ 10 mM EDTA, 10 mM EGTA and 50 mM NaCI) and passed through a 25 microfluidizer (Microfluidics Corp., Newton, MA) to break open the bacteria and shear DNA. The reslllt~nt mixture is diluted and loaded onto an ~p~ncled bed Streamline SP
cation-exchange resin. The column is washed with step gradients of increasing concentrations of NaCI. The eluted material is analyzed by Western analysis for fractions co"~ -g the fusion protein. These fractions are pooled, diluted, and loaded 30 onto a Heparin-Sepharose affinity column. After washing, the bound proteins are eluted WO 96/36362 PCT/US96/0716"

in a batch-wise manner in buffer cont~ining 1 M NaCl and then in buffer cC)~ lg 2 M NaCl. Peak fractions of the 2M elution, as determined by optical density at 280 nm, are pooled and the purity cl~Le.,.,i.~ed by gel electrophoresis and Western analysis. The final pool of material will be loaded onto a column of Sephacryl S-100 equilibrated with 20 mM HEPES pH 7.4, 150 mM NaCI.
Fusion protein located in the pellet is isolated, solubilized and refolded.
Briefly, each culture pellet is thawed completely and re~u~ellded in buffer A (10 mM
Tris, 1 mM EDTA, pH 8.0 + 0.1 mg/ml lyzozyme). The nli~Lul~, iS sonicated on ice, centrifuged at 16,000 X g, and the sUpçrn~t~nt discarded. Inclusion bodies are 10 solubilized with solubilization buffer: (6 M gll~nic~in~.-HCl, 100 mM Tris, 150 mM
NaCl, 50 mM EDTA, 50 mM EGTA, pH 9.5,), vortexed, incubated for 30 minutes at room temperature, and centrifuged at 35,000 X g for 15 minl1t~s The supern~t~nt is saved and diluted 1:10 in dilution buffer (100 mM Tris, 10 mM EDTA, 1%
monothioglycerol, 0.25 M L-arginine, pH 9.5). The m~tl?ri~l is stirred, covered, at 4~C
15 for 2 hours and then cc;.lLliruged at 35,000 X g for 20 mimltes The supçrn~t~nt is dialyzed in against 5 liters PBS, pH 8.8, for 24 hours at 4~C with 3 changes of fresh PBS. The m~t~rizll is concentrated approximately 10-fold using size-exclusion spin columns. The soluble refolded m~tt~ l is then analyzed by gel electrophoresis.
Expression of the FGF-plotalline fusion protein can be achieved in 20 mzlmmz~ n cells by excising the insert with restriction enzymes NdeI and BamHI and lig~ting into a m~mm~ n expression vector.

C. Expression of the recombinant bFGF-nucleic acid bindin~ domain fusion proteins A two-stage method is used to produce recombinant bFGF-myoD protein (hereinafter bFGF-nucleic acid binding domain fusion protein).
Three liters of LB broth cont~inin~ arnpicillin (50 ~lg/ml) and chloramphenicol (25 ~lg/ml) are inoculated with pFS92 plasmid-cont~ining bacterial cells (strain BL21(DE3)pLysS) from an overnight culture (1:100 dilution). Cells are 30 grown at 37~C in an incubator shaker to an OD600 of 0.7. IPTG (Sigma Chemical, - ~ = ~= =

St. Louis, MO) is added to a final concentration of 0.2 mM and growth was continllecl for 1.5 hours at which time cells were centrifuged.
Experiment~ have shown that growing BL21(DE3)pLysS cells at 30~C
instead of 37~C improves yields. Thus, cells are grown at 30~C to an OD600 of 1.5 prior S to induction. Following induction, growth is continlle~l for about 2 to 2.5 hours at which time the cells are harvested by centrifugation.
The pellet is resuspended in lysis solution (45-60 ml per 16 g of pellet, 20 mM TRIS, pH 7.4, 5 mM EDTA, 10% sucrose, 150 mM NaCl, lysozyme, 100 ~L
g/ml, aprotinin, 10 ~Lg/ml, 1GU~G~ 10 ~Lg/ml, pc~ A, 10 ,ug/ml and 1 mM PMSF)10 and incubated with stirring for 1 hour at room temperature. The solution is frozen and thawed three times and sonicated for 2.5 minutec. The suspension is centrifuged at 12,000 X g for 1 hour, the resulting first-supern~t~nt saved and the pellet is resuspended in another volume of lysis solution wi~out lysozyme. The resuspended material isce,ll,iruged again to produce a second-supern~tSlnt and the two supern~t~ntc are pooled 15 and dialyzed against borate buffered saline, pH 8.3.

D. AffinitY purification of bFGF-nucleic acid bindin~ domain fusion protein Thirty ml of the dialyzed solution co..~;..i..~ the bFGF-nucleic acid binding domain fusion protein from Fx~mple 5.C. is applied to HiTrap heparin-Sepharose column (Ph~rm~ Uppsala, Sweden) equilibrated with 0.15 M
NaCl in 10 mM TRIS, pH 7.4 (buffer A). The column is washed first with equilibration buffer; second with 0.6 M NaCl in buffer A; third with 1.0 M NaCl in buffer A; and finally eluted with 2 M NaCl in buffer A into 1.0 ml fractions. Samples were assayed by the ELISA method.
bFGF-nucleic acid binding domain fusion protein elutes from the heparin-Sepharose column at the same concentration (2 M NaCl) as native and recombinantly-produced bFGF, indicating that the heparin affinity is retained in the bFGF-SAP fusion protein.

-E. Characteri_ation of the bFGF-nucleic acid bindin~ domain fusion protein bv Western blot SDS gel electrophoresis is performed on a Pha~l~y~le~ ltili7ing 20%
acrylamide gels (Ph~rm~ ). Western blotting is accomplished by transfer of the S electrophoresed protein to nitrocellulose using the PhastTransfer system (Pharmacia), as described by the mz~nllf~cturer. Antisera to bFGF is used at a dilution of 1:1000.
Horseradish peroxidase labeled anti-IgG is used as the second antibody (Davis et al., Basic Methods in Molecular Biology, New York, Elsevier Science Publishing Co., pp 1-338, 1986).
Anti-FGF antisera should bind to a protein with an approximate molecular weight of 53,000, which corresponds to the sum of the independent molecular weights of nucleic acid binding domain (35,000) and bFGF (18,000).

PREPARATION OF FGF-NucLEIc ACID BINDING DOMAIN CONJUGATES THAT CONTAIN
LINKERS ENCODING PROTEASE SUBSTRATES

A. Synthesis of oli~os encodin~ protease substrates Compl~ment~ry single-stranded oligos in which the sense strand encodes a protease substrate, have been synthe~i7~cl either using a cyclone m~-~hine (Millipore, MA) according the instructions provided by the m~nllf~c.turer, or were made by Midland Certified Reagent Co. (Midland, TX) or by National Biosciences, Inc. (MN).
The following oligos have been synthesi7.ocl 1. Cathepsin B substrate linker 5'- CCATGGCCCTGGCCCTGGCCCTGGCCCTGGCCATGG SEQ ID NO: 66 2. Cathepsin D substrate linker 5'- CCATGGGCCGATCGGGCTTCCTGGGCTTCGGCTTCCTGG
GCTTCGCCAT GG -3' SEQ ID NO: 67 3. Trypsin substrate linker 5'- CCATGGGCCGATCGGGCGGTGGGTGCGCTGGTAATAGAGT

CAGMGATCAGTCGGMGCAGCCTGTCTTGCGGTGGTCTC
GACCTGCAGG CCATGG-3' SEQ ID NO: 68 4. Gly4Ser 5'- CCATGGGCGG CGGCGGCTCT GCCATGG -3' SEQ ID NO: 47 5. (Gly4ser)2 5'- CCATGGGCGGCGGCGGCTCTGGCGGCGGCGGCTC
TGCCATGG -3' SEQ ID NO: 48 6. (Ser4Gly)4 5'- CCATGGCCTCGTCGTCGTCGGGCTCGTCGTCGTC

GCCATGG -3' SEQ ID NO: 49 7. (Ser4GlY)2 GGGCGCCATGG -3' SEQ ID NO: 50 8. Thrombin substrate linker CTG GTG CCG CGC GGC AGC SEQ ID NO. 69 Leu Val Pro Arg Gly Ser 9. Enterokinase substrate linker GAC GAC GAC GAC CCA SEQ ID NO. 70 20 ASp Asp ASp Asp Lys 10. Factor Xa substrate ATC GM GGT CGT SEQ ID NO. 71 IleGlu GlyArg 25 B. P~ Iion of DNA constructs encodin~ FGF-Linker-nucleic acid bindin~
domain The complementary oligos are annealed by heating at 95~C for 15 min., cooled to room temperature, and then incnb~te~l at 4~C for a minute to about an hour.
Following incubation, the oligos are digested with l~coI and ligated overnight at a 3:1 30 (insert:vector) ratio at 15~C to NcoI-digested plasmid which has been treated with zllk~line phosphatase (Boehringer Mannheim).
Bacteria (Novablue (NOVAGEN, Madison, WI)) are transformed with the ligation mixture (1 ~11) and plated on LB-amp or LB-Kan, depending upon the plasmid). Colonies are selected, clones isolated and sequenced to determine orientation 35 of the insert. Clones with correct orientation are used to transform strain expression strain BL21(DE3) (NOVAGEN, Madison, WI). Glycerol stocks are generated from single transformed colonies. The transformed strains are cultured as described in Example 2 and fusion proteins with linkers were expressed.
The DNA and amino acid sequences of exemplary fusion proteins, 5 co~ cathepsin B substrate (FPFS9), cathepsin D substrate (FPFSS), Gly4Ser(FPFS7), (Gly4Ser)2 (FPFS8), trypsin substrate (FPFS6), (Ser4Gly)4 (FPFS12) and (Ser4Gly)~ (FPFS11) linkers, respectively, are set forth in SEQ ID NOs. 72-78.

FGF-PoLY-L-LYslNE (FGF2-K) COMPLEXED WITH A
PLASMID ENCODING ,B-GALAcToslDAsE

A. D~.iv~li~lion of polY-L-lYsine Polylysine polymer with average lengths of 13, 39, 89, 152, and 265 15 (K13, K39, Kg4, Kl52, K265) are purchased from a commercial vendor (Sigma, St. Louis, MO) and dissolved in 0.1 M NaPO4, 0.1 M NaCl, 1 mM EDTA, pH 7.5 (buffer A) at 3-5 mg/ml. Approximately 30 mg of poly-L-lysine solution is mixed with 0.187 ml of 3 mg/ml N-succinimidyl-3(pyridyldithio)proprionate (SPDP) in anhydrous ethanol resulting in a molar ratio of SPDP/poly-L-lysine of 1.5 and incubated at room 20 temperature for 30 minlltes The reaction ~ Lul~; is then dialyzed against 4 liters of buffer A for 4 hours at room t~lllp~;ldlulc~.

B. Coniugation of derivatized polvlYsine to FGF2-3 A solution contz~inin~ 28.5 mg of poly-L-lysine-SPDP is added to 12.9 25 mg of FGF2-3 ([C96S]-FGF2) in buffer A and incubated overnight at 4~C. The molar ratio of poly-L-lysine-SPDP/FGF2-3 is approximately 1.5. Following incubation, the conjugation reaction mixture is applied to a 6 ml Resource S (Pharmacia, Uppsala, Sweden) column. A gradient of 0.15 M to 2.1 M NaCl in 20 mM NaPO4, 1 mM
EDTA, pH 8.0 (Buffer B) over 24 column volumes is used for elution. The FGF2-30 3/poly-L-lysine conjugate, called FGF2-K, is eluted off the column at approximately 1.8-2 M NaCl concentration. Unreacted FGF2-3 is eluted off by 0.5-0.6 M NaCI.

WO 9G/36362 PCI'IUS96/07164 The fractions co~ i..i..g FGF2-K are concentrated and loaded onto a gel-filtration column (Sephacryl S100) for buffer exchange into 20 mM HEPES, 0.1 M
NaCl, pH 7.3. The molecular weight of FGF-K152 as determined by size exclusion HPLC is ~ oxilllately 42 kD. To determine if the conjugation procedure hlL~lrt;les S with the ability of FGF2-3 to bind heparin, the chemical conjugate FGF2-K is loaded onto a heparin column and eluted off the column at 1.8- 2.0 M NaCl. In comparison, unconjugated FGF2-3 is eluted off heparin at 1.4 - 1.6 M NaCI. This suggests that poly-L-lysine contributes to FGF2-3 ability to bind heparin. The ability of poly-L-lysine 152 to bind heparin is not ~iett?rmined; poly-L-lysine 84 elutes at approximately 10 1.6 M NaCI. Histone HI-polylysine was purchased and cytochrome C was conjugated to polylysine as described herein.
A sample of FGF2-K is electrophoresed on SDS-PAGE under non-reducing and redn~ing conditions. The protein migrates at the same molecular weight as FGF. Under non-re~ cin~ conditions the conjugate does not enter the gel because of 15 its high charge density (Figure 1, lanes 1,2, non-reducing, lanes 3, 4, reducing).
A standard proliferation assay using aortic bovine endothelial cells is olllled to determine if the conjugation procedure reduced the ability of FGF2-3 ability to stimlll~te mitogenesis. The results reveal that FGF2-K is equivalent to FGF2-3 in stim~ tin~ proliferation (Figure 2).
C. FGF2-3-poly-L-lYsine-nucleic acid complex formation Optimal conditions for complex formation are established. Varying quantities (0.2 to 200 ~g) of ~-galactosidase encoding plasmid nucleic acid pSV,B or pNASS-,B (lacking a promoter) are slowly mixed with 100 ~lg of FGF2-K in 20 mM
25 HEPES pH 7.3, 0.15 M NaCl. The reaction is incubated for 1 hour at room temperature. Nucleic acid binding to the FGF-lysine conjugate is confirmed by gel mobility shift assay using 32P-labeled SV40-,B-gal nucleic acid cut with HincII
restriction endonuclease. In brief, SV40~-gal nucleic acid is digested with HincII
restriction endonucleases; ends are labeled by T4 PNK following dephosphorylation 30 with calf intestin~l ~lk~line phosphatase. To each sample of 35 ng of 32P-labeled nucleic acid increasing arnounts of FGF-polylysine conjugate is added to the mixture.

CA 0222l269 l997-ll-l4 The protein/nucleic acid mixture is electrophoresed in an agarose gel with 1 X TAE
buffer. Binding of the conjugate to the radiolabeled DNA is shown by a shift in the complex to the top of the well. (Figure 3.) As seen in Figure 3D, as little as 10 ng of K84 causes a complete shift of restriction fr~gment~ indicating binding. With Kl3, 100 5 ng of poly-L-lysine was required (Figure 3C). With K265, 10 ng was required (Figure 3E).
The optimal length of poly-L-lysine and weight ratios is determined by conjugation of FGF2-3 to poly-lysine of different lengths. DNA encoding ~[~_g~l~ctosidase was complexed with the conjugates at 10:1, 5:1, 2:1, 1:1, and 0.5:1 10 (Figure 4, lanes 1-5, respectively) (w/w) ratios. The ability of these FGF2-K complexes to bind DNA was d~leJ ,..i"ed by mc~llring the ability of FGF to promote the uptake of plasmid DNA into cells. FGF2-K conjugates were evaluated at various protein to DNA
ratios for their ability to deliver pSV,B-gal DNA into cells (Figure 4).
Briefly, the complexes were incubated for 1 hr at room temperature and then added to COS cells for 48 hrs. Cell extracts were prepared and assayed for ,B-gal enzyme activity. Briefly, cells are washed with 1 ml of PBS (Ca+2 and Mg+2 free) and lysed. The lysate was vortexed and cell debris removed by centrifugation. The lysate was assayed for ,l~-gal activity as recommenlled by the m~mlf~cturer (Promega, Madison, WI). The ~-gal activity was norm~li7tod to total protein. As seen in Figure 4, lane 3, a 2:1 (w/w) ratio of FGF2-K:DNA gave m~im~l enzyme activity.
In addition, toroid formation, which correlates with increased gene es:jion, was ~e~secl by electron microscopy. A representative toroid at a protein to DNA ratio of 2:1 is shown in Figure 5, upper panel. Toroidal structures are absent, or only partially formed, at low ratios (e.g, 0.5:1 ) (Figure 5, lower panel).
A proliferation assay is performed to determine if the condensed nucleic acid had an effect on the ability of FGF2-K to bind to cognate receptor and stimulate mitogenesis. The proliferation assay shows that only the highest dose of nucleic acid (200 ,~Lg) has a slightly inhibitory effect on proliferation as compared to FGF2-3 plus poly-L-lysine + DNA (Figure 6).

W 096/36362 PCTrUS96/07164 A FGF2-K84-DNA at a protein:DNA ratio of 2:1 is introduced into COS
cells and an endothelial cell line, ABAE, both of which express FGF receptors. The cells are subsequently assayed for ,(3-galactosidase enzyme activity. COS and ABAE
cells are grown on coverslips and incubated with the different ratios of FGF2-K:DNA
S for 48 hours. The cells are then fixed and stained with X-gal. ~im~l ,13-galactosidase enzyme activity is seen when 50 llg of pSV13 per 100 ~lg of FGF2-3-polylysine conjugate is used.
FGF2-K84-pSV,l~-gal at a protein to DNA ratio of 2:1 was added to various cell lines and incubated for 48 hr. Cell extracts were prepared, assayed for 10 ,3-gal activity and total protein. As shown in Figure 7A, COS, B16, NIH3T3, and BHK
cell lines were all able to take up complex and express ~-gal.
The expression of ~-gal requires FGF2 for targeting into cells. pSV~ or pNASS~ plasmid DNA was incubated with (Figure 7B, lanes 1, 2) or without (lanes 3, 4) FGF2-K84 for 1 hr at room temperature. Complexes were added to COS cells for 48 15 hr. Cell extracts were assayed for ~-gal activity and norm~li7~1 to total protein. Only background 13-gal activity was seen unless the plasmid was complexed with FGF2/K84.
Expression of ,B-gal is seen to be both time and dose-dependent (Figures 7C and 7D).
Sensitivity of the receptor me~ ted gene delivery system is determinP(1 using the optimized FGF2-K/DNA ratio for complex formation. Increasing amounts of 20 the FGF2-K/DNA complex is added to cells. 100 ~g of FGF2-K was mixed with 50 ug of pSV13 for 1 hour at room temperature. The COS and endothelial cells are incubated with increasing amounts of con-l~n~e~1 material (0 ng, 1 ng, 10 ng, 100 ng, 1000 ng and 10,000 ng). The cells are incubated for 48 hours and then were assayed for ~13-galactosidase activity. In addition, cells grown on cover slips are treated with 1000 25 ng of FGF2-K-DNA for 48 hours, then fixed and stained using X-gal. The ~-gal enzyme assay reveals that with increasing amounts of material there is an increase in enzyme activity. (Figure 7D) Cells incubated with X-gal show blue staining throughout the cytoplasm in approximately 3% of the cells on the coverslip.
Targeting of the complexes is specific for the FGF receptor. First, as 30 seen in Figure 8A, FGF2-K84-pSV,B-gal resulted in enzyme activity (lane 1), while only background levels of activity were seen with FGF2+K84+DNA (lane 2), FGF2+DNA
(lane 3), K84+DNA (lane 4), DNA (lane 5), FGF2-K84 (lane 6), FGF2 alone (lane 7)and K84 alone (lane 8). The expression of ,~-gal is specifically inhibited if free FGF2 is added during transfection (Figure 8B). Moreover, the addition of heparin ~1 ~e~ es the 5 ~:x~lession of ~-gal (Figure 8C). Moreover, histone HI and cytochrome C were ineffective in delivering pSV,~-gal (Figure 8C).
Taken together, these fin~lingc support the hypothesis that the targeted DNA is introduced into receptor-bearing cells via the high affinity FGF receptor.
Because histone can bind heparin sulfate yet fails to elicit a signal, the introduction of 10 DNA appears independent of the low affinity FGF receptor or non-specific endocytosis.

D. Effect of endosome-disruptive Peptides Targeting is mediated by passage of the complex through endosomes.
Chloroquine, which was added to complexec before transfection, resulted in an 8-fold 15 increase in ,B-gal activity (Figure 9A).
Based on this, the effect of endosome disruptive peptides was evaluated.
The peptide INF7, GLF EAIEGFIEN GWEGMIDGWYGC, derived from influen7~
virus, was synthe~i7~ A complex between FGF2-K84 (5 ~lg) and pSV,l~-gal plasmid DNA (5 ~lg) was formed. At this ratio, approximately half of the negative charge of the 20 DNA was neutralized by the conjugate. K84, poly-L-lysine, was further added to s~t lr~te binding to the rem~ining DNA. The INF7 peptide was added 30 minlltes later.
The complex is added to COS cells and ~-gal activity is assayed 48 or 72 hr later.
The amount of free polylysine necessary to neutralize the DNA and allow INF7 to complex was determin~ Polylysine was added at 4, 10, or 25 ,ug to the 25 FGF2-K84/pSV,~-gal complex. To each of these complexes four different concentrations of INF7 were added. Maximal ,B-gal expression was seen with 4 ~g of K84 and 12 ~g of INF7 (Figure 13A). When higher amounts of poly-lysine were used, more cell death resulted. The optimal amount of INF7 was determined using 4 ~Lg of polylysine. As seen in Figure 13B, 24 ~lg of INF7 gave m~xim~l ~-gal activity. At 72 hr, 48 ~g of INF7 gave maximal ,B-gal activity (approximately 20-32 fold enhancement) (Figure 13C).
When an endosome disruptive peptide was included in the complex, expression of ,13-gal was increased 26-fold (Figure 9B). Concomitant with this increased 5 S level of expression was an increase in the number of cells expressing ~-gal. As seen in Figure 9C, when endosome disruptive peptide (EDP) was present (right panel), 1%-5%
of cells express ,B-gal in comparison to 0.1%-0.3% without EDP added (left panel).

BOUND TO SAP DNA PLASMID

The cytotoxicity assay measures viable cells after transfection with a 15 cytocide-encoding agent. When FGF-2 is the receptor-binding int~rn~li7~-1 ligand, COS7 cells, which express FGFR, may be used as targets, and T47D, which does notexpress a receptor for FGF-2 at detect~ble levels, may be used as negative control cells.
Cells are plated at 38,000 cells/well and 48,000 cells/well in a 12-well tissue culture plate in RPMI 1640 supplemented with 5% FBS. The complex FGF2-20 K/pZ200M (a plasmid which expresses saporin) is incubated with COS7 or T47D cellsfor 48 hrs. Controls include FGF2-K alone, pZ200M alone, and FGF-2 plus poly-L-lysine plus pZ200M. Following incubation, cells are rinsed in PBS lackingMg~ and Ca~. Trypsin at 0.1% is added for 10 min and cells are harvested and washed. Cell number from each well is determined by a Coulter particle counter (or 25 equivalent method). A statistically significant decrease in cell number for cells incubated with FGF2-K/pZ200M compared to FGF2-K or pZ200M alone indicates sufficient cytotoxicity.
FGF2-polylysine-DNASAP complexes show selective cytotoxicity. To optimize the expression of the plant RIP, saporin, in m~mm~ n cells, a synthetic30 saporin gene using preferred m~mm~ n codons and introduced a "Kozak" sequence for translation initiation. The synthetic gene was then cloned into SV40 promoter and promoterless c;~ s~ion vectors. Because the expression of SAP from SAP-encoding DNA would only be feasible if the m~mm~ n ribosome can synthe~i7e the protein (SAP) prior to its inactivation by the SAP synthesized, the enzymatic activity of saporin 5 encoded by the synthetic gene was tested. SAP was cloned into a T7/SP6 promoter plasmid and sense RNA was generated using T7 RNA polymerase. The RNA was then added to a m~rnm~ n in vitro translation assay. The results from this cell-free in vitro translation assay clearly show that the saporin expressed in a m~mm~ n system can inhibit the ~ ion of protein mutagenesis (Figure 10). When added above to the 10 lysate, SAP mRNA is tr~n~l~fel1 into a protein that has the anticipated molecular weight of the saporin protein (lane 2). Similarly, when luciferase mRNA is added to the Iysate, a molecule consistent with the luciferase protein is detected (lane 3). In contrast, if SAP
mRNA is added to the Iysate along with or 30 minutes prior to luciferase mRNA, saporin activity is detected (lanes 4 and 5).
Transfection of cells with SAP DNA demonstrates cytotoxicity. When a m~mm~ n expression vector encoding saporin is transiently expressed in NIH 3T3 cells using CaPO4, there is a >65% decrease in cell survival (lane 3) compared to cells mock transfected (lane 1) or transfected with DNA encoding ~-gal (lane 2) (Figure 11).
To determine whether the FGF2-K can transfer plasmid DNA encoding 20 SAP into FGF receptor bearing cells, FGF2-K was con-l~n.~ed with the pSV40-SAP
plasmid DNA at a ratio of 2:1 (w:w). BHK 21 and NIH 3T3 cells were used as the target cells. The cells (24,000 cells/well) were incubated with either FGF2-K-DNASAP
or an FGF2-K-DNA,13-gal complex. After 72 hours of incubation, cell number was det~-rmineA As shown in Figure 12, there is a significant decrease in cell number when 25 cells are incubated with the FGF2-K-DNASAP complex compared to cells incubated with the FGF2-K-DNA~3-gal complex.

From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

CA 0222l269 l997-ll-l4 SEQUENCE LISTING

(1) GENERAL INFORMATION:
~i) APPLICANT: Prizm Pharmaceuticals. Inc.
(ii) TITLE OF INVENTION: COMPOSITIONS CONTAINING NUCLEIC ACIDS AND LIGANDS FOR THERAPEUTIC
. TREATMENT
(iii) NUMBER OF SEQUENCES: 106 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SEED and BERRY
(B) STREET: 6300 Columbia Center. 701 Fifth Avenue (C) CITY: Seattle (D) STATE: Washington (E) COUNTRY: USA
(F) ZIP: 98104-7092 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1Ø Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: 16-MAY-1996 (C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Nottenburg Ph.D.. Carol (B) REGISTRATION NUMBER: 39.317 (C) REFERENCE/DOCKET NUMBER: 760100.415PC
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (206) 622-4900 (B) TELEFAX: (206) 682-6031 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 473 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 13..456 (D) OTHER INFORMATION: /product= ''VEGFI2l-encoding DNA~

CA 0222l269 l997-ll-l4 ( i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 13. .90 (D) OTHER INFORMATION: /product= leader-encoding sequence (xi ) SEQUENCE DESCRIPTION: SEQ ID NO:l:

Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp . 45 50 55 60 Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His Gln Gly Çln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Lys Cys Asp Lys Pro Arg Arg (2) INFORMATION FOR SEQ ID NO:2:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 605 base pairs ( B ) TYPE: nuc l ei c ac i d ( C ) STRANDEDNESS: doub l e (D) TOPOLOGY: both CA 0222l269 l997-ll-l4 ( i i ) MOLECULE TYPE: cDNA

( i x) FEATURE:
(A) NAME/KEY: CDS
( B ) LOCAT I ON: 13. .588 (D) OTHER INFORMATION: /product= ''VEGFI6~-encoding DNA"
( i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 13..90 (D) OTHER INFORMATION: /product= "leader sequence-encoding DNA"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GGATCCGMM CC ATG MC m CTG CTG TCT TGG GTG CAT TGG AGC CTT 48 Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Ly~ Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Asn Pro Cys Gly Pro Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys _ Pro Arg Arg --(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 677 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: both (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 13..657 (D) OTHER INFORMATION: /product= ''VEGFI~9-encoding DNA"
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 13..90 (D) OTHER INFORMATION: /product= "leader sequence-encoding DNA"
(xi) SEOUENCE DESCRIPTION: SEQ ID NO:3 GGATCCGAAA CC ATG AAC m CTG CTG TCT TGG GTG CAT TGG AGC CTT 48 Met Asn Phe Leu Leu Ser Trp Val His Trp Sèr Leu Ala Leu Leu Leu Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys Phe Met 30 35 40 .

Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser ~ 65 70 75 TGT GTG CCC CTG ATG CGA TGC:GGG GGC TGC TGC AAT GAC GAG GGC CTG 288 Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu CA 0222l269 l997-ll-l4 Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Tyr Lys Ser Trp Ser Val Pro Cys Gly Pro Cys Ser Glu CGG AGA MG CAT TTG m GTA CM GAT CCG CAG ACG TGT MA TGT TCC 576 Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg Arg (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 728 base pairs ( B ) TYPE: nucl ei c aci d ( C ) STRANDEDNESS: doubl e ( D ) TOPOLOGY: both ( i i ) MOLECULE TYPE: cDNA
( i x ) FEATURE:
(A) NAME/KEY: CDS
(8) LOCATION: 13..711 (D) 3THER INFORMATION: /product= ''VEGFz06-encoding DNA"
( i x ) FEATURE:
( A ) NAME / KEY: CDS
(8) LOCATION: 13..90 (D) OTHER INFORMATION: /product= leader sequence encoding DNA

CA 0222l269 l997-ll-l4 WO 96l36362 PCTIUS96107164 (xi ) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GGATCCGMM CC ATG MC m CTG CTG TCT TGG GTG CAT TGG AGC CTT 48 Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu G1y Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys Glu Cys Arg Pro,Lys Lys Asp Arg Ala Arg Gln Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Tyr Lys Ser Trp Ser Val Tyr Val Gly Ala Arg Cys Cys CTA ATG CCC TGG AGC eTc ccr GGC CCC CAT CCC TGT GGG CCT TGC TCA 576 Leu Met Pro Trp Ser Leu Pro Gly Pro His Pro Cys Gly Pro Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg Arg (2) INFORMATION FOR SEQ ID NO:S:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 208 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..627 (D) OTHER INFORMATION: /note "human HBEGF precursor"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
Met Lys Leu Leu Pro Ser Val Val Leu Lys Leu Phe Leu Ala Ala Val ~eu Ser Ala Leu Val Thr Gly Glu Ser Leu Glu Arg Leu Arg Arg Gly Leu Ala Ala Gly Thr Ser Asn Pro Asp Pro Pro Thr Val Ser Thr Asp Gln Leu Leu Pro Leu Gly Gly Gly Arg Asp Arg Lys Val Arg Asp Leu Gln Glu Ala Asp Leu Asp Leu Leu Arg Val Thr Leu Ser Ser Lys Pro ~ln Ala Leu Ala Thr Pro Asn Lys Glu Glu His Gly Lys Arg Lys Lys ~ys Gly Lys Gly Leu Gly Lys Lys Arg Asp Pro Cys Leu Arg Lys Tyr Lys Asp Phe Cys Ile His Gly Glu Cys Lys Tyr Val Lys Glu Leu Arg Ala Pro Ser Cys Ile Cys His Pro Gly Tyr His Gly Glu Arg Cys His Gly Leu Ser Leu Pro Val Glu Asn Arg Leu Tyr Thr Tyr Asp His Thr Thr Ile Leu Ala Val Val Ala Val Val Leu Ser Ser Val Cys Leu Leu Val Ile Val Gly Leu Leu Met Phe Arg Tyr His Arg Arg Gly Gly Tyr ~sp Val Glu Asn Glu Glu Lys Val Lys Leu Gly Met Thr Asn Ser His ~2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 77 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (ix) FEATURE:
(D) OTHER INFORMATION: /note "human mature HBEGF"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Arg Val Thr Leu Ser Ser Lys Pro Gln Ala Leu Ala Thr Pro Asn Lys Glu Glu His Gly Lys Arg Lys Lys Lys Gly Lys Gly Leu Giy Lys Lys Arg Asp Pro Cys Leu Arg Lys Tyr Lys Asp Phe Cys Ile His G:ly Glu ~5 Cys Lys Tyr Val Lys Glu Leu Arg Ala Pro Ser Cys Ile Cys His Pro Gly Tyr His Gly Glu Arg Cys ~is Gly Leu Ser Leu Pro (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 208 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (ix) FEATURE:
(D) OTHER INFORMATION: /note "monkey HBEGF precursor"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
Met Lys Leu Leu Pro Ser Val Val Leu Lys Leu Leu Leu Ala Ala Val Leu Ser Ala Leu Val Thr Gly Glu Ser Leu Glu Gln Leu Arg Arg~Gly CA 0222l269 l997-ll-l4 Leu Ala Ala Gly Thr Ser Asn Pro Asp Pro Ser Thr Gly Ser Thr Asp Gln Leu Leu Arg Leu Gly Gly Gly Arg Asp Arg Lys Val Arg Asp Leu Gln Glu Ala Asp Leu Asp Leu Leu Arg Val Thr Leu Ser Ser Lys Pro Gln Ala Leu Ala Thr Pro Ser Lys Glu Glu His Gly Lys Arg Lys Lys Lys Gly Lys Gly Leu Gly Lys Lys Arg Asp Pro Cys Leu Arg Lys Tyr Lys Asp Phe Cys Ile His Gly Glu Cys Lys Tyr Val Lys Glu Leu Arg Ala Pro Ser Cys Ile Cys His Pro Gly Tyr His Gly Glu Arg Cys His Gly Leu Ser Leu Pro Val Glu Asn Arg Leu Tyr Thr Tyr Asp His Thr Thr Ile Leu Ala Val Val Ala Val Val Leu Ser Ser Val Cys Leu Leu Val Ile Val Gly Leu Leu Met Phe Arg Tyr His Arg Arg Gly Gly Tyr Asp Val Glu Asn Glu Glu Lys Val Lys Leu Gly Met Thr Asn Ser His (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 208 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (ix) FEATURE:
(D) OTHER INFORMATION: /note "rat HBEGF precursor"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Met Lys Leu Leu Pro Ser Val Val Leu Lys Leu Phe Leu Ala Ala Val Leu Ser Ala Leu Val Thr Gly Glu Ser Leu Glu Arg Leu Arg Arg Gly WO 96/36362 PCI~/US96/07164 Leu Ala Ala Ala Thr Ser Asn Pro Asp Pro Pro Thr Gly Thr Thr Asn Gln Leu Leu Pro Thr Gly Ala Asp Arg Ala Gln Glu Val Gln Asp Leu Glu Gly Thr Asp Leu Asp Leu Phe Lys Val Ala Phe Ser Ser Lys Pro Gln Ala Leu Ala Thr Pro Gly Lys Glu Lys Asn Gly Lys Lys Lys Arg Lys Gly Lys Gly Leu Gly Lys Lys Arg Asp Pro Cys Leu Lys Lys Tyr Lys Asp Tyr Cys Ile His Gly Glu Cys Arg Tyr Leu Lys Glu Leu Arg 115 120 lZ5 Ile Pro Ser Cys His Cys Leu Pro Gly Tyr His Gly Gln Arg Cys His Gly Leu Thr Leu Pro Val Glu Asn Pro Leu Tyr Thr Tyr Asp His Thr Thr Val Leu Ala Val Val Ala Val Val Leu Ser Ser Val Cys Leu Leu Val Ile Val Gly Leu Leu Met Phe Arg Tyr His Arg Arg Gly Gly Tyr Asp Leu Glu Ser Glu Glu Lys Val Lys Leu Gly Met Ala Ser Ser His (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 627 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: both (ii~ MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS =-(B) LOCATION: 1..627 (D) OTHER INFORMATION: /note "human HBEGF precursor"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Met Lys Leu Leu Pro Ser Val Val Leu Lys Leu Phe Leu Ala Ala Val Leu Ser Ala Leu Val Thr Gly Glu Ser Leu Glu Arg Leu Arg Arg Gly Leu Ala Ala Gly Thr Ser Asn Pro Asp Pro Pro Thr Val Ser Thr Asp Gln Leu Leu Pro Leu Gly Gly Gly Arg Asp Arg Lys Val Arg Asp Leu Gln Glu Ala Asp Leu Asp Leu Leu Arg Val Thr Leu Ser Ser Lys Pro Gln Ala Leu Ala Thr Pro Asn Lys Glu Glu His Gly Lys Arg Lys Lys Lys Gly Lys Gly Leu Gly Lys Lys Arg Asp Pro Cys Leu Arg Lys Tyr Lys Asp Phe Cys Ile His Gly Glu Cys Lys Tyr Val Lys Glu Leu Arg Ala Pro Ser Cys Ile Cys His Pro Gly Tyr His Gly Glu Arg Cys His Gly Leu Ser Leu Pro Val Glu Asn Arg Leu Tyr Thr Tyr Asp His Thr Thr Ile Leu Ala Val Val Ala Val Val Leu Ser Ser Val Cys Leu Leu Val Ile Val Gly Leu Leu Met Phe Arg Tyr His Arg Arg Gly Gly Tyr Asp Val Glu Asn Glu Glu Lys Val Lys Leu Gly Met Thr Asn Ser His (2) INFORMATION FOR SEQ ID NO:10:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (8) TYPE: amino acid ( C ) STRANDEDNESS: s i ngl e (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide .

(ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-1"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: -Met Ala Glu Gly G]u Ile Thr Thr Phe Thr Ala Leu Thr Glu Lys Phe Asn Leu Pro Pro Gly Asn Tyr Lys Lys Pro Lys Leu Leu Tyr Cys Ser Asn Gly Gly His Phe Leu Arg Ile Leu Pro Asp Gly Thr Val Asp Gly Thr Arg Asp Arg Ser Asp Gln His Ile Gln Leu Gln Leu Ser Ala Glu Ser Val Gly Glu Val Tyr Ile Lys Ser Thr Glu Thr Gly Gln Tyr Leu Ala Met Asp Thr Asp Gly Leu Leu Tyr Gly Ser Gln Thr Pro Asn Glu Glu Cys Leu Phe Leu Glu Arg Leu Glu Glu Asn His Tyr Asn Thr Tyr Ile Ser Lys Lys His Ala Glu Lys Asn Trp Phe Val Gly Leu Lys Lys Asn Gly Ser Cys Lys Arg Gly Pro Arg Thr His Tyr Gly Gln Lys Ala Ile Leu Phe Leu Pro Leu Pro Val Ser Ser Asp (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 155 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-2"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:i1 ==
Met Ala Ala Gly Ser n e Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe iys Asp Pro Lys Arg Leu CA 0222l269 l997-ll-l4 ~ Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys 115 120 ~ 125 Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 239 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-3"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Met Gly Leu Ile Trp Leu Leu Leu Leu Ser Leu Leu Glu Pro Gly Trp Pro Ala Ala Gly Pro Gly Ala Arg Leu Arg Arg Asp Ala Gly Gly Arg Gly Gly Val Tyr Glu His Leu Gly Gly Ala Pro Arg Arg Arg Lys Leu Tyr Cys Ala Thr Lys Tyr His Leu Gln Leu His Pro Ser Gly Arg Val Asn Gly Ser Leu Glu Asn Ser Ala Tyr Ser Ile Leu Glu Ile Thr Ala Val Glu Val Gly Ile Val Ala Ile Arg Gly Leu Phe Ser Gly Arg Tyr -Leu Ala Met Asn Lys Arg Gly Arg Leu Tyr Ala Ser Glu His Tyr Ser Ala Glu Cys Glu Phe Val Glu Arg Ile His Glu Leu Gly Tyr Asn Thr Tyr Ala Ser Arg Leu Tyr Arg Thr Val Ser Ser Thr Pro Gly Ala Arg Arg Gln Pro Ser Ala Glu Arg Leu Trp Tyr Val Ser Val Asn Gly Lys Gly Arg Pro Arg Arg Gly Phe Lys Thr Arg Arg Thr Gln Lys Ser Ser Leu Phe Leu Pro Arg Val Leu Asp His Arg Asp His Glu Met Val Arg Gln Leu Gln Ser Gly Leu Pro Arg Pro Pro Gly Lys Gly Val Gln Pro Arg Arg Arg Arg Gln Lys Gln Ser Pro Asp Asn Leu Glu Pro Ser His Val Gln Ala Ser Arg Leu Gly Ser Gln Leu Glu Ala Ser Ala His (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 206 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= FGF-4 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Met Ser Gly Pro Gly Thr Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro Trp Ala Gly Arg Gly Gly Ala Ala Ala Pro Thr Ala Pro Asn Gly Thr Leu Glu Ala Glu Leu Glu Arg Arg Trp Glu Ser Leu Val Ala Leu Ser Leu Ala Arg Leu Pro Val Ala Ala Gln Pro - ~60 Lys Glu Ala Ala Val G'n Ser Gly Ala Gly Asp Tyr Leu Leu Gly Ile CA 0222l269 l997-ll-l4 Lys Arg Leu Arg Arg Leu Tyr Cys Asn Val Gly Ile Gly Phe His Leu Gln Ala Leu Pro Asp Gly Arg Ile Gly Gly Ala His Ala Asp Thr Arg Asp Ser Leu Leu Glu Leu Ser Pro Val Glu Arg Gly Val Val Ser Ile Phe Gly Val Ala Ser Arg Phe Phe Val Ala Met Ser Ser Lys Gly Lys Leu Tyr Gly Ser Pro Phe Phe Thr Asp Glu Cys Thr Phe Lys Glu Ile Leu Leu Pro Asn Asn Tyr Asn Ala Tyr Glu Ser Tyr Lys Tyr Pro Gly Met Phe Ile Ala Leu Ser Lys Asn Gly Lys Thr Lys Lys Gly Asn Arg Val Ser Pro Thr Met Lys Val Thr His Phe Leu Pro Arg Leu (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 268 amino acids (B) TYPE: amino acid ~C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-5"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
Met Ser Leu Ser Phe Leu Leu Leu Leu Phe Phe Ser His Leu Ile Leu Ser Ala Trp Ala His Gly Glu Lys Arg Leu Ala Pro Lys Gly Gln Pro Gly Pro Ala Ala Thr Asp Arg Asn Pro Ile Gly Ser Ser Ser Arg Gln Ser Ser Ser Ser Ala Met Ser Ser Ser Ser Ala Ser Ser Ser Pro Ala Ala Ser Leu Gly Ser Gln Gly Ser Gly Leu Glu Gln Ser Ser Phe Gln Trp Ser Pro Ser~Gly Arg Arg Thr Gly Ser Leu Tyr Cys Arg Val Gly Ile Gly Phe His Leu Gln Ile Tyr Pro Asp Gly Lys Val Asn Gly Ser His Glu Ala Asn Met Leu Ser Val Leu Glu Ile Phe Ala Val Ser Gln ~y 11e Val Gly Ile Arg Gly Val Phe Ser Asn Lys Phe Leu Ala Met Ser Lys Lys Gly Lys Leu His Ala Ser Ala Lys Phe Thr Asp Asp Cys Lys Phe Arg Glu Arg Phe Gln Glu Asn Ser Tyr Asn Thr Tyr Ala Ser Ala Ile His Arg Thr Glu Lys Thr Gly Arg Glu Trp Tyr Val Ala Leu Asn Lys Arg Gly Lys Ala Lys Arg Gly Cys Ser Pro Arg Val Lys Pro Gln His Ile Ser Thr His Phe Leu Pro Arg Phe Lys Gln Ser Glu Gln Pro Glu Leu Ser Phe Thr Val Thr Val Pro Glu Lys Lys Asn Pro Pro Ser Pro Ile Lys Ser Lys Ile Pro Leu Ser Ala Pro Arg Lys Asn Thr Asn Ser Val Lys Tyr Arg Leu Lys Phe Arg Phe Gly (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 198 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-6"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: ~
Met Ser Arg Gly Ala Gly Arg Leu Gln Gly Thr Leu Trp Ala Leu Val Phe Leu Gly Ile Leu Val Gly Met Val Val Pro Ser Pro Ala Gly Thr Arg Ala Asn Asn Thr Leu Leu Asp Ser Arg Gly Trp Gly Thr Leu Leu CA 0222l269 l997-ll-l4 Ser Arg Ser Arg Ala Gly Leu Ala Gly Glu Ile Ala Gly Val Asn Trp Glu Ser Gly Tyr Leu Val Gly Ile Lys Arg Gln Arg Arg Leu Tyr Cys Asn Val Gly Ile Gly Phe His Leu Gln Val Leu Pro Asp Gly Arg Ile Ser Gly Thr His Glu Glu Asn Pro Tyr Ser Leu Leu Glu Ile Ser Thr Val Glu Arg Gly Val Val Ser Leu Phe Gly Val Arg Ser Ala Leu Phe Val Ala Met Asn Ser Lys Gly Arg Leu Tyr Ala Thr Pro Ser Phe Gln Glu Glu Cys Lys Phe Arg Glu Thr Leu Leu Pro Asn Asn Tyr Asn Ala Tyr Glu Ser Asp Leu Tyr Gln Gly Thr Tyr Ile Ala Leu Ser Lys Tyr Gly Arg Val Lys Arg Gly Ser Lys Val Ser Pro Ile Met Thr Val Thr His Phe Leu Pro Arg Ile (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 194 amino acids (5) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-7 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Met His Lys Trp Ile Leu Thr Trp Ile Leu Pro Thr Leu Leu Tyr Arg Ser Cys Phe His Ile Ile Cys Leu Val Gly Thr Ile Ser Leu Ala Cys Asn Asp Met Thr Pro Glu Gln Met Ala Thr Asn Val Asn Cys Ser Ser Pro Glu Arg His Thr Arg Ser Tyr Asp Tyr Met Glu Gly Gly Asp Ile -WO 96/36362 PCI~/US96/0716'~

Arg Val Arg Arg Leu Phe Cys Arg Thr Gln Trp Tyr Leu Arg Ile Asp Lys Arg Gly Lys Val Lys Gly Thr Gln Glu Met Lys Asn Asn Tyr Asn Ile Met Glu Ile Arg Thr Val Ala Val Gly Ile Val Ala Ile Lys Gly Val Glu Ser Glu Phe Tyr Leu Ala Met Asn Lys Glu Gly Lys Leu Tyr Ala Lys Lys Glu Cys Asn Glu Asp Cys Asn Phe Lys Glu Leu Ile Leu Glu Asn His Tyr Asn Thr Tyr Ala Ser Ala Lys Trp Thr His Asn Gly Gly Glu Met Phe Val Ala Leu Asn Gln Lys Gly Ile Pro Val Arg Gly Lys Lys Thr Lys Lys Glu Gln Lys Thr Ala His Phe Leu Pro Met Ala Ile Thr (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 215 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= FGF-8 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Met Gly Ser Pro Arg Ser A1a Leu Ser Cys Leu Leu Leu His Leu Leu Val Leu Cys Leu Gln Ala Gln Val Thr Val Gln Ser Ser Pro Asn Phe Thr Gln His Val Arg Glu Gln Ser Leu Val Thr Asp Gln Leu Ser Arg Arg Leu Ile Arg Thr Tyr Gin Leu Tyr Ser Arg Thr Ser Gly Lys His Val Gln Val Leu Ala Asn Lys Arg Ile Asn Ala Met Ala Glu Asp Gly Asp Pro Phe Ala Lys Leu Ile Val Glu Thr Asp Thr Phe Gly Ser Arg Val Arg Val Arg Gly Ala Glu Thr Gly Leu Tyr Ile Cys Met Asn Lys Lys Gly Lys Leu Ile Ala Lys Ser Asn Gly Lys Gly Lys Asp Cys Val Phe Thr Glu Ile Val Leu Glu Asn Asn Tyr Thr Ala Leu Gln Asn Ala Lys Tyr Glu Gly Trp Tyr Met Ala Phe Thr Arg Lys Gly Arg Pro Arg Lys Gly Ser Lys Thr Arg Gln His Gln Arg Glu Val His Phe Met Lys Arg Leu Pro Arg Gly His His Thr Thr Glu Gln Ser Leu Arg Phe Glu Phe Leu Asn Tyr Pro Pro Phe Thr Arg Ser Leu Arg Gly Ser Gln Arg Thr Trp Ala Pro Glu Pro Arg (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 208 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(D) OTHER INFORMATION: /note= "FGF-9"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Met Ala Pro Leu Gly Glu Val Gly Asn Tyr Phe Gly Val Gln Asp Ala Val Pro Phe Gly Asn Val Pro Val Leu Pro Val Asp Ser Pro Val Leu Leu Ser Asp His Leu Gly Gln Ser Glu Ala Gly Gly Leu Pro Arg Gly Pro Ala Val Thr Asp Leu Asp His Leu Lys Gly Ile Leu Arg Arg Arg : 60 Gln Leu Tyr Cys Arg Thr Gly Phe His Leu Glu Ile Phe Pro Asn Gly ~ 70 75 80 Thr Ile Gln Gly Thr Arg Lys Asp His Ser Arg Phe Gly Ile Leu Glu Phe Ile Ser Ile Ala Val Gly Leu Val Ser Ile Arg Gly Val Asp Ser Gly Leu Tyr Leu Gly Met Asn Glu Lys~Gly Glu Leu Tyr Gly Ser Glu 115 120 lZ5 Lys Leu Thr Gln Glu Cys Val Phe Arg Glu Gln Phe Glu Glu Asn Trp Tyr Asn Thr Tyr Ser Ser Asn Leu Tyr Lys His Val Asp Thr Gly Arg Arg Tyr Tyr Val Ala Leu Asn Lys Asp Gly Thr Pro Arg Glu Gly Thr Arg Thr Lys Arg His Gln Lys Phe Thr His Phe Leu Pro Arg Pro Val Asp Pro Asp Lys Val Pro Glu Leu Tyr Lys Asp Ile Leu Ser Gln Ser 195 . 200 205 (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 804 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..804 (ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 1..804 (D) OTHER INFORMATION: /note= "Nucleotide sequence corresponding to the clone M13 mpl8-G4 in Example I.B.2."

(ix) FEATURE:
(A) NAME/KEY: mat peptide (B) LOCATION: 46..804 (D) OTHER INFORMATION: /product= ""Saporin""
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

Ala Trp Ile Leu Leu Gln Phe Ser Ala Trp Thr Thr Thr Asp Ala Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser TCT m GTG GAT MM ATC CGA MC MT GTA MG GAT CCA MC CTG MM 144 Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile ATa Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn CA 0222l269 l997-ll-l4 MM GAT TAT GAT TTC GGG m GGA MM GTG AGG CAG GTG MG GAC TTG 768 Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 804 base pairs (B) TYPE: nucleic acid ( C ) STRANDEDNESS: doubl e (D) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA
( i x ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..8Q4 ( i x ) FEATURE:
(A) NAME/KEY: mi sc_feature (B) LOCATION: 1..804 (D) OTHER INFORMATION: /note= "Nucleotide sequence corresponding to the clone M13 mpl8-G1 in Example I.B.2."
( i x ) FEATURE:
(A) NAME/KEY: mat_peptide ( B ) LOCATION: 46. .804 (D) OTHER INFORMATION: /product= Saporin"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:20:
GCA TGG ATC CTG CTT CAA m TCA GCT TGG ACA ACA ACT GAT GCG GTC 48 Ala Trp Ile Leu Leu Gln Phe Ser Ala Trp Thr Thr Thr Asp Ala Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser~

Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Arg Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Ser Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys MC GM GCT AGG m CTG CTT ATC GCT ATT CM ATG ACA GCT GAG GTA 576 Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val GCA CGA m CGG TAC ATT CM MC TTG GTA ACT MG MC TTC CCC MC 624 Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:21:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 804 base pairs (B) TYPE: nucleic acid ( C ) STRANDEDNESS: doubl e (D) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA

WO 9''~636'~ PCT/US96/07164 ( i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..804 ( i x) FEATURE ~
(A) NAME/KEY: misc_feature (B) LOCATION: 1..804 (D) OTHER INFORMATION: /note= "Nucleotide sequence corresponding to the clone M13 mpl8-G2 in Example I.B.2."
( i x ) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 46..804 (D) OTHER INFORMATION: /product= "Saporin"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

Ala Trp Ile Leu Leu Gln Phe Ser Ala Trp Thr Thr Thr Asp Ala Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser TCT m GTG GAT MA ATC CGA MC MC GTA MG GAT CCA MC CTG MA 144 Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Asp Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala TTA GM TAC ACA GM GAT TAT CAG TCG ATC GM MG MT GCC CAG ATA ~32 Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile ACA CAG GGA GAT AM AGT AGA MM GM CTC GGG TTG GGG ATC GAC TTA _ 480 Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys AAC GM GCT AGG m CTG CTT ATC GCT ATT CM ATG ACA GCT GAG GTA 576 Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg MG ATT TCT ACG GCA ATA TAC GGG GAT GCC AAA MC GGC GTG m MT 720 Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEq ID NO:22:
(i ~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 804 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA
( i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..804 ( i x ) FEATURE:
(A) NAME/KEY: mi sc feature (B) LOCATION: 1..804 (D) OTHER INFORMATION: /note= "Nucleotide sequence corresponding to the clone M13 mpl8-G7 in Example I.B.2."
( i x~ FEATURE:
(A) NAME/KEY: mat_peptide ( B ) LOCAT I ON: 46. .804 (D) OTHER INFORMATION: /product= "Saporin"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:22:

WO 96/36362 PCI~/US96/07164 GCA TGG ATC CTG CTT CM m TCA GCT TGG ACA ACA ACT GAT GCG GTC 48 Ala Trp Ile Leu Leu Gln Phe Ser Ala Trp Thr Thr Thr Asp Ala Val -15 =10 -5 Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln ryr Ser TCT m GTG GAT MA ATC CGA MC MC GTA MG GAT CCA MC CTG MA 144 Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Arg Ser Glu Ile Thr Ser Ala~

Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Ser Met Glu Ala Val Asn Ly5 Lys Ala Arg Val Val Lys MC GM GCT AGA TTC CTT CTT ATC GCT ATT CAG ATG ACG GCT GAG GCA ~ 576 Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Ala Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Ile Lys Asn Phe Pro Asn Lys Phe Asn Ser Glu Asn Lys Val Ile Gln Phe Glu Val Asn Trp Lys Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn MM GAT TAT GAT TTC GGG m GGA MM GTG AGG CAG GTG MG GAC TTG 768 Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:23:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 804 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA
( i x ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..804 ( i x ) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 1..804 (D) OTHER INFORMATION: /note= "Nucleotide sequence corresponding to the clone M13 mpl8-G9 in Example I.B.2."
( i x) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 46..804 (D) OTHER INFORMATION: /product= "Saporin"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:23:

Ala Trp Ile Leu Leu Gln Phe Ser Ala Trp Thr Thr Thr Asp Ala Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys WO 96136362 PCI'IUS96/07164 Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Arg Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Gln Ser Arg Lys Glu Leu Giy Leu Gly Ile Asp Leu Leu Ser Thr Ser Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asp Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Ala GCG CGA m AGG TAC ATA CAA AAC TTG GTA ATC MG AAC TTT CCC AAC 624 Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Ile Lys Asn Phe Pro Asn MG TTC MC TCG GAA MC AM GTG ATT CAG m GAG GTT MC TGG AAA 672 Lys Phe Asn Ser Glu Asn Lys Val Ile Gln Phe Glu Val Asn Trp Lys Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg G1n Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:24:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (E) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Pro Lys Lys Arg Lys Val Glu (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..8 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
Pro Pro Lys Lys Ala Arg Glu Val (2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLQGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..9 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Pro Ala Ala Lys Arg Val Lys Leu Asp (2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..5 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
Lys Arg Pro Arg Pro (2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..5 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
Ly5 Ile Pro Ile Lys (2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE: - - ~
(A) NAME/KEY: CDS
(B) LOCATION: 19 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

Gly Lys Arg Lys Arg Lys Ser ,~
(2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii~ MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..9 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
Ser Lys Arg Val Ala Lys Arg Lys Leu (2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..9 (D) OTHER INFORMATION: /product- nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
Ser His Trp Lys Gln Lys Arg Lys Phe (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..8 (D) OTHER INFORMATION: /product= nuclear translocation sequence ~ 150 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: .
Pro Leu Leu Lys Lys Ile Lys Gln (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Pro Gln Pro Lys Lys Lys Pro (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1 .15 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
Pro Gly Lys Arg Lys Lys Glu Met Thr Lys Gln Lys Glu Val Pro (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS

~ 151 (B) LOCATION: 1..12 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Ala Pro (Z) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
Asn Tyr Lys Lys Pro Lys Leu (2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7 (D) OTHER INFORMATION: /product= nuclear transloca~ion sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
His Phe Lys Asp Pro Lys Arg (2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide -CA 0222l269 l997-ll-l4 W O 96/36362 PC~rrUS96/07164 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
Ala Pro Arg Arg Arg Lys Leu (2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..6 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Ile Lys Arg Leu Arg Arg (2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..6 (D) OTHER INFORMATION: /product= nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: -- - -- ---Ile Lys Arg Gln Arg Arg (2) INFORMATION FOR SEQ ID NO:41:

_ (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..5 (D) OTHER INFORMATION: /product2 nuclear translocation sequence (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Ile Arg Val Arg Arg (2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Cytoplasmic Translocation Signal"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Lys Asp Glu Leu (2) INFORMATION FOR SEQ ID NO:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Cytoplasmic Translocation Signal"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:
Arg Asp Glu Leu (2) INFORMATION FOR SEQ ID NO:44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Cytoplasmic Translocation Signal"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:
Lys Glu Glu Leu (2) INFORMATION FOR SEQ ID NO:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Endosome-disruptive peptide INF"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:

Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Ile Asp Gly Gly Gly Cys (2) INFORMATION FOR SEQ ID NO:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Endosome-disruptive peptide INF"
(xi) SEQUENCE DESCRIPTION: SEq ID NO:46:
Gly Leu Phe Glu Ala Ile Glu Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Ile Asp Gly Trp Tyr Gly Cys (2) INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nuc 1 ei c aci d (C) STRANDEDNESS: si ng1 e (D) TOPOLOGY: li nea r (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 3..26 (A) NAME/KEY: Gly4Ser with NcoI ends (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:

(2) INFORMATION FOR SEQ ID NO:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: li nea r (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 3..41 (A) NAME/KEY: (Gly4Ser)2 with NcoI ends (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:
CCATGGGCGG CGGCGGCTCT GGC~GGCG GCTCTGCCAT GG 42 (2) INFORMATION FOR SEQ ID NO:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 75 base pai rs (B) TYPE: nucl ei c aci d (C) STRANDEDNESS: si ng 1 e (D) TOPOLOGY: li nea r (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 3..74 (A) NAME/KEY: (Ser4Gly)4 with NcoI ends (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:

CCATGGCCTC GTCGTCGTCG ~G~IC~IC~I CGTCGGGCTC GTCGTCGTCG GG~ 60 _ CA 0222l269 l997-ll-l4 W O 96/36362 PC~r~US96/07164 (2) INFORMATION FOR SEQ ID NO:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH:45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 3..45 (A) NAME/KEY: (Ser4GlY)2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:

(2) INFORMATION FOR SEQ ID NO:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: CDS - --(B) LOCATION: 1..8 (D) OTHER INFORMATION: /product= Flexible linker (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:

Ala Ala Pro Ala Ala Ala Pro Ala (2) INFORMATION FOR SEQ ID NO:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 465 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..465 (ix) FEATURE:

(A) NAME/KEY: mat_peptide (B) LOCATION: 1..465 (D) OTHER INFORMATION: /product= "bFGF"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:52:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAT GAG TGT TTC m m GM CGA TTG GM TCT MT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser (2) INFORMATION FOR SEQ ID NO:53:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1230 base pairs ( B ) TYPE: ruc l ei c aci d ( C ) STRANDEDNESS: doub l e (D) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA

WO 96/36362 PCr/US96/07164 ( i x ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1230 ( i x ) FEATURE:
(A) NAME/KEY: mat_peptide ( B ) LOCATION: 1. .465 (D) OTHER INFORMATION: /product= "bFGF"
( i x ) FEATURE:
(A) NAME/KEY: mat_peptide ( B ) LOCATI ON: 472. .1230 (D) OTHER INFORMATION: /product= "Saporin"

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:53:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala G~iu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys 130 ~35 14Q

Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Val Thr Ser WO 96/36362 PCI~/US96/07164 ATC ACA TTA GAT CTA GTA MT CCG ACC GCG GGT CM TAC TCA TCT m 528 Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp I1e Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp TAT GAT TTC GGG m GGA MM GTG AGG CAG GTG M G GAC TTG C M ATG 1200 Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: misc_recomb (B) LOCATION: 6..11 (D) OTHER INFORMATION: /standard_name= "EcoRI Restriction Site"
(ix) FEATURE:
(A) NAME/KEY: sig_peptide (B) LOCATION: 12..30 (D) OTHER INFORMATION: /function= "N-terminal extension" /product= "Native saporin signal peptide"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:

(2) INFORMATION FOR SEQ ID NO:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: s~ng1e (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iv) ANTI-SENSE: YES
(ix) FEATURE:
(A) NAME/KEY: misc_recomb (B) LOCATION: 6..11 (D) OTHER INFORMATION: /standard_name= "EcoRI Restriction Site"
(ix) FEATURE~ ~ -(A) NAME/KEY: terminator (B) LOCATION: 23..25 (D) OTHER INFORMATION: /note= "Anti-sense stop codon"

W O 96/36362 PC~rrUS96/07164 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 26..30 (D) OTHER INFORMATION: /note= "Anti-sense to carboxyl terminus of mature peptide"
(xi) SEqUENCE DESCRIPTION: SEQ ID NO:55 CTGCAG M TT CGCCTCG m GACTAC m G 30 (2) INFORMATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:

(2) INFORMATION FOR SEQ ID NO:57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:

(2) INFORMATION FOR SEQ ID NO:58:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:

(2) INFORMATION FOR SEQ ID NO:59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:

(2) INFORMATION FOR SEQ ID NO:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:
GGATCCGCCT CG m GACTA CTT 23 (2) INFORMATION FOR SEQ ID NO:61:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 59 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(D) OTHER INFORMATION/product= bacteriophage lambda CII ribosome binding site (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6~:

(2) INFORMATION FOR SEQ ID NO:62: -(i) SEqUENCE CHARACTERISTICS:
(A) LENGTH: 59 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(D) OTHER INFORMATION: /product= trp promoter (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:

(2) INFORMATION FOR SEQ ID NO:63:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: misc_recomb (B) LOCATION: 11..16 (D) OTHER INFORMATION: /standard_name= "Nco I restriction enzyme recognition site."
(ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1..10 (D) OTHER INFORMATION: /product= "Carboxy terminus of mature FGF protein"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:

(2) INFORMATION FOR SEQ ID NO:64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..12 (D) OTHER INFORMATION: /product= "Carboxy terminus of wild type FGF"
(ix) FEATURE:
(A) NAME/KEY: misc_recomb - (B) LOCATION: 13.. 18 (D) OTHER INFORMATION: /standard_name= "Nco I restriction enzyme recognition site"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:

Ala Lys Ser W 096/36362 PCTrUS96/07164 (2) INFORMATION FOR SEQ ID NO:65:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 102 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..96 (D) OTHER INFORMATION: /product= "pFGFNcol"
/note= "Equals the plasmid pFC80 wih native FGF
stop codon removed."
(i x) FEATURE:
(A) NAME/KEY: misc_recomb (B) LOCATION: 29..34 (D) OTHER INFORMATION: /standard_name= "Nco I restriction enzyme recognition site"
(xi) SEQUENCE OESCRIPTION: SEQ ID NO:65:
CTT m CTT CCA ATG TCT GCT MG AGC GCC ATG GAG ATC CGG CTG MT 48 Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Glu Ile Arg Leu Asn GGT GCA GTT CTG TAC CGG TTT TCC TGT GCC GTC m CAG GAC TCC TGMMTCTT 102 Gly Ala Val Leu Tyr Arg Phe Ser Cys Ala Val Phe Gln Asp Ser (2) INFORMATION FOR SEQ ID NO:66:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE
(A) NAME/KEY: CDS
(B) LOCATION: 3..35 (A) NAME/KEY: Cathepsin B linker (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:

CA 0222l269 l997-ll-l4 (2) INFORMATION FOR SEQ ID NO:67:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs (B) TYPE: nucl ei c aci d (C) STRANDEDNESS: si ngl e (D) TOPOLQGY: 1inear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 3..50 (A) NAME/KEY: Cathepsin D linker (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:

(2) INFORMATION FOR SEQ ID NO:68:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 96 base palrs (B) TYPE: nuc 1 ei c aci d (C) STRANDEDNESS: single (D) TOPOLOGY: li near (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 3..95 (A) NAME/KEY: "Trypsi n 1 i nker"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:

(2) INFORMATION FOR SEQ ID NO:69:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: doub 1 e (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
- (B) LOCATION: 1.. 18 (D) OTHER INFORMATION: /product= Thrombin substrate linker CA 0222l269 l997-ll-l4 W O 96/36362 PC~r~US96/07164 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:

Leu Val Pro Arg Gly Ser (2) INFORMATION FOR SEQ ID NO:70:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double ~D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE: =
(A) NAME/KEY: CDS
(B) LOCATION: 1..15 (D) OTHER INFORMATION: /product= Enterokinase substrate linker (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:

Asp Asp Asp Asp Lys (2) INFORMATION FOR SEQ ID NO:71:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..12 (D) OTHER INFORMATION: /product= Factor Xa substrate (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:

Ile Glu Gly Ar~

(2) INFORMATION FOR SEQ ID NO:72:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1260 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA

( i x ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1~.1260 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1. .465 (D) OTHER INFORMATION: /product= "bFGF"
( i x ) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 466...501 (D) OTHER INFORMATION: /product= "Cathepsin B linker"
( i x) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 502..1260 (D) OTHER INFORMATION: /product= "Saporin"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:72:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly A1a Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Ala Leu Ala Leu Ala Leu Ala Leu Ala Met Val Thr Ser Ile Thr Leu Asp Leu Val MT CCG ACC GCG GGT CM TAC TCA TCT m GTG GAT MM ATC CGA MC 576 Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly GAT GCC MM M C GGC GTG m M T MM GAT TAT GAT TTC GGG m GGA 1200 Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:73:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1275 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1275 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1..465 (D) OTHER INFORMATION: /product= "bFGF"
(ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 466...516 (D) OTHER INFORMATION: /product= "Cathepsin D linker"
(ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 517..1275 (D) OTHER INFORMATION: /product= "Saporin"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu -Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAT GAG TGT TTC m m GM CGA TTG GM TCT MT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys GCT ATA CTT m CTT CCA ATG TCT GCT MG AGC GCC ATG GGC CGA TCG 480 Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Gly Arg Ser Gly Phe Leu Gly Phe GLy Phe Leu GLy Phe Ala Met Val Thr Ser Ile 165 170 ~ 175 ACA TTA GAT CTA GTA MT CCG ACC GCG GGT CAA TAC TCA TCT TrT GTG 576 Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val CA 0222l269 l997-ll-l4 Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala AGG m CTG CTT ATC GCT ATT CM ATG ACA GCT GAG GTA GCA CGA TTT 1056 Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser ACG GCA ATA TAC GGG GAT GCC MM MC GGC GTG m MT MM GAT TAT 1200 Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr GAT TTC GGG m GGA MM GTG AGG CAG GTG MG GAC TTG CM ATG GGA 1248 Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) I NFORMAT I ON FOR SEQ I D NO: 74:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1251 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double ( D ) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA
( i x) FEATURE:
(A) NAME/I~EY: CDS
(B) LOCATION: 1..1251 W 096/36362 PCT~US96/07164 ( i x ) FEATURE:
(A) NAME/KEY: mat_pepti de (8) LOCATION: 1..465 (D) OTHER INFORMATION: /product= "bFGF"
( i x ) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 466..492 (D) OTHER INFORMATION: /product= " Gly4Ser linker"
( i x ) FEATURE:
(A) NAME/KEY: mat peptide (8) LOCATION: 493..1251 (D) OTHER INFORMATION: /product= "Saporin"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAt GAG TGT TTC m TTT GAA CGA TTG GM TCT MT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys GCT ATA CTT TTT CTr CCA ATG TCT GCT MG AGC GCC ATG GGC GGC GGC 480 Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Gly Gly Gly -CA 0222l269 l997-ll-l4 Gly Ser Ala Met Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr GCG GGT CM TAC TCA TCT m GTG GAT MM ATC CGA MC MC GTA MG 576 Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys GCA CGT GTG GTT MM MC GM GCT AGG m CTG CTT ATC GCT ATT CM 1008 Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr MG MC TTC CCC MC MG TTC GAC TCG GAT MC MG GTG ATT CM m 1104 Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys M C GGC GTG TTT M T MM GAT TAT GAT TTC GGG m GGA MM GTG AGG 1200 Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg 385 390 3~5 400 CAG GTG M G GAC TTG C M ATG GGA CTC CTT ATG TAT TrG GGC MM CCA 1248 Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro M G ~ 1251 Lys --(2) INFORMATION FOR SEQ ID NO:75:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1266 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE.
(A) NAME/KEY: CDS
(B) LOCATION: 1..1266 (ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 1..465 (D) OTHER INFORMATION: /product= "bFGF"
(ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 466..507 (D) OTHER INFORMATION: /product= " (Gly4Ser)2 linker"
(ix) FEATURE:
~A) NAME/KEY: mat_peptide (B) LOCATION: 508.,1266 (D) OTHER INFORMATION: /product= "Saporin"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly GGC AGC GGC GCC TTC CCG CCC GGC CAC TTC M G GAC CCC AAG CGG CTG : 96 Gly Ser Gly Ala Phe Pro Pro Gly His Fhe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly~-P~e Phe Leu Arg Ile His Pro Asp Gly Arg GTT GAC GGG GTC CG'G GAG M G AGC GAC CCT CAC ATC M G CTT C M CTT 192 Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu W 096/36362 PCTnUS96/07164 Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAT GAG TGT TTC m m GM CGA TTG GM TCT MT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys GCT ATA CTT m CTT CCA ATG TCT GCT MG AGC GCC ATG GGC GGC GGC 480 Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Met Val Thr Ser Ile Thr Leu Asp CTA GTA MT CCG ACC GCG GGT CM TAC TCA TCT m GTG GAT MM ATC 576 Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala TAT TAC TTC AAA TCA GM ATT ACT TCC GCC GAG rTA ACC GCC CTT TTC 816 Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp CA 0222l269 l997-ll-l4 Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu GCA GTG MC MG MG GCA CGT GTG GTT MM MC GM GCT AGG m CTG 1008 Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu CTT ATC GCT ATT CM ATG ACA GCT GAG GTA GCA CGA m AGG TAC ATT 1056 Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn MG GTG ATT CM m GM GTC AGC TGG CGT MG ATT TCT ACG GCA ATA 1152 Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile TAC GGG GAT GCC MM MC GGC GTG m MT MA GAT TAT GAT TTC GGG 1200 Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly m GGA MM GTG AGG CAG GTG MG GAC TTG CM ATG GGA CTC CTT ATG 1248 Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:76:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1320 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double ~D) TOPOLOGY: unknown ( i i ) MOLECULE TYPE: cDNA
( i x ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1320 ( i x ) FEATURE:
(A) NAME/KEY: mat_peptide ( B ) LOCAT I ON: 1. .465 (D) OTHER INFORMATION: /product= "bFGF"

o ( i x ) FEATURE:
(A) NAME/KEY: mat_peptide ( B ) LOCATI ON: 466. .561 (D) OTHER INFORMATION: /product= "Trypsin linker"
( i x ) FEATURE:
(A) NAME/KEY: mat_pepti de (B) LOCATION: 562..1320 (D) OTHER INFORMATION: /product= "Saporin"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAT GAG TGT TTC TTT m GM CGA TTG GM TCT MT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Gly Arg Ser Gly Gly Gly Cys Ala Gly Asn Arg Val Arg Arg Ser Val Gly Ser Ser W 096/36362 PCTrUS96/07164 Leu Ser Cys Gly Gly Leu Asp Leu Gln Ala Met Val Thr Ser Ile Thr TTA GAT CTA GTA MT CCG ACC GCG GGT CM TAC TCA TCT m GTG GAT 624 Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr 290 ~ 295 300 Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp 305 3io 315 320 Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe 325 330 335 .

Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg TTT CTG CTT ATC GCT ATT CM ATG ACA GCT GAG GTA GCA CGA m AGG 1104 Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr -~ GCA ATA TAC GGG GAT GCC MM M C GGC GTG m M T MM GAT TAT GAT 1248 Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:77:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1299 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1299 (ix) FEATURE:
(A) NAME/KEY: mat peptide (B) LOCATION: 1..465 (D) OTHER INFORMATION: /product= "bFGF"
(ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 466..540 (D) OTHER INFORMATION: /product= "(Ser4Gly)41inker"
(ix) FEATURE:
(A) NAME/KEY: mat_peptide (B) LOCATION: 541..1299 (D) OTHER INFORMATION: /product= "Saporin"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:77:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Giy Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg CA 0222l269 l997-ll-l4 WO 96/36362 PCTrUS96/07164 Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg G1y Val Val Ser Ile Lys Gly Val Cys Ala Asn' Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAT GAG TGT TTC m m GM CGA TTG GM TCT MT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys GCT ATA CTT m CTT CCA ATG TCT GCT MG AGC GCC ATG GCC TCG TCG 480 Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Ala Ser Ser TCG TCG GGC TCG TCG TC'G TCG GGC TCG TCG TCG TCG GGC TCG TCG TCG 528 Ser Ser Gly Ser Ser Ser Ser Gly Ser Ser Ser Ser Gly Ser Ser Ser Ser Gly Ala Met Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu G~y Leu Lys Arg'Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser 260 : 265 270 W 096/36362 PCTrUS96/07164 Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser lle Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys GCA CGT GTG GTT MM MC GM GCT AGG m CTG CTT ATC GCT ATT CM 1056 Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr MG MC TTC CCC MC MG TTC GAC TCG GAT MC MG GTG ATT CM m 1152 Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:78:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1269 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double ( D ) TOPOLOGY: unknown (ii) MOLECULE TYPE: cDNA
( i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1269 - -096136362 PCTrUS96/07164 ( i x) FEATURE:
(A) NAME/KEY: mat peptide (B) LOCATION: 1..465 (D) OTHER INFORMATION: /product= "bFGF"
( i x) FEATURE:
(A) NAME/KEY mat_pepti de (B) LOCATION: 466..510 (D) OTHER INFORMATION: /product= "(SeraGly)2 linker"
( i x) FEATURE:
(A) NAME/KEY: mat peptide (B) LOCATION: 511..1269 (D) OTHER INFORMATION: /product= "Saporin"
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:78:

Met Ala A~a Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala G7u Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys GTT ACG GAT GAG TGT TTC m m GM CGA TTG GM TCT AAT MC TAC 336 Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Ala Ser Ser Ser Ser G1y Ser Ser Ser Ser Gly Ala Met Val Thr Ser Ile Thr Leu GAT CTA GTA MT CCG ACC GCG GGT CM TAC TCA TCT m GTG GAT MM 576 Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Gl u Al a Val Asn Lys Lys Al a Arg Val Val Lys Asn Gl u Al a Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Tle Ser Thr Ala WO 96/36362 PCI'IUS96/07164 Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:79:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 765 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: 5i ngl e ( D ) TOPOLOGY: l i nea r ( i x) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..762 (D) OTHER INFORMATION: /product= "Mammalian codon optimized saporin"

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:79:

Met Val Thr Ser Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln~

Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr .

Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys (2) INFORMATION FOR SEQ ID NO:80:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1233 base pai rs ( ~ ) TYPE: nucl ei c aci d ( C ) STRANDEDNESS: s i ng l e ( D ) TOPOLOGY: l i nea r ~

CA 0222l269 l997-ll-l4 WO 96l36362 PCT/US96/07164 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1230 (D) OTHER INFORMATION: /product= "E. coli codon optimized FGF-SAP "

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:80:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu TAT TGC MM MC GGT GGT m TTC CTG CGT ATC CAC CCG GAT GGC CGC 144 Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg Ile His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr' Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser Ala Met Val Thr Ser ATC ACG CTG GAT CTG GTC MC CCG ACC GCT GGT CAG TAC AGC TCG m 528 Ile Thr Leu Asp Leu Val Asn Pro Thr Ala Gly Gln Tyr Ser Ser Phe Val Asp Lys Ile Arg Asn Asn Val Lys Asp Pro Asn Leu Lys Tyr Gly Gly Thr Asp Ile Ala Val Ile Gly Pro Pro Ser Lys Glu Lys Phe Leu Arg Ile Asn Phe Gln Ser Ser Arg Gly Thr Val Ser Leu Gly Leu Lys Arg Asp Asn Leu Tyr Val Val Ala Tyr Leu Ala Met Asp Asn Thr Asn Val Asn Arg Ala Tyr Tyr Phe Lys Ser Glu Ile Thr Ser Ala Glu Leu Thr Ala Leu Phe Pro Glu Ala Thr Thr Ala Asn Gln Lys Ala Leu Glu Tyr Thr Glu Asp Tyr Gln Ser Ile Glu Lys Asn Ala Gln Ile Thr Gln Gly Asp Lys Ser Arg Lys Glu Leu Gly Leu Gly Ile Asp Leu Leu Leu Thr Phe Met Glu Ala Val Asn Lys Lys Ala Arg Val Val Lys Asn Glu Ala Arg Phe Leu Leu Ile Ala Ile Gln Met Thr Ala Glu Val Ala Arg TTC CGT TAC ATT CAG MC TTG GTT ACT MG MC m CCG MC MM TTC 1056 Phe Arg Tyr Ile Gln Asn Leu Val Thr Lys Asn Phe Pro Asn Lys Phe Asp Ser Asp Asn Lys Val Ile Gln Phe Glu Val Ser Trp Arg Lys Ile TCG ACG GCT ATT TAT GGC GAT GCC MM MC GGC GTA m MC AM GAT 1152 Ser Thr Ala Ile Tyr Gly Asp Ala Lys Asn Gly Val Phe Asn Lys Asp Tyr Asp Phe Gly Phe Gly Lys Val Arg Gln Val Lys Asp Leu Gln Met Gly Leu Leu Met Tyr Leu Gly Lys Pro Lys CA 02221269 l997-ll-l4 (2) INFORMATION FOR SEQ ID NO:81:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 465 base pairs (B) TYPE: nucleic acid ( C ) STRANDEDNESS: s i ngl e (D) TOPOLOGY: linear ( i x ) FEATURE:
(A) NAME/KEY: CDS
( B ) LOCATION: 1. .462 (D) OTHER INFORMATION: /product= "FGF 2 - Ile Mutation at Res i due 116 "

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:81:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Vai Ser Ile Lys Gly Val Cys Ala Asn Arg TAC CTG GCT ATG MG GM GAT GGA AGA TTA CTG GCT TCT MA TGT GTT ~ 288 Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val ACG GAT GAG TGT TTC m-m GM CGA TTG GM TCT MT MC TAC MT 336 Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Ile Ser Arg Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala ATA CTT m CTT CCA ATG TCT GCT MG AGC TM 465 Ile Leu Phe Leu Pro Met Ser Ala Lys Ser (2) INFORMATION FOR SEQ ID NO:82:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 465 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: si ngl e (D) TOPOLOGY: linear ( i x ) FEATURE:
(A) NAME/KEY: CDS
( B ) LOCAT I ON: 1. .462 (D) OTHER INFORMATION: /product= "FGF 2 - Glu Mutation at Residue 119"

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:82:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Ly5 Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Glu Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Ly5 Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala ATA CTT m CTT CCA ATG TCT GCT MG AGC TM 465 Ile Leu Phe Leu Pro Met Ser Ala Lys Ser (2) INFORMATION FOR SEQ ID NO:83:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 465 base pairs ( B ) TYPE: nucl ei c aci d (C) STRANDEDNESS: si ngl e (D) TOPOLOGY: linear ( i x ) FEATURE:
(A) NAME/KEY: CDS
(8) LOCATION: 1..462 (D) OTHER INFORMATION: /product= "FGF 2 - Ala Mutation at Residue 120"

(xi ) SEQUENCE DESCRIPTION: SEQ ID N0:83:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn,,Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val 235 = 240 245 250 ACG GAT GAG TGT TTC- TTT m GM CGA TTG GM TCT MT MC TAC MT 336 Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn WO 96/36362 PCTrUS96107164 Thr Tyr Arg Ser Arg Lys Ala Thr Ser Trp Tyr Val Ala Leu Lys Arg a ACT GGG CAG TAT AM CTT GGA TCC MM ACA GGA CCT GGG CAG MM GCT 432 Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala Ile Leu Phe Leu Pro Met Ser Ala Lys Ser (2) INFORMATION FOR SEQ ID NO:84:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 465 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: l i near ( i x ) FEATURE:
(A) NAME/KEY: CDS
( B ) LOCATION: 1. .462 (D) OTHER INFORMATION: /product= "FGF 2 - Trp Mutation at Residue 123"

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:84:

Met Ala Ala Gly Ser Ile Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly Phe Phe Leu Arg His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro His Ile Lys Leu Gln Leu Gln Ala Glu Glu Arg Gly Val Val Ser Ile Lys Gly Val Cys Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val ACG GAT GAG TGT TTC m m G M CGA TTG G M TCT M T M C TAC M T 336 Thr Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg Lys Tyr Thr Ser Ala Tyr Val Ala Leu Lys Arg Thr Gly Gln Tyr Lys Leu Gly Ser Lys Thr Gly Pro Gly Gln Lys Ala ATA CTT m CTT CCA ATG TCT GCT M G AGC T M 465 Ile Leu Phe Leu Pro Met Ser Ala Lys Ser (2) INFORMATION FOR SEQ ID NO:85:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Protamine"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:

(2) INFORMATION FOR SEQ ID NO:86:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Protamine"

(xi) SEQUENCE DESCRrPTION: SEQ ID NO:86:
GCAGCTCCGC CTCCTTCGTC TGCGACTTCT II~ G CGGT M TATC TGCTCCGGCT 60 -W O 96/36362 PC~r~US96/07164 (2) INFORMATION FOR SEQ ID NO:87:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Protamine"

(xi) SEQUENCE DESCRIPTION: SEQ ID ND:87:

(2) INFORMATION FOR SEQ ID NO:88:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 59 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Protamine"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:88:

(2) INFORMATION FOR SEQ ID NO:89:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
t (D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:

W O 96/36362 P C T~US96/07164 (2) INFORMATION FOR SEQ ID NO:90:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 69 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLQGY: linear (ix) FEATURE: --(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:90:

(2) INFORMATION FOR SEQ ID NO:91:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 65 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:91:

(2) INFORMATION FOR SEQ ID NO:92:
(i) SEQUENCE CHARACTERISTICS: .-(A) LENGTH: 65 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

CA 0222l269 l997-ll-l4 txi) SEQUENCE DESCRIPTION: SEQ ID NO:92:

(2) INFORMATION FOR SEQ ID NO:93:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 75 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:
CTCCCGCGGC ACCGTGTCCC I~GGC~l~ M GCGCGAC M C CTGTACGTGG TGGCCTACCT 60 (2) INFORMATION FOR SEQ ID NO:94:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 77 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~~

(ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:94:

(2) INFORMATION FOR SEQ ID NO:95:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 78 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:95:

(2) INFORMATION FOR SEQ ID NO:96:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 76 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:96:

(2) INFORMATION FOR SEQ ID NO:97:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 74 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:97:

t2) INFORMATION FOR SEQ ID NO:98:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 68 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:
CGGCGGTCAT CTGGATGGCG ATCAGCAGGA AGCGGGCCTC GTTCTTCACC ~ CCT 60 ~ 68 (2) INFORMATION FOR SEQ ID NO:99:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 70 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:

(2) INFORMATION FOR SEQ ID NO:100:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 76 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single - (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

CA 0222l269 l997-ll-l4 W O 96/36362 PC~r~US96/07164 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100:
GGCGGATCCC AGCTGACCTC G M CTGGATC A~ l CGGAGTCGAA CTTGTTGGGG 60 (Z) INFORMATION FOR SEQ ID NO:101:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 61 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:

(2) INFORMATION FOR SEQ ID NO:102:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 64 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:102:

(2) INFORMATION FOR SEQ ID NO:103:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 58 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear i ti x) FEATURE: ~ -(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:103:

(2) INFORMATION FOR SEQ ID NO:104:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 52 base pairs (B) TYPE: nuclei c acid (C) STRANDEDNESS: singl e (D) TOPOLOGY: linear (i x) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for Mammalian Codon Preferred Saporin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:104:

(2) INFORMATION FOR SEQ ID NO:105:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nuclei c acid (C) STRANDEDNESS: si ngl e (D) TOPOLOGY: li near (ix) FEATURE:
(D) OTHER INFORMATION: /note= "Primer for SAP-6"

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:105:

(2) INFORMATION FOR SEQ ID NO:106:
(i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucl ei c acid (C) STRANDEDNESS: si ngl e (D) TOPOLOGY: linear CA 0222l269 l997-ll-l4 W O 96136362 PC~r~US96/07164 (ix) FEATURE: -(D) OTHER INFORMATION: /note= "Primer for SAP-6"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:106:
CAGG m GGA TCC m ACGT T 21

Claims (31)

1. A pharmaceutical composition comprising the formula:
receptor-binding internalized ligand nucleic acid binding domain cytocide-encoding agent, wherein:
receptor-binding internalized ligand is a polypeptide reactive with a cell surface receptor;
nucleic acid binding domain binds to a nucleic acid, the domain being conjugated or fused to the receptor-binding internalized ligand;
cytocide-encoding agent is a nucleic acid molecule encoding a cytocide, the agent being bound to the nucleic acid binding domain; and wherein the receptor-binding internalized ligand nucleic acid binding domain cytocide-encoding agent binds to the cell surface receptor and internalizes the cytocide-encoding agent in cells bearing the receptor.
2. A pharmaceutical composition comprising the formula:
receptor-binding internalized ligand-nucleic acid binding domain-prodrug-encoding agent, wherein:
receptor-binding internalized ligand is a polypeptide reactive with a cell surface receptor;
nucleic acid binding domain binds to a nucleic acid, the domain being conjugated or fused to the receptor-binding internalized ligand;
prodrug-encoding agent is a nucleic acid molecule encoding a prodrug, the agent being bound to the nucleic acid binding domain; and wherein the receptor-binding internalized ligand-nucleic acid binding domain-prodrug-encoding agent binds to the cell surface receptor and internalizes the prodrug-encoding agent in cells bearing the receptor.
3. The composition of either of claims 1 or 2 wherein the receptor-binding internalized ligand is a polypeptide reactive with an FGF receptor.
4. The composition of either of claims 1 or 2 wherein the receptor-binding internalized ligand is selected from the group consisting of a polypeptide reactive with a VEGF
receptor and a polypeptide reactive with an HBEGF receptor.
5. The composition of either of claims 1 or 2 wherein the receptor-binding internalized ligand is a cytokine.
6. The composition of claim 1 wherein the cytocide-encoding agent encodes a protein that inhibits protein synthesis.
7. The composition of claim 6 wherein the protein is a ribosome inactivating protein.
8. The composition of claim 7 wherein the ribosome inactivating protein is saporin.
9. The composition of claim 7 wherein the ribosome inactivating protein is gelonin.
10. The composition of claim 6 wherein the protein inhibits elongation factor 2.
11. The composition of claim 10 wherein the protein is diphtheria toxin.
12. The composition of claim 2 wherein the prodrug-encoding agent encodes HSV-thymidine kinase.
13. The composition of either of claims 1 or 2 wherein the growth factor is a polypeptide reactive with the FGF
receptor and the nucleic acid binding domain is poly-L-lysine.
14. The composition of either of claims 1 or 2 wherein the nucleic acid binding domain is selected from the group consisting of helix-turn-helix motif proteins, homeodomain proteins, zinc finger motif proteins, steroid receptor proteins, leucine zipper motif proteins, helix-loop-helix motif proteins, and B-sheet motif proteins.
15. The composition of either of claims 1 or 2 wherein the nucleic acid binding domain is selected from the group consisting of AP-1, Sp-1, rev, GCN4, .lambda.cro, .lambda.CI, TFIIA, myoD, retinoic acid receptor, glucocosteroid receptor, SV40 large T antigen, and GAL4.
16. The composition of either of claims 1 or 2 wherein the nucleic acid binding domain is selected from the group consisting of poly-L-lysine, protamine, histone and spermine.
17. The composition of claim 1 wherein the nucleic acid binding domain binds a DNA molecule that encodes a ribosome inactivating protein.
18. The composition of claim 1 wherein the nucleic acid binding domain binds the coding region of saporin DNA.
19. The composition of claim 1 wherein the cytocide-encoding agent further comprises a tissue-specific promoter.
20. The composition of claim 2 wherein the prodrug-encoding agent further comprises a tissue-specific promoter.
21. The composition of either of claims 19 or 20 wherein the tissue-specific promoter is selected from the group consisting of alpha-crystalline, tyrosinase, .alpha.-fetoprotein, prostate specific antigen, CEA, .alpha.-actin, VEGF receptor, erbB-2, C-myc, cyclin D, FGF receptor and gamma-crystalline promoter.
22. The composition of any one of claims 1-21, further comprising at least one linker that increases the serum stability or intracellular availability of the nucleic acid binding domain, the addition of said linker(s) resulting in the formula:
receptor-binding internalized ligand-(L)q-nucleic acid binding domain-cytocide encoding agent or the formula:
receptor-binding internalized ligand-(L)q-nucleic acid binding domain-prodrug encoding agent wherein:
L is at least one linker; and q is 1 or more, such that the conjugate retains the ability to bind to a cell surface receptor and internalize the cytocide-encoding agent or prodrug-encoding agent, and wherein the cytocide-encoding agent or prodrug-encoding agent is bound to the nucleic acid binding domain.
23. The composition of claim 22 wherein the linker increases the flexibility of the conjugate.
24. The composition of claim 23 wherein the linker is selected from the group consisting of (GlymSerp)n, (SermGlyp)n and (AlaAlaProAla)n in which n is 1 to 6, m is 1 to 6 and p is 1 to 4.
25. The composition of claim 24 wherein m is 4, p is 1 and n is 2 to 4.
26. A therapeutically effective amount of a pharmaceutical composition according to any one of claims 1, 2 or 22, for use in the manufacture of a medicament for preventing excessive cell proliferation in the eye, comprising contacting the eye with a cell proliferation-inhibiting amount, wherein:
the inhibited cells are epithelial cells, endothelial cells, fibroblast cells or keratocytes.
27. A therapeutically effective amount of a pharmaceutical composition according to any one of claims 1, 2 or 22, for use in the manufacture of a medicament for treating cancer, comprising contacting the cancer cells with an amount of the composition sufficient for inhibiting proliferation of the cancer cells.
28. A therapeutically effective amount of a pharmaceutical composition according to any one of claims 1, 2 or 22, for use in the manufacture of a medicament for treating smooth muscle cell hyperplasia, comprising contacting the smooth muscle cells with an amount of the composition sufficient for inhibiting hyperplasia of smooth muscle cells.
29. A pharmaceutical composition comprising the formula:

receptor-binding internalized ligand-cytocide-encoding agent nucleic acid binding domain, wherein:
receptor-binding internalized ligand is a polypeptide reactive with a cell surface receptor;
cytocide-encoding agent is a nucleic acid molecule encoding a cytocide, the agent being conjugated to the receptor-binding internalized ligand; and wherein the cytocide-encoding agent is bound to the nucleic acid binding domain; and wherein the receptor-binding internalized ligand-cytocide-encoding agent nucleic acid binding domain binds to the cell surface receptor and is internalized in cells bearing the receptor.
30. The composition of claim 30 wherein the nucleic acid binding domain is poly-L-lysine.
31. The composition of claim 30 wherein the receptor binding internalized ligand is a polypeptide reactive with an FGF receptor.
CA002221269A 1995-05-16 1996-05-16 Compositions containing nucleic acids and ligands for therapeutic treatment Abandoned CA2221269A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US44197995A 1995-05-16 1995-05-16
US08/441,979 1995-05-16

Publications (1)

Publication Number Publication Date
CA2221269A1 true CA2221269A1 (en) 1996-11-21

Family

ID=23755069

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002221269A Abandoned CA2221269A1 (en) 1995-05-16 1996-05-16 Compositions containing nucleic acids and ligands for therapeutic treatment

Country Status (5)

Country Link
EP (1) EP0833665A1 (en)
JP (1) JPH11505805A (en)
AU (1) AU710309B2 (en)
CA (1) CA2221269A1 (en)
WO (1) WO1996036362A1 (en)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2185671A1 (en) * 1994-03-15 1995-09-21 Prizm Pharmaceuticals, Inc. Heparin-binding growth factors for gene therapy and anterior eye disorders
US20080076706A1 (en) 1997-07-14 2008-03-27 Bolder Biotechnology, Inc. Derivatives of Growth Hormone and Related Proteins, and Methods of Use Thereof
US7495087B2 (en) 1997-07-14 2009-02-24 Bolder Biotechnology, Inc. Cysteine muteins in the C-D loop of human interleukin-11
CA2296770A1 (en) 1997-07-14 1999-01-28 Bolder Biotechnology, Inc. Derivatives of growth hormone and related proteins
US7153943B2 (en) 1997-07-14 2006-12-26 Bolder Biotechnology, Inc. Derivatives of growth hormone and related proteins, and methods of use thereof
US6537813B1 (en) 1998-02-13 2003-03-25 Selective Genetics, Inc. Concurrent flow mixing methods and apparatuses for the preparation of gene therapy vectors and compositions prepared thereby
US6903077B1 (en) 1999-01-04 2005-06-07 University Of Vermont And State Agricultural College Methods and products for delivering nucleic acids
WO2000040723A2 (en) * 1999-01-04 2000-07-13 University Of Vermont And State Agricultural College Methods and products for delivering nucleic acids
IL144259A0 (en) * 1999-01-14 2002-05-23 Bolder Biotechnology Inc Methods for making proteins containing free cysteine residues
US8288126B2 (en) 1999-01-14 2012-10-16 Bolder Biotechnology, Inc. Methods for making proteins containing free cysteine residues
EP1185304A2 (en) * 1999-06-03 2002-03-13 Bioinnovation Limited Conjugates comprising cytokines and nucleic acids for treating proliferating cells
US6506365B1 (en) * 2000-09-25 2003-01-14 Baxter Aktiengesellschaft Fibrin/fibrinogen binding conjugate
JP2002161049A (en) * 2000-11-28 2002-06-04 Terumo Corp Intimal thickening inhibitor
GB0209896D0 (en) 2002-04-30 2002-06-05 Molmed Spa Conjugate
US7270983B1 (en) * 2004-02-19 2007-09-18 Research Foundation Of The University Of Central Florida, Inc. Messenger RNA profiling: body fluid identification using multiplex reverse transcription-polymerase chain reaction (RT-PCR)
US20100003226A1 (en) * 2006-07-26 2010-01-07 Intrexon Corporation Methods and Compositions for Treating Disease
CA2796459C (en) 2010-04-16 2016-05-24 Salk Institute For Biological Studies Methods for treating metabolic disorders using fgf-1
WO2015061331A1 (en) 2013-10-21 2015-04-30 Salk Institute For Biological Studies Chimeric fibroblast growth factor (fgf) 2/fgf1 peptides and methods of use
WO2017127493A1 (en) * 2016-01-22 2017-07-27 Salk Institute For Biological Studies Fgf2 truncations and mutants and uses thereof
WO2021261996A2 (en) * 2020-06-24 2021-12-30 Sapreme Technologies B.V. Nhs-based saponin conjugates
EP4171639A2 (en) * 2020-06-24 2023-05-03 Sapreme Technologies B.V. Saponin derivatives for use in medicine
CH716377B1 (en) * 2020-08-05 2020-12-30 Contrad Swiss Sa Topical hydrogel effective in preventing and / or attenuating cartilage degeneration.

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH07507926A (en) * 1992-06-16 1995-09-07 ホイツテイアー・インステイテユート・フオー・ダイアビテイーズ・アンド・エンドクリノロジー Recombinant production of saporin-containing proteins
CA2185671A1 (en) * 1994-03-15 1995-09-21 Prizm Pharmaceuticals, Inc. Heparin-binding growth factors for gene therapy and anterior eye disorders
JPH10501963A (en) * 1994-04-15 1998-02-24 ターゲテッド ジェネティクス コーポレイション Gene delivery fusion protein
WO1996006641A1 (en) * 1994-08-29 1996-03-07 Prizm Pharmaceuticals, Inc. Conjugates of vascular endothelial growth factor with targeted agents
WO1996008274A2 (en) * 1994-09-13 1996-03-21 Prizm Pharmaceuticals, Inc. Conjugates of heparin-binding epidermal growth factor-like growth factor with targeted agents

Also Published As

Publication number Publication date
AU710309B2 (en) 1999-09-16
JPH11505805A (en) 1999-05-25
WO1996036362A1 (en) 1996-11-21
EP0833665A1 (en) 1998-04-08
AU5862896A (en) 1996-11-29

Similar Documents

Publication Publication Date Title
US6503886B1 (en) Compositions containing nucleic acids and ligands for therapeutic treatment
AU710309B2 (en) Compositions containing nucleic acids and ligands for therapeutic treatment
AU702323B2 (en) Heparin-binding growth factors for gene therapy and anterior eye disorders
WO1996006641A1 (en) Conjugates of vascular endothelial growth factor with targeted agents
US6054312A (en) Receptor-mediated gene delivery using bacteriophage vectors
AU767195B2 (en) Delivery of substances to cells
WO1996008274A2 (en) Conjugates of heparin-binding epidermal growth factor-like growth factor with targeted agents
US6855688B2 (en) ADP-ribosyl transferase fusion proteins, pharmaceutical compositions, and methods of use
HU218716B (en) Systems for transport of nucleic acids, process for their production and their transport to cells
CA2168647A1 (en) Monogenous preparations of cytotoxic conjugates
US20040110928A1 (en) Peptide conjugates for drug delivery
US20040213797A1 (en) Conjugates for the modulation of immune responses
US20030040496A1 (en) Methods for halting unwanted cell growth, such as using ligand-directed nucleic acid delivery vehicles
EP0923387B1 (en) Heparin-coated medical devices for intravenous use containing heparin-binding growth factor conjugates
WO1997049434A9 (en) Heparinized medical devices containing heparin-binding growth factor conjugates
CA2198361A1 (en) Intracellular delivery of chemical agents to a specific cell type
CA2342970A1 (en) Fusion proteins

Legal Events

Date Code Title Description
EEER Examination request
FZDE Dead