JPH11505805A - Compositions containing nucleic acids and ligands for therapeutic treatment - Google Patents

Abstract

  (57) [Summary] Preparations of conjugates of a receptor-binding internalized ligand and a cell killing factor-encoding substance, and compositions containing such preparations are provided. The conjugate contains a polypeptide (e.g., bFGF or other heparin-binding growth factor, cytokine, or growth factor) reactive with an FGF receptor, linked to a nucleic acid binding domain. One or more linkers may be used in the linkage. The linker is selected to increase specificity, toxicity, solubility, serum stability, or cellular availability, and to promote nucleic acid condensation of the targeting moiety. The conjugate is complexed with a cell killing factor-encoding substance, such as DNA encoding saporin. Binding of a receptor binding internalized ligand to a nucleic acid molecule is also provided.

Description

DETAILED DESCRIPTION OF THE INVENTION           Compositions containing nucleic acids and ligands for therapeutic treatmentTechnical field   The present invention generally relates to the treatment of disease, and more particularly, to the treatment of cells in a therapeutic manner. Receptor binding internals for altering function, gene expression or viability Preparation of Complex Containing Rising Ligand NABD and Cell Killing Factor Encoding Substance And use.Background of the Invention   The primary goal of treating neoplastic and hyperproliferative disorders is to touch normal cells Is to remove abnormally growing cells. Various methods provide treatment But are not under development to provide the required degree of specificity.   One method of treatment is to provide a toxin. Immunotoxins and cytotoxins Between the toxin molecule and either an antibody or a factor that binds to a receptor on the target cell It is a protein conjugate. Three major problems can limit the usefulness of immunotoxins. First, antibodies can react with more than one cell surface molecule, thereby causing multiple cells Resulting in delivery to the mold, possibly including normal cells. Second, even if the antibody is specific Even though the antibody-reactive molecule can be present on normal cells. Third, toxin molecules Can be toxic to cells prior to delivery and internalization. Fine Vesicle toxins suffer from similar disadvantages of specificity and toxicity. Of immunotoxins and cytotoxins Another limitation in therapeutic use is the relatively low therapeutic dose versus toxic dose It is a ratio. In addition, a sufficient concentration of toxin is required to ensure that the drug exerts its desired activity. Directing to the resulting cytoplasm and subcellular fraction can be difficult.   Given these limitations, cytotoxic therapies transfer DNA encoding the toxin into cells. Have been attempted using viral vectors to deliver to Currently used If eukaryotic viruses such as retroviruses are used, they will Can recombine with A to give an infectious virus. In addition, retroviral vectors , Limited in vivo use, often inactivated by complement system . Retroviral vectors also lack specificity in delivery; A large percentage, if not all, of the receptors for the Lus vector Present on. Therefore, infection with such a viral vector is the same as that of abnormal cells. Normal cells as described above. Because of this general mechanism of infection, viral vectors It is not desirable to encode the cytotoxic molecule directly.   Nucleic acid delivery may result in cytotoxicity such as reduced toxicity prior to internalization Provides benefits for delivery of soluble proteins, but is not available in current systems There is a need for high specificity of delivery.   More effective in terms of issues related to gene therapy, and such There is a strong need for improved treatments without disadvantages. The present invention relates to other It has increased specificity and provides more target cells, while providing related benefits. Develop the use of a conjugate to deliver an amount of nucleic acid.Summary of the Invention   The present invention generally provides for therapeutic compositions. In one aspect, the composition The product has the formula: receptor binding internalized ligand-nucleic acid binding domain-cell A death factor-encoding substance. Receptor binding internalized ligands A polypeptide that is reactive with cell surface receptors and has a nucleic acid binding domain Binds, the cell killing factor-encoding substance encodes a cell killing factor, and A nucleic acid molecule that binds to the main and the composition binds to a cell surface receptor. And intercalates the cell killing factor-encoding substance into cells having the receptor. Narize. In another aspect, the composition has the formula: Narizing ligand-nucleic acid binding domain (comain) -prodrug-encoding substance, Having.   In certain embodiments, the receptor binding internalizing ligand is FG Reactive with F receptor, VEGF receptor, HBEGF receptor, or cytokine Is a polypeptide. In another embodiment, the cell killing factor-encoding substance is Inhibits protein synthesis and preferably ribosome-inactivating proteins, most preferably Preferably, it encodes a protein that is a saporin. This protein is used in other In embodiments, it is gelonin or diphtheria toxin. In other embodiments, The prodrug-encoding substance encodes HSV-thymidine kinase.   The nucleic acid binding domain is, in one embodiment, poly-L-lysine. other In embodiments, the nucleic acid binding domain is a helix-turn-helix motif. Protein, homeodomain protein, zinc finger motif protein Quality, steroid receptor protein, leucine zipper motif protein, Helix-loop-helix motif proteins and β-sheet motifs It is a transcription factor selected from the group consisting of proteins. In another embodiment, the core The acid binding domain binds nucleic acid non-specifically, and poly-L-lysine, protamine , Histones and spermidine. In a preferred embodiment In addition, the nucleic acid binding domain is a ribosome-inactivating protein such as saporin Bind to coding region. In another preferred embodiment, FGF is attached to poly-L-lysine. Be combined.   In yet another embodiment, the cell killing factor-encoding substance is α-crystallized. Γ-crystallin, α-fetoprotein, CEA, prostate specific antigen, erbB-2, Tyrosinase, α-actin, c-myc, VEGF receptor, FGF receptor or cytochrome Contains a tissue-specific promoter, such as Clin D.   In another aspect, the composition also contains a linker. In various embodiments, The linker increases the flexibility of the conjugate and (Gly_mSer_p)_n, (AlaAlaProAla)_nso Where n is 1-6, m is 1-6, and p is 1-4 Or the linker is a disulfide bond.   In yet another aspect, the composition has the formula: Gand-a cell killing factor-encoding substance-a nucleic acid binding domain, wherein the receptor Is bound to a cell killing factor-encoding substance and The vesicle killing factor-encoding substance binds to the nucleic acid binding domain to form a complex.   In another aspect, the invention is directed to preventing excessive cell proliferation in the anterior eye after surgery Treatment of corneal turbidity after excimer laser surgery, closure of travel ectomy Prevent chains, prevent pterygium recurrence, macular degeneration, diabetic retinopathy and proliferative vitreous network film Hyperproliferative after eyes like proliferative virtreal retinopathy For treatment of disease, procedures (eg, vein transplantation, endarterectomy and arteriovenous shunt) Treatment of smooth muscle cell hyperplasia after wound healing response to Provide a way to: In these aspects, an effective amount of the composition is administered. You.BRIEF DESCRIPTION OF THE FIGURES   Figure 1 shows SDS-PAGE of FGF2-K152 under non-reducing (left) and reducing (right) conditions. It is a photograph of. Lane 1, FGF2-K152; Lane 2, FGF2; Lane 3, FGF2-K152; Lane 4, FGF2. White arrows indicate substances that cannot enter the gel. Black arrows correspond to FGF2 2 shows protein bands.   Figure 2 shows bovine motility in response to FGF2 (closed squares) and FGF2-K152 (open circles) conjugates 4 is a graph showing proliferation of vascular endothelial cells.   FIG. 3 shows the effect of various lengths of poly-L-lysine on the ability to interact with DNA. It is a photograph of the gel shown. 35 ng of labeled DNA was added to increasing concentrations of either FGF2 or FGF2-K Lane 1, 0 ng; lane 2, 0.1 ng; lane 3, 1 ng; lane 4 Lane 5, 20 ng; lane 6, 35 ng; lane 7, 100 ng. Panel A: FGF2; Panel B, FGF2-K152; Panel C, FGF2-K13; Panel D, FGF2-K84; Panel E, E GF2-K267; panel F, FGF2-K39. Shows the length of digested DNA.   Figure 4 shows the transfection of FGF2 / poly-L-lysine / DNAβ-gal into COS cells. 4 is a chart showing the activity of β-gal after the activation. Lane 1, FGF2 / poly- for DNA Lanes 2, 5: 1 ratio; lanes 3, 2; 10: 1 (w / w) ratio of L-lysine conjugate; Lane 4, 1: 1 ratio; lane 5, 0.5: 1 ratio. The five bars are (left To right), FGF2, FGF2-K13, FGF2-K39, FGF2-K84, and FGF2-K152.   FIG. 5 is a toroid style photograph observed by an electron microscope. Upper panel Shows examples of toroids; lower panel shows incomplete toroids.   FIG. 6 is a graph showing the proliferation of bovine aortic endothelial cells. In the upper panel , Cells were treated with FGF2-K152-DNA; in the lower panel, cells were treated with FGF2, K152 and And a mixture of DNA.   FIG. 7A shows COS cells of FGF2 / poly-L-lysine / pSVβ-gal (lane 1), B16 cells (Lane 2), NIH 3T3 cells (lane 3), and BHK cells (lane 4). It is a graph which shows (beta) -gal activity after transfection.   FIG. 7B is a graph showing β-gal expression in COS cells. 1 and 3) or pNASSβ-gal (lanes 2 and 4) together with FGF2-K84 (lane 1 2) or incubated without FGF2-K84 (lanes 3, 4) and complex Was incubated on COS cells for 48 hours.   FIG. 7C shows either the plasmid alone or the FGF2 / K84 / pSβ-gal complex. Showing the activity of β-gal activity at various time points after transfection It is. -Δ-, DNA alone;-■-, FGF2-K84-DNA.   FIG. 7D shows β-g after transfection of various concentrations of FGF2 / K84 / pSVβ-gal. It is a graph which shows al activity. Lane 1, 0 μg; Lane 2, 0.1 μg; Lane 3, 1 μg Lane 4, 5 μg; lane 5, 10 μg.   FIG. 8A shows FGF2-K84-pSVβ-gal (lane 1), FGF2 + K84 + pSVβ-gal (lane 1). 2), FGF2 + pSVβ-gal (lane 3), K84 + pSVβ-gal (lane 4); pSVβ-gal (Lane 5), FGF2-K84 (lane 6), FGF2 (lane 7) and K84 (lane 8) FIG. 7 is a graph showing β-gal activity in COS cells after transfection of FIG. .   FIG. 8B is a graph showing completion for cell binding. Lane 1, COS cells FGF2-K84-pSVβ-gal complex transfected into; lane 2, FGF2-K84-pSV β-gal + 100 μg FGF2; lane 3, no complex.   FIG. 8C shows β-gal activity upon addition of heparin during transfection. 6 is a graph showing the attenuation of the graph. Lane 1, FGF2-K84-pSVβ-gal + 10 μg heparin; Lane 2, FGF2-K84-pSVβ-gal; Lane 3, heparin alone; Lane 4, pSVβ-ga l alone.   FIG. 8D is a graph showing ligand targeting of DNA, showing that pSVβ-galDNA alone (R 1), FGF2-K84 (lane 2), histone H1-K84 (lane 3) and cytochrome C-K84 (lane 4) was condensed with pSVβ-gal DNA and added to BHK cells. β-gal activity was measured after 48 hours.   FIG. 9A is a graph showing the effect of chloroquine on β-gal expression, where pSVβ- gal and FGF2-K84 in the absence (lane 1) or presence of 100 μM chloroquine (lane 1) Mix in lane 2) and incubate for 1 hour at room temperature before adding the complex to COS cells. Incubated. Lane 3, chloroquine alone; lane 4, DNA alone.   FIG. 9B is a graph showing the effect of endosomal disrupting peptides on β-gal expression. It is. Lane 1, control; Lane 2, FGF2-K84-pSVβ-gal; Lane 3, FGF2-K84-pSVβ-gal + EDP.   FIG. 9C shows (Right panel) the endosomal disrupting peptide and FGF2-K84-pSVβ-gal. After transfection of COS cells with or without (left panel) 1 is a photograph of a cell stained for β-gal activity.   FIG. 10 is a photograph of a fluorograph analyzing cell-free translation products. Lane 1, No RNA; lane 2, saporin RNA; lane 3, luciferase RNA; lane 4, Saporin RNA and luciferase RNA; lane 5, saporin RNA and after 30 With luciferase RNA.   FIG. 11 shows an expression vector encoding saporin CaPO._FourBy transfect 4 is a graph showing the direct cytotoxicity of isolated cells. Lane 1, mock transfer Lane 2, transfection with pSVβ-gal; lane 3, sapoli Transfection with a nin-containing vector.   FIG. 12 is a graph showing the cytotoxicity of cells transfected with FGF2-K84-pSVSAP. It is rough. Left panel, BHK21 cells; right panel, NIH 3T3 cells. Lane 1, FGF2-K 84-pSVβ-gal; lane 2, FGF2-K84-pSVSAP.   FIG. 13A is a graph showing β-gal activity with endosomal disrupting peptides in the complex It is.   FIG. 13B is a graph showing β-gal activity with endosomal disrupting peptides in the complex. It is.   FIG.13C is a graph showing β-gal activity with endosomal disrupting peptides in the complex It is.Detailed description of the invention Definition   All U.S. patents and publications mentioned herein are hereby incorporated by reference. The whole is used.   The “amino acids” present in the various amino acid sequences that appear herein are their amino acids. Shown in well-known three-letter or one-letter abbreviations. Nuku present in various DNA fragments Leotide is indicated by the standard single letter designation routinely used in the art.   As used herein, "binding to a receptor" refers to a standard in vitro assay. Specifically recognizes and recognizes such receptors as assayed by The ability of a ligand to releasably bind. For example, as used herein, See Moscatelli, J .; Cell Physiol. 131: 123-130, 1987 Qualitatively, using VEGF receptors on vascular endothelial cells, such as the aortic vascular endothelial cell line The ability of the VEGF conjugate, VEGF monomer, or VEGF dimer to recognize is measured.   As used herein, "biological activity" refers to the in vivo activity, or compound, of a compound. Physiological response obtained upon in vivo administration of a substance, composition or other mixture. U. Thus, the biological activity of such compounds, compositions, and mixtures may be therapeutic. Including effects and pharmacological activity. Such biological activity can be measured in defined assays Can be defined with reference to the specific in vitro activity measured in. For example, this specification In mentioning the biological activity of FGF or FGF fragments in FGF Ability to bind to GF receptor-bearing cells and internalize linked factors Say. Such activity is typically associated with FG to cytotoxic factors such as saporin. F and bind cells with FGF receptors, such as fibroblasts, to the conjugate. And assessed in vitro by assessing cell proliferation or growth. I In vivo activity is recognized as a mouse xenograft model for antitumor activity Can be determined using animal models (see, eg, Beitz et al., Cancer Research 52). : 227-230, 1992; Houghton et al., Cancer Res. 42: 535-539, 1982; Bogden et al., Cancer. r (Philadelphia) 48: 10-20, 1981; Hoogenhout et al., Int. J. Radiat. Oncol. Biol . Phys. 9: 871-879, 1983; Stastny et al., Cancer Res. 53: 5740-5744, 1993).   As used herein, a "cell killing factor" such as DNA encoding saporin References to "the biological activity of a code substance" imply that such substances inhibit protein synthesis. The ability to interfere with the metabolism of cells by harming. Such biological and Is a cytotoxic activity, in vitro assay to measure protein synthesis and cell By measuring the effect of a test compound on growth or protein synthesis One of skill in the art, including but not limited to in vivo assays for assessing cytotoxicity Can be assayed by any method known in the art. Cell wounds in targeted cells Assays for assessing harm are particularly preferred.   As used herein, a “conjugate” is directly or via a linker, And by chemical coupling methods or to produce fusion proteins At least one receptor produced by recombinant expression of a chimeric DNA molecule of -Internalized binding ligand and at least one nucleic acid binding domain Refers to a molecule that contains   “Cell killing factor-encoding substance” refers to a protein that inhibits protein synthesis. The nucleic acid molecule to be loaded. Such proteins can be rRNA or ribonucleoprotein By cleaving quality, inhibiting elongation factors, cleaving mRNA, or By other mechanisms that reduce protein synthesis to levels that make it unviable. Can work. Cell killing factor-encoding substances are additional to the cell killing factor gene. May be contained. Such elements include promoters, enhancers, Price site, transcription terminator, poly (A) signal sequence, bacterial or mammalian It can include an origin of animal replication, a selectable marker, and the like.   As used herein, the term “cytotoxic factor” refers to a molecule that can inhibit cell function. U. This factor can inhibit proliferation or be cytotoxic to cells . A variety of cytotoxic factors can be used, which inhibit protein synthesis And the expression of certain genes essential for cell growth or survival Including things. Cytotoxic factors cause cell death, as well as cell growth, proliferation and And / or those that inhibit differentiation.   As used herein, cytotoxic agents include saporin, ricin, abrin and other Ribosome-inactivated protein (RIP), aquatic cytotoxin, pseudomo Inhibitors of eggplant exotoxin, DNA, RNA or protein synthesis (eg, Nucleic acids), other metabolic inhibitors (eg, DNA-cleaving molecules), prodrugs (eg, For example, thymidine kinase from HSV and bacterial cytosine deaminase), and And light activated porphyrins. Saporin is preferred RIPs, but other suitable RIPs are ricin, ricin A chain, corn RIP, Lonin, diphtheria toxin, diphtheria toxin A chain, tricosanthin, tritin, Pokeweed antiviral protein (PAP), mirabilis Lus protein (MAP), Dianthin 32 and 30, Abrin, Mono Catalytic activity of protein biosynthesis from luzin, bryodin, shiga and cucumber seeds Inhibitor (see, for example, WO 93/24620), Pseudomonas exotoxin, cytotoxic Biologically active fragments, and others known to those skilled in the art. Suitable Sensitive cytotoxic factors also include transcription, translation, biosynthesis or degradation pathways, DNA synthesis, Kills cells, inhibits cell metabolic processes, including and other such processes Or a cytotoxic factor that inhibits cell growth.   "Heparin-binding growth factor" refers to a heparin-binding growth factor protein protein. Any member of Millie, where at least one member of this family Members bind to heparin. Preferred growth factors in this regard are FGF, VEG F, and HBEGF. Such growth factors are isoforms, family members Peptide fragments, splice variants, and single or multiple Some forms, including exon, may not bind to heparin.   As used herein, "hybridizing" under certain stringency conditions "Depending on" refers to the stability of a hybrid formed between two single-stranded nucleic acid molecules. Used to describe. The stringency of hybridization is Typically, the ionic strength at which such hybrids are annealed and washed and Expressed in terms of temperature. Typically, high, medium and low stringers Includes the following or equivalent conditions:   1) High stringency: 0.1 × SSPE or SSC, 0.1% SDS, 65 ° C   2) Medium stringency: 0.2 x SSPE or SSC, 0.1% SDS, 50 ° C   3) Low stringency: 1.0 × SSPE or SSC, 0.1% SDS, 50 ° C.   "Nucleic acid binding domain" (NABD) refers to the binding of a nucleic acid (eg, DNA or RNA) Molecule, usually a protein, polypeptide, or peptide (but Can be a cation). NABD is an RNA or DNA or mixed RNA / DNA hybrid. Can bind to a single or double strand. Nucleic acid binding domains bind to specific sequences Or can bind independently of the sequence.   As used herein, “nucleic acid” refers to internalization of cells. Refers to intended RNA or DNA, DNA encoding a therapeutic protein, cytotoxicity DNA encoding a sex protein, DNA encoding a prodrug, and cell killing factor Encoding DNA, the complement of these DNAs, antisense nucleic acids, and other such But not limited to these. References to nucleic acids refer to double-stranded DNA, single-stranded D NA, any form of RNA (including triple-, double- or single-stranded RNA), antisense RNA, polynucleotide, oligonucleotide, single nucleotide, chimera, And its derivatives.   Nucleic acids are bases adenosine, cytosine, guanine, thymidine, and uridine Consists of well-known deoxyribonucleotides and ribonucleotides obtain. Similarly, various other nucleotide derivatives and non-phosphate backbones or phosphates Derivative backbones can be used. For example, a normal phosphodiester oligonucleotide (Referred to as PO oligonucleotides) is a DNA- and RNA-specific nuclease The phosphate groups are phosphotriesters, methylphosphonates, or Or several types of resistant oligonucleotides modified to phosphorothioates (See U.S. Pat. No. 5,218,088).   As used herein, regulation of nucleotides and effector sequences of heterologous DNA (eg, Eg, promoters, enhancers, transcription and translation stop sites) A "linkage" or operable association is defined as such DNA and such nucleotide sequences. Refers to the functional relationship between For example, operable linkage of heterologous DNA to a promoter This means that the transcription of such DNA specifically recognizes this DNA, binds to it, and RNA polymerase that transcribes this DNA in the reading frame Physical and functional between the DNA and promoter, such as those initiated from the promoter A relationship.   As used herein, the term "a polypeptide reactive with an FGF receptor" refers to an FGF receptor. Specifically interacts with a high-affinity FGF receptor, Any polypeptide that is transported into cells by its interaction with . Polypeptides that are reactive with the FGF receptor are also called FGF proteins. Such polypeptides include, but are not limited to, FGF-1 to FGF-9. For example, bFGF (FGF-2) is an amino acid substantially identical to bovine bFGF or human bFGF. Generally speaking, polypeptides having sequence and receptor targeting activity Should be understood. Amino acid sequence differences differ between different species of FGF, as well as It is understood that there may be between FGFs from individual organisms or species. In addition, FGF-1 A chimera or hybrid of any of FGF-9 to FGF-9, or amino acid deletion (eg, For example, PCT Application No. WO 90/02800), FGFs with insertions or substitutions are The peptide or protein specifically interacts with the FGF receptor and this phase As long as they are internalized by interaction, they are within the scope of the FGF protein.   As used herein, "prodrug" refers to an inert, non-toxic compound, Biologically, pharmaceutically, or therapeutically toxic of the compound Otherwise, it is a compound that converts. Prodrugs may also be modified upon administration. Pharmaceutically inactive to produce the active compound via metabolic or other processes It can be a compound. Prodrugs modify the metabolic stability or transport characteristics of a drug, Mask side effects or toxicity and improve or modify other features or properties of the drug You. With knowledge of pharmacodynamic processes and drug metabolism in vivo, one of skill in the art Once a pharmaceutically active compound has been identified, designing the inactive form of the compound (Eg, Nogrady, Medicinal Chemistry A Biochemical Approach, Ox ford University Press, New York, pp. 388-392, 1985).   As used herein, the term "receptor binding internalized ligand" or "Gand" means any that can bind to a cell surface molecule and is internalized A peptide, polypeptide, protein, or non-protein (eg, pepti Mockup). In the context of the present invention, receptor binding internalization Ligating ligand, either as a fusion protein or via chemical linkage A cell killing factor-encoding substance or prod attached to the nucleic acid binding domain Used to deliver rag code material to cells. In one aspect, the ligand Is directly bound to the nucleic acid molecule, which is further complexed with the nucleic acid binding domain. Can be done. Such ligands may be growth factors, cytokines, antibodies or their flags. And hormones.   As used herein, “saporin” (abbreviated as SAP in this specification) Isolated from the leaves or seeds of Saponaria officinalis Polypeptide still expresses substantial ribosome inactivating activity A modified form having an amino acid substitution, deletion, insertion or addition. Saporin spirit Observed preparations often contain several molecular isoforms of the protein Is done. Amino acid sequence differences occur in saporins from different species, as well as in It is understood that there may be one type of saporin molecule from an individual organism. This specification Can the Saporins Used in the Book be Purified from Leaves or Synthesized Chemically? Or by expression of a DNA encoding a saporin polypeptide.   As used herein, “targeting factor” refers to a receptor-binding internalization reagent. Intended for internalization by conjugation or ligation to gand And in several ways, during internalization, cell metabolism, Alter growth, activity, viability, or other properties or characteristics of the cell; or A nucleic acid molecule that affects it.   As used herein, "therapeutic nucleic acid" refers to a book that alters the transcription or translation of a gene. Any nucleic acid molecules used in the context of the invention are described. This term also , Nucleic acids that bind to sites on the protein. It contains the following types of nucleic acids: But not limited to: nucleic acids encoding proteins, antisense RNA , DNA intended to form triplex molecules, extracellular protein binding oligos Nucleotides, and small nucleotide molecules. Therapeutic nucleic acids are alternatives to defective genes By encoding a therapeutic product such as TNF Or by encoding cytotoxic molecules, especially enzymes such as saporin. Can be used to perform gene therapy. Therapeutic nucleic acids can contain all or one of the genes. Part can be encoded and recombined with DNA already present in the cell, thereby May work by replacing the defective part. It is also one of protein Part can be encoded and exert its effect by co-suppression of the gene product.      Receptor binding internalized ligand, nucleic acid binding domain,                 Of cell and cell killing factor-encoding substance complex   As described above, the present invention provides a receptor binding internalized ligand and Provide a cell killing factor-encoding substance complexed with a conjugate of a nucleic acid binding domain . Upon binding to the appropriate receptor, the complex is internalized by the cell. And move back and forth through the endosomal compartment, where less complex is present. At least some can be cut off.A. Receptor-binding internalized ligand   As described above, the receptor-binding internalized ligand is located on its cell surface. To deliver a cell killing factor-encoding substance to cells expressing the appropriate receptor thereon Used for A number of molecules that bind to specific receptors have been identified and These are suitable for use in the present invention. Such molecules include growth factors, sites Including Cain and antibodies. Many growth factors and growth factor families are structural And share functional features and can be used in the present invention. One such growth factor The family specifically binds to heparin. Heparin-binding growth factor is heparin The ability to interact with is generally found on the cell surface and extracellular matrix. In vivo between these factors and heparin sulfate proteoglycan molecules. It seems to be a reflection of the more physiologically relevant interactions that occur. Heparin knot Competitive growth factors include fibroblast growth factors FGF-1 through FGF-9, vascular endothelial growth factor ( VEGF), and heparin-binding epidermal growth factor (HBEGF). Selected cells Antibodies specific for cell surface molecules expressed by the type can be monoclonal or Is readily produced as a polyclonal antiserum. Many such antibodies are available (Eg, American Type Culture Collection, Rockville, MD). PDGF ( Platelet-derived growth factor), EGF (epidermal growth factor), TGF-α (tumor growth factor), TGF- Other growth factors such as β, IGF-I (insulin-like growth factor), and IGF-II It binds to specific identified receptors on the cell surface and can be used in the present invention. I Including interleukin, CSF (colony stimulating factor), and interferon Itokine has specific receptors found primarily on hematopoietic cells, It can be used as described in the textbook. These ligands are described in more detail below. Put on.   Fragments of these ligands are useful when the fragments bind to the appropriate cell surface molecule. It can be used within the present invention as long as it retains the ability to combine. Similarly, substitutions or other modifications Modified ligands that retain binding ability may also be used.1. Fibroblast growth factor   One family of growth factors with a broad spectrum of activity is fibroblast proliferation. Factor (FGF) family. These proteins have the ability to bind to heparin. Shares the power of intracellular receptor-mediated tyrosine phosphorylation and c-fos mRNA transcripts Induces expression and stimulates DNA synthesis and cell growth. This protein fa Millie was able to obtain FGF-1 (acidic FGF (aFGF)), FGF-2 (basic FGF (bFGF)), FGF-3 (i nt-2) (see, eg, Moore et al., EMBO J. 5: 919-924, 1986), FGF-4 (hst-1 / K-FGF (Eg, Sakamoto et al., Proc. Natl. Acad. Sci. USA 86: 1836-1840, 1986; US Pat. No. 5,126,323), FGF-5 (see, eg, US Pat. No. 5,155,217) , FGF-6 (hst-2) (see, eg, published European Application EP 0 488 196 A2; Uda et al., Oncog. ene 7: 303-309, 1992), FGF-7 (keratinocyte growth factor) (KGF) (for example, Finch et al., Science 245: 752-755, 1985; Rubin et al., Proc. Natl. Acad. Sci. US A 86: 802-806, 1989; and International Application WO 90/08771), FGF-8 (eg, Tana ka et al., Proc. Natl. Acad. Sci. USA 89: 8528-8532, 1992), and FGF-9 (M iyamoto et al., Mol. Cell. Biol. 13: 4251-4259, 1993).   The DNA encoding the FGF peptide and / or the amino acid sequence of FGF may be It is known. DNA encoding FGF is based on a known amino acid or DNA sequence. Can be prepared synthetically, isolated using methods known to those skilled in the art, or Can be obtained commercially or from other sources. Virtually any FGF peptide family DNA encoding Lee is known. For example, DNA encoding human FGF-1 (Jay e et al., Science 233: 541-545, 1986; U.S. Patent No. 5,223,483), bovine FGF-2 (Abra ham et al., Science 233: 545-548, 1986; Esch et al., Proc. Natl. Acad. Sci. USA 82: 6507-6511, 1985; and U.S. Patent No. 4,956,455), human FGF-2 (Abraham et al., EMB). O J. 5: 2523-2528, 1986; U.S. Patent No. 4,994,559; U.S. Patent No. 5,155,214; EP  470,183B; and Abraham et al., Quant. Biol. 51: 657-668, 1986) and rat FG DNA encoding F-2 (Shimasaki et al., Biochem. Biophys. Res. Comm, 1988, and And Kurokawa et al., Nucleic Acids Res. 16: 5201, 1988), FGF-3, FGF-6, FGF-7 And FGF-9 are known (US Pat. No. 5,155,214; US Pat. No. 4,956,455). No. 5,026,839; US Pat. No. 4,994,559, EP 0,488,196 A2, DNAST (See also AR, EMBL or GenBank databases and references mentioned above and below) . FGF-encoding DNA is modified by replacing the degenerate codons Can be produced from any of the Once a complete peptide such as the FGF peptide Amino acid sequences and DNA fragments encoding such peptides are known in the art. If available, replace degenerate codons and encode such peptides It is understood that producing any of the unique DNA fragments is routine. It is. Based on the amino acid sequence, DNA encoding such a peptide is synthesized. It is also generally possible.   Therefore, the term “FGF” used herein refers to the amino acid sequence of a natural FGF protein. Polypeptides, as well as amino acid substitutions, deletions, and insertions in native proteins Or the ability to bind to and internalize FGF receptors Refers to a polypeptide having a modified sequence that retains power. Amino acid sequence differences Between certain FGFs, as well as between FGFs from individual organisms or species. Understood.   Reference to FGF refers to proteins isolated from natural sources, as well as recombinant means. Protein produced synthetically, or possibly by chemical synthesis It is intended to include quality. FGF also has the ability to bind to FGF receptor expressing cells Also contains muteins. Such muteins are described herein. Produced by replacing one or more cysteines with serine, or Indicates that the resulting protein binds to FGF receptor-bearing cells and is linked to a targeting factor Deletion of any other amino acid, as long as it has the ability to internalize Including, but not limited to, permutations. Typically, such In has conservative amino acid changes as described in Table 1. Such a mute DNA that encodes a sequence, if not altered by replacement of degenerate codons. At least under conditions of low stringency, the native DNA sequence encoding the starting FGF may To hybridize.   Acidic and basic FGFs are about 55% identical at the amino acid level, and Highly preserved. Other members of the FGF family include one or more FGF receptors. High degree amino acid sequences with FGF-1 and FGF-2, including the ability to bind It has similarities and common physical and biological properties. Basic FGF, int-2, hst- 1 / K-FGF, FGF-5, hst-2 / FGF-6, and FGF-8 may have oncogenic potential; Expressed in norma, int-2 is expressed in mammalian tumor virus, and hst-1 / K-F GF is expressed in angiogenic tumors. Acidic FGF, bFGF, KGF, and FGF-9 are normal It is expressed in cells and tissues.   FGF exerts mitogenic effects on a wide range of mesenchymal, endocrine, and neuronal cells And is also important in differentiation and development. Of particular interest is the collateral vessel shape Their stimulatory effect on formation and angiogenesis. In some cases, FGF Induced mitogenic stimuli can be detrimental. For example, cell proliferation and angiogenesis This is an integrated phase of growth. Members of the FGF family, including bFGF, For example, tumor development, rheumatoid arthritis, proliferative diabetic retinopathy, and other diabetic complications It is thought to play a pathological role in the disease.   The effect of FGF is based on the high-affinity receptor tyrosine on the cell surface of FGF-responsive cells. (E.g., PCT WO 91/00916, WO 90/05522, PCT W O 92/12948; Imamura et al., Biochem. Biophys. Res. Comm. 155: 583-590, 1988; H uang et al. Biol. Chem. 261: 9568-9571, 1986; Partanen et al., EMBO J. 10: 1347 1991; and Moscatelli, J. et al. Cell. Physiol. 131: 123, 1987). Lower Affinity receptors also appear to play a role in mediating FGF activity. You. The high affinity receptor protein is a family of structurally related FGF receptors. One with a molecular weight in the range of 110-150 kDa, depending on the cell type that makes up the milly Chain polypeptide. Four FGF receptor genes have been identified, and Three of these genes are responsible for alternative splicing of the primary transcript. To generate multiple mRNA transcripts.2. Vascular endothelial cell growth factor   Vascular endothelial cell growth factors (VEGF) directly stimulate endothelial cell growth Identified by ability but has no mitogenic effect on other cell types It seems. VEGF also causes a rapid and reversible increase in vascular permeability You. Members of this family include vascular endothelial growth factor (VEGF), vascular permeability Factor (VPF), and vasculotropin (eg, Plouet et al., EMBO J. 8: 3801-3). 806, 1989). In the present specification, they are collectively referred to as VEGF That.   VEGF was originally isolated from guinea pig hepatoma cell line 10 (see, eg, US Pat. No. 4,456,550), and subsequently were identified in human and normal cells. So It is expressed during normal development and in certain normal adult organs. Refined VEGF is a heat-stable and acid-stable salt that can be inactivated by a reducing agent. It is a basic heparin-binding homodimer glycoprotein.   DNA sequences encoding VEGF and methods for isolating these sequences are primarily U.S. Pat.No. 5,240,848, U.S. Pat.No. 5,332,671, U.S. Pat. No. 5,194,596 and Houch et al., Mol. Endocrin. 5: 180, found in 1991 obtain. "DNA encoding VEGF peptide or polypeptide" as used herein Means any of the DNs described herein as encoding such a peptide A fragment, any such DNA fragment, VEGF Any encoding VEGF that binds to the scepter and is thereby internalized DNA fragment. VEGF DNA is, for example, a conventional DNA fragment As a probe, or the VEGF peptide described in SEQ ID NOs: 1-4. Human DNA lines with any DNA fragment encoding any of the Can be isolated. Once the complete amino acid of a peptide such as VEGF peptide Acid sequences and DNA fragments encoding such peptides are available to those of skill in the art. If possible, replace the degenerate codons and possible DNs encoding such peptides It is understood that producing any of the A fragments is routine . Based on the amino acid sequence, DNA encoding such a peptide can be synthesized. Once again, it is generally possible.   VEGF family members are organized as eight exons in the human genome And results from a single gene spanning approximately 14 kb. The four molecular species of VEGF are arising from alternative splicing of mRNA and 121, 165, 189, and 2 Contains 06 amino acids. Although the four species have similar biological activities, Notably different in lactation patterns. Secreted by various normal and transformed cells VEGF is the predominant isoform₁₆₅It is. VEGF₁₂₁And VEGF₁₈₉Transcription to code The body is detectable in most cells and tissues that express the VEGF gene. Contrast , VEG₂₀₅Not very abundant, identified only in human fetal liver cDNA library Have been. VEGF₁₂₁Lacks the heparin binding domain and, as a result, Is a weakly acidic polypeptide that does not bind to VEGF₁₈₉And VEGF₂₀₆Is VEGF₁₆₅Yo Is more basic and binds heparin with greater affinity. Identified Not all VEGF isoforms bind to heparin, but all isoforms It is considered in the context of the invention to be a heparin binding growth factor.   VEGF is a secreted isoform₁₂₁And VEGF₁₆₅Is the preferred VEGF protein It is. VEGF is a longer isoform₁₈₉And VEGF₂₀₆Is the extracellular matrix Binds almost completely to suramin, heparin or heparinase, or It must be released by a substance such as sumin. Other preferred VEGF proteins The quality is that the protein still binds to the VEGF receptor and is As such, it contains various combinations of VEGF exons. Used in the context of the present invention VEGF protein has any in vivo biological activity, such as endothelial cell growth stimulation There is no need to carry or bind to heparin. VEGF protein or its Fragment binds to the VEGF receptor and binds to cells with the receptor. It only needs to be internalized. However, in certain circumstances In some cases, it may be desirable for VEGF to express some of its biological activities. You. For example, if VEGF is used for DNA encoding a molecule useful in wound healing When used as a carrier, VEGF has vascular permeability activity and fibroblast migration And exhibiting enhanced vasculogenesis. Which activity of VEGF is maintained Is desirable from the teachings provided within the present application.   VEGF promotes vascular hyperpermeability, endothelial cell growth, angiogenesis, and enhanced glucose Promotes a series of responses in the endothelium, including source transport. VEGF is a species at low concentrations From various sources, including brain capillaries, fetal and adult aorta, and venules Stimulates the growth of endothelial cells, but stimulates vascular smooth muscle cells, adrenocortical cells, Has no effect on the growth of lens epithelial cells or BHK-21 fibroblasts Has been reported. VEGF is also a polypeptide regulator with excellent vascular function. It does not cause endothelial cell damage or mast cell degranulation; Causes a rapid but transient increase in vessel permeability, and its action is Not blocked by histamine. VEGF also promotes monocyte migration and activation And have been reported to induce tumors, and in some human gliomas It has been implicated as an angiogenic factor. VEGF is also a monocyte chemoattractant Yes, and VEGF enhances the activity of inflammatory mediator tumor necrosis factor (TNF) Is shown.   Resting and proliferating endothelial cells exhibit high affinity binding to VEGF and The endothelial cell response to VEGF is mediated by high affinity cell surface receptors (Eg, International Application WO 92/14748 based on US Application No. 08 / 657,236). , De Vries et al., Science 255: 989-91, 1992; Terman et al., Biochem. Biophys. Res . Commun. 187: 1579-1586, 1992; Kendall et al., Proc. Natl. Acad. Sci. USA 90: 10705-10709, 1993; and Peters et al., Proc. Natl. Acad. Sci. USA 90: 8915-891 9, 1993). Two tyrosine kinases have been identified as VEGF receptors You. The first, known as the fms-like tyrosine kinase or FLT, It is a specific receptor tyrosine kinase. FL in adult and embryonic tissues T mRNA expression is localized to endothelial cells and a population of cells that give rise to endothelium. Second KDR (Human kinase insert domain containing receptor) And its mouse homolog FLK-1 are closely related to FLT. KDR / FLK-1 receptor It is expressed on endothelium during fetal growth, early embryonic development, and in adult tissues. Addition Instead, messenger RNAs encoding FLT and KDR are And especially the endothelial cells of the blood vessels that supply glioblasts. As well In addition, FLT and KDR mRNA are upregulated in tumor vessels in invasive human colon adenocarcinoma. But not in adjacent normal tissue vessels. 3.Heparin-binding epidermal growth factor   Epidermal growth factor factor that exhibits the ability to bind glycosaminoglycan heparin Several new mitogens in the protein family have recently been identified. Some of these are known as heparin-binding EGF-like growth factors (HBEGFs). There is togen, which is heparin-Sepharose at about 1.0-1.2M NaCl.^TMMosquito And eluted from cultured human monocytes, macrophages, and macrophages. Identified as a secreted product of the phage-like U937 cell line (Higashiyama et al., Science 251: 936-939, 1991; Besner et al., Cell Regul. 1: 811-19, 1990). HBEGF is a cow Same high affinity as EGF on aortic smooth muscle cells and human A431 epidermal carcinoma cells Have been shown to interact with sexual receptors (Higashiyama et al., Science 251). : 936-939, 1991).   HBEGF is effective against a wide range of cells, including BALB / c 3T3 fibroblasts and smooth muscle cells. Mitogenic effects, but unlike VEGF, mitogenic effects on endothelial cells. It is not reciprocal (Higashiyama et al., Science 251: 936-939, 1991). HBEGF also Has a stimulatory effect on collateral vascularization and angiogenesis I do. Members of the HBEGF family are involved in a variety of tumors (eg, bladder cancer, breast tumors and And non-small cell lung tumors). Follow Thus, these cell types are likely to be used for the delivery of cell killing factor-encoding substances. Will be a candidate.   HBEGFs isolated from U-937 cells are heterogeneous in structure and at least Also contains two sites of 86 amino acids and an O-linked glycosyl group (Higashiyama et al., J. Am. . Biol. Chem. 267: 6205-6212, 1992). Carboxyl terminal side of secreted HBEGF Half have about 35% sequence identity with human EGF and are members of the EGF protein family. The bar contains six cysteines spaced in a characteristic pattern. This In contrast, the amino-terminal part of the maturation factor depends on the stretch of hydrophilic residues (stretch). Characterized and has no structural equivalent in EGF. Site-directed mutation of HBEGF Heparin binding of HBEGF by induction and peptide fragment studies The sequence is 21 amino acids upstream of and slightly overlapping this EGF-like domain. It was shown to be mainly in the acid region.   The effect of HBEGF depends on the EGF receptor thyro expressed on the cell surface of HBEGF-responsive cells. Synthase-mediated (e.g., U.S. Pat.Nos. 5,183,884 and 5,211) 8,090; and Ullrich et al., Nature 309: 4113-425, 1984). EGF receptor Proteins (which are single-chain polypeptides with a molecular weight of 170 kD) Constitutes a family of closely related EGF receptors. Expresses EGF receptor Cells known to be smooth muscle cells, fibroblasts, keratinocytes, and Numerous human cancer cell lines (eg, A431 (epidermoid); KB3-1 (epidermoid); COLO205 (conclusion) Intestine); CRL 1739 (stomach); HEP G2 (liver cancer); LNCAP (prostate); MCF-7 (breast); MDA-MB-468 ( NCI 417D (lung); MG63 (osteosarcoma); U-251 (glioblastoma); D-54MB (glia) And SW-13 (adrenal gland)).   For the purposes of the present invention, HBEGF binds to a specific HBEGF receptor and It only needs to be internationalized. Any member of HBEGF Family Bars, whether or not they bind to heparin, also meet the above requirements, Useful in the present invention. HBEGF Family members are regular stringers Nucleotide identity sufficient to hybridize under stringent conditions (typically , More than 75% nucleotide identity). Sub-length of full-length HBEGF A fragment or subportion may also be desirable. Those skilled in the art will appreciate that From the teachings provided herein, certain biological activities are more desirable depending on the application Or undesirable.   The DNA encoding the HBEGF peptide or polypeptide is defined as above. , Any DNA fragment encoding HBEGF. Exemplary DNA fragment Is any such DNA fragment known to those of skill in the art; binds to the HBEGF receptor And encode the HBEGF or fragment thereby being internalized Any DNA fragment; and any HBEGF polypeptide set forth in SEQ ID NOs: 5-8 And any DNA fragment that encodes the code. Encodes HBEGF fragment Such DNA sequences can be obtained from publicly accessible databases (eg, EMBL, GenBan k (accession numbers M93012 (monkey) and M60278 (human)); plasmid pMTN-HBEGF (ATCC # 40900) and pAX-HBEGF (ATCC # 40899) (described in PCT application WO / 92/06705); and Abraham et al., Biochem. Biophys. Res. Comm. 190: 125-133, 1993) is there. Encodes HBEGF polypeptide if not modified by degenerate codon replacement The human DNA, at least under conditions of low stringency, is naturally occurring human HBEGF (e.g., For example, it hybridizes to DNA encoding SEQ ID NO: 9). In addition, the degenerate codon Any DNA fragment that can be made from any of the aforementioned DNA fragments by substitution Is intended for use herein. Complete HBEGF polypeptide The amino acid sequence, and DNA fragments encoding such peptides, are Replace the degenerate code, and make such HBEGF polypeptides Producing any possible DNA fragment that encodes a peptide is a routine procedure. It is understood that the order is. Based on the amino acid sequence, such a peptide is It is also generally possible to synthesize DNA to be loaded. 4.Other receptor binding internalized ligands   Other receptor binding ligands may be used in the present invention. Cell surface receptor Any protein, polypeptide, or protein that binds to and is internalized Analogs or fragments may be used. Generally, the specific heparin In addition to syngenic growth factors, other growth factors and cytokines are particularly well suited for use. I do. These ligands can be used by recombinant means in preparation for binding to the nucleic acid binding domain. Or it can be made by other means. These receptor-bound internals DNA sequences and methods for obtaining the sequence of a ligated ligand are well known. For example, These ligands are CSF-1 (GenBank accession numbers M11038, M37435; Kawasaki et al., Sci. ence 230: 291-296, 1985; Wong et al., Science 235: 1504-1508, 1987); GM-CSF (Gen Bank accession number X03021; Miyatake et al., EMBO J .; 4: 2561-2568, 1985); IFN-α (in Terferon) (GenBank accession number A02076; Patent No. Wo8502862-A, July 4, 1985) IFN-γ (GenBank accession number A02137; Patent No. WO8502624-A, June 20, 1985) Hepatocyte growth factor (GenBank accession numbers X16323, S80567, X57574; Nakamura et al., Natu re, 342: 440-443, 1989; Nakamura et al., Prog. Growth Factor Res. 3: 67-85, 199 1; Miyazawa et al., Eur. J. Biochem. 197: 15-22, 1991); IGF-Ia (insulin-like increase Growth factor Ia) (GenBank accession number X56773, S61841; Sandberg-Nordqvist et al., Brain Res. . Mol. Brain Res. 12: 275-277, 1992; Sandberg, Sandberg-Nordqvist et al., Ca ncer Res. 53: 2475-2478, 1993); IGF-Ib (GenBank accession number X56774, S61860; San) dberg-Nordqvist et al., Brain Res. Mol. Brain Res. 12: 275-277, 1992; Sandberg -Nordqvist, A. C., Cancer Res, 53: 2475-2478, 1993); IGF-I (GenBank accession number) No. X03563, M29644; Dull et al., Nature 310: 771-781, 1984; Rall et al., Meth, Enzymo. l. 146: 239-248, 1987); IGF-II (GenBank accession number J03242; Shen et al., Proc. Natl.  Acad. Sci. USA 85: 1947-1951, 1988); IL-1-α (interleukin 1α) (GenBa nk accession number X02531, M15329; March et al., Nature 315: 641-647, 1985; Nishida et al. Biochem. Biophys. Res. Commun. 143: 345-352, 1987); IL-1-β (interloy Kin 1β) (GenBank accession numbers X02532, M15330, M15840; March et al., Nature 315: 641). -647, 1985; Nishida et al., Biochem. Biophys. Res. Commun. 143: 345-352, 1987 Bensi et al., Gene 52: 95-101, 1987); IL-1 (GenBank accession numbers K02770, M54933, M3). 8756; Auron et al., Proc. Natl. Acad. Sci. USA 81: 7907-7911, 1984; Webb et al., Ad. v. Gene Technol. 22: 339-340, 1985); IL-2 (GenBank accession numbers A14844, A21785, X00695, X00200, X00201, X00202; Lupker et al., Patent EP 0307285-A, March 1989 15; Perez et al., Patent No. EP0416673-A, March 13, 1991; Holbrook et al., Nuclei c Acids Res. 12: 5005-5013, 1984; Degrave et al., EMBO J. 2: 2349-2353, 1983; T aniguchi et al., Nature 302: 305-310, 1983); IL-3 (GenBank accession numbers M14743, M2013). 7; Yang et al., Cell 47: 3-10, 1986; Otsuka et al. Immunol. 140: 2288-2295, 1988 IL-4 (GenBank accession number M13982; Yokota et al., Proc. Natl. Acad. Sci. USA 83: 5). 894-5898, 1986); IL-5 (GenBank accession number X04688, J03478; Azuma et al., Nucleic Ac ids Res. 14: 9149-9158, 1986; Tanabe et al. Biol. Chem. 262: 16580-16584, 1 987); IL-6 (GenBank accession numbers Y00081, X04602, M54894, M38669, M14584; Yasuka wa et al., EMBO J. 6: 2939-2945, 1987; Hirano et al., Nature 324: 73-76, 1986; Wong Behring Inst. Mitt. 83: 40-47, 1988; May et al., Proc, Natl. Acad. Sci. US A 83: 8957-8961, 1986); IL-7 (GenBank accession number J04156; Goodwin et al., Proc. Natl. . Acad. Sci. USA 86: 302-306, 1989); IL-8 (GenBank accession number Z11686; Kusner et al. Kidney Int. 39: 1240-1248, 1991); IL-10 (GenBank accession number X78437, M57627; Vieira et al., Proc. Natl. Acad. Sci. USA 88: 1172-1176, 1991); IL-11 (GenBank Accession numbers M57765, M37006; Paul et al., Proc. Natl. Acad. Sci. USA 87: 7512-751 6, 1990); IL-13 (GenBank accession numbers X69079, U10307; Minty et al., Nature 362: 248-2). 50, 1993; Smilnov, Shemyakin and Ovchinnikov Institute of Bioorganic Che mistry, June 2, 1994); TNF-α (tumor necrosis factor) (GenBank accession number A21522; No. GB 2246569-A1, February 5, 1992); TNF-β (GenBank accession number D12614; Mats uyama et al., FEBS LETTERS 302: 141-144, 1992). Other suitable receptor binding DNA sequences for internalized ligands can be found in GenBank or EMBL DNA databases And can be reverse synthesized from protein sequences obtained from the PIR database. Or standard methods from cDNA or genomic libraries (Sambrook et al., Supra). Can be isolated by 5.Modification of receptor binding internalized ligand   These ligands can be individually customized for a particular application. Ta Means for modifying the protein are provided below. Briefly, the addition and substitution of amino acids Replacements and deletions can be made by any of the commonly used recombinant DNA methods. .   FGF, VEGF, HBEGF or other receptor binding internalizing ligands The amino acid residue is a polypeptide that has been modified by deletion of the residue, but not modified. In a manner substantially similar to a new polypeptide, it binds to and binds to its receptor. It is not required if you have the ability to internalize.   As mentioned above, FGF receptor, VEGF receptor, HBEGF receptor, other proliferation Factor receptor (e.g., PDGF receptor), cytokine receptor, or With other cell surface molecules, including members of these families and their fragments Any polypeptide or peptide analog that is reactive (including peptidomimetics) Or a target substance that binds to and binds to a receptor. Non-constrained analogs of such peptides that Can be used. FGF peptide family members (including FGF-1 to FGF-9 ) Is preferred. Modified peptides (especially those lacking proliferative functions) and chimeras Peptides (they retain specific binding and internalizing activities) Are also intended for use herein.   Modifications made substantially near the N-terminus of a polypeptide generally comprise Done within the first about 10 residues. Such modifications may involve the addition or deletion of residues (e.g., Polypeptide that facilitates binding and has a defined molar ratio, preferably a 1: 1 ratio (Cysteine addition to form a conjugate containing   The DNA encoding one of the above receptor-binding internalized ligands is To delete or replace any cysteine residues responsible for aggregate formation, It can be mutagenized using standard methods. Contributes to aggregate formation, if necessary The identity of the cysteine residue is empirically determined by deleting the cysteine residue and / or Substitution, and the resulting protein contains physiologically acceptable buffers and salts. Can be determined by ascertaining whether they aggregate in a solution having further Construct fragments of these receptor binding internalized ligands , And can be used. The binding regions of many of these ligands have been described. H The fragments may also bind and bind from any of the tests described herein. Can be shown to be internalized.   Modifications of the polypeptide can be made by any means known to those of skill in the art. Honcho The preferred method in the description is the modification and modification of DNA encoding the polypeptide. It depends on the expression of the DNA.   By way of example only, DNA encoding an FGF polypeptide may be isolated, synthesized, or commercialized. Available from commercial sources (the amino acid sequences of FGF-1 to FGF-9 are Show; the DNA sequence may be based on these amino acid sequences or may be based on public DNA data. Databases and literature (see, for example, GenBank; U.S. Pat.No. 4,956,455, U.S. Pat.No. 5,126,323, U.S. Pat. No. 4,868,113, PCT application WO 90/08771, EP application 0 488 196 A2 and Miyamoto et al. Mol. Cell. Biol. 13: 4251-4259, 1993). Yeast and E. coli. pairs in coli Expression of the recombinant FGF-2 protein is described in Barr et al. Biol. Chem. 263: 16471-16478, 198 8, described in PCT Application No.PCT / US93 / 05702 and U.S. Patent Application No. 07 / 901,718 . Expression of the recombinant FGF protein may be determined as described herein, or by those skilled in the art. Can be performed using a known method.   Similarly, other receptor binding internalized ligands (VEGF, HBEGF, IL-1, IL-2 and other cytokines and growth factors). The DNA to be loaded can also be isolated, synthesized, or obtained from commercial sources. above As such, DNA sequences are available in public databases (e.g., GenBank). You. Based on these sequences, oligonucleotide primers were used to obtain DNA Of cDNA or mRNA by polymerase chain reaction technology as one means of It can be designed and used to amplify genes.   Mutations can be made by any method known to those of skill in the art (for site-specific Or introduce and amplify modifications in site-directed mutagenesis and DNA templates DNA amplification methods using primers (e.g., PCR splicing by overlap extension) (SOE)). Site-directed mutagenesis is typical Are well-known and commercially available phage vectors having single- and double-stranded forms. (For example, an M13 phage vector). Single-stranded phage replication Other suitable vectors containing the origin may be used (eg, Veira et al., Meth. Enzy. mol. 15: 3, 1987). Generally, site-directed mutagenesis is performed on the protein of interest ( That is, a member of the FGF family or a cytotoxic molecule (e.g., saporin)) By preparing a single-stranded vector encoding Single-stranded vector Oligonucleotide primers containing the desired mutation in the region homologous to the DNA in To the vector, followed by a DNA polymerase (eg, E. coll DNA polymerase). Melase I (Klenow fragment)) is added. DNA polymerase is heteroduplex Use a double-stranded region as a primer to create a heteroduplex . Here, one strand encodes the modified sequence and the other encodes the original sequence. Do. This heteroduplex is introduced into appropriate bacterial cells and cloned containing the desired mutation. Select an option. The resulting modified DNA molecule is expressed recombinantly in a suitable host cell. To produce a modified protein.   Suitable conservative substitutions of amino acids are well known, and generally involve the production of the resulting molecule. It can be performed without altering the physical activity. For example, such a substitution would be It can be done according to the substitutions described in Table 1.   Other similar conservative substitutions can be made. If necessary, such a substitution would simply be Ability to bind to the appropriate receptor and internalize upon binding Is determined empirically by testing the resulting modified protein for obtain. Those that retain this ability are the conjugates and methods herein. Suitable for use. In addition, muteins of FGF are known to those of skill in the art (see, for example, U.S. Pat. No. 5,175,147; PCT application WO 89/00198, US application 07 / 070,797; PCT application WO 91/1. 5229 and US application Ser. No. 07 / 505,124). B.Nucleic acid binding domain   As noted above, nucleic acid binding domains (NABDs) can be used in a sequence-specific manner or Interacts with the target nucleic acid in any of a variety of ways. When the interaction is non-specific The nucleic acid binding domain binds to a nucleic acid regardless of sequence. For example, poly-L- Syn is a basic polypeptide that binds to oppositely charged DNA. Other altitude Basic proteins or polycationic compounds (e.g., histones, protami And spermidine) also bind to nucleic acids in a non-specific manner.   Many proteins that bind to specific sequences in DNA have been identified. These tongues Parkin is responsible for genome replication, transcription and repair of damaged DNA. Transcription factors are inherited Regulates offspring expression, which is a diverse group of proteins. These factors are Due to their sequence-specific recognition they are particularly well suited for the purpose of the present invention. Host transcription factor The child has seven well-established classes, based on the structural motifs used for recognition. Are classified as The main family is Helix-Turn-Helix (HTH ) Protein, homeodomain, ginta finger protein, steroid receptor Puter, leucine zipper protein, helix-loop-helix (HLH) Protein, and β-sheet. The other class or subclass, after all, As more factors are discovered and defined, they will be described. Those classes Proteins, or in a sequence-specific manner that do not fit into one of these classes Proteins that bind nucleic acids (e.g., SV40 T antigen and p53) can also be used .   These families of transcription factors are generally well known (GenBank; Pabo and Sa uer, Ann. Rev. Biochem. 61: 1053-1095, 1992; and the following literature). this Many of these factors have been cloned and the exact DNA binding region has been Have been. If the sequence of the DNA binding domain is known, the encoding Genes can be synthesized if the region is short. Alternatively, this gene is Using otide as a probe from a host genomic library or cDNA Rally or from genomic DNA or cDNA by polymerase chain reaction Can be cloned. Such methods can be found in Sambrook (supra).   Helix-turn-helix proteins are well-studied λ Cro Protein, λcI, and E.I. coli CAP protein (Steitz et al., Proc. Natl. Acad. Sci. USA 79: 3097-3100, 1982; Ohlendorf et al. Mol. Biol. 169: 757-76 9, 1983). In addition, the lac repressor (Kaptein et al., J. Mol. Biol. 182: 179). -182, 1985) and the Trp repressor (Scheritz et al., Nature 317: 782-786, 1985). Belongs to this family. Members of the homeodomain family are Drosophila Including Protein Antennapedia (Antennapaedia) (Qian et al., Cell 59: 573-580,  1989) and yeast MATα2 (Wolberger et al., Cell 67: 517-528, 1991). Zinc Finger proteins include TFIIIA (Miller et al., EMBO J. 4: 1609-1614, 1985), Sp- 1, zif268, and many others (generally, Krizek et al., J. Am. Chem. Soc. 113: 4518-4523, 1991). Steroid receptor proteins are Receptors for mons, retinoids, vitamin D, thyroid hormones, and other compounds Including Specific examples are retinoic acid, knylps, progesterone, and Rogen, glucocorticosteroid and estrogen receptor Ter protein. The leucine zipper family covers a region of 30 to 40 residues. It was defined by the heptad repeat of barrel leucine. This file Specific members of the family include C / EBP, c-fos, C-jun, GCN4, sis-A and CREB. (See generally, O'Shea et al., Science 254: 539-544, 1991). Helix-Lou The helix (HLH) family of proteins is It seems to have some similarities. Well-known members of this family are myoD (Weintraub et al., Science 251: 761-766, 1991); c-myc; and AP-2 (Williams and And Tijan, Science 251: 1067-1071, 1991). Beta sheet family Use anti-parallel β-sheets for DNA binding, rather than common α-helix . This family is described in MetJ (Phillips, Curr. Opin. Struc. Biol. 1: 89-98, 199). 1), Arc (Breg et al., Nature 346: 586-589, 1990), and the Mnt repressor. In addition, other motifs (e.g., cysteine-rich genes in the yeast GAL4 repressor) Chief and GATA factors) are used for DNA binding. Viruses are also identified Contains the gene product that binds to the sequence. Most studied such viral inheritance One of the offspring is the rev gene from HIV. The rev gene product is found in the env gene Binds to a sequence called RRE (rev responsive element). Other that binds to DNA Proteins or peptides are based on sequence similarity to known classes, or Choice Can be found functionally.   Several techniques can be used to select other nucleic acid binding domains ( US Patent No. 5,270,170; PCT Application WO 93/14108; and US Patent No. 5,223,409. reference). One of these technologies is phage display (eg, phage display). See, for example, US Pat. No. 5,223,409). In this method, the DNA sequence is Gene (eg, M13) into gene III or VIII. Marc Several vectors with roning sites have been developed for insertion (M cLafferty et al., Gene 128: 29-36, 1993; Scott and Smith, Science 249: 386-390. Smith and Scott, Methods Enzymol. 217: 228-257, 1993). Inserted The DNA sequence may be randomly generated or may be a known DNA binding domain. May be a mutant. Generally, the insert encodes 6-20 amino acids . The peptide encoded by the inserted sequence is located on the surface of the bacteriophage. To be presented. Bacteriophage that express the desired nucleic acid binding domain Selected for binding to the vesicle killing factor-encoding substance. This target molecule can be single-stranded or Or double-stranded DNA or RNA. Cell killing factor-encoding substance to be delivered If is single-stranded (eg, RNA), a suitable target is single-stranded. To be delivered If the target molecule is double-stranded, the target molecule is preferably double-stranded. Preferably, The entire coding region of the cell killing factor encoding substance is used as a target. In addition, The elements required for transcription included for in vitro or in vitro delivery are the target DNA May be present in the molecule. The bacteriophage that binds to the target is recovered and grown. Let The next round of choice can be made. Bacteriophage finally selected And the DNA sequence of the insert is determined. Once the binding peptide Once the predicted amino acid sequence is known, the nucleic acid binding domain herein Peptides sufficient for use can be made by either recombinant means or synthetically . Receptor binding internalized ligand / nucleic acid binding domain When produced as a protein, recombinant means is used. In addition, a single polype To maximize the affinity or binding of multiple DNA molecules to the peptide, the peptide It can be made as a tandem array of two or more peptides.   Recognize saporin coding region as an example of phage display selection technology Isolate the DNA binding domain / peptide. In short, code saporin DNA fragments can be isolated from plasmids containing these sequences. Plasmid FPFS1 contains the entire coding region for saporin. NcoI and EcoRI restrictions Upon digestion of the plasmid with the enzyme, saporin was converted into a single fragment of approximately 780 bp. The specific sequence is released. This fragment can be prepared in a number of ways (e.g., agarose). Purified by any one of the following methods: Can be The saporin fragment is transferred to a solid support (e.g., a 96-well plate). ). If the double-stranded fragment does not bind well to the plate, Coatings (e.g., positively charged molecules) are used to promote DNA adhesion. Can be Add the phage library to the wells and incubate During the incubation period, the phage is allowed to bind to the DNA. Unbound phage is typically 10 m Wash solution containing M Tris, 1 mM EDTA and no salt or low concentration of salt Is removed. Bound phages elute starting from buffer containing 0.1 M NaCl Is done. The NaCl concentration is increased stepwise until all phages elute. representative Phage binding with higher affinity is only released by higher salt concentrations Is done.   The eluted phage is propagated in a bacterial host. Higher round choice It can be done to select for a small number of phage bindings with affinity. Then join The DNA sequence of the insert in the sex phage is determined. Furthermore, higher affinity Peptides having variants of the insert sequence, and these variants Can be isolated by subjecting it to a further round of selection.C. Cell killing factor-encoding substance   Cell killing factor-encoding substances are used for internalization and For subsequent transcription (for DNA) and / or translation into cell killing factors By being cytotoxic to cells or by inhibiting protein synthesis Is a nucleic acid molecule (DNA or RNA) that inhibits cell growth.   Cell killing factors include ricin, saporin, abrin and others. Ribosome-inactivating protein, Pseudomonas exotoxin, diphtheria toxin, Angiogenin, tritin, dianthin 32 and 30, Morzine, American pokeweed antiviral protein, mirabilis antiviral Proteins, bryodin, angiogenin, and shiga exotoxin, and Includes other known cell killing factors. Alternatively, the cell killing factor gene product is Compounds that can be harmful but are produced endogenously or applied exogenously Activates from a non-toxic form to a toxic product that inhibits protein synthesis.   Of particular interest are those that result in cell killing or the addition of another product. A DNA molecule that encodes an enzyme that makes cells susceptible to cell death. For example, Sapoli Is an enzyme that cleaves rRNA and inhibits protein synthesis. Protein synthesis Other enzymes that inhibit are particularly well suited for use in the present invention. In addition, enzymes Wherein the enzyme has little or no cytotoxicity The compound is activated to a toxic product that inhibits protein synthesis.1. Ribosome-inactivating protein   Ribosome-inactivating proteins (RIP, including ricin, abrin, and saporin) ) Are plant proteins that catalytically inactivate eukaryotic ribosomes. Riboso Inactivated proteins interfere with the protein elongation step of protein synthesis. Thus, the ribosome is inactivated. For example, the ribosome-inactivated protein sapoli (Hereinafter referred to as SAP) is located at position 4324 in rat 28S ribosomal RNA (rRNA). Inactivates the 60S ribosome by cleavage of the N-glycosidic bond of adenine Are shown. A₄₃₂₄The specific regions that are located on rRNA are prokaryotic and eukaryotic. Highly conserved between A and 28S rRNA₄₃₂₄Is E. coli 23S rRNA A₂₆₆₀Corresponding to Some of the ribosome-inactivating proteins are also E. coli. co It appears to interfere with protein synthesis in prokaryotes such as li.   Saporin is preferred as a cell killing factor, but other suitable ribosome-inactivating Protein (RIP) and toxins can also be used. Other suitable RIPs are not limited Not available, but lysine, ricin A chain, maize inactivated protein, gelonin , Diphtheria toxin, diphtheria toxin A chain, tricosansin, tritin, USA Pokeweed antiviral protein (PAP), mirabilis antiviral protein (MA P), diansin 32 and 30, abrin, monoludin, bryodin, shiga (e.g. See, for example, WO 93/24620) and others (eg, Barbieri et al., Cancer Sur). veys 1: 489-520, 1982, and EP Patent Application No. 4662222 (herein incorporated by reference). With assistance, a list of numerous ribosome-inactivating proteins and their sources is provided. See also US Pat. No. 5,248,608 to Walsh et al.) including. Some ribosome-inactivating proteins like Abrin and Lysine Has two constituent chains: binding to cell surface receptors and internalization of the molecule. It contains a cell-binding chain that mediates the solution and a chain that is responsible for toxicity. Saporin Such a single-stranded ribosome-inactivating protein (Type I RIPS) does not have a cell-associated chain. As a result, if not internalized, they are two-strand ribosomes. Is substantially less toxic to whole cells than protein-inactivated proteins.   Several structurally related ribosome-inactivating proteins are found in the plant Saponaria of  ficinalis has been isolated from seeds and leaves (GB Patent No. 2,194, 241B; GP Patent No. 2,216,891; EP Patent No. 89306016). Used in the present invention Saporin proteins have amino acid substitutions, deletions, insertions, or additions However, the natural plant host Sapona still substantially exhibits ribosome inactivating activity. has an amino acid sequence or a modified sequence found in ria officinalis. Purified preparations of saporin often contain isoforms of some molecules of the protein. It is observed that it contains a mold. The difference in amino acid sequence is saporin from different species, It is understood that this can occur between saporin molecules from individual organisms of the same species. You. Of these, SO-6 is the most active and abundant, accounting for 7% of total seed protein. Represents%. Saporin is very stable, has a high isoelectric point, contains no carbohydrates, And denaturants such as sodium dodecyl sulfate (SDS) and various proteins Resistant to ze. Amino acid sequence of some saporin-6 isoforms from seed Rows are known and saporin ribosome inactivation with little difference in amino acid residues There seems to be a family of proteins. These saporins that are cytotoxic Either proteins or modified proteins can be used in the present invention.a. Isolation of DNA encoding saporin   Some of the DNA molecules provided herein have amino acid positions 48 and 91. Of saporin-6 (SO-6), including any four isoforms having heterogeneity in Sapoli with substantially the same amino acid sequence and ribosome inactivating activity (Eg, Maras et al., Biochem. Internat. 21: 631-638, 1990 and And Barra et al., Biotechnol. Appl. Biochem. 13: 48-53, 1991; GB Patent No. 2.216.891B And EP Patent No. 89306106; and SEQ ID NOs: 19-23). Other appropriate Novel saporin polypeptides include SO-1 and SO-3 (Fordham Skelton et al., Mol. Gen. Ge. net. 221: 134-138, 1990), SO-2 (eg, US application Ser. No. 07 / 885,242; GB 2,216). See, For example, Fordham-Skelton et al., Mol. Gen. Genet. 229: 460- 466, 1991), SO-4 (see, for example, GB 2,194,241B; ppi et al., Biochem. Biophys. Res. Commun. 129: 934-942, 1985) and SO-5 (e.g. See GB2,194,241B; also, Montecucchi et al., Int. J. Peptide Prote in Res. 33: 263-267, 1989). Includes other members of the multi-gene family that encode protein isoforms. No.   Saporin polypeptides for use in the present invention include Saponaria officina lis or related species or can be isolated from modified forms possessing cytotoxic activity Any of the isoforms of saponin. In particular, such modified saporins have the following properties: Change the above amino acids, or delete or insert one or more amino acids Can be produced by modifying the DNA encoding the protein (See, for example, International PCT Application PCT / US93 / 05702 and US Application No. 07 / 901,718. And US Patent Application No. 07 / 885,242 and Italian Patent No. 1,231,914. See). In a standard in vitro or in vivo assay, at least Even within the approximate order of size of the saporin conjugate described herein, Any such protein or a portion thereof that exhibits harm may be used herein. To be considered for.   Preferably, the saporin DNA sequence contains preferred mammalian codons (sequence Number 79). Mammals, yeast, Drosophila, E. coli, and Curre for primates nt Protocols in Molecular Biology, infra, and Zhang et al. (Gene 105: 61, 1991). The preferred codon usage exemplified in) is established for saporin sequences.   A cell killing factor-encoding substance, such as a saporin DNA sequence, is Introduced into a plasmid by operable linkage to an appropriate promoter for expression of the tide I do. Currently preferred saporin proteins are SO-6 and SO-4. DNA is required Depending on the origin of replication, which allows extra-chromosomal maintenance of saporin-containing plasmids And can be designed to integrate into the host genome. (As another means to ensure stable maintenance in the host).b. Nucleic acids encoding other ribosome-inactivating proteins and cell killing factors   In addition to the above saporins, other cell-killing factors that inhibit protein synthesis were also developed. Useful in the light. The gene sequences for these cell killing factors are PCR, Probe hybridization and expression libraries for nom or cDNA libraries And can be isolated by standard methods, such as antibody screening in Leeds. Or Clones can be obtained from commercial or other sources. Ricin A chain (GenB ank accession number X02388); maize ribosome-inactivating protein (GenBank accession number) No. L26305); gelonin (GenBank accession number L12243; PCT application WO92 / 03155; US patent) No. 5,376,546); diphtheria toxin (GenBank accession number K01722); trichosancin (GenBank accession number M34858); Tritin (GenBank accession number D13795); Burdock antiviral protein (GenBank accession number X78628); mirabilis antiviral Protein (GenBank accession number D90347); diansin 30 (GenBank accession number X592) 60); Abrin (GenBank accession number X55667); Shiga (GenBank accession number M19437) and And Pseudomonas endotoxin (GenBank accession number K01397, M23348), Many DNA sequences for these cell killing factors are well known. DNA sequence or amino acid sequence If the sequences are known, DNA molecules encoding these proteins can be synthesized. , Preferably mammalian preferred codons.D. Prodrug code substance   A nucleic acid molecule encoding a prodrug may alternatively be used within the scope of the present invention. You. Prodrugs are provided with a substrate or an activating molecule. To some extent they are inactive in host cells. Most typically, prodrugs are Activates compounds with little or no damage to toxic products. Together Two of the more frequently used prodrug molecules that can be used in the light are HS V thymidine kinase and E. coli. coli cytosine deaminase.   Briefly, compounds with little or no cytotoxicity are directly A wide variety of gene products that activate either toxic or indirect It can be used within the range of light. A typical example of such a gene product is HSVTK (simple Lupes virus thymidine kinase) and VZVTK (varicella-zoster virus virus) Midine kinase), which contains specific purine arabinosides and substituted Selectively phosphorylates lymidine compounds. Phosphorylation makes these compounds cytotoxic Converts to metabolites that are harmful or cytostatic. For example, drug gas Ancyclovir, acyclovir or any analogs thereof (eg, Exposure to HSVTK-expressing cells, FIAU, FIAC, DHPG) responds to the drug Into the active nucleotide triphosphate form.   Other gene products that may be utilized within the scope of the present invention include thioxanthine, a toxic thiol. E. Conversion to xanthine monophosphate coli guanine phosphoribosyl transferase Mitomycin phosphate (Besnard et al., Mol. Cell Biol. 7: 4139-4141, 1987); Toxic dephosphorylation of inactive phosphorylated compounds such as and doxorubicin-phosphate Alkaline phosphatase that converts 5-fluorocytosine into toxic compounds Fungi that convert to the compound 5-fluorouracil (eg, Fusarium oxysporum or Is a bacterial cytosine deaminase (Mullen, PNAS 89:33, 1992); para-N-bis (2 Glutamic acid is cleaved from (-chloroethyl) aminobenzoylglutamic acid and Carboxypeptidase G2, thereby producing toxic mustard benzoate; and Toxic and phenoxyacetabide derivatives of melphalan Penicillin-V amidase which converts to a compound (generally Vrudhula et al., J. of Med. C hem. 36 (7): 919-923, 1993; Kern et al., Canc. Immun. Immunother. 31 (4): 202-20 6, 1990). In addition, primate and non-primate herpesviruses A wide variety of Herpesviridae thymidine kinases are suitable, including both. Such herpesviruses include herpes simplex virus type 1 (McKnight et al., Nuc. Acids Res. 8: 5949-5964, 1980), herpes simplex virus type 2 (Swain and Gall oway, J. Virol. 46: 1045-1050, 1983), varicella-zoster virus (Davison et al. And Scott, J.M. Gen. Vrirol. 67: 1759-1816, 1986), marmoset herpesvirus (Otsuka and Kit, Virology 135: 316-330, 1984), Feline herpesvirus 1 Type (feline herpesvirus type 1) (Nunberg et al., H. Virol. 63: 3240-3249, 1989). Pseudorabies virus (Kit and Kit, U.S. Pat. No. 4,514,497, 1985); Lupes virus type 1 (Roberston and Whalley, Nuc, Accis Res. 16: 11303-1131 7, 1988), bovine herpesvirus type 1 (Mittal and Field, J. Virol. 70: 2901- Turkey herpes virus (Martin et al., J. Virol. 63: 2847-). 2852, 1989), Marek's disease virus (Scott et al., J. Gen. Virol. 70: 3055-3065, 1989). ), Herpesvirus simyli (Honess et al., J. Gen. Virol. 70: 3003-3013, 1989). And Epstein-Barr virus (Baer et al., Nature (London) 310: 207-311, 1 984). Such herpesviruses are available from the American Type Culture Collection ("ATCC", Rockville, Maryland).   In addition, as described above, a wide variety of inactive precursors can be converted to active inhibitors . For example, thymidine kinase is a phosphorylate nucleoside (eg, dT) and And ganciclovir (9-{[2-hydroxy-1- (hydroxymethyl) ethoxyl) Methyl diguanosine), famiciclovir, buciclovir, penciclovir, ba Luciclovir, acyclovir (9- [2-hydroxyethoxy) methyl] guanosi ), Trifluorothymidine, 1- [2-deoxy, 2-fluoro, β-D-arabi Nofuranosyl] -5-iodouracil, ara-A (adenosine arabinoside, Viva Rabin) 1-β-D-arabinofuranosylthymidine, 5-ethyl-2'-deoxy Lysine, 5-iodo-5'-amino-2,5'-dideoxyuridine, idoxouri Gin (5-iodo-2'-deoxyuridine), AZT (3 'azido-3' thymidine) , DdC (dideoxycytidine), AIU (5-iodo-5'amino 2 ', 5'-dideo Xyuridine), and nucleosides such as AraC (cytidine arabinoside) It can phosphorylate nalog.E. FIG. Other nucleic acid molecules   Using the conjugates provided herein, other types of nucleic acids can also be delivered to target cells. Can be delivered. Such other nucleic acids include antisense RNA, antisense DNA, , Triplex forming oligonucleotides, and oligonucleotides that bind proteins Contains nucleotides. Nucleic acids are used for RNA trafficking, such as viral packaging sequences. King signals can also be included (eg, Sullenger et al., (1994) Science 262: 1566-1). 569). Nucleic acids are also defective, such as genes associated with cystic fibrosis. Also includes DNA molecules that encode proteins that replace genes (see, eg, PCT application WO 93/03709, US Patent Application No. 07 / 745,900; and Riordan et al. (1989) Science 245: 1. 066-1073). Other DNA molecules bind tumor necrosis factor and cells to anticancer factors. Tumor-specific cytotoxicity such as viral antigens and other proteins that render them sensitive Harmful molecules can be encoded.   The nucleic acids and oligonucleotides used as described herein can be obtained by those skilled in the art. (Eg, WO93 / 01286, US application Ser. No. 07/72). 3,454; U.S. Pat. No. 5,218,088; U.S. Pat. No. 5,175,269; U.S. Pat. No. 24). Antisense agents for gene therapy and targeted delivery Oligonucleotides and ribosas for use as DNA encoding genes The identification of the immu includes methods well known to those skilled in the art. For example, such an oligonucleotide The desired properties, lengths, and other characteristics of otide are well known. Antisense Ori Gonucleotides are typically resistant to degradation by endogenous nucleases. Designed, but not limited to, phosphorothioate, methylphospho Nate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoroa Including midates, phosphate esters and other such linkages (eg, Ag rwal et al., Tetrahedron Lett. 28: 3529-3452 (1987); Miller et al. Am. Chem. Soc . 93: 6657-6665 (1971); Stec et al., Tetrahedron Lett. 26: 2191-2194 (1984); Mood y et al., Nucl. Acids Res. 12: 4769-4782 (1989); Uznanski et al., Nucl. Acids Res. ( 1989); Letsinger et al., Tetrahedron 40: 137-143 (1984); Ecstein, Annu. Rev. Bi ochem. 54: 367-402 (1985); Ecstein, Trends Biol. Sci. 14: 97-100 (1989); Ste in: Oilgodeoxynucleotides. Antisense Inhibitors of Gene Expressi on, Cohen, Macmillan Press, London, 97-117 (1989); Jager et al., Biochemis. try 27: 7237-7246 (1988)).   Antisense nucleotides appear to be sequence-specific for nucleic acids such as mRNA or DNA. Oligonucleotides linked by a formula. Field that binds to mRNA with complementary sequence In that case, antisense prevents translation of the mRNA (see, for example, Altam et al., US Pat. No. 5,168,075). No. 53; Inouye U.S. Pat. No. 5,190,931; Burch U.S. Pat. No. 5,135,917, Smith And Clusel et al., US Pat. No. 5,087,617 (1993) Nucl. Acids Res. 21: 3405-3411 (See Dumbbell antisense oligonucleotides). Triple Strand molecules bind to double-stranded DNA forming a co-linear triplex molecule, thereby transcribed (Eg, Hogan et al., US Pat. No. 5,176,996 (duplex D) Describes a method for making synthetic oligonucleotides that bind to target sites on NA See).   Particularly useful antisense nucleotides and triplex molecules are bFGF, int-2, hst DNA encoding oncogenes, such as -1 / K-FGF, FGF-5, hst-2 / FGF-6, FGF-8 Or a molecule that is complementary to or binds to the sense strand of the mRNA. other Useful antisense oligonucleotides are those specific for IL-8 (treatment of psoriasis) This can be linked to bFGF (eg, US Pat. No. 5,241,049; And PCT applications WO 89/004836; WO 90/06321; WO 89/10962; WO 90/00563; and WO 91 / 08483), non-muscle myosin heavy chain and / or c-myb specific Antisense oligonucleotides (eg, Simons et al. (1992) Cir. Res. 70: 835-843). PCT application WO 93/01286, US application Ser. No. 07 / 723,454; LeClerc et al. Am. Col .. Cardiol. 17 (2 Supplement A); 105A; Ebbecke et al., (1992) Basic Res. Cardiol. 87: 585 (See -591) (this blocks smooth muscle cell proliferation, such as after angioplasty, and To prevent restenosis or to prevent restenosis in transformed or infected cells. (Which can be targeted by FGFs to inhibit ills gene expression).   Ribozymes specifically cleave RNA substrates, such as mRNA, and therefore proliferate cells Or an RNA molecule that inhibits or prevents expression. RNA strand cleavage and / or Or there are at least five classes of ribozymes known to be involved in ligation I do. Ribozymes can be targeted to any RNA transcript, and such transcripts are Catalytic cleavage (eg, US Pat. No. 5,272,262; US Pat. No. 5,144,019) And Cech U.S. Patent Nos. 5,168,053, 5,180,818, 5,116,742 and And No. 5,093,246 (described ribozyme and its production method) . Both such ribozymes have an internalized receptor binding Linked to a growth factor for delivery to cells having a receptor for the sexual ligand Can be   Ribozymes act by direct transcription of the ribozyme upon introduction into the nucleus. Ribosomes linked to eukaryotic promoters, such as eukaryotic virus promoters It can be delivered to target cells by DNA encoding the Zyme. In such a case, The structure also generally contains the nucleic acid binding domain as part of the ligand or with the ligand. And a nucleic acid translocation sequence as part of the linker between the   The DNA encoding the therapeutic product intended for use is defective in cystic fibrosis. Correct copy of a defective gene such as a transgene (CFTR) (see, eg, International Patent Application WO 93/03709, US Patent Application No. 07 / 745,900; and Riordan et al. (1989) Science 245. : 1066-1073), and encodes anti-cancer factors such as tumor necrosis factor Containing DNA. The conjugate preferably comprises NTS. Ligand and nucleic acid binding NTS binds to DNA if the conjugate is designed so that the mesin is cleaved in the cytoplasm Should be included as part of the conjugate or linker that remains as it is. Nuclear translocation sequence (NTS) can be a heterologous sequence or can be derived from a selected growth factor. You.F. Construct containing a cell killing factor-encoding substance   In the case of cell-killing molecules such as ribosome-inactivating proteins, in fact, Very few molecules may need to be expressed to do so. Introduced into cells Single molecule diphtheria toxoid was sufficient to kill cells. Other cell death With respect to factors or prodrugs, gene products for effective gene therapy Growth or stable maintenance of the construct is required to achieve sufficient amounts or concentrations. is there. Examples of replicating stable eukaryotic plasmids can be found in the scientific literature.   Generally, the construct will also contain the necessary elements for transcription and translation. If the cell killing factor-encoding substance is DNA, it must contain a promoter No. The choice of promoter depends on the cell type to be transformed and the desired control Depends on the degree or type of Promoters are used in any cell type May be constitutive or active, tissue-specific, cell-specific, event-specific, or time-specific. Or inducible. Cell type-specific promoters and event type-specific promoters Are preferred. As an example of a constitutive or non-specific promoter, the SV40 early promoter Motor (US Pat. No. 5,118,627), SV40 late promoter (US Pat. 627), CMV early gene promoter (US Pat. No. 5,168,062) and adeno Viral promoters. In addition to viral promoters, cell pro Motors can also be used within the scope of the present invention. In particular, the so-called housekeeping inheritance Cell promoters for offspring are useful. Viral promoters are generally Viral promoters are preferred because they are stronger than vesicle promoters.   Tissue-specific promoters target specific tissue types for transformation It is especially useful when it should. Use one of the promoters in this class Thereby, a further slight specificity can be achieved. For example, the indication to be treated If the disease is ophthalmological (eg, secondary lens turbidity), α-crystallin promoter Either the promoter or the γ-crystallin promoter is preferred. Tumor is a gene If targeted for delivery, cell promoters or tumors for specific tumor markers A promoter that is more active in tumor cells should be selected. Therefore, prostate tumor For treating ulcers, a prostate-specific antigen promoter is particularly useful. As well Tyrosinase promoter or tyrosinase-related protein promoter Is a preferred promoter for melanoma treatment. Diseases that are angiogenic Or VEGF receptor promoter for the treatment of diseases that progress by angiogenesis Is preferred. VEGF receptors are expressed on developing capillaries. In the treatment of breast cancer , A promoter from heat shock protein 27 is preferred; treatment of colon or lung cancer. For placement, promoters from carcinoembryonic antigens are preferred; restenosis, or smooth muscle. In the treatment of other cell-related diseases, alpha-actin or myosin heavy chain derived Motors are preferred. In B lymphocytes, the immunoglobulin variable region gene promoter For T lymphocytes, TCR receptor variable region promoter; N In papocytes, CD4 promoter; in liver, albumin or α-fetoprotein Promoters are some further examples of tissue-specific promoters. Other many Examples of many tissue-specific promoters are readily available to those skilled in the art. c- Some of these promoters, such as myc and cyclin D, are temporarily regulated. It is set.   Inducible promoters can also be used. These promoters are dexamethasone MMTV LTR (PCT application WO 91/13160) induced by heavy metals, induced by heavy metals Metallothionein and cAMP-induced cAMP response element Includes a promoter. By using an inducible promoter, the nucleic acid is It can be delivered to the cells and remains dormant until the addition of the inducer. This means Further control over the timing of the production of the therapeutic gene is possible.   Event type-specific promoters are responsible for events such as tumorigenesis or viral infection. Active or up-regulated only upon occurrence. HIV LT R is a well-known example of an event-specific promoter. Promoter is a tat gene product Is inactive unless is present and occurs upon viral infection. Another promoter Is c-myc.   In addition, promoters that are synergistically regulated with particular cellular genes may be used. For example, a gene that is expressed synergistically when a specific FGF receptor gene is expressed A gene promoter may be used. Next, FGF receptors such as FGRF1 are expressed If so, the nucleic acid is transcribed, and if FGFR2 is expressed, it is not. this Types of promoters have a pattern of FGF receptor expression in specific tissues. It is particularly useful when known, so that specific cells within the tissue Can be killed upon transcription of the cytotoxic factor gene without affecting other tissues .   If the domains bind in a sequence-specific manner, the construct will bind to the nucleic acid binding domain Must contain the following sequence: As described below, the target nucleic acid sequence Child coding region, in which case no additional sequences need to be incorporated. No. Further, it may be desirable to have multiple copies of the target sequence. Target sequence is If the sequence is a non-coding region of the cell killing factor-encoding substance, Must be located at The target sequence of the nucleic acid binding domain is typical and general Publicly known. Even if not known, the target sequence can be easily determined. Target sequence Techniques for establishing are generally available (see, for example, PCT application WO 92/05285 and No. 586,769).G. FIG. Other elements 1. Nuclear translocation signal   As used herein, “nuclear localization or targeting sequence” (NST) refers to a protein Is the sequence of amino acids in a protein required for translocation of the protein to the cell nucleus. NTS example Are described in Table 2 below. Comparison with known NTS and, if necessary, candidates Sequence testing allows those skilled in the art to easily identify other amino acid sequences that function as NTS Should be able to Heterologous NTS refers to wild-type peptide, polypeptide Refers to an NTS that is different from the NTS present in the protein or protein. For example, NTS is another Can be derived from a polypeptide, can be synthesized, or it can be the same polypeptide May be derived from another region in   In order to deliver nucleic acids to the nucleus, the conjugate should include NTS. Receptor binding The integrated internalized ligand and the linked nucleic acid binding domain are cut in the cytoplasm. If the conjugate is designed to be cleaved or dissociated, NTS will bind to the nucleic acid. Should be included in the part of the complex that remains Upon ligation, the conjugate is transported to the nucleus. Therefore, NTS is preferred Is included in the nucleic acid binding domain, but may further be included in the ligand. Cell death If the factor-encoding substance is DNA, NTS is preferred. Cell killing factor-encoding substance is mRNA If so, the NTS can be omitted. Nuclear Localization Sequence (NTS) Can Be, Or Is Heterogeneous Or derived from a selected growth factor. All of the FGF family of peptides Currently identified members contain NTS (see, eg, International Application WO 91/15229 and And Table 2). A typical consensus NTS sequence is the amino-terminal Or glycine, followed by at least three in an array of 7-9 amino acids (Eg, Dang et al., J. Biol. Chem. 264: 18019-18023, 1). 989; Dang et al., Mol. Cell. Biol. 8: 4049-4058, 1988 and Table 2) .2. Cytoplasmic translocation signal   The cytoplasmic translocation signal sequence triggers protein retention in the endoplasmic reticulum lumen. In proteins that translocate and / or translocate proteins to the cytosol Amino acid sequence. The signal sequence in mammalian cells is KDEL (Lys-Asp-Glu- Leu) (SEQ ID NO: 42) (Munro and Pelham, Cell 48: 899-907, 1987). This Some modifications of the sequence have been made without loss of activity. For example, The columns RDEL (Arg-Asp-Glu-Leu) (SEQ ID NO: 43) and KEEL (Lys-Glu-Glu-Leu) (sequence No. 44) confer efficient or partial retention in plants, respectively (Denecke Et al., Embo. J. 11: 2345-2355, 1992).   The cytoplasmic translocation signal sequence is a receptor internalizing binding ligand or May be included in either or both of the nucleic acid binding domain portions. Severable phosphorus If the ligand is linked to the nucleic acid binding domain using a car The null is preferably a nucleic acid binding domain that remains bound to the cell killing factor-encoding substance. Included. In addition, the cytoplasmic translocation signal sequence has an effect on receptor binding. Unless included in the receptor internalized binding ligand it can. Similarly, the signal sequence located in the nucleic acid binding domain is Should not interfere with binding to the host material.3. Endosomal disrupting peptide   Additionally or alternatively, the membrane-disrupting peptide can be incorporated into the complex. example For example, adenoviruses are known to enhance endosomal destruction. Inn Virus-free virus proteins such as fluenza virus hemagglutinin HA-2 Quality also destroys endosomes and is useful in the present invention. Other proteins herein Specific endosomal disruption that enhances gene delivery, tested in the assay described in Disintegrants can be found. Generally, these proteins and peptides are amphiphilic. (Wagner et al., Adv. Drug. Del. Rev. 14: 113-135, 1994).   Endosomal disrupting peptides (sometimes called fusogenic peptides) are Ternalized binding ligand, nucleic acid binding domain, and cell killing factor It can be incorporated into the complex of the code substance. Two from influenza virus Such peptides of GLFEAIEGFIENGWEGMIDGGGC (SEQ ID NO: 45) and GLFEAIE GFIENGWEGMIDGWYGC (SEQ ID NO: 46). Useful for destroying endosomes Other peptides can be identified by general characteristics: 25-30 residues in length, parents Hydrophobic domains and acids at low pH (eg, pH 5) from a amphiphilic helix Includes alternative patterns for sex domains. Candidate endosomal disrupting peptides replicate it. Incorporation into the union and whether it increases the total number of cells expressing the target gene Tested by determining what. The peptide has an excess of negative charge To the complex. For example, a DNA construct has only the negatively charged portion of the DNA Complexed with FGF-poly-L-lysine chemical conjugate to be neutralized. Poly-L- Lysine is added to further bind the DNA, and then the fusogenic peptide is added. Add. Any ratio of DNA, poly-L-lysine, and fusogenic peptide can be It is determined using assays such as expression and cell viability.   Alternatively, the fusogenic peptide is either a ligand or a nucleic acid binding domain Alternatively, it can be incorporated into the complex as a fusion protein with both. Endosome The disrupting peptide can have single or multiple copies at the N- or C-terminus of the ligand. May exist. Endosomal disrupting peptides, nucleic acid binding domains, and receptors A single fusion protein of a tar internalized binding ligand is constructed and developed. Can be revealed. Encodes an endosomal disrupting peptide for insertion into the construct The DNA uses overlapping oligonucleotides and allows for cloning. PCR to incorporate restriction sites at the 5 'and 3' ends for ease Can be synthesized. The sequence can be confirmed by sequence analysis.4. Linker   As used herein, a “linker” is a receptor-binding internalized ligand. Extension linking the peptide or its fragment with the nucleic acid binding domain. is there In an example, a linker is used to attach the ligand directly to the nucleic acid. This specification The ligands provided herein have specificity for the conjugate, increased intracellular availability Imparts serum stability, and / or solubility, and promotes nucleic acid condensation. Can work.   The linker provided herein can be, for example, a given protease, especially a given protease. Present only in the subcellular compartment of the tumor or in tumor cells rather than normal cells By conferring specificity to proteases present at high levels, Confers gender and serum stability to the cytotoxic conjugate. Although present in the intracellular compartment, Particular preference is given to specificities for proteases that are not present in blood. Linker Hama Also includes a sorting signal that directs the conjugate to a specific intracellular locus or compartment. I can see. In addition, the linker can increase the growth factor by increasing the distance between the components of the conjugate. It can reduce steric hindrance between the offspring and other proteins or linked nucleic acids. Re Anker can also condense nucleic acids. For this purpose, the linker also May contain basic amino acids (eg, Lys, Arg), and Is also good.   Increase serum stability, solubility, and / or intracellular concentration, or One or more linkers are used to condense specific factors. Inserted between the isogenic ligand and the nucleic acid binding domain. With these linkers Peptide linkers such as intracellular protease substrates, and acid labile phosphorus Chemical linkers such as car, ribozyme substrate linkers and the like. Pepti The drinker may be inserted using a heterobifunctional reagent as described below, Alternatively and preferably, the DNA encoding the ligand encodes the nucleic acid binding domain. Ligated to other growth factors, including FGF, heparin-binding growth factor Linked to a factor or cytokine.   Chemical linkers link the linker to FGF, other growth factor proteins, or It can be inserted by covalent attachment to tocaine and a nucleic acid binding domain. The linker can be linked via the N-terminus or C-terminus or via an internal residue. rear The described heterobifunctional agents can be used to achieve such covalent bonding. You.a. Protease substrate   Peptides encoding protease-specific substrates are composed of a ligand and a nucleic acid binding domain. Can be introduced between the This peptide is a heterobifunctional reagent as described below. Or preferably, by recombinant means and obtained It may be inserted by expression of a chimera.   As long as the substrate is cleaved in the intracellular compartment, any protease-specific substrate ( See, for example, O'Hare et al., FEBS 273: 200-204, 1990; Forsberg et al. Protein Chem. 1 0: 517-526, 1991; Wesby et al., Bioconjugate Chem. 3: 375-381, 1992) is also a linker Can be introduced as Preferred substrates include higher levels in tumor cells Expressed in Escherichia coli, preferentially expressed in endosomes, or not present in blood Substrates specific for different proteases. The following substrates are used herein Included in substrates intended to be used in accordance with the method of: Cathepsin B group Quality, cathepsin D substrate, trypsin substrate, thrombin substrate, and recombinant subtilis Lysine substrate.b. Flexible linkers and linkers to increase solubility of conjugates   Flexible linkers to reduce steric hindrance and to increase the solubility of the conjugate The linker can be used alone or with another linker, such as a protease-specific substrate linker. It is intended to be used together. Typically, these linkers are small amino acids (I.e., small side chains) and uncharged polar side chains. These Mino acids (Gly, Ser, Thr, Cys, Tyr, Asn, Gln) are more soluble in water. This Of these amino acids, Gly and Ser are preferred. As such a linker :   a. Gly_FourSer SEQ ID NO: 47   b. (Gly_FourSer)_TwoSEQ ID NO: 48   c. (Ser_FourGly)_FourSEQ ID NO: 49   d. (Ser_FourGly)_TwoSEQ ID NO: 50   e. (AlaAlaProAla)_nWherein n is 1-4, preferably 2. (SEQ ID NO: 5 1) Like (Gly_FourSer)_n, (Ser_FourGly)_n, And (AlaAlaProAla)_n(Where n is 1 to 6 , Preferably 1 to 4), but is not limited thereto.c. Heterobifunctional cross-linking reagent   Form a covalent bond between amino group and thiol group to introduce thiol group to protein Numerous heterobifunctional crosslinkers used to insert are known to those skilled in the art ( For example, the preparation and use of such reagents is described, and the commercial PIERCE CATALOG to provide industrial sources, Immuno Technology Catalog & Handbook See, eg, Cumber et al., Bioconjugate Chem. 3: 397-401, 1992; Thorpe et al., Cancer Res. 47: 5924-5931, 1987; Gordon et al., Proc. . Natl. Acd. Sci. 84: 308-312, 1987; Walden et al. Mol. Cell Immunol. 2; 191 -197, 1986; Carlsson et al., Biochem. J. 173: 723-737, 1978; Mahan et al., Anal. Bi ochem. 162: 163-170, 1987; Wawryznazak et al., Br. J. Cancer 66: 361-366, 1992;  Fattom et al., Infection & Immun. 60: 584-589, 1992). These trials The drug is a receptor binding internalizer with a protease substrate peptide linker Used to form a covalent bond between the isogenic ligand and the nucleic acid binding domain. Can be These reagents include N-succinimidyl-3- (2-pyridyldiamine Thio) propionate (SPDP: disulfide linker); sulfosuccinimidi 6- [3- (2-pyridyldithio) propionamide] hexanoate (sulfur E-LC-SPDP): succinimidyloxycarbonyl-α-methylbenzylthio Sulfate (SMBT, hindered disulfide linker); succinimi Jil 6- [3- (2-pyridyldithio) propionamide] hexanoate (LC -SPDP); sulfosuccinimidyl 4- (N-maleimidomethyl) cyclohexa 1-carboxylate (sulfo-SMCC); succinimidyl 3- (2-pyri (Zirdithio) butyrate (SPDB: hindered disulfide bond linker); Cinimidyl 2- (7-azido-4-methylcoumarin-3-acetamido) ethyl 1,3'-dithiopropionate (SAED): sulfosuccinimidyl 7-a Zido-4-methylcoumarin-3-acetate (SAMCA); sulfosuccinimidi 6- [α-methyl-α- (2-pyridyldithio) toluamido] hexanoate (Sulfo-LC-SMPT); 1,4-di- [3 '-(2'-pyridyldithio) propyl Onamide] butane (DPDPB); 4-succinimidyloxycarbonyl-methyl Ru- (2-pyridylthio) toluene (SMPT, hindered disulfate linker): Luphosuccinimidyl 6 [-methyl- (2-pyridyldithio) toluamide] hex Sanoate (sulfo-LC-SMPT): m-maleimidobenzoyl-N-hydroxy Succinimide ester (MBS): m-maleimidobenzoyl-N-hydroxy Sulfosuccinimide ester (sulfo-MBS); N-succinimidyl (4- Iodoacetyl) aminobenzoate (SIAB: thioether linker); sulfo Succinimidyl (4-iodoacetyl) aminobenzoate (sulfo-SIAB) : Succinimidyl 4 (p-maleimidophenyl) butyrate (SMPB); sulfo Succinimidyl 4- (p-maleimidophenyl) butyrate (sulfo-SMPB) : Includes, but is not limited to, azidobenzoyl hydrazide (ABH) .   These linkers can be peptide linkers (eg, linkers that increase flexibility). It should be particularly useful when used in combination with-).d. Acid-degradable, photo-degradable and heat-sensitive linkers   Acid-decomposable linkers include bismaleimidoethoxypropane, Hydrazine linkers (eg, Fattom et al., Infection & Immun. 60: 584-589, 1992). And entry into the intracellular transferrin cycling pathway Acid labile transferrin containing sufficient transferrin moiety to render Conjugates (see, for example, Welhoer et al., J. Biol. Chem. 266: 4309-4314, 1991). But not limited to these. A conjugate linked via an acid-decomposable linker is It should preferentially be cleaved in acidic intracellular compartments such as endosomes.   Photodegradable linkers are linkers that are cleaved upon exposure to light (e.g., Goldm acher et al., Bioconj. Chem. 3: 104-107, 1992). Releases targeted drugs upon exposure to (Hazum et al., Proc. Eur. Pept. Symp., 16th, Brunfeldt, K (Ed), 105-110, 1981; Photolytic protection against cysteine Nitrobenzyl group as a group; Yen et al., Makromol. Chem. 190: 69-92, 1989; Hid Roxypropyl methacrylamide copolymer, glycine copolymer, fluorescein -Soluble photodegradable copolymers containing copolymers of methyl and rhodamine ー; and Senter et al., Photochem. Photobiol. 42: 231-237, 1985; Nitrobenzyloxycarbonyl chloride cross-linking reagent that produces union). Such a resource The skin or eye condition and other tissues (eg, to prevent or treat restenosis) Are particularly useful for treating blood vessels during angioplasty in a surgical procedure. It can be exposed to light using fiber optics. After administration of the conjugate, The skin or other body part is exposed to light, releasing the targeted moiety from the conjugate Can occur. It releases cytotoxic factors during internalization Allows the administration of higher doses of such conjugates as compared to conjugates Should be. Thermosensitive linkers have similar applicability.H. Expression of receptor-binding internalized ligand and nucleic acid binding domain Expression vectors and host cells for   Examples of the host organism include bacteria (eg, E. coli) and yeasts (eg, Saccharomyces).  cerevisiae and Pichia pastoris), mammalian cells, and insect cells , An organism in which a heterologous protein is produced recombinantly can be mentioned. Currently preferred inn The main organism is an E. coli bacterial strain.   A DNA construct encoding the desired protein is used for expression in a suitable host. Is introduced into the plasmid. In a preferred embodiment, the host is a bacterial host . The sequence encoding the ligand or nucleic acid binding domain is preferably Codons are optimized for expression in primary. Thus, for example, human FGF-2 When expressed in bacteria, the codons are optimized for bacterial use. Small code For regions, the gene can be synthesized as a single oligonucleotide. Than For large proteins, multiple oligonucleotide splicing, mutation Induction, or other techniques known to those skilled in the art, may be used. For example, bacteria-codon The sequence of a preferred FGF-SAP fusion is shown in SEQ ID NO: 80. Promoters and operating The sequence of nucleotides in the plasmid, which is a regulatory region, such as Operatively interconnected for Coat growth factor or growth factor-chimera The sequence of nucleotides to be encoded also includes DNA that encodes a secretion signal. Is a precursor protein. Processing that occurs The recovered protein can be recovered from the periplasmic space or the fermentation medium.   In a preferred embodiment, the DNA plasmid also has a transcription terminator sequence including. As used herein, “transcription terminator region” refers to (a) the transcript Subsegment Encoding a Polyadenylation Signal and Site And / or (b) a polymerase that recognizes the selected promoter. And has a subsegment that provides a transcription termination signal that terminates transcription by Perfect Various transcription terminators can be obtained from protein-encoding genes, which The source of the inserted gene or promoter may be the same or different. Good. A transcription terminator is an optional component of the expression system herein, but is preferably Used in a preferred embodiment.   A plasmid as used herein is a protein or polypeptide of interest. And a promoter operably linked to the DNA encoding Designed for expression of the protein in the host. Tightly adjustable promotions Has been found to be preferred for saporin expression. Proteins in this specification Promoters suitable for the expression of quality and polypeptide are widely available and It is well known in the art. Inducible promoter or construct linked to regulatory region Preferred promoters are preferred. Such promoters include T7 phage pro Motor and other T7-like phage promoters (eg, T3, T5 and SP6 Motor), lac promoters such as trp, lpp, and lacUV5 from E. coli A baculovirus / insect cell expression system P10 or polyhedron gene promoter (E.g., U.S. Patent Nos. 5,243,041, 5,242,687, 5,266,317, 4,7 45,051, and 5,169,784) and inducible proteins from other eukaryotic expression systems. Motors include, but are not limited to. For protein expression, Such promoters are operably linked to control regions such as the lac operon. And inserted into the plasmid.   Preferred promoter regions are promoters that are inducible and functional in E. coli. Data area. Examples of suitable inducible promoters and promoter regions E. coli lac which is responsive to isopropyl β-D-thiogalactopyranoside Operator (IPTG; see Nakamura et al., Cell 18: 1109-1117, 1979); Metallothionein promoter metal-mediated which is responsive to metal (e.g., zinc) induction Clause-element (see, for example, U.S. Pat. No. 4,870,009 to Evans et al.); IP Phage T7lac promoter responsive to TG (e.g., U.S. Pat. And Studier et al., Meth. Enzymol. 185: 60-89, 1990), and TAC promoter But are not limited to these.   The plasmid also preferably contains a selectable marker gene (single) that is functional in the host. Or multiple). As selectable marker genes, most non-transformed cells A phenotype that allows transformed bacterial cells to be identified and selectively grown from within And any gene that imparts to a bacterium. Appropriate selectable markers for bacterial hosts Examples of the gene include an ampicillin resistance gene (Amp^r),tetracycline Resistance gene (Tc^r) And the kanamycin resistance gene (Kan^r). Mosquito The namycin resistance gene is currently preferred.   Plasmids also provide a signal for secretion of an operably linked protein. Contains encoding DNA. Secretion signals suitable for use are widely available and It is well known in the art. Prokaryotic and eukaryotic secretory systems functional in E. coli Signals may be used. Currently preferred secretion signals include the following E. coli genes: Encoded by offspring: secreted by ompA, ompT, ompF, ompC Gnal, β-lactamase, alkaline phosphatase and the like (von Heijne, J . Mol. Biol. 184: 99-105, 1985). Further In addition, bacterial pelB gene secretion signal (Lei et al., J. Bacteriol. 169: 4379, 1987), p. The hoA secretion signal and cek2, which is functional in insect cells, can be used. Most preferred The secretion signal is the E. coli ompA secretion signal. Other prokaryotes known to those skilled in the art And eukaryotic secretion signals can also be used (see, eg, von Heijne, J. Mol. Mol. Biol. 184: 99-105, 1985). Using the method described herein Thus, those skilled in the art will recognize that a yeast cell, an insect cell, or a mammalian cell Certain secretion signals can be substituted to cause the protein to be secreted from those cells.   Particularly preferred plasmids for the transformation of E. coli cells include pET expression vectors (See US Pat. No. 4,952,496; available from Novagen, Madison, WI; In addition, see the literature published by Novagen describing this system). I can do it. Such plasmids include T7lac promoter, T7 terminator PET containing the lac, the inducible E. coli lac operator, and the lac repressor gene  11a; T7 promoter, T7 terminator, and E. coli ompT secretion signal Including pET 12a-c; and His-Tag for use in purification on a His column^TMleader A sequence and a thrombin cleavage site that allows cleavage following purification on this column, PET 15b (Novagen, Mad) containing T7-lac promoter region and T7 terminator ison, WI).   Other preferred plasmids include pKK plasmids, especially pKK233-3. , Which contain the tac promoter (available from Pharmacia; furthermore, Brosiu s et al., Proc. Natl. Acad. Sci. 81: 6929, 1984; Ausubel et al., Current Protocols in Molecular Biology; U.S. Patent Nos. 5,122,463, 5,173,403, 5,187,153 No. 5,204,254, 5,212,058, 5,212,286, 5,215,907, 2,220, 013, 5,233,483 and 5,229,279). Plasmid pKK EcoRI digestion with a kanamycin resistance cassette with EcoRI sticky ends Npishi Modified by substitution of a phosphorus resistance marker gene (purchased from Pharmacia; p. See, for example, Vieira et al. (Gene 19: 259-268, 1982; and U.S. Pat. No. 4,719,179). pBlueBac (also called pJVETL and its induction Body), especially pBlueBac III (see, for example, US Pat. Nos. 5,278,050, 5,244,805, 5 No. 5,243,041, No. 5,242,687, No. 5,266,317, No. 4,745,051, and No. 5,169,7 No. 84; available from Invitrogen, San Diego). Rus vectors can also be used for expression of polypeptides in insect cells. pB The lueBacIII vector is a dual promoter vector and Smid is a β-galactosidase residue under the control of an insect recognizable ETL promoter Contains the gene (lacZ) and is inducible by IPTG, so it can be used for blue / white screening. Provides for selection of recombinants. The DNA construct is a baculovirus vector pBlue Insect cells Spodopterafru, which can be made in Bac III and then along with the wild-type virus giperda can be co-transfected (sf9 cells, eg, Luckow et al., Bio / te chnology 6: 47-55, 1988 and U.S. Patent No. 4,745,051).   Other plasmids include pIN-IIIompA plasmids such as pIN-IIIompA2 (e.g., See, for example, U.S. Patent No. 4,573,013; furthermore, Duffaud et al., Meth. Enz. 153 : 492-507, 1987). The pIN-IIIompA plasmid is E. coli Functional fragments derived from the lipoprotein gene and transcriptional readiness It contains an insertion site for heterologous DNA linked to the binding frame. This plasmid is In addition, a DNA fragment encoding the signal peptide of the ompA protein of E. coli The ompA signal at the amino terminus of the desired polypeptide. Expressed with the peptide, which allows for efficient secretion across the plasma membrane Position. This plasmid also provides for transcriptional expression of the desired polypeptide. E. coli lac promoter-operator DNA encoding specific segments, and absence of lac operon inducer Interacts with the lac promoter-operator in the presence to prevent transcription therefrom And another functional E. coli lacI gene encoding a related repressor molecule. Place Expression of the desired polypeptide is determined by the lipoprotein (lpp) promoter and lac pro Under the control of a motor-operator, but not driven from any promoter Transcription is usually blocked by a repressor molecule. Repressor is independence Selective inactivation by the promoter molecule, thereby allowing both promoters Induce the transcriptional expression of these desired polypeptides.   Preferably, the DNA fragment is replicated in a bacterial cell, preferably in E. coli . Preferred DNA fragments also contain a bacterial origin of replication, which allows DNA fragmentation between bacterial generations. To ensure that In this way, large amounts of DNA fragments are transmitted to bacteria. Can be produced by replication. Preferred origins of bacterial replication include fl-ori and Including, but not limited to, the col E1 origin of replication. A preferred host is lac UV Pro T7 RNA polymerase operably linked to an inducible promoter, such as a motor (See US Pat. No. 4,952,496.) When). Such hosts include lysogen E. coli strains HMS174 (DE3) pLysS, BL21 (DE3) pLysS, HMS174 (DE3), and BL21 (DE3), but are not limited thereto. BL21 (DE3 ) Strains are preferred. The pLys strain has low levels of T7 lysozyme, Provide inhibitors.   The provided DNA fragment also contains a gene encoding a repressor protein. It may contain a gene. Repressor protein binds to repressor protein Transcription of a promoter containing a sequence of nucleotides of interest can be suppressed. This professional The motor can be desuppressed by changing the physiological conditions of the cell. For example, this change can be caused by adding an operator or regulatory protein or DN to the growth medium. By adding molecules that inhibit the ability to interact with other regions of A Or by altering the temperature of the growth medium. Preferred repress Sir protein is an E. coli lacI repressor that is responsive to IPTG induction, But is not limited thereto. E.coli The lacI repressor is preferred.   DNAs encoding full-length FGF-2 or FGF-3 muteins were FGF-protamine fusions, respectively. Nuclei such as protamine for intracellular and periplasmic expression of synthetic proteins Ligated to DNA encoding the acid binding domain and expressed pET-11a and pET-12a It is introduced into a pET vector (Novagen, Madison, WI) containing the vector.I. Receptor binding internalized ligand / nucleic acid binding domain conjugate and Of a complex containing a cell and a cell killing factor-encoding substance   Within the scope of the present invention, the specificity of the delivery is achieved via the ligand. Typically The nucleic acid binding domain can be either chemically linked or as a fusion protein. At some point, it binds to the receptor binding internalizing ligand. Or, As described below, the ligand can be directly attached to the nucleic acid and then condensed with the nucleic acid. Can be complexed with a nucleic acid binding protein such as poly-lysine that acts to cause . A linker can optionally be used as described above. Receptor binding internala The isizing ligand confers delivery specificity in a cell-specific manner. The receptor to use -Selection of binding internalized ligand depends on receptor expressed by target cells Depends on the The receptor type of the target cell population is determined by antibody staining, receptor- PCR of cDNA using specific primers and biochemical or functional receptors It can be determined by standard methods such as binding assays. Receptor is cell type-specific Differential or increased expression or activity in the target cell population (ie, It is preferable to have a higher rate of internalization.   As described herein, nucleic acid binding domains can be of two types (Either non-specific in the ability to bind to nucleic acids or amino acid residues Highly specific to bind only to nucleic acid sequences). Non-specific binding protein , Polypeptides, or compounds are generally polycationic or highly basic It is. Lys and Arg are the most basic of the 20 normal amino acids; Residue-enriched proteins are candidates for nucleic acid binding domains. Basic protein Examples of qualities include histone, protamine, and anti-lysine and arginine. Including subunits. Poly-L-lysine is a frequently used nucleic acid binding domain (See U.S. Patent Nos. 5,166,320 and 5,354,844). Poly-L-lysine And protamine are preferred. Other poly such as spermine and spermidine Cations can also be used to bind nucleic acids. For example, gal4, Sp-1, AP-1, my Sequence-specific proteins including oD, and the rev gene product from HIV can be used. You. Specific nucleic acid binding domains are used to internalize the receptor binding of interest. Can be cloned in tandem, individually or in multiples into the desired area of Gand it can. Alternatively, the ligand and the binding domain may be chemically linked to each other.   The corresponding sequence that binds to the sequence-specific domain is included in the construct to be delivered. Can be caught. Receptor-bound internalization of cell killing factor-encoding substances Conjugation to the gand / nucleic acid binding domain requires specific binding to the nucleic acid binding domain. Make it possible. Greater specificity of binding binds to cell killing factor-encoding substance of interest This can be achieved by identifying and using small amino acid sequences that For example Bind to specific nucleic acid sequences with high affinity using phage display Amino acid residues of various lengths can be identified (see US Pat. No. 5,223,409). When). The peptide sequence is then receptor bound as a single copy or multiple copies. Can be cloned into a combined internalized ligand. Alternatively, the peptide It may be chemically coupled to a pter-bound internalized ligand. Combined tongue Incubation of cell-killing factor-encoding substance with protein is specific between the two A natural bond.   These complexes may be expressed, overexpressed, or Cells with appropriate receptors that are more active in internalization Encodes saporins, other cell-killing proteins, or prodrugs Can be used to deliver nucleic acids. Cell killing factor gene is c-myc, early in SV40 Or a late gene, such as a CMV-IE, TK, or adenovirus promoter. Cloned downstream of the milk promoter. As mentioned above, Is active in either cell type, α-crystallin or Active only in a tissue-specific manner, such as rosinase, or event-specific Or inducible, such as MMTVLTR.1. Chemical bonding a. Preparation of receptor-bound internalized ligand   Receptor binding internalized ligands, recombinant DNA technology, appropriate supply Any suitable method, including isolation from a source, purchase from a commercial source, or chemical synthesis. Prepared by the method as discussed. Selected linker (single or multiple) (Number) is generally the number of available channels on the receptor-binding internalized ligand. Receptor-bound internalization by chemical reaction relying on all or amine groups Conjugated ligand. Heterobifunctional linkers are particularly suitable for chemical coupling . Alternatively, if the linker is a peptide linker, the receptor binding The turning ligand, linker and nucleic acid binding domain are It can be expressed recombinantly as a quality.   Any tag that binds and is internalized through receptor interactions Protein can be used herein. In particular, it binds to and binds to FGF receptors Any member of the FGF peptide family that internalizes May be used in part herein. For the chemical bonding method, its tamper The protein can be recombinantly produced, synthetically produced, or commercially or other sources. Can be obtained from a source. In preparing a fusion protein, the DNA encoding FGF can be any It can be obtained from known sources or synthesized according to its DNA or amino acid sequence. (See discussion above).   Although any growth factors can be bound in this manner, FGF, VEGF, and HBEGF Combinations are discussed by way of example only and are not limiting.   If necessary or desired, ligands including chemical conjugates and fusion proteins Heterogeneity in the preparation of (eg, FGF) is the site of inhomogeneity (single U or Can be reduced by modifying the ligand by deleting or substituting I can do it. Such sites in FGFs are typically associated with protein folding. In this case, interaction with other cysteines or one per FGF peptide molecule Cysteine residues still available for interaction with more cytotoxic molecules. You. Thus, such cysteine residues provide the proper folding of the FGF peptide. Or for binding and internalization to the FGF receptor Does not contain any required cysteine residues. In chemical bonding, physiological One cysteine residue available for interaction in this case is not replaced and a cytotoxic site Used as a site for linking to Thus, the resulting modified FGF is A single species of nucleic acid binding domain (or nucleic acid) is associated.   A polypeptide that is reactive with the FGF receptor is a protein in which the obtained FGF protein is Make sure that there is only one cysteine residue available for binding to the damaging agent. Not required for sceptor binding but for reaction with appropriately derivatized cytotoxic factors It can be modified by removing one or more reactive cysteines available. Must If necessary, the contribution of each cysteine to its ability to bind to FGF receptors is empirical Can be determined. Each cysteine residue is a conservative amino acid change (see Table 1 above). ) Can be systematically substituted or deleted. The resulting mutein Indicates the required biological activity, binding to the FGF receptor and the linked cytotoxic moiety Tested for ability to internalize minutes. If mutein is wild type active Cysteine residues are not required if they retain at least 50% of their sex. Sa Cysteines are systematically deleted and replaced, and the resulting mutein is Tested for activity. In this way, it binds to the FGF receptor and Determines minimum number and identity of cysteines needed to retain ability to localize Can be done. Then, the obtained mutant FGF is cytotoxic to cells expressing the FGF receptor. Targeting harmful factors and internalizing cytotoxic factors into such cells Are tested for retention. Retention of proliferative activity is not critical Is an indicator of the retention of such activity. Proliferative activity of bovine aortic endothelial cells For any suitable proliferation assay, such as the one described below, which measures the increase in number, Thus it can be measured.   However, it should be noted that: Modified or mutated FGFs may show reduced or no proliferative activity But if they target cell-killing factor-encoding substances to cells with FGF receptors If it retains its ability to localize, resulting in internalization May be suitable for use herein. Certain residues of FGF-2 are associated with proliferative activity. It is linked. These residues arg116, lys119, tyr120, trp123, ile116, Modifications to glu119, ala120, ala123 can be made individually to remove this function. (See SEQ ID NOs: 81-84). The resulting protein is analyzed using standard assays. Tested for proliferative activity.   Any of FGF-1 to FGF-9 can be used. FGF-1 to FGF-9 The amino acid sequences are known (eg, SEQ ID NO: 10 (FGF-1) and SEQ ID NOS: 12-18 ( FGF-3 to FGF-9, respectively). The comparison between the amino acid sequences of FGF-1 to FGF-9 is one Cy s is conserved among the FGF family of peptides (see Table 3 When). These cysteine residues may be required for secondary structure and are modified Not a preferred residue to be. Each of the remaining cysteine residues is systematically deleted Predicted not to alter the gain and / or serine residue or protein structure It can be replaced by another residue. The resulting peptides are tested for biological activity Is done. If a cysteine residue is required to retain biological activity, it may be deleted. No; preferably, if not necessary, secondary to serine or the resulting protein It is replaced with another residue that does not change its structure.   Appears essential for retention of biological activity and preferred residues for deletion or substitution The cysteine residues from each of the non-groups FGF-1 to FGF-9 are as follows:   For example, FGF-1 has cysteines at positions 31, 98 and 132; FGF-2 has 34, 78, 96 Has cysteines at positions 101 and 101; FGF-3 has cysteines at positions 50 and 115; GF-4 has cysteines at positions 88 and 155; FGF-5 has cysteines at positions 19, 93, 160 and 202. Has stain; FGF-6 has cysteines at positions 80 and 147; FGF-7 has 18, 23, 3 Has cysteines at positions 2, 46, 71, 133 and 137; FGF-8 is 10, 19, 109 and 127 Has a cysteine at position; and FGF-9 has a cysteine at positions 68 and 134.   Since FGF-3, FGF-4 and FGF-6 have only two cysteines, For the purpose of chemical linkage, another residue, preferably the residue near either end, is Cysteine does not delete or replace unless replaced by in Is preferred. For other FGF family members, at least one cis Thein must remain available in association with the cytotoxic conjugate, presumably Is two cysteines, at least the cysteine residues listed in Table 3. A second cysteine may be required to form a disulfide bond. like this In addition, any FGF peptide having more than three cysteines can Modified for chemical conjugation by deleting or replacing residues. 3 FGF peptide with two cysteine residues is modified by removing one cysteine And binds to the cytotoxic site, binds to the FGF receptor, and Tested for ability to internalize site.   Several methods of basic FGF for chemical conjugation according to the methods herein (The preparation of mutein for recombinant expression of the conjugate is described below) . PFC80 encoding basic FGF (PCT Application No. PCT / US93 / 05702; US Patent Application No. 0 No. 7 / 901,718; see also SEQ ID NO: 52). Mutagenesis. The basic FGF (FGF-2) to cysteine 78 serine ((C78S ] FGF) or mutagenesis of cysteine 96 to serine ([C96S] FGF) As judged by the ability to stimulate endothelial cell proliferation, substantially complete Two mutants were generated that retained proliferative activity. Two mutants and a natural tag Protein activity does not differ significantly as assessed by efficiency or maximal response . Sequence analysis of the modified DNA converts each mutant to a serine codon. Cysteine. One, two or all The construction and biological activity of FGF-1 with three cysteine cysteine substitutions is open. (US Pat. No. 5,223,483). The mitogenic activity of the mutant is Similar to or greater than protein. Thus, any Cysteine can also be mutated, and FGF-1 still binds and internalizes You.   The obtained mutein FGF or unmodified FGF is reacted with the nucleic acid binding domain. bF GF mutein is a single species of derivatized nucleic acid binding domain (mono-derivatized nucleic acid binding domain). Main), thereby producing a single species preparation of the FGF-nucleic acid binding domain conjugate And a homogenous composition of the FGF-nucleic acid binding domain chemical conjugate is obtained. Get The resulting chemical conjugate does not aggregate and retains the required biological activity.   VEGF or HBEGF may be isolated from a suitable source, or may be a recombinant Can be produced using DNA technology. To produce a chemical bond herein, Growth factor proteins are generally linked to the core via a reactive amine or thiol group. Binds to a nucleic acid binding domain directly or through a linker to the acid binding domain Let it. Growth factor proteins may be N-terminal, C-terminal or other Binding through any of the locations. In a preferred embodiment, the growth factor protein Can be linked to the linker or to the nucleic acid binding domain via a reactive cysteine residue. Join. In addition, growth factors may be Is near (within about 20, preferably 10 residues from either end) and preferably Substituting residues or inserting cysteines at or near the amino terminus Can be modified by the addition of cysteine residues.   In some embodiments, the heterogeneity of the preparation alters the growth factor protein abruptly. Mutageneses replace reactive cysteines and preferably provide only one It can be reduced by leaving only the available cysteines intact. Success Long factor protein is a site or sites on the growth factor that causes heterogeneity Is modified by deletion or substitution. Such sites are typically Interacts with other cysteines during protein folding or Interaction of phosphorus-binding growth factor peptide with more than one cytotoxic molecule per minute A cysteine residue that is still available for action. As mentioned above, such a system The in residue binds to the correct folding of the growth factor or to the growth factor receptor. Does not contain any cysteine residues required to retain its ability to internalize . One cysteine available for interaction under physiological conditions for chemical bonding No residues are substituted. Because it is the part that connects the cytotoxic part Because it is used as a place. The resulting modified heparin-binding growth factor is Attached to a single species of cytotoxic conjugate.   Alternatively, binds to VEGF, HBEGF or other heparin-binding growth factor receptors The contribution of each cysteine to the ability to perform Can be determined. Each cysteine residue is a conservative amino acid change (see Table 1 above) ) Can be systematically substituted or deleted. The obtained mutein can be Sex: binds to a growth factor receptor and incorporates a linked nucleic acid binding domain and agent. Test for ability to turn. If muteins do not retain this activity If so, no cysteine residue is needed. Systematically delete and place additional cysteines And the resulting muteins are tested for activity. Each remaining cysteine The residues are systematically deleted and / or altered serine residues or protein structure. Can be replaced by other residues that would not be possible. The resulting peptide is biologically Test for activity. If cysteine residues are required for retention of biological activity If so, do not delete it; if not necessary, serine or the resulting tamper It is preferable to substitute with another residue that does not alter the secondary structure of the protein. Like this Ability to bind to and internalize heparin-binding growth factor receptor Can determine the minimum number and identity of cysteines required to retain But, The modified or mutant heparin-binding growth factor has a reduced growth activity. Or do not show it, if they bind unmodified heparin-binding growth factor, Has a receptor that results in internalization of the cytotoxic moiety If the ability to target the linked cytotoxic agent to cells that It is noted that it may be suitable for use in writing. For VEGF, VEGF_{12 1} Contains 9 cysteines and VEGF₁₆₅, VEGF₁₈₉And VEGF₂₀₆Each of VEGF₁₂₁Contains seven additional residues in a region that is absent. Any of the seven Are not essential for targeting and internalization of linked cytotoxic factors. It looks like Su. Recently, Cys-25, Cys-56, in dimerization and biological activity, The role of Cys-67, Cys-101, and Cys-145 has been evaluated (Claffery et al., Biochem. Bi). ophys. Acta 1246: 1-9, 1995). Dimerization requires Cys-25, Cys-56 and Cys-67 And Substitution of any one of these cysteine residues results in the formation of monomeric VEGF Secretion occurs, which is inactive in both vascular permeability and endothelial cell mitogenesis assays Met. In contrast, the biological activity was somewhat reduced but the substitution of Cys145 was dimeric. It had no effect on incarnation. Cys-101 substitutions can be secreted or cytoplasmic proteins Did not result in production. Thus, substitution of Cys-145 is preferred.   The VEGF monomer is preferably linked to a linker or a non-essential cysteine residue. Is linked to the targeting agent. At or at one end, preferably the N-terminus VEGF modified by the introduction of a Cys residue in the vicinity of Preferred. For use herein, preferably a linker and / or linker is used. Alternatively, VEGF is dimerized prior to binding to the targeting agent. Heterobifunctional drugs Linkers, such as, or coupling of proteins to nucleic acids, or proteins Logging methods are known to those of skill in the art and are also described herein.   Necessary for biological activity for recombinant expression using the methods described herein. Can be deleted or substituted up to all cysteines in the missing HBEGF polypeptide You. Alternatively, for use in the chemical conjugation methods herein, cytotoxic All but one of these cysteines used in chemical coupling to the factor have been deleted. Or it can be replaced. Each HBEGF polypeptide described herein has six system It has an in residue. Each of the six cysteines can be independently substituted, and The resulting mutein binds to the HBEGF receptor and is internalized Ability can be tested. Alternatively, the DNA encoding the obtained mutein is A construct comprising DNA encoding a nucleic acid binding domain linked to BEGF encoding DNA Used as part. The construct is expressed in a suitable host cell and the resulting protein Ability to bind and internalize protein to HBEGF receptor test. As long as this ability is maintained, muteins are suitable for use herein. That's right.   Methods for chemical conjugation of proteins are known to those skilled in the art. Chemical bond The preferred method for this depends on the components selected, but is preferably a disulfide bond. It relies on formation. For example, if the targeting substance is SPDP-derivatized saporin VEGF prior to coupling or binding to derivatized saporin It is advantageous to dimerize the moiety. If VEGF is N-terminal, preferably, or Nucleic acids, if modified to include a cysteine residue at or near the C-terminus Coupling to the binding domain should be followed by dimerization. This specification To perform chemical conjugation in a HBEGF polypeptide, one or more selected Via a provided linker or directly to a nucleic acid binding domain.b. Preparation of nucleic acid binding domains for chemical conjugation   A nucleic acid binding domain is prepared for chemical conjugation. Nucleus for chemical bonding The acid binding domain can be derivatized with SPDP or other suitable chemical agent. If join If the sex domain has no Cys residue available for the reaction, an insertion or another amino acid Can be substituted for the acid. If desired, substantially as described, the mono-derivative Species can be isolated.   For chemical binding, the nucleic acid binding domain is Derivatization or inclusion of a cysteine residue for binding to the Can be modified. Typically, derivatization proceeds by reaction with SPDP. As a result , Resulting in a heterogeneous population. For example, 0.9 moles per mole of nucleic acid binding domain Nucleic acid binding domains derivatized by SPDP to the level of gin-disulfide Include a population of underivatized, monoderivatized, and diderivatized SAPs. SPD generally The nucleic acid binding domain protein derivatized with P Therefore, it may lose its ability to bind to nucleic acids (Lambert et al., Cancer Treat. Res. 37: 175- 209, 1988). The amount of underivatized nucleic acid binding domain in the preparation of Can be difficult to cleave, and this can result in the addition of derivatized nucleic acid to the reaction mixture. Estimating the correct proportion of the affinity domain can cause errors.   However, due to the removal of the negative charge by the reaction of SPDP with lysine, the three species are Has a difference in charge. The method herein is based on Mono-S cation exchange chromatography. In order to purify the mono-derivatized nucleic acid binding domain by rely. The use of a purified, mono-derivatized nucleic acid binding domain is Has significant advantages. Receptor binding interface capable of reacting with nucleic acid binding domain The amount of localizing ligand is limited to one molecule with a mono-derivatized substance, Results in a more heterogeneous conjugate in the results presented in the specification I understand. Heterogeneity with mono-derivatized nucleic acid binding domain used here Source is still possible, but binding to cell killer-encoding substances is not affected As long as it is acceptable.   More than one amino group on the nucleic acid binding domain reacts with the succinimidyl moiety More than one amino group on the surface of the protein may be reactive . This raises the possibility of heterogeneity in the mono-derivatized nucleic acid binding domain.   As an alternative to derivatization to introduce sulfhydryls, introduction of cysteine residues Can alter the nucleic acid binding domain. Preferred for introduction of cysteine residues The new locus is located in the N-terminal region (preferably about N-terminal to the nucleic acid binding domain). 1-20 residues).   (React the mono-derivatized nucleic acid binding domain, or Resulting preparation of chemical conjugates using either method (introducing into the affinity domain) The object is a single species; and the composition containing the conjugate does not appear to be agglomerated.2. Fusion of receptor binding internalized ligands and nucleic acid binding domains Synthetic protein   As a preferred alternative, as described below, the heterogeneity is To generate a fusion protein of a localized ligand and a nucleic acid binding domain And can be avoided. Receptor binding in linked to nucleic acid binding domain Expression of DNA encoding the fusion of the turning ligand results in cytotoxic binding A more homogeneous preparation of the body is obtained. Aggregate formation is due to the removal of non-essential cysteines So that the receptor binding internalized ligand and / or nucleic acid binding Modify the domain to prevent interaction between conjugates via free cysteine And may be reduced in preparations containing the fusion protein. As needed , One or more coding regions for endosomal disrupting peptides Can be built as part of   DNA encoding the polypeptide can be isolated, synthesized, or commercially available. It can be obtained from a source or can be prepared as described herein. Recombination Expression of the polypeptide can be performed as described herein; The DNA encoding these polypeptides can be used for the methods described herein. Can be used as starting material.   As described above, FGF, VEGF, HBEGF hepatocyte growth factor, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-8, IL-10, IL-11, IL-13, TNF, GM-CSF, IFN and IGF polypep The DNA encoding the tide and / or the amino acid sequence of these factors is described above. ing. DNA can be prepared synthetically based on amino acids or DNA sequence, or Are available to those skilled in the art, such as PCR, library probe hybridization, etc. It can be isolated using known methods or obtained commercially or from other sources. You. For example, a cDNA encoding FGF is converted from a plasmid containing a cDNA encoding FGF. Suitable methods for amplifying are described in the examples.   As described herein, such DNA is then responsible for any aggregate formation. Mutations can be made using standard methods to delete or replace any cysteine residues. May be induced. If necessary, the identity of cysteine residues that contribute to aggregate formation Deleting and / or replacing cysteine residues, cysteine deleted The resulting growth factor is in a solution containing physiologically acceptable buffers and salts. It can be determined empirically by ascertaining whether aggregates form. Cysteine Positions for insertion of residues can also be determined empirically. Generally, C- or, preferably, Is preferably the region at or near the N-terminus (within 20, preferably 10 amino acids).   Insert the DNA construct encoding the fusion protein into the plasmid, as described above. And expressed in a selected host, and Ligated ligand-nucleic acid binding domain conjugate can be produced. Multiple copies of the chimera One can be inserted into a single plasmid in operable linkage with one promoter. Departure When revealed, the resulting protein is multimeric. Typically, chimeras 2-6 The copies are inserted into one plasmid, preferably in a head-to-tail fashion.a. Preparation of muteins for recombinant production of fusion proteins   Cysteine removal, which is not required for conjugation and internalization, is Preferred for both recombinant and recombinant methods of chemical conjugation methods, All but one of the key cysteines are deleted or substituted. In fact, FGF For polypeptides, 2 (including each of the cysteine residues listed in Table 3) Only one cysteine, and possibly only those listed in Table 3, It appears necessary to retain the required biological activity of the F peptide. Like this, 2 FGF peptides with more cysteines replace the remaining cysteines with serine By doing so. The resulting muteins are tested for the required biological activity. You can experiment.   FGF peptides with two cysteines, such as FGF-3, FGF-4 and FGF-6, Can be modified by substituting a second cysteine not listed in Table 3, The mutein obtained in this way has a cytotoxic factor linked to DNA encoding FGF. Used as part of the construct containing the DNA to be loaded. A suitable inn for this construct The protein is expressed in the main cells, and the resulting protein binds to the FGF receptor. Test for ability to internalize vesicle-toxic factor. Illustrated herein As you do, Cys⁷⁸And Cys⁹⁶Containing bFGF mutein substituted with a serine residue Coalescence was prepared.b. DNA constructs and expression of DNA constructs   To produce a mono-species preparation of the fusion protein, the FGF protein or other Expression of DNA encoding receptor-binding internalized ligand Any system in which the FGF portion of the resulting fusion protein is available for the reaction Modify to not include in. In a preferred embodiment, the FGF polypeptide Is linked to DNA encoding the nucleic acid binding domain. FGF PO Encodes a repeptide or other receptor binding internalizing ligand DNA removes possible translation stop codons and transcription or translation stop signals. , And modified to remove or replace available cysteine-encoding DNA. Changed. The DNA is then replaced with the first codon of the direct or nucleic acid binding domain. Via a linker region of one or more codons between the FGF and the last codon of FGF Ligation to DNA encoding the binding domain polypeptide. Linker region support The result is that the resulting conjugate binds to the target cell, and thereby It can be of any length as long as Currently, about 1 to about 75 to 90 codons The pacer region is preferred. Receptor-bound internals in fusion proteins The order of the isizing ligand and the nucleic acid binding domain can be reversed. If nucleic acid binding If the sex domain is N-terminal, it is a stop codon and any stop signals Are also removed.   As described above, all including FGF, VEGF, HBEGF, cytokines, growth factors, etc. The heparin binding protein is modified according to the methods described herein and Can be expressed. Binding to FGF receptor followed by internalization Is the only activity required for an FGF protein suitable for use herein. FGF All of the proteins are from a very wide range of normal diploid mesoderm and neural crest derived cells. Induces mitogenic activity in vesicles, and this activity binds to FGF cell surface receptors. If so, it is mediated by subsequent internalization. FGF receptor Such “FGF mitogens” reflect their ability to integrate and be internalized The test for `` activity '' is the ability to stimulate the growth of cultured bovine aortic endothelial cells ( See, for example, Gospodarowicz et al. Biol. Chem. 257: 12266-12278, 1982; Gospodaro wicz et al., Proc. Natl. Acad. Sci. USA 73: 4120-4124, 1976).   If FGF or other ligand lacks mitogenic or other biological activity If modified, binding and internalization should Or it can still be easily assayed by any one of the other equivalent tests. General Typically, these tests involve the step of labeling the ligand and inking it with the target cells. And the step of visualizing or measuring the intracellular label. For example, Briefly, FGF is fluorescently labeled with FITC, or¹²⁵Can be radiolabeled with I. Fluorescein-conjugated FGF is incubated with the cells, and internalized. Examine microscopically by fluorescence or confocal microscopy for the application. FGF To¹²⁵When labeled with I, labeled FGF is incubated with cells at 4 ° C. cell Temperature shifted to 37 ° C. and washed with 2M NaCl at low pH to remove all cell-bound FGF. Remove. The label is then counted, which allows internalization of FGF. Measurement. Alternatively, the ligand can be any of the methods described herein. Binds to the nucleic acid binding domain and encodes a saporin-encoding plasmid. And complex with it. As described below, cells can be transferred using this complex. And cytotoxicity can be measured.   The resulting receptor binding internalized ligand-nucleic acid binding domain The encoding DNA can be inserted into a plasmid, as described above, and It can be expressed in a host and produce a mono-species preparation. FGF-2 and protamine fusion Proteins are particularly suitable for use in the present invention.   Modified receptor binding internalized ligand / nucleic acid binding domain Multiple copies of the chimera of Can be inserted into the mid. When expressed, the resulting protein is multimeric. Typical Contains two to six copies of the chimera, preferably one in a head-to-tail fashion Inserted into the plasmid.   By way of example only, the DNA encoding human bFGF-SAP having SEQ ID NO: 52 may be duplicated. Mutagenesis as described in the Examples using Splicing by Extension (SOE) I let it. Another preferred coding region is set forth in SEQ ID NO: 53. In both examples In a preferred embodiment, the cysteines at positions 78 and 96 are replaced with serine. And thereby modify the DNA. Cod encoding cysteine residues at positions 78 and 96 of FGF Was converted to serine codon by SOE. Each application of the SOE method is Containing a modified codon at the position where mutation is desired and having a complementary end. A hybrid product is produced using the two amplified oligonucleotide products. Let By a second amplification reaction using two primers that anneal to non-overlapping ends Amplify the hybrid to produce DNA with the desired modification.3. Details of receptor-binding internalized ligand / nucleic acid binding domain conjugate Binding to vesicle killing factor-encoding substances   A receptor binding internalized ligand / nucleic acid binding domain is delivered The nucleic acid to the substance together with the cell killing factor-encoding substance, preferably a linear DNA molecule to be Incubate under conditions that allow binding of the binding domain. Conditions are nucleic acid binding It varies somewhat depending on the nature of the fusion domain, but is typically 0.1 M NaCl and 20 mM Occurs in M HEPES, or other similar buffers. Alternatively, change the salt conditions Can increase the packing or condensation of DNA. The degree of binding is preferably Test on the preparation. After conjugation, additional nuclei such as poly-L-lysine An acid binding domain may be added to further condense the nucleic acid.   By way of example only, a test construct was made and tested. One construct is bF It is a chemical conjugate of GF and poly-L-lysine. The bFGF molecule has a Cy at position 96 A variant in which the s residue has been changed to serine; therefore, only Cys at position 78 binds Available to This bFGF is called FGF2-3. Induce this poly-L-lysine with SPDP Conducted and coupled to FGF2-3. This FGF2-3 / poly-L-lysine The conjugate is used to deliver a plasmid capable of expressing the β-galactosidase gene. Was.   Conveniently, the ability of the construct to bind to the nucleic acid molecule is agarose gel electrophoresis. It can be assessed by electrophoresis. Briefly, plasmids such as pSVβ are restricted Digestion yields various fragment sizes. Terminals for ease of detection Can be filled in with DNA polymerase I or converted to alkaline phosphatase. Therefore, after dephosphorylation, the 5'-end is phosphorylated with polynucleotide kinase. This fragment by either³²Can be labeled with P. Then plus Mido Fragment for Receptor Binding Internalized Ligand / Nucleic Acid Binding Domain 20 mM HEPES (pH 7.3), 0 Incubate in a buffered saline solution such as 1M NaCl. The reaction mixture Electrophoresed on agarose gel with similarly digested but unreacted fragments Move. If the radiolabel is incorporated, the gel is dried and autoradiated. It can be subjected to ography. If no radiolabel is present, run this gel on ethidium. Stain with bromide and excite the DNA with appropriate red filters after UV excitation. Can be visualized through Fragment mobility is delayed compared to controls If binding has occurred. In the case of the examples, FGF2-3 / poly-L-lysine conjugate The fragment mobility was delayed after ligation. If the join is not enough, Further poly-L-lysine may be added until observed.   The conjugate binds to the cell surface receptor and is internalized in the cell Further testing of the conjugate is performed to show that Conjugate receptor It is not necessary that the binding internalized ligand moiety retain full biological activity. No. For example, FGF is mitogenic for certain cell types. As mentioned above, This activity may not always be desirable. If this activity is present, growth Do the essay. Similarly, appropriate assays can be performed for each desired activity. You. However, in the application of the present invention, the only criteria that need to be met is the receptor -Binding and internalization.   Receptor binding and internalization were performed in three assays: Thus it can be measured. (1) Competition of the complex with cells expressing the appropriate receptor Inhibition assays indicate receptor binding. (2) Receptor binding and internal Ligation is performed using a plasmid encoding the reporter gene and the receptor. Form a conjugate of a binding internalized ligand and a nucleic acid binding domain in a complex Expression of a reporter gene such as β-gal (eg, (For example, enzyme activity). This assay is It is particularly useful for optimizing conditions that give rise to large transformations. Therefore, nucleic acid Optimal ratio of receptor binding internalized ligand / nucleic acid binding domain And the amount of DNA per cell can be assayed for and compared to the enzyme activity of β-gal. And can be easily determined by As such, these first two assays are Useful for preparative analysis and does not show receptor binding or β-gal activity The fact is that further analysis can be used to internalize candidate receptor binding Does not exclude ligand / nucleic acid binding domain conjugates or fusion proteins. (3) A preferred assay is a receptor binding internalized ligand / nucleic acid binding Performed on cells transformed with a cell killing factor-encoding substance bound by the main This is a cytotoxicity assay. Generally, any cell-killing molecule can be used However, ribosome-inactivating proteins are preferred, and saporin or another type I Bosome-inactivated proteins are particularly preferred. A statistically significant decrease in cell number Scepter binding internalizing ligand / nucleic acid binding domain conjugate or fusion Shows the ability of coalescence to deliver nucleic acid into cells.4. Binding of ligands to nucleic acids and binding to nucleic acid binding domains   Alternatively, the receptor internalizing binding ligand can be directly or The nucleic acid can be attached either via an linker. 5 'end, 3' end and its Elsewhere, the nucleic acid is ligated to the amino and carboxyl termini And methods for coupling to other sites are known to those of skill in the art (for a review, see For example, Goodchild (1993) Perspectives in Bioconjugate Chemistry, Mears , American Chemical Society, Washington, D.C., pp. 77-99). An example For example, ultraviolet irradiation (Sperling et al. (1978) Nucleic Acids Res. 5: 2755-2773; Fiser (1975) FEBS Lett. 52: 281-283), bifunctional chemicals (Baumert et al. (1978) Eur . J. Biochem. 89: 353-359; and Oste et al. (1979) Mol. Gen. Genet. 168: 81-86) And photochemical crosslinking (Vanin et al. (1981) FEBS Lett. 124: 89-92; Rinke et al. (1980) J. . Mol. Biol. 137: 301-314; Millon et al. (1980) Eur. J. Biochem. 110: 485-454) Is used to link the protein to the nucleic acid.   In particular, the reagents (N-acetyl-N '-(p-glyoxylylbenzoyl) cystamine and Using 2-iminothiolane, DNA is converted into protein, through mixed disulfide formation. For example, α-macroglobulin (α_TwoM) (Cheng et al., N ucleic Acids Res. 11: 659-669, 1983). N-acetyl-N '-(p-gly Oxylylbenzolyl) cystamine is specific for unpaired guaninine residues And upon reduction yields free sulfhydryl groups. 2-iminochi Oran reacts with proteins to produce sulfhydryl groups, which in turn It is bound to the derivatized DNA by a disulfide exchange reaction. The targeting nucleic acid is a conjugate Any linkage can be used as long as it is active in the internalization of You. Thus, it is expected that a break in the linkage may be necessary. But the promoter DNA encoding a ribozyme linked to a nucleic acid or a therapeutic agent for delivery to a nucleic acid. For some reagents, such as DNA to be loaded, such cleavage may not be necessary it is conceivable that.   Preferred thiol linkages use heterobifunctional reagents. And can be easily formed. The amine also converts the nucleic acid 1- in imidazole buffer at pH 6. Ethyl-3 '[3-dimethylaminopropyl] carbodiimide (EDC) or N-ethyl-N Water-soluble carbs such as' (3-dimethylaminopropylcarbodiimide hydrochloride (EDCI) By reacting with a bodimide to form 5 'phosphorimidazolide, In an aqueous solution, the terminal 5 ′ phosphorus of the unprotected oligonucleotide or nucleic acid Attached to acids. 5 'phosphorimidazolide is converted to FGF and ethylenediamine Contact with amine-containing molecules such as (See, for example, Chu et al., Nucleic Acids Res. 11: 6513-6529, 1983; and WO 88/05077. checking). In particular, the solution of DNA is saturated with EDC at pH 6 and brought to 4 ° C. And incubate overnight with stirring. The resulting solution is then, for example, Buffered to pH 8.5 by the addition of 3 volutes of 100 mM citrate buffer. And add about 5 μg to about 20 μg of FGF and stir the resulting mixture at 4 ° C. for about 48 hours. You. The unreacted protein is, for example, 0.1 M ammonium carbonate at pH 7.0 as elution buffer. Column chromatography using Sephadex G75 (Pharmacia) using chromium solution Can be removed from the mixture. The isolated conjugate is lyophilized and used. Can be stored until   U.S. Pat. No. 5,237,016 discloses a 5'-terminal bromoacetylated nucleotide. And reacting the resulting oligonucleotide with a thiol group. Provide a way. Oligos derivatized with their 5 'terminal bromoacetyl groups The nucleotide is a 5'-amino acid, as described in U.S. Patent No. 5,237,016. Hexyl-phosphoramidate oligonucleotides are converted to bromoacetic acid-N-hydroxys It can be prepared by reacting with succinimide ester. This patent also Thiol-derivatized nucleotides (which are then thiol derivatized on selected growth factors) Which can be reacted with a thiol group) is described. In short, Thio Derivatized nucleotides use 5'-phosphorylated nucleotides in two steps (1) In one reaction step, the phosphoric acid group in the presence of diimide Reaction with imidazole and replacement of the imidazole leaving group with cystamine; Reduction of the disulfide bond of the cystamine linker with dithiothreitol. Orgel et al. (1986) Nucl. Acids. Res. See also 14: 651 thing). The 5'-phosphorylated starting oligonucleotide is prepared by methods known to those skilled in the art. (Eg, Maniatis et al. (1982) Molecular Cloning: A Laboratory Man ual, Cold Spring Harbor Laboratory, New York, p. 122).   Nucleic acids such as methylphosphonate oligonucleotides (MP oligomers) It can be derivatized by reaction with DP or SMPB. The obtained MP oligomer is Purified by HPLC as described above, then FGF (eg, FGF or FGF And modified by substitution of one or more cysteine residues. Dissolve MP oligomer (about 0.1 μM) in 40-50 μl of 1: 1 acetonitrile / water This is supplemented with phosphate buffer (pH 7.5, final concentration 0.1 M) and about 1 ml of phosphate buffered Food Add 1 mg MP oligomer in saline. The reaction is allowed to proceed at room temperature for about 5-10 hours, Then, quench with about 15 μL of 0.1 iodoacetamide. FGF-oligonucleoside The tide conjugate was purified on a heparin sepharose Hi Trap column (1 ml, Pharmacia). And can be eluted with a linear or step gradient. This conjugate is 0.6M  It should elute in NaCl.   The ligand binds to a nucleic acid construct encoding a cell killing or cytotoxic factor. Oligonucleotides that can be combined or complementary to one strand of the construct It can be bound to a mixture of otides. The oligonucleotide is then transferred to the double-stranded construct. Is added or increased to the single-stranded construct produced by melting To isolate as a single strand. As a general guideline, oligonucleotides are When a double-stranded construct is used as a starting material, it hybridizes at a higher temperature than the construct alone. Should soy. Fill in the gap with DNA polymerase I One strand bound to the ligand and one unbound strand This results in a construct having Construction with different strands linked to a ligand In addition to producing a mixture of the May be used. Any remaining single-stranded plasmid Can be digested with a single-strand-specific endonuclease. Then the ligand-binding Mixing the construct with a nucleic acid binding domain, such as protamine or polylysine, This results in condensation of the construct for delivery. The optimal ratio of ligand to DNA is determined by the reporter -By receptor-mediated transfection of a construct containing the gene Can be determined empirically. J.Formulation and administration of pharmaceutical compositions   The conjugates and complexes provided herein can be used for various diseases, syndromes, and Useful for treating and preventing hyperproliferative disorders. As used herein, "treatment" Ameliorates or otherwise favorably changes the symptoms of the condition, disorder, or disease Means any style. The treatment may also include any of the drugs of the compositions herein. It also includes scientific use. Administration of certain pharmaceutical compositions as used herein "Improvement" of the symptoms of a particular disability by a person, whether permanent or temporary so Administration of this composition, whether continuous or transient Any mitigation that can be attributed to or associated therewith. For example, these Laser surgery, glaucoma surgery, and pterygium using conjugates and complexes Ocular complications after removal of the piece may be treated. After these procedures, the problem of recurrence is Or as a result of the proliferation of cells in the eye. This conjugate and The complex inhibits the growth of these cells. The conjugates and complexes are generally Pathophysiology by specifically targeting cells with corresponding receptors Treat biological conditions, particularly FGF-, VEGF-, or HBEGF-mediated pathophysiological conditions Can be used for   As used herein, “FGF-mediated pathophysiological condition” refers to FGF-division Characterized by or growth of cells susceptible to a stimulating stimulus A harmful condition caused by this. Basic FGF-mediated pathophysiological conditions Have melanoma, other tumors, rheumatoid arthritis, restenosis, Dupuytren's contracture And certain complications of diabetes such as proliferative retinopathy Not.   As used herein, "HBEGF-mediated pathophysiological condition" refers to HBEGF Characterized by or due to the proliferation of cells sensitive to mitogenic stimuli A harmful condition caused by HBEGF-mediated pathophysiological conditions are Pathophysiological proliferation of smooth muscle cells such as stenosis, solid tumors including breast and bladder cancer Specific tumors such as, tumors associated with the pathophysiological expression of the EGF receptor, psoriasis Skin disorders such as, and over, such as pterygium recurrence and secondary lens turbidity Includes conditions involving ocular disorders associated with skin cells.   Similarly, tumors and tumors that express cytokine or growth factor receptors And hyperproliferative cells can be eliminated. Such diseases include restenosis, Dupuytren Contracture, diabetic retinopathy, rheumatoid arthritis, Kaposi's sarcoma, lymphoma, leukemia, kidney Tumors such as hepatocellular carcinoma, colon carcinoma, breast cancer, bladder cancer, diseases behind the eyes (eg Underlying blood (such as proliferative vitreoretinopathy, macular degeneration and diabetic retinopathy) Includes diseases associated with duct growth. Especially in the back of the eye, cell killing factors or cells The use of a VEGF-receptor promoter to control the expression of the damaging factor is preferred. This conjugate can be used to treat corneal laser radiation during eye surgery, especially LRK. It may prevent corneal haze or turbidity resulting from exposure. Haze and cloudiness Is due to the proliferation of fibroblasts and keratocytes in the subepithelial region after corneal photoablation. It seems to come.   The conjugate can be used to treat "hyperproliferative skin disorders". As used herein As it is, it increases the number of skin endothelial cells coupled with the underlying vascular growth. A disorder manifested by multiplication, resulting in scaly or horny or thickened It results in localized patches of skin or tumors of endothelial origin. Such obstacles are Dermatitis and atopic dermatitis, toxic eczema, allergic eczema, psoriasis, skin cancer, And other tumors such as Kaposi's sarcoma, hemangiosarcoma, hemangiomas, and highly vascularized Tumors, and vasoproliferative responses such as varicose veins.   Similarly, the conjugate can be used to reduce restenosis (which occurs after angioplasty in which the artery has reoccluded). Process and resulting condition) can be treated or prevented. Balloon mosquito After treatment of the artery with Tethel or other such device, configure the lining of the blood vessel Exposure of the inner wall of the vessel occurs, including the removal of the endothelial cells that become involved. This removal and simultaneous Smooth muscle cells (SMCs) that form the vasculature proliferate as a result of vascular injury And fill the interior of the blood vessel. This process and the resulting condition is restenosis .   Pharmaceutical carriers suitable for administering the conjugates and conjugates provided herein Alternatively, the vehicle may be any such known in the art that is suitable for the particular mode of administration. Including a good carrier. Further, the conjugates and conjugates are the only pharmaceutically active agents in the composition It may be formulated as an active ingredient or may be combined with other active ingredients.   The conjugates and complexes can be in any suitable form, in liquid, semi-liquid, or solid form. Depending on the route, for example, oral, parenteral (including intravenous, intradermal, subcutaneous, or topical )) And are formulated in a manner suitable for each route of administration. Preferred administration The manner depends on the indication being treated. Dermatological and ophthalmic indications are typically Treated locally, whereas tumors and restenosis are typically systemic, intradermal, or otherwise. Or by the intramuscular mode of administration.   The conjugates and complexes herein are topical, local, venous It can be formulated into pharmaceutical compositions suitable for internal and systemic application. In this specification Ophthalmic use for topical administration by topical administration or injection (Local) administration is preferred. Time release formulations are also desirable. One or more of the effective concentrations The conjugates and conjugates are mixed with a suitable pharmaceutical carrier or vehicle. Honcho As used herein, an "effective amount" of a compound for treating a particular disease is defined as An amount sufficient to ameliorate or somewhat reduce the symptoms associated with the disease. Such an amount may be administered as a single dose or may be administered according to a regimen. May be given, thereby being effective. This amount can cure the disease, but typically Is administered to ameliorate the symptoms of the disease. To achieve the desired improvement in symptoms For example, multiple doses may be required.   As used herein, an "ophthalmically effective amount" refers to the composition to which it is administered. Depending on the technique used and the technique used to administer the cornea after excimer laser surgery. Prevents or reduces blemishes, prevents travel lecttomy closure, and recurs pterygium And related ocular tissue sufficient to prevent or substantially delay other conditions Is the amount that provides the amount of the therapeutic agent for   Effective conjugate and complex concentrations or amounts will improve symptoms upon administration. Or requires delivery of an amount to treat the disease. Typically, the composition is a single Formulated for dosage administration. Therapeutically effective concentrations and amounts are described herein. Conjugates and complexes in known in vitro and in vivo systems such as It can be determined empirically by testing coalescence; then human or other Product dosages can be extrapolated from them.   The conjugate is therapeutically active in the absence of undesired side effects on the patient being treated. Contained in a pharmaceutically acceptable carrier in an amount sufficient to produce a useful effect on You. The conjugate can be combined with a pharmaceutically acceptable salt, ester, or other derivative of the conjugate. Can be delivered. For these, known methods for such derivatization are used. Can be readily prepared by those skilled in the art and have no substantial toxic effects on animals or humans. Any salt, ester, or derivative that results in a compound that can be administered to . The number and extent of side effects will depend on the condition to which the conjugate and conjugate are administered. Is understood. For example, certain toxicities and unwanted side effects are life threatening Tolerated when treating disease (eg, tumors) and to treat disorders with smaller consequences. Place If not, it is not acceptable. The concentration of the conjugate in the composition will determine its absorption, inactivation, And elimination rate, dosing regimen, and amount administered, as well as other factors known to those of skill in the art. It depends on the factor.   Preferably, the conjugate and the conjugate are substantially pure. As used herein As such, "substantially pure" refers to those skilled in the art for assessing such purity. Thin-layer chromatography (TLC), gel electrophoresis, high-performance liquid chromatography When measured by standard methods of analysis such as chromatography (HPLC), Homogeneous or even sufficiently to appear to be free of readily detectable impurities Purification depends on the physical and chemical properties of the substance (eg, enzymatic and biological activities). Gender) is sufficiently pure so as not to detectably alter it. Real Methods for purifying compounds to produce chemically pure compounds are known to those skilled in the art. is there. However, a substantially chemically pure compound is a mixture of stereoisomers Is also good. In such cases, further purification may increase the specific activity of the compound.   Typically, a therapeutically effective dose will range from about 0.1 ng / ml to about 50-100 μg / ml of the active ingredient. Should result in a serum concentration of 1 minute. Pharmaceutical compositions will typically be selected From about 0.01 mg to about 100-2000 mg binding per kg body weight per day, depending on the coalescence A body dose should be provided. For example, in the treatment of restenosis, (FGF-SAP chemical Conjugates or equivalents provided herein on a molar basis Daily dose between about 0.05-0.5 mg / kg should be sufficient) is there. Topical application for ocular and dermatological disorders is approximately From 1 ng to 100 μg, preferably from about 1 ng to about 10 μg, should be provided. Administered The amount chosen will depend on the conjugate selected, the indication being treated, and possibly the It is understood that it is a function of the action.   Known in vitro and in vivo systems, such as the systems described herein (eg, For example, in a mouse, rat, rabbit, or baboon model) By testing the conjugate, a therapeutically effective concentration and amount can be determined herein. Can be empirically determined for each application of; the dosage for humans or other animals is then They can be extrapolated from them. Conjugates and conjugates as described herein Stimulates the proliferation of keratinocytes or fibroblasts stimulated by serum explanted from the eye Prevention Evidence of arrest or inhibition and the role of such tissue growth in rabbits. Proof of intentional inhibition should prove human efficacy. Rabbit eye model is topical And is an accepted model for studying the effects of locally applied drugs ( For example, U.S. Pat.Nos. 5,288,735, 5,263,992, 5,262,178, 5,256,408 Nos. 5,252,319, 5,238,925, 5,165,952; and also, Mirat e et al., Curr. Eye Res. 1: 491-493, 1981).   The active ingredient can be administered at once, or it can be administered at intervals Can be divided into small doses. The exact dose and duration of treatment will be treated Is a function of the disease and uses known test protocols or Or extrapolated from in vivo test data can be determined empirically Understood. Concentration and dosage values will also vary with the severity of the condition to be alleviated. It should be noted that Specific dosing levels for any particular subject Zimen will respond to the needs of the individual and the professional judgment of the person administering or supervising the administration of the composition. Should be adjusted over time according to the protocol, and the concentrations described herein The scope is merely illustrative and is intended to limit the scope or practice of the claimed compositions. It is further to be understood that doing so is not intended.   The conjugates and complexes are applied to the eye in the form of gels, creams, and lotions. Local or for topical application to the skin and mucous membranes For topical application, as well as for application to the eye, or in a tank May be formulated for intraspinal application. Such solutions, especially intended for ophthalmic use Is formulated as a 0.01% -10% isotonic solution (pH about 5-7) containing the appropriate salt Can be done. The ophthalmic composition may also include additional components such as hyaluronic acid . Conjugates and conjugates can be formulated as aerosols for topical application (eg, See, for example, U.S. Pat.Nos. 4,044,126, 4,414,209, and 4,364,923. thing).   Solutions and suspensions used for parenteral, intradermal, subcutaneous or topical application May comprise any of the following components: water for injection, saline solution, fixed oils, Polyethylene glycol, glycerin, propylene glycol, or other synthetic Sterile diluents such as solvents; anti-bacterial agents such as benzyl alcohol and methyl paraben Fungus Agents; antioxidants such as ascorbic acid and sodium bisulfite; ethylene dia Chelating agents such as mintetraacetic acid (EDTA); for acetic acid, citric acid, and phosphoric acid Buffers such as sodium chloride or dextrose Drugs for conditioning. Parenteral preparations can be stored in ampoules, disposable syringes, or glass. Sealed in multi-dose vials made of plastic, plastic, or other suitable material Can be entered.   For intravenous administration, suitable carriers are saline or phosphate buffered saline. Saline (PBS) and glucose, polyethylene glycol and polyp Contains thickeners and solubilizers such as propylene glycol and mixtures thereof Solution. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. May be appropriate. These can be prepared according to methods known to those skilled in the art.   If the conjugate is mixed or added with the vehicle, the resulting mixture will , Solutions, suspensions, emulsions and the like. The form of the resulting mixture is The intended mode and solubility of the conjugate in the selected carrier or vehicle. It depends on a number of factors, including: The effective concentration will be the disease, disorder, or condition to be treated. Mouse xenograft model is sufficient to improve the symptoms of In vitro and / or in vivo, such as data from It can be determined empirically based on the in vivo data. If necessary, combine and combine Pharmaceutically acceptable salts or other derivatives of the coalescence can be prepared.   The active substance may also be used with other active substances which do not impair the desired action or under the trademark HEAL Hyaluronic acid (high molecular weight of sodium hyaluronate (about 30 0,000 MW) fraction solution; manufactured by Pharmacia, Inc .; see, for example, US Patent No. 5,292. No. 5,362, No. 5,282,851, No. 5,273,056, No. 5,229,127, No. 4,517,295, and And 4,328,803), VISCOAT (1H, 1H, 2H, 2H-heptadecafluorode). Fluorine-containing (meth) acrylates, such as silmethacrylate; see, for example, US patents See 5,278,126, 5,273,751, and 5,214,080; Alcon Sur gical, Inc.), ORCOLON (see, eg, US Pat. No. 5,273,056) ; Commercially available from Optical Radiation Corporation), methylcellulose, hyaluronic acid Methyl, polyacrylamide, and polymethacrylamide (for example, US Supplementing the desired effect, including viscoelastic substances such as U.S. Pat. No. 5,273,751) Can be mixed with quality. This viscoelastic material generally comprises about 0.5-5.0% by weight of the conjugate material. , Preferably in an amount ranging from 1 to 3% by weight and covering the treated tissue. And work to protect. The composition may also contain methylene blue or other Dyes such as active dyes may also be included whereby the composition is injected into the eye or Alternatively, it may be observed when contacting a surgical site during surgery.   The conjugates and complexes are applied to the eye in the form of gels, creams, and lotions. Local or topical, such as topical application to the skin and mucous membranes It can be formulated for topical applications and for ophthalmic applications. like this Solutions, especially those intended for ophthalmic use, are 0.01% to 10% isotonic solutions containing appropriate salts. It can be formulated as a liquid (pH about 5-7). Suitable ophthalmic solutions are known (eg, U.S. Pat. 116,868). Such a solution having a pH adjusted to about 7.4 is an example For example, 90-100 mM sodium chloride, 4-6 mM dibasic potassium phosphate, 4-6 mM Dibasic sodium phosphate, 8-12 mM sodium citrate, 0.5-1.5 mM mug chloride Nesium, 1.5-2.5 mM calcium chloride, 15-25 mM sodium acetate, 10-20 mM D.L Contains sodium .-β-hydroxybutyrate, and 5-5.5 mM glucose.   Conjugates and conjugates can be incorporated into a body, such as a time controlled release formulation or coating. It can be prepared with carriers that protect them against rapid elimination from the body. Such carriers include implants and microencapsulated delivery systems (including Controlled release formulations such as, but not limited to, ethylene vinyl acetic acid, Hydride, polyglycolic acid, polyorthoester, polyacetic acid, and others And biodegradable, biocompatible polymers. For example, this composition Commercially available surgical sponges that are immersed in an object and release this composition upon contact with the eye (See, e.g., U.S. Patent Nos. 3,956,044 and 4,045,238; Weck, A lcon, and available from Mentor) using a sponge. It can be applied during surgery. These are after surgery where only a single dose is possible It is particularly useful for or during the eye application for ophthalmic indications. This composition Also, pellets that can be implanted into the eye during surgery (eg, Elvax pellets) (Ethylene-vinyl acetate copolymer resin); 1 to 5 μg of conjugate per 1 mg resin ) May also apply amongst others.   An ophthalmically effective concentration or amount of one or more conjugates and conjugates will be Mixed with rear or vehicle. Concentrations of conjugates and complexes that are effective The dose should not exceed the corneal haze, trabeculectomy closure, or pterygium at the time of administration. Requires delivery of an amount to prevent or substantially reduce the onset.   The conjugates and conjugates herein are formulated in an ophthalmically acceptable composition. And applied to the affected area of the eye during or immediately after surgery. Especially, This composition is applied to the cornea after excimer laser surgery; After Tommy, the composition is applied to a fistula; After removal, the composition is applied to the cornea. The composition also treats pterygium. Can be used for Conjugates and complexes are applied during and immediately after surgery, And if possible, it can be applied after surgery until healing is complete. This composition is It is applied as an eye drop for topical and subconjunctival application or Injected into the eye for use. The composition may also include a cellulose sponge or other Absorbed and affected by a biocompatible support such as a polymer delivery device An area can be contacted.   As used herein, ophthalmic indications typically absorb solutions of the conjugates and complexes. Of Eye Drops to Affected Tissues by Contacting with Incompatible Biocompatible Sponge , Or by injection of the composition. In this specification For indications, apply this composition during or immediately after surgery to Prevents lecttomy occlusion and prevents keratinocyte cell injury after excimer laser surgery Prevents the growth of rat cytoplasm or the recurrence of pterygium. This composition is It is injected into the affected tissue after surgery and healing is complete after surgery Until it is applied with eye drops. For example, to administer the formulation to the eye, The composition can be slowly injected into the bulbar conjunctiva of the eye.   Conjugates and conjugates having photodegradable linkers are among the methods described herein. Preferred for use in Upon administration of such a composition to an affected area of the eye, The eye is exposed to light of a wavelength that cuts the linker (typically visible or UV). Thereby releasing the cytotoxic factor.   If oral administration is desired, the conjugate will protect it from the acidic environment of the stomach. Should be administered in an object. For example, the composition maintains its entirety in the stomach And may be formulated in an enteric coating that releases the active compound in the intestine . The composition can also be formulated in combination with an antacid or other such ingredient. .   Oral compositions generally include an inert diluent or an edible carrier, and It can be compressed into tablets or enclosed in gelatin capsules. Oral treatment For the purpose of administration, the active compound (s) are combined with excipients, And may be used in the form of tablets, capsules or lozenges. Pharmaceutical compatibility A binding agent and an adjuvant substance may be included as part of the composition.   Tablets, pills, capsules, troches and the like may contain any of the following ingredients, or a similar composition: Quality compounds: microcrystalline cellulose, tragacanth gum , And binders such as gelatin; excipients such as starch and lactose; Disintegrants such as, but not limited to, acid and corn starch; Lubricant, such as, but not limited to, magnesium phosphate; Glidants such as, but not limited to, silicon dioxide A sweetening agent such as loin or saccharin; and peppermint, methyl salicylate And flavorings such as fruit flavors.   When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a fat and oil. It may contain a liquid carrier such as a fatty oil. In addition, dosage unit forms are A variety of other substances that modify the physical form, such as sugars and other enteric-soluble substances May be included. Conjugates and conjugates can also be used as elixirs, suspensions, It can be administered as a component such as a poultice, cachet, chewing gum and the like. Syrup Sucrose as a sweetener and certain preservatives, pigments in addition to the active compound And coloring and flavoring agents.   The active substance may also be another active substance that does not impair the desired action, or a treatment For example, cisplatin for supplementing the desired effect.   Finally, the compound is a packaging material, One or more conjugates and conjugates or compositions provided herein, and conjugates It can be packaged as a product containing a label indicating the indication for which the body is to be served.   To deliver nucleic acids to cells, retroviral vectors, electroporation , CaPO_FourMany methods have been developed, including precipitation, and microinjection. However, each of these methods has other disadvantages. Transfer of nucleic acids to cells Cloinjection is very time consuming. Because each cell is manipulated individually Because you have to make it. Retroviral vectors are limited in length It can only retain nucleic acids and has an oncogene depending on the insertion site in the target chromosome. May be activated. Electroporation and CaPO_Four-Mediated transfection The conditions for the application are harsh and cause the death of many cells.   By comparison, the receptor-mediated gene delivery described herein is "more active" Cells that have receptors or overexpress specific cell surface receptors This is a more desirable method of selectively targeting a toxic gene to a cell. Les Scepters can be more active. Because the receptor is an end to the cell surface Has a high internalization or turnover rate through thesome It is. The advantage of this method over other gene delivery is the increased specificity of the delivery Including the absence of nucleic acid length limitations, reduced toxicity, and reduced immunogenicity of the conjugate. No. These properties allow repeated administration of the substance with minimal damage to the cells, and These properties can increase the level of expression of the toxic protein. In addition, primary culture Nutrition can also be treated using this method.   The following examples are given for illustrative purposes only and do not limit the scope of the invention. It is not intended to be specified.                                 Example                                 Example 1                       Isolation of DNA encoding saporin A.Materials and methods   1.Bacterial strain   E. coli JA221 strain (lpp^- hdsM + trpE5 leuB6 lacY recA1 F '[lacI^q lac⁺ pro ⁺ ]) Is the American Type Culture Collection (ATCC; Rockville, MD 2085) It is publicly available from 2) as accession number ATCC 33875. (JA221 is also Northern Regional Research Center (NRRL; Agricultural Res. earch Serivce); obtained from Peoria, IL 61604) under accession number NRRL B-15211. Can be Inouye U.S. Pat. No. 4,757,013; and Nakamura et al., Cell 18: 1109-1. 117, 1979). The INV1α strain is commercially available from Invitrogen (San Diego, CA). Have been.   2.DNA operation   The restriction enzymes and modification enzymes used herein are commercially available in the United States. Natural Type saporin and rabbit polyclonal antisera to saporin are already available from Lappi Et al., Biochem. Biophys. Res. Comm. 129: 934-942 as described Obtained. Ricin A chain is commercially available from Sigma (Milwaukee, WI). Antisera, Aff It was conjugated to i-gel 10 (Bio-Rad; Emeryville, CA) according to the manufacturer's instructions. Sequencing is performed using the United States Biochemical Corporation's Sequenase kit (Virs ion 2.0) according to the manufacturer's instructions. Plasmid Micro and large scale preparation, competent cell preparation, transformation, M13 manipulation , Bacterial cultures, western blotting, and ELISA assays ook et al. (Molecular Cloning: A Laboratory Manual; Cold Harbor Laboratory Pr ess, Cold Spring Harbor, NY, 1989). Purification of DNA fragments This was performed using the Geneclean II kit (Bio 101) according to the manufacturer's instructions. SDS gel Electrophoresis was performed on Phastsystem (Pharmacia).   Western blotting is performed using PhastTransfe as described by the manufacturer. Transfer of electrophoresed proteins to nitrocellulose using the r system Achieved by Antiserum against SAP was used at a dilution of 1: 1000. Horseradish Peroxidase-labeled anti-IgG was used as a secondary antibody (Davis et al., Basic Method s In Molecular Biology, New York, Elsevier Science Publishing Co., 1-338 1986). B.Isolation of DNA encoding saporin   1.Genomic DNA isolation and polymerase chain reaction (PCR) primer preparation   Genomic DNA of leaves of Saponaria officinalis was obtained from Bianchi et al., Plant Mol. Biol. 11  : 203-214,1988. Primers for genomic DNA amplification Synthesized with a 380B automatic DNA synthesizer. Primer corresponding to the "sense" strand of saporin 5′-CTGCAGAATTCGCATGGATCCTGCTTCAAT-3 ′ (SEQ ID NO: 54) is a natural saporin N- Immediately upstream of the DNA codon corresponding to amino acid -15 of the terminal leader sequence, an EcoRI restriction Includes restriction site adapter. Primer 5'-CTGCAGAATTCGCCTCGTTTGACTACTTTG-3 '( SEQ ID NO: 55) corresponds to the "antisense" strand of saporin and of the mature peptide Saporin starting from last 5 nucleotides of DNA encoding carboxyl terminus Complementary to the coding sequence of Use this primer to encode mature saporin A translation stop codon and an EcoRI restriction site were introduced behind the sequence.   2.Amplification of saporin-encoding DNA   Genomic DNA (1 μl) of unfractionated Saponaria officinalis leaves was added to 10 mM Tris-HCl (PH 8.3), 50 mM KCl, 0.01% gelatin, 2 mM MgCl_Two, 0.2 mM dNTP, 0.8 μg Mix in a final volume of 100 μl containing lymer. Then, 2.5 U of Taq DNA poly Add merase (Perkin Elmer Cetus) and add 30 μl mineral to the mixture Oil (Sigma) was overlaid. Incubation is performed by DNA Thermal Cycler (Erico mp). One cycle consists of the denaturation step (94 ° C for 1 minute), annealing (60 ° C. for 2 minutes) and an extension step (72 ° C. for 3 minutes). After 30 cycles, Run a 10 μl aliquot of the reaction on a 1.5% agarose gel to confirmed.   The amplified DNA was digested with EcoRI and EcoRI restricted M13mp18 (New England Biolabs, B everly, MA; Yanisch-Perron et al. (1985) "Improved M13 phage cloning vector. And host strains: nucleotide sequences on M13mp18 and pUC19 vectors "Gene 3 3: 103 (see also). One from recombinant phage The strand DNA is distributed using oligonucleotides based on the interior of the saporin coding sequence. Sequence determination (see Bennati et al., Eur. J. Biochem. 183: 465-470, 1989). . Nine M13mp18 derivatives were sequenced and compared. Nine M13mp18 derivatives Columns were determined and compared. Of the nine clones sequenced, five were each sequenced It had the unique sequence shown in Nos. 19-23. These clones were converted to M13mp18-G4, -G Named 1, -G2, -G7, and -G9. Each of these clones is Encoding all of the native sequence and the native saporin N-terminal leader peptide Contains nucleotide DNA.   The saporin DNA sequence was also cloned into the pET11a vector. Briefly state And the DNA encoding SAP-6 from the parental plasmid pZ1B1 by polymerase chain reaction (PCR). Plasmid pZ1B1 has a two amino acid linker (Ala-Met ) Contains the DNA sequence of human FGF-2 linked to SAP-6. PZ1B1 also has pET- T7 promoter, lac operator, ribosome binding site present in 11a vector And the T7 terminator. SAP-6 sense strand for SAP-6 DNA amplification 5 'primer (5' CATATGTGTGTCACATCAATCACATTAGAT 3 ') corresponding to (SEQ ID NO: In 105), an NdeI restriction enzyme site used for cloning was incorporated. This is It also contains a Cys codon at position -1 relative to the start of the mature protein sequence. Re No leader sequence was included. 3 'primer corresponding to the antisense strand of SAP-6 (5 'CAGGTTTGGATCCTTTACGTT 3') (SEQ ID NO: 106) is the Bam used for cloning. It had an HI site. Amplified DNA was gel purified and digested with NdeI and BamHI . Subcloned digested SAP-6 DNA fragment into NdeI / BamHI digested pZ1B1 did. By this digestion, 5 ′ of FGF-2 and SAP-6 were removed from the parent rFGF2-SAP vector (pZ1B1). A portion (up to nucleotide position 650) is removed and this portion is replaced with the native mature SAP -6 protein was replaced with a Cys-containing SAP-6 molecule at position -1 to the start site Was. The resulting plasmid was named pZ50B. Restriction analysis and sequencing analysis For this purpose, pZ50B was E. coli NovaBlue strain. Next, the expression and mass production Clones suitable for E. coli. coli BL21 (DE3) strain. C.Mammalian codon optimization of saporin cDNA   pSV-β, a mammalian expression plasmid encoding β-galactosidase (β-gal) And pNASS-β were obtained from Clontech (Palo Alto, CA). Plasmid pSVβ Expresses β-gal from the SV40 early promoter. Plasmid pNASSb is a β-gal plasmid It is a promoter-free mammalian reporter vector containing a gene.   Reverse the amino acid sequence of the plant protein saporin (SAP) using mammalian codons translated. Obtained mammalian optimal for synthesis by PCR using overlapping oligos The modified cDNA was divided into four fragments (designated 5'-3'A-D). Each fragment Corresponding clones to facilitate subcloning of all Adding a restriction enzyme site to the end of each fragment without changing the amino acid sequence, Then, a restriction enzyme site inside each fragment was added or deleted. In addition, feeding Include a Kozak sequence at the 5 'end of the cDNA to optimize expression in animal cells Was modified to Four oligos with 20 base overlap (two senses, two Denatured) and fill in and fragment the fragment using PCR. By amplification, fragments A, B, and D were synthesized, respectively. Next Then, the PCR product is purified using Geneclean (Bio 101), and the site in the primer is Digested with a restriction enzyme that recognizes and subsequenced into pBluescript (SK +) (Stratagene). Cloned. Insert the insert sequence into Sequence Virsion 2.0 (United States Bio chemical / Amersham). Fragment C was synthesized in two steps. So PCR of the 5 ′ half and 3 ′ half of the fragment using two overlapping oligos Were synthesized separately. The two reactants were then purified, mixed, and PCR using the oligos at both ends as primers Prepared. The full-length fragment C was subcloned into pBluescript for sequencing. Learning. Fragments A and B are ligated in pBluescript at overlapping KspI sites. With each other. Fragments C and D were ligated at the overlapping PvuII site with pBluescri Linked together within pt. Then, the fragments AB and CD are combined in pBluescript. To obtain a full-length mammalian optimized SAP cDNA by ligation at overlapping AvaI sites Was. The β-gal sequence was converted with NotI from plasmids pNASS-β and pSV-β (Clonetech). Was excised and replaced with a synthetic SAP gene with a NotI end. The orientation of the insert was confirmed by restriction enzyme digestion. Large-scale plasmid preparation requires Qi This was performed using an agen Maxi 500 column.   The oligos used for the synthesis of each SAP fragment are as follows (5'-3 '): D.pOMPAG4 Plasmid construction   M13mp18-G4 was digested with EcoRI and the resulting fragment was described herein. Using the method described, the vector pIN-IIIopmA2 (eg, Inouye, US Pat. No. 4,57 No. 5,013; and Duffaud et al., Meth. Enz. 153: 492-507, see 1987) Ligation at the coRI site. This ligation is performed with DNA encoding saporin (including N-terminal extension). Was fused to the leader peptide segment of the bacterial ompA gene . The resulting plasmid, pOMPAG4, contains the lpp promoter (Nakamura et al., Cell 18: 110). 9-1117, 1987); coli lac promoter operator sequence (lac 0), and E. coli ompA gene secretion signals, which contain each other and SEQ ID NO: 19 Operably linked to the saporins listed in Table 1 and the natural N-terminal leader encoding DNA Re ing. This plasmid is also known as E. coli. coli lac repressor gene (lac I) No.   M13mp18-G1, -G2, -G7, and -G9 claw containing SEQ ID NOs: 20-23, respectively Was digested with EcoRI and described earlier in the Examples of the invention for M13mp18-G4. Ligation to EcoRI digested pIN-IIIopmA2 as described. The resulting plasmid (pOMP AG1, pOMPAG2, pOMPAG7, pOMPA9) were described for plasmid pOMPAG4. Screen, express, purify, and characterize as described.   INV1α competent cells are transformed with pOMPAG4 and described herein. Using the method, to obtain large scale preparations of the isolated pOMPAG4 plasmid, Cultures with the plasmid structure were further expanded. E.E . Saporin expression in E. coli   pOMPAG4 transformation coli cells until the end of the logarithmic growth phase. Were grown under conditions where expression of the quality was suppressed by the lac repressor, at which point I Addition of PTG induced expression of saporin-encoding DNA.   pOMPAG4 transformation 125 mg / kg to produce large batch cultures of E. coli cells LB broth containing ml ampicillin (eg, Sambrook et al., Molecular Cloning:  A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring H arbor, NY, 1989) in which JA221 was transformed with plasmid pOMPAG4. E. An overnight culture of E. coli cells (growing for about 16 hours) contains 125 mg / ml ampicillin. 1: 100 into a flask containing 750 ml of LB broth. Measured with a spectrophotometer Log cells while shaking at 37 ° C until the optical density at 550 nm reaches 0.9. Grow in phase.   The second step is to add IPTG (Sigma) to a final concentration of 0.2 mM. And induced saporin expression. After the induced culture was grown for another 2 hours, It was collected by heart separation (25 minutes, 6500 × g). 1.0M ice-cold cell pellet Resuspended in Tris (pH 9.0), 2 mM EDTA (10 ml was added per gram of pellet). Again The suspended material is kept on ice for 20-60 minutes and then centrifuged (20 minutes, 6500 × g ) And the E. coli corresponding to the supernatant. Cells corresponding to the pellet of the periplasmic fraction of E. coli Separated from the inner fraction.   E. coli containing the C-SAP construct in pET11a. coli cells at a temperature and pH of 30 each. C. and controlled at 6.9 were grown in a high cell density packed batch fermentation. Glycerols Tok (1 ml) in 50 ml Luria broth 50 ml₆₀₀Multiplied until reaches 0.6 I let you. 5 g / l glucose, 1.25 g / l yeast extract and Lipton (Difco Laboratories), 7g / l K_TwoHPO_Four, 8g / l KH_TwoPO_Four, 1.66 g / l ( NH_Four)_TwoSO_Four, 1 g / l MgSO_Four・ 7H_TwoO, 2ml / l trace metal solution (74g / l trinatto citrate) Li, 27 g / l FeCl_Three・ 6H_TwoO, 2.0 g / l CoCl_Two・ 6H_TwoO, 2.0 g / l Na_TwoMoO_Four・ 2H_TwoO, 1.9 g / l CuSO_Four・ 5H_TwoO, 1.6 g / l MnCl_Two・ 4H_TwoO, 1.4 g / l ZnCl_Two・ 4H_TwoO, 1.0 g / l CaCl_Two・ 2 H_TwoO, 0.5 g / l H_ThreeBO_Three) 2 ml / l vitamin solution (6 g / l thiamine / HCl, 3.05 g / l Niacin, 2.7 g / l pantothenic acid, 0.7 g / l pyridoxine / HCl, 0.21 g / l Riboflavin, 0.03 g / l biotin, 0.02 g / l folic acid), and 100 mg / l carve 7-Applikon (Foster City, CA) with 2 liters of complex batch medium consisting of nicillin ) The inoculum (10 ml) was injected into the fermentor. After growing the culture for 12 hours, No phosphates and only 25 ml / l trace metal and vitamin solutions respectively The continuous addition of a 40 × solution of a complex batch medium containing was started. Add this raw material The culture of A₆₀₀Until 85 is reached, at which time (about 9 hours) the culture is Derived with isopropyl β-D-thiogalactopyranoside. 4 hours of culture after induction In the meantime, cultures should be supplemented with 100 g / l glucose, 100 g / l yeast extract, And a solution containing 200 g / l tryptone. Finally, centrifuge the cells ( 8000 × g for 10 minutes) and frozen at −80 ° C. until further processing. Was.   A cell pellet containing C-SAP (about 400 g wet weight) was mixed with 3 volumes of buffer B (10 mM Sodium phosphate (pH 7.0), 5 mM EDTA, 5 mM EGTA, and 1 mM dithiotray (Tall). This suspension is placed on a microfluidizer at 124 Mpa on ice ( microfluidizer) three times. The obtained melt is reduced to a conductivity of less than 2.7 mS / cm. NanoPure H_TwoDiluted with O. All subsequent operations were performed at room temperature.   The diluted lysate was added to buffer C (20 mM sodium phosphate (pH 7.0), 1 mM EDTA). Bed of Streamline SP cation exchange resin (300 ml) equilibrated with  bed) with 100ml / min ascending flow. Buffer the resin until it looks good Washed with C. Then, while continuing washing at 70 ml / min, the plunger was increased to 2 cm / min. Slowed down. Stop the ascending flow when the plunger is about 8 cm away from the bed, and The runner was moved to within 0.5 cm of the packed bed. Resin at a downflow of 70 ml / min , A₂₈₀Further washing was performed until に reached the baseline. Then, buffer C and The protein containing C-SAP was eluted at the same flow rate using 0.25M NaCl.   Sartocon Mini equipped with 10000 NMolecular Massco module (Sartorius) Using a cross-flow filtration system, the eluate was transferred to buffer D (50 mM sodium borate). Buffer (pH 8.5), 1 mM EDTA). Next, the sample was washed with buffer D. Loaded to equilibrated Source 15S (30 ml) column. 10 of 0-0.3M NaCl in buffer D C-SAP was eluted at 30 ml / min using a column volume linear gradient. F.Assay for cytotoxic activity   Cell-free cells in nuclease-treated rabbit reticulocyte lysate (Promega) In an in vitro assay to measure protein synthesis, recombinant saporin ribosomal Ribosome-inactivating protein activity of native SAP Compared. A sample of immunoaffinity purified saporin is diluted with PBS and 5 μl sample on ice with 35 μl rabbit reticulocyte lysate and 0.5 μl Brom e Mosaic Virus RNA, 1mM amino acid mixture (leucine free), 5μCi Triti 10 μl of the reaction mixture containing urea leucine and 3 μl of water was added. Assay The tubes were incubated in a 30 ° C. water bath for 1 hour. Transfer this tube to ice. And add 5 μl of the assay mixture in triplicate to a Millititer HA 96-well filtration plate. 75 μl 1N sodium hydroxide, 2.5% peroxide in wells of Millipore The reaction was stopped by adding to the solution. When the red color disappears from the sample, 300 μl Of ice-cold 25% trichloroacetic acid (TCA) is added to each well and the plate is further For 30 minutes on ice. Perform vacuum filtration using a Millipore vacuum holder. Was. The wells were washed three times with 300 μl of ice-cold 8% TCA. After drying, remove the filter paper to 96 Removed from well plate and counted by liquid scintillation technique.   IC of recombinant saporin and natural saporin₅₀Was about 20 pM. Therefore, the pair Recombinant saporin-containing protein has a complete protein synthesis compared to native saporin. It has a growth inhibitory activity.                                 Example 2                             Preparation of FGF mutein A.Materials and methods   1.Reagents   BRL (Gaithersburg, MD), Stratagene (La Jolla, CA) And New England Biolabs (Beverly, MA).   Plasmid pFC80 containing the basic FGF coding sequence was obtained from Farmitalia Carlo Erba (Milan, Italy) Dr. Paolo Sarmientos and Dr. Antonella Isacchi Was. Plasmid pFC80 has PCT application number WO90 / 02800 and PCT application number PCT / US93 / 05702. And the entire contents of these PCT applications are incorporated herein by reference. It is. The sequence of the bFGF-encoding DNA in pFC80 is the PCT application number PCT / US93 / 05702 and the sequence number No. 52.   Plasmid isolation, competent cell generation, transformation and M13 manipulation are publicly available Procedure (Sambrook et al., Molecular Cloning, a Laboratory Manual, Cold Spri ng Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) . For purification of DNA fragments, use the Geneclean II kit purchased from Bio 101 (La Jolla, CA). Was performed using Sequencing of different constructs was performed using USB (Cleveland, OH) Sequenase This was performed using a kit (version 2.0).   2.Sodium dodecyl sulfate (SDS) gel electrophoresis and Western blotting The   SDS gel electrophoresis was performed on a PhastSystem (Pharmacia) using a 20% gel. . Perform Western blotting using the PhastTransfer system (Ph armacia) to transfer the electrophoresed protein to nitrocellulose. I did it. Antisera against SAP and basic FGF were used at a dilution of 1: 1000. Da vis, L., Dibner et al. (1986) Basic Methods in Molecular Biology, page 1 (Elsevi er Science Publishing Co., New York) Le Oxidase-labeled anti-IgG was used as the second antibody. B.Preparation of mutant FGF by site-directed mutagenesis   The substitution of cysteine to serine was performed by Amersham (Arlington Heights, IL) By oligonucleotide-directed mutagenesis using Toro mutagenesis system 2.1 Done. Oligonucleotides encoding new amino acids were synthesized using 380B automated DNA synthesis. The synthesis was performed using an instrument (Applied Biosystems, Foster City, CA).   1.Mutagenesis   The oligonucleotide used for in vitro mutagenesis of cysteine 78 had the sequence AGGAGTGTCTGCTAACC (SEQ ID NO: 56) spanning nucleotides 225-241 of No. 52 Was. The oligonucleotide for mutagenesis of cysteine 96 is the nucleotide of SEQ ID NO: 52. TTCTAAATCGGTTACCGATGACTG (SEQ ID NO: 57) spanning 279-302 . The mutated replicative form of DNA was transformed into E. coli strain JM109 and a single plaque was picked. And sequenced to confirm the mutation. Next, the FGF mutant gene was converted from M13. Cut out, ligated into the expression vector pFC80 from which the non-mutated form of the gene had been removed, and The strain was transformed into the ColiJM109 strain. Pick a single colony and transform its plasmid Sequenced to confirm its presence. Next, a plug with the correct mutation The Smid was transformed into the E. coli FICE2 strain and single colonies from these transformations were selected. A basic FGF mutant was obtained. About 20mg of protein per liter of fermentation broth I got the quality.   2.Purification of mutant FGF   Cells were grown overnight in 20 ml of LB broth containing 100 μg / ml ampicillin. next morning Pellet the cells and transfer to 500 ml of M9 medium containing 100 μg / ml ampicillin at 7 Proliferated for a while. The cells are pelleted and a lysis solution (10 mM Tris pH 7.4, 150 mM NaC l, lysozyme 10 μg / mL, aprotinin 10 μg / mL, leupeptin 10 μg / mL, pep Statin A resuspended in 10 μg / mL and 1 mM PMSF; 45-60 ml per 16 g pellet) And incubated for 1 hour at room temperature with stirring. Freeze-thaw the solution three times, 2.5 Sonicated for minutes. Centrifuge the suspension, save the supernatant, and pellet. Resuspended in another volume of lysis solution without lysozyme, centrifuged again, and Supernatants were pooled. Extraction volume (40 ml) with 10 mM Tris, pH 7.4 (buffer A) 50 ml Diluted. The pool was pooled with 5 mM equilibrated with 150 mM sodium chloride in buffer A. l Load on Hi-Trap Heparin-Sepharose column (Pharmacia, Uppsala, Sweden) I did it. The column is washed with 0.6M sodium chloride and 1M sodium chloride in buffer A. Washed and then eluted with 2M sodium chloride in buffer A. Its 2M elution Pool the peak fractions of the solution (determined by the optical density at 280 nm) Purity was determined by electrophoresis. The yield of purified protein is⁷⁸10.For mutants 5mg, Cys⁹⁶It was 10.9 mg for the mutant.   Biological activity of [C78S] FGF and [C96S] FGF was determined by cultured adrenal capillary endothelial cells Was measured. Wells were placed in a 24-well plate containing 1 ml of 10% bovine serum-HDMEM. 3000 cells were cultured (plate). Attach cells and sample in triplicate at indicated concentration Was added and incubated at 37 ° C. for 48 hours. Add an equal volume of sample and continue for 48 hours Incubated. Aspirate medium and treat cells with trypsin (1 ml volume) Cells were removed into 9 ml of Hematall dilution and counted on a Coulter Counter. To the result Thus, these two mutants were determined by their ability to stimulate the proliferation of cultured endothelial cells. As noted, it must retain substantially complete proliferative activity of natural basic FGF. Was shown.                                 Example 3               Preparation of mono-derivatized nucleic acid binding domain (MyoD)   4.1 mg / ml MyoD to 0.1 M sodium phosphate, 0.1 M sodium chloride, pH 7.5 Dialyze against. A 1.1 molar excess (563 μg in 156 μl absolute ethanol) of SPDP (Pha rmacia, Uppsala, Sweden) and the reaction mixture was immediately stirred and shaken on a shaking table ( rocker platform) for 30 minutes. The solution is then dialyzed against the same buffer I do. Aliquots of the dialyzed solution were collected according to Pharmacia's instructions for derivatization. Find out about the degree. The degree of derivatization is typically one mole of nucleic acid binding domain 0.79 to 0.86 moles of SPDP.   The derivatized myoD (32.3 mg) was dialyzed in 0.1 M sodium borate, pH 9.0, and dialyzed. Apply to a Mono S 16/10 column equilibrated with 25 mM sodium chloride in the buffer. A gradient of 25 mM to 125 mM sodium chloride in dialysis buffer provides a free nucleic acid binding domain. And the derivatized nucleic acid binding domain is eluted. Flow rate 4.0ml / min, 4m Collect fraction l. Aliquots of the fractions are used for protein concentration (BCA Protein Assay). , Pierce Chemical, Chicago, IL) and pyridylthione released by reducing agents Assayed. Individual fractions (25-37) were analyzed for protein concentration, pyridyl -Analyze for disulfide concentration. The data is used for derivatization with SPDP. Shows separation according to bell. The first eluting peak is mostly from di-derivatized myoD. You. The second peak is mono-derivatized and the third peak is derivatized. Absent. The di-derivatized material accounts for about 20% of these three peaks, and the second peak is About 48%, the third peak accounts for about 32%. When the substance from the second peak is pooled, my The average ratio of pyridyl-disulfide to oD is 0.95. Against protein Fraction 33, which showed a significantly different ratio of pyridine-2-thione, was removed from the pool. . Fractions showing a ratio of SPDP to myoD of greater than 0.85 and less than 1.05 were pooled, Dialyze against 1M sodium chloride, 0.1M sodium phosphate, pH7.5 to basic FGF Used for derivatization.                                 Example 4                 Preparation of modified nucleic acid binding domain (MyoD)   As an alternative to derivatization, cysteine is added at or near the N-terminal coding portion of DNA. Modify myoD by adding residues. Next, the obtained myoD was placed on FGF. Reacts with any available cysteine or attaches to a linker or FGF React with the linker to form a conjugate linked via the added Cys. Can be.   The modified myoD is used to modify the DNA encoding myoD (GenBank accession number X56677). And is prepared by The Cys-encoding DNA should be Insert at codon within residue. The resulting DNA was inserted into pET11a and pET15b and BL2 Expression in one cell (NOVAGEN, Madison, WI). A.N- Preparation of myoD with a terminally added cysteine residue   Primer # 1 corresponding to the sense strand of myoD (nucleotides 121 to 144) has an NdeI site And add a Cys codon 5 'to the start site of the mature protein.   Primer # 2 encodes a nucleic acid binding domain spanning nucleotides 1054-1077 Antisense primer that complements the sequence and contains a BamHI site.   Using the primers described above, MyoD DNA is amplified by PCR as described below. myo A clone (1 μl) containing the full-length DNA (or cDNA) of D was transferred to 10 mM Tris HCl (p H8.3), 50 mM KCl, 0.01% gelatin, 2 mM MgCl_Two, 0.2 mM dNTP, 0.8 μg Mix in a final volume of 100 μl containing the immer. Then, 2.5 U of TaqI DNA polymerase (Boehringer Mannheim) and add 30 μl of mineral oil (Si gma). Incubation is performed in a DNA thermal cycler. cycle Are the denaturation step (94 ° C for 1 minute), the annealing step (60 ° C for 2 minutes) and the extension step. (3 min at 72 ° C). After 35 cycles, a 1.5% aliquot of 10 μl aliquot of each piece was Run on a gelose gel to confirm the correct structure of the amplification product.   The amplified DNA was gel purified, digested with NdeI and BamHI, and FGF digested with NdeI and BamHI. Subcloning into a plasmid containing / myoD. This digestion and subcloning Depending on the procedure, the FGF encoding DNA and the 5 'portion of SAP are replaced by nucleotides 555-560 (SEQ ID NO: 52) To the BamHI site at the start of the native mature SAP protein. On the other hand, is replaced by DNA encoding a myoD molecule containing a cysteine residue at position -1 . B.Nucleic acid binding domain having cysteine residue at position 4 or 10 of natural protein Preparation   In these constructs, the Ser residue at position 4 or the Val residue at position 10 is replaced with cysteine. This will introduce a cysteine residue at position 4 or 10 of the native protein. Design.   Using a primer that incorporates a TGT or TGC codon at position 4 or 10, FGF- From the parent plasmid encoding the nucleic acid binding domain fusion protein, a polymerase Amplify myoD by chain reaction (PCR).   PCR conditions are performed as described above using the following cycle: denaturation at 94 ° C for 1 minute 35 cycles of annealing step at 60 ° C. for 2 minutes and extension at 72 ° C. for 2 minutes. The amplified DNA was gel purified, digested with NdeI and BamHI, and pET11 digested with NdeI and BamHI. Subcloning into a. By this digestion, FGF and nucleic acid are separated from the parent FGF-myoD vector. The 5 'portion of the binding domain (up to the newly added BamHI) is removed and the portion is Contains a cysteine at position 4 or 10 relative to the start of the native protein Is replaced by a myoD molecule.   The resulting plasmid was digested with NdeI / BamHI and His-Tag^TMLeader sequence (sequence number No. 60) with pET15b (NOVAGEN, Madison, WI) (also digested with NdeI / BamHI). Inserted).   DNA encoding unmodified myoD was similarly inserted into pET5b or pET11A, and modified SA The P-encoding DNA is expressed as described below. C.Expression of DNA encoding the modified nucleic acid binding domain   BL21 (DE3) cells were transformed with the resulting plasmid and treated as described in Example 2. And culture. However, all incubations were performed at 30 ° C instead of 37 ° C . Briefly, a single colony was used for LB AMP₁₀₀OD in₆₀₀Until is 1.0-1.5 Propagate and then induce with IPTG (final concentration 0.1 mM) for 2 hours. Spin down bacteria (spin down). D.Purification of the modified nucleic acid binding domain   Lysis buffer (20 mM NaPO_Four, PH7.0, 5mM EDTA, 5mM EGTA, 1mM DTT, 0.5μg / ml Leupeptin, 1 μg / ml aprotinin, 0.7 μg / ml pepstatin) Buffer (generated from pZ50B1 in BL21 cells as described above) with 1.5 ml buffer Liquid / g cells were added at the ratio. This mixture is used as a Polytron homogenizer. And suspend twice with a microfluidizer.   The obtained lysate is centrifuged at 50,000 rpm for 45 minutes. The supernatant is added to SP buffer A (20mM NaPO_Four, 1mM EDTA, pH7.0), diluted so that conductivity is less than 2.5mS / cm I do. Then, the diluted lysate supernatant was loaded on a SP-Sepharose column, 0-30% SP buffer B in P buffer A (1 M NaCl, 20 mM NaPO_Four, 1mM EDTA, pH7.0 ) (6 column volumes total). Combine the fractions containing myoD Let The resulting nucleic acid binding domain had a purity of greater than 90%. Buffer exchange Of the SP eluate using 50 mM NaBO_ThreeBuffer containing 1 mM EDTA, pH 8.5 (S buffer To liquid A). The sample was then re-equilibrated with Resourc pre-equilibrated with S-buffer A. Apply to eS column (Pharmacia, Sweden). 0-300 mM NaC in SP buffer A Purify pure nucleic acid binding domains from the column with 10 column volumes with a linear gradient to l Elute.   In this preparation, the lysate was clarified using ultracentrifugation, but filtration and flocculant (fl oculent) can also be used. In addition, for large scale preparations, Strea mline S (Pharmacia, Sweden) may also be used.                                 Example 5                       Preparation of conjugate containing FGF mutein A.FGF Binding of muteins to nucleic acid binding domains   1.[C78S] FGF- Nucleic acid binding domain (CCFN2) and [C96S] FGF-nucleic acid binding domain (CCFN3) chemical synthesis   [C78S] FGF or [C96S] FGF (1 mg; 56 nmo) dialyzed against phosphate buffered saline l) with 2.5 mg of mono-derivatized nucleic acid binding domain (1.5 And then leave on a shaking table overnight. The next morning, UV-visible wavelength spectrum Pyridylthione adsorb at 343 nm with known extinction coefficient Release determines the extent of the reaction. Pyridylthio for basic FGF variants The ratios of the [C78S] FGF are 1.05 and [C96S] FGF are 0.92. The reaction mixture is prepared by the following method Similarly, purify the reaction mixture: 0.15 M sodium chloride in buffer A 0.5 ml / min flow through a HiTrap Heparin-Sepharose column (1 ml) equilibrated with Let through at high speed. The column was washed with 0.6M NaCl and 1.0M NaCl in buffer A, The product is eluted with 2.0 M NaCl in buffer A. Fractions (0.5 ml) were analyzed by gel electrophoresis. Analyze by absorbance at 0 nm. Pool the peak tubes and add 10 mM sodium phosphate Dialysis against pH 7.5 and applied to a Mono S 5/5 column equilibrated with the same buffer. Lie. The product was prepared using a 10 ml gradient of 0-1.0 M sodium chloride in equilibration buffer. Is eluted. Purity is determined by gel electrophoresis and the peak fractions are pooled.   Under these conditions, substantially 100% of the FGF variants react with the mono-derivatized myoD. Free surface cysteines on each mutant act as free sulfhydryls There is no need to reduce cysteine after purification from bacteria. The resulting product is Purified on heparin-Sepharose (data not shown), thus Confirm that the phosphorus binding activity is maintained.   2.Expression of recombinant FGFC78 / 96S-nucleic acid binding domain fusion protein (FPFN4)   Produces recombinant FGF [C78 / 96S] -myoD protein (FPFN4) using a two-step method I do. Plasmids are contained in 250 ml of LB medium containing ampicillin (100 μg / ml) Inoculate a new glycerol stock of bacteria. 30 ° C in an incubator shaker And OD₆₀₀Grow cells until is 0.7 and store overnight at 4 ° C. The next day, remove cells Let resuspend in fresh LB medium (without ampicillin). 5 of those cells OD at 30 ° C in an incubator shaker.₆₀₀To 1.5 Proliferate until Add IPTG to a final concentration of 0.1 mM and increase for about 2-2.5 hours After continued growth, cells were collected by centrifugation.                                 Example 6             Recombinant production of FGF-nucleic acid binding domain fusion protein A.Introduction   1.Bacterial strains and plasmids   E.coli BL21 (DE3), BL21 (DE3) pLysS, HMS174 (DE3) and HMS174 (DE3) The pLysS strain was purchased from NOVAGEN (Madison, WI). The plasmid pFC80 described below WIPO International Patent Application No. WO 90/02800. However, in this specification, pFC The bFGF coding sequence in the plasmid designated 80 is nucleotides 1-465 of SEQ ID NO: 52. The sequence is described as follows. This plasmid described herein was used as a starting material. CII ribosome using pFC80 or linked to FGF-encoding DNA (SEQ ID NO: 52) ー Prepared by starting from a fragment containing the DNA binding site (SEQ ID NO: 61) can do.   E.coli JA221 strain (lpp^- hdsM + trpE5 leuB6 lacY recA1 F '[lacI^q lac⁺ pro⁺] ) Is the American Type Culture Collection (ATCC; Rockville, MD 20852) It is publicly available under accession number ATCC 33875. (JA221 is also Northern Re gional Research Center (NRRL), Agricultural Research Service, U.S. Department t of Agriculture, Peoria, IL 61604) as accession number NRRL B-15211 It is. U.S. Patent No. 4,757,013 to Inouye and Nakamura et al., Cell 18: 1109-1. 117, 1979). INV1α strain is commercially available from Invitrogen (San Diego, Ca) Have been. B.FGF / Construction of plasmid encoding nucleic acid binding domain fusion protein   1.FGF Of FGFM13 containing DNA encoding the cI ribosome binding site linked to Construction   Amersham in vitro mutagenesis system 2.1 for nucleic acid binding domain encoding DNA An Nco I restriction site is introduced by site-directed mutagenesis. Nco I restriction site Oligonucleotides used for the preparation were converted to 380B automatic DNA synthesizer (Applied Biosystem Synthesize using s). This oligonucleotide containing an Nco I site Replace with a coding sequence containing an acid binding domain.   To generate the bFGF coding sequence with the stop codon removed, the FGF coding DNA was Subcloned into 3 phages and subjected to site-directed mutagenesis. Plasmid pFC 80 is pDS20 (see, for example, Duester et al., Cell 30: 855-864, 1982; Nos. 4,914,027, 5,037,744, 5,100,784 and 5,187,261 See PCT International Application No. WO 90/02800 and European Patent Application No. EP 267703 A1 See also). It is based on plasmid pKG1800 (Bernardi et al., DNA  Sequence 1: 147-150, 1990; McKenney et al. (1981), pp. 383-415, Ge. ne Amplification and Analysis 2: Analysis of Nucleic Acids by Enzymatic See also Methods, Chirikjian et al., North Holland Publishing Company Amsterdam G) between nucleotides 2440 and 2880 of pDS20. The difference is that it contains an extra 440 bp at the distal end of alK. Plasmid pKG1800 2880 bp EcoR I-Pvu II of pBR322 containing the ampicillin resistance gene and origin of replication Including.   Plasmid pFC80, the entire galK gene was replaced with the FGF-encoding DNA of SEQ ID NO: 52, trp Promoter (SEQ ID NO: 62) and bacteriophage lambda cII ribosome binding site Position (SEQ ID NO: 61; see, eg, Schwarz et al., Nature 272: 410, 1978). Prepared from pDS20 by inserting upstream of FGF-encoding DNA and operably linking Is done. Replace the Trp promoter with the plasmid pDR720 (Pharmacia PL Biochemicals) Or synthesized according to SEQ ID NO: 62. Plasmid pFC8 0 is the 2880 bp EcoR I-BamHI fragment of plasmid pSD20, the Trp promoter Synthetic Sal I-Nde I fragment encoding the region: And cII ribosome binding site (SEQ ID NO: 61): It contains.   The FGF-encoding DNA is extracted from pFC80 by treating pFC80 as follows. The pFC80 plasmid was digested with HgaI and SalI. This connects to FGF-encoding DNA A fragment containing the cleaved CII ribosome binding site is generated. The obtained hula Fragment was blunt-ended with Klenow reagent, opened with SamI for blunt-end ligation, Then, it is inserted into M13mp18 treated with alkaline phosphatase. Stop codon To remove, insert the ORI negative insert as described above in the Amersham kit. Using the following oligonucleotides (SEQ ID NO: 63): GCTAAGAGCGCCATGGAGA ( This is one nucleotide between the FGF carboxy-terminal serine codon and the NcoI restriction site. ). It has the wild-type having SEQ ID NO: 64 below. Replace with type FGF-encoding DNA:   The resulting mutant derivative of M13mp18 (this is after the carboxy-terminal serine codon of bFGF) (Lacking the natural stop codon) was designated FGFM13. Mutagenesis region of FGFM13 is positive New sequence (SEQ ID NO: 65).   2.FGF / MyoD Preparation of plasmid encoding fusion protein   Plasmid FGFM13 was cut with NcoI and SacI, and the stop codon was replaced with bF A fragment containing the CII ribosome binding site linked to the GF coding sequence is obtained.   The M13mp18 derivative containing the myoD coding sequence also contains the restriction endonuclease Nco I And bFGF-encoding fragment derived from FGFM13 and the fusion protein Insertion into its M13mp18 derivative by ligation to DNA encoding the quality bFGF-myoD Mp containing CII ribosome binding site bound to GF-nucleic acid binding domain fusion gene Create FGF-myoD.   Plasmid mpFGF-myoD was digested with Xba I and EcoR I and the resulting bFGF-myoD code Sequence-containing fragments were isolated and treated with EcoRI and XbaI. Rasmid pET-11a (available from NOVAGEN, Madison, WI; see description of this plasmid) See US Patent No. 4,952,496; also, Studier et al., Meth. Enz. 1 85: 60-89, 1990; Studier et al. Mol. Biol. 189: 113-130, 1986; Rosenberg Et al., Gene 56: 125-135, 1987).   E. coli BL21 (DE3) pLysS strain (NOVAGEN, Madison, WI) was It can be transformed with a plasmid having   Plasmid FGF / myoD is digested with EcoRI and the ends are digested with nucleoside triphosphates. And repair with the addition of Klenow DNA polymerase and then with Nde I. To release FGF-encoding DNA without a CII ribosome binding site. This file The fragment was digested with BamHI, truncated, and digested with NdeI. Connect to a. The resulting plasmid contains the T7 transcription terminator and pET-11a ribosome. A binding site.   Plasmid FGF / myoD is digested with EcoR I and Nde I and the CII ribosome binding site Can release FGF-encoding DNA without the DNA and repair its ends as described above. . This fragment can be ligated into pam 12a digested with BamH I and end repaired. You. The resulting plasmid is an OMP operably linked to the DNA encoding the fusion protein. Includes DNA encoding T secretion signal.   3.FGF2- Preparation of plasmid encoding protamine fusion protein   Protamine is a small basic DNA binding protein with a molecular weight of about 6.8 kD and an isoelectric point of 12.175. Quality. 24 of the 51 amino acids are strongly basic. Human protami Have been shown to enrich genomic DNA for packaging into sperm heads. Have been. The positive charge of protamine reacts with the negative charge on the phosphate backbone of DNA.   FGF- which has the ability to bind to FGF receptor and bind DNA with high affinity A protamine fusion protein is constructed for expression in E. coli. Human protami The gene sequence is obtained from GenBank (Accession No. Y00443). 4 overlapping oligos Nucleotides (60 mer) are made and used for amplification of the protamine gene. The amplification product is purified and ligated into the bacterial expression vector pET11a (Novagen) . Nco I and BamHI sites should be included in the primers to facilitate subcloning. Incorporate the rank. Those four oligos with 20 base overlap (two sense and And two antisenses) and fill the fragments using PCR And amplifying to synthesize a fragment. Transfer the PCR product to NcoI and And BamHI, and subcloned into pBluescript SK +. Confirm insert sequence I do. Next, the downstream of the sequenced product is cloned, and pET11a expression In-frame with FGF2 cloned in the plasmid. Fragment The oligos used to create A are as follows (5'-3 '):   Transform competent bacterial cell BL21 (DE3) with pET11-FGF2-protamine construct I do. The cells are first placed on an LB agar plate containing 100 μg / ml ampicillin. Sowing Glycerol stocks made from individual colonies were added to 1 ml of fresh Add to LB broth and then to 250 ml LB broth. OD cells₆₀₀Until 0.7 And induced with IPTG. The culture is harvested 4 hours after induction. Centrifuge the suspension; save the supernatant, resuspend the pellet in lysis buffer and resuspend. And centrifuged, and the supernatants were pooled. Transfer the pellet and supernatant samples to FG The fusion within each fraction was analyzed by Western analysis using an antibody against F2. Determine the percentage of protein. Purify the soluble protein. Briefly, Pellet cells and add buffer A (containing 10 mM EDTA, 10 mM EGTA, and 50 mM NaCl). Resuspended in 10 mM sodium phosphate (pH 6.0) Microfluidics Corp., Newton, Mass.) To disrupt bacteria and remove DNA. Refuse. Dilute the resulting mixture and expand the expanded bed Streamline  Place on SP cation exchange resin. The column is used in stages with increasing concentrations of NaCl. Wash on gradient. The eluted substance was analyzed for the fraction containing the fusion protein. Analyze by Western analysis. The fractions were pooled, diluted, and heparin -Place on a Sepharose affinity column. After washing, bound proteins In a buffer containing 1 M NaCl and then a buffer containing 2 M NaCl in a batch-wose method. Elute. Pool the peak fractions of the 2M eluate as determined by optical density at 280 nm. And its purity is determined by gel electrophoresis and Western analysis. That Sephacryl was equilibrated with 20 mM HEPES (pH 7.4), 150 mM NaCl.  Load on S-100 column.   Isolate, solubilize, and refold the fusion protein in the pellet. To run. Briefly, each culture pellet was thawed completely and buffer A (10 mM is, 1 mM EDTA (pH 8.0) + 0.1 mg / ml lysozyme). The mixture on ice Sonicate, centrifuge at 16,000 xg, and discard the supernatant. Inclusion bodies allowed Solubilization buffer (6M guanidine-HCl, 100 mM Tris, 150 mM NaCl, 50 mM EDTA, 50 mM E GTA (pH 9.5)), vortex and incubate for 30 minutes at room temperature. Centrifuge at 000 xg for 15 minutes. Save the supernatant and dilute buffer (100 mM T ris, 10 mM EDTA, 1% monothioglycerol, 0.25 M L-arginine (pH 9.5)) Dilute to 10. The material is stirred, capped at 4 ° C for 2 hours, and then Centrifuge for 0 minutes. 24 hours at 4 ° C against 5 liters of PBS (pH8.8) In the meantime, dialyze with 3 changes to fresh PBS. The substance is spin-excluded Concentrate about 10 times using a system. Next, the refolded soluble substance was Analyze by electrophoresis.   Expression of the FGF-protamine fusion protein in mammalian cells is determined by the restriction enzyme Nde Cut out the insert with I and BamHI and connect it to the mammalian expression vector. Can be achieved by tying. C.Expression of recombinant bFGF-nucleic acid binding domain fusion protein   Using a two-step method, the recombinant bFGF-myoD protein (bFGF-nucleic acid (Binding domain fusion protein).   3 containing ampicillin (50 μg / ml) and chloramphenicol (25 μg / ml) Liters of LB broth, bacterial cells containing the pFS92 plasmid from an overnight culture (BL21 ( DE3) pLysS strain) (1: 100 dilution). OD at 37 ° C in a shaking incubator₆₀₀Is 0 Grow to .7. IPTG (Sigma Chemical, St. Louis, MO) at a final concentration of 0. 2 mM was added and growth was continued for 1.5 hours before the cells were centrifuged.   Growth of BL21 (DE3) pLysS cells grown at 30 ° C instead of 37 ° C improves yield It turned out through experiments. Therefore, cells are OD at 30 ° C.₆₀₀Until 1.5 After expansion, induce. After induction, the cells are allowed to grow for about 2 to 2.5 hours. Collect by centrifugation.   The pellet is lysed with a lysis solution (45-60 ml per 16 g of pellet; 20 mM TRIS (pH 7.4), 5 mM ED TA, 10% sucrose, 150 mM NaCl, lysozyme 100 μg / ml, aprotinin 10 μg / m l, leupeptin 10 μg / ml, pepstatin A 10 μg / ml, and 1 mM PMSF) Turn turbid and incubate for 1 hour at room temperature with agitation. Freeze the solution three times Thaw and sonicate for 2.5 minutes. Centrifuge the suspension at 12,000 xg for 1 hour Separate; save the resulting supernatant and pellet free of lysozyme Resuspend in fresh lysis solution. The resuspended material is centrifuged again and the second supernatant is Make and pool the two supernatants and add to borate buffered saline (pH 8.3). And dialyze. D.bFGF- Affinity purification of nucleic acid binding domain fusion protein   30 ml dialysis solution containing bFGF-nucleic acid binding domain fusion protein obtained in Example 5.C Was transferred to HiTrap equilibrated with 10 mM TRIS (pH 7.4) containing 0.15 M NaCl (buffer A). Apply to a Palin-Sepharose column (Phrmacia, Uppsala, Sweden). That The column is first washed with equilibration buffer; then in buffer A containing 0.6M NaCl. Washed; further washed in buffer A containing 1.0 M NaCl; and finally, 2 M NaCl Elute to a 1.0 ml fraction in buffer A containing Assay samples by ELISA did.   The bFGF-nucleic acid binding domain fusion protein is produced by native bFGF and recombinantly. Elute from the heparin-Sepharose column at the same concentration (2M NaCl) as the bFGF produced You. This indicates that heparin affinity is retained in the bFGF-SAP fusion protein. And E.Characterization of bFGF-Nucleic Acid Binding Domain Fusion Protein by Western Blot Ke   SDS gel electrophoresis was performed using a Phastsystem (Pharmaci Perform in a). Western blotting, as described by the manufacturer, The electrophoresed protein is subjected to nitrite transfer using the PhastTransfer system (Pharmacia). Achieved by transferring to rocellulose. Antiserum against bFGF was diluted 1: 1000. Use at the basal rate. Horseradish peroxidase-labeled anti-IgG used as secondary antibody (Davis et al., Basic Methods in Molecular Biology, New York, Elsevier Scie nce Publishing Co., p. 1-338, 1986).   The anti-FGF antiserum contains individual nucleic acid binding domains (35,000) and bFGF (18,000) It should bind to a protein with a molecular weight of about 53,000, corresponding to the sum of the molecular weights.                                 Example 7             Contains a linker that encodes a protease substrate                     Preparation of FGF-nucleic acid binding domain complex A.Synthesis of oligos encoding protease substrates   The complementary single-stranded oligo, whose sense strand encodes the protease substrate, is Description provided by the manufacturer for the cyclone machine (Millipore, MA) Synthesized by use according to written or Midland Certified Reagen t Co. (Midland, TX) or National Biosciences, Inc. (MN) . The following oligos were synthesized:   1. Cathepsin B substrate linker   2. Cathepsin D substrate linker   3. Trypsin substrate linker   4. Gly_FourSer   5. (Gly_FourSer)_Two   6. (Ser_FourGly)_Four   7. (Ser_FourGly)_Two   8. Thrombin substrate linker   9. Enterokinase substrate linker   10.Factor Xa substrate B.FGF- Preparation of a DNA construct encoding a linker-nucleic acid binding domain   Anneal the complementary oligo by heating at 95 ° C for 15 minutes, then cool to room temperature. And then incubate at 4 ° C. for 1 minute to about 1 hour. After incubation, Rigo is digested with NcoI and alkaline phosphatase (Boheringer Mannheim) To the NcoI digested plasmid that had been treated with Ligation overnight at ° C.   Transform bacteria (Novablue (NOVAGEN, Madison, WI)) with the ligation mixture (1 μl) And inoculate LB-amp or LB-Kan depending on the plasmid. Colony Select, isolate clones, and sequence to determine insert orientation Set. Using the clone in the correct orientation, the expression strain BL21 (DE3) strain (NOVAGEN, Madison , WI). Glycerol stock generated from single transformed colonies I do. The transformant is cultured as described in Example 2 and has a linker The fusion protein was expressed.   Cathepsin substrate (FPFS9), Cathepsin D substrate (FPFS5), Gly_FourSer (FPFS7), ( Gly_FourSer)_Two(FPFS8), trypsin substrate (FPFS6), (Ser_FourGly)_Four(FPFS12), and (Ser_FourGly)_Two(FPFS11) DNA sequence and sequence of a representative fusion protein containing a linker And the amino acid sequences are set forth in SEQ ID NOs: 72-78, respectively.                                 Example 8                 Plasmid encoding β-galactosidase                 FGF-poly-L-lysine (FGF2-K) complexed with A.Derivatization of poly-L-lysine   Polylysine polymers of average length 13, 39, 89, 152 and 265 (K₁₃, K₃₉, K₈₄, K_{Fifteen Two} , K₂₆₅) Was purchased from a commercial supplier (Sigma, St. Louis, MO) and 0.1 M NaPO_Four, 0.1M  Dissolve in NaCl, 1 mM EDTA, pH 7.5 (buffer A) at a concentration of 3-5 mg / ml. About 30mg 0.187 ml of 3 mg / ml N-succinimidyl-3 (pyridyldithi E) Proprionate (N-succinimdyl-3 (piridyldithio) proprionate) (SPDP ) And mixed with absolute ethanol to give a SPDP / poly-L-lysine molar ratio of 1.5. And incubate it for 30 minutes at room temperature. Next, add 4 liters of the reaction mixture. Against buffer A for 4 hours at room temperature. B.FGF2-3 Of derivatized polylysine to DNA   A solution containing 28.5 mg of poly-L-lysine-SPDP was mixed with 12.9 ml of FGF2-3 ([C96S] -FGF2). Add to buffer A containing g and incubate overnight at 4 ° C. Poly-L-lysine-SP The molar ratio of DP / FGF2-3 is about 1.5. After incubation, the binding reaction mixture To a 6 ml Resource S (Pharmacia, Uppsala, Sweden) column. 20mM NaPO_FourTo 24 column volumes from 0.15 M to 2.1 M NaCl in 1 mM EDTA, pH 8.0 (Buffer B) A gradient across is used for elution. FGF2-3 / poly-L-lysine conjugate (referred to as FGF2-K) Elute from the column at a concentration of about 1.8-2M NaCl. Unreacted FGF2-3 is 0.5-0.6M  Elute with NaCl.   The fraction containing FGF2-K was concentrated and added to a buffer of 20 mM HEPES, 0.1 M NaCl, pH 7.3. Load on a gel filtration column (Sephacryl S100) for replacement. Size exclusion HP The molecular weight of FGF-K152 determined by LC is about 42 kD. This binding procedure is the heparin of FGF2-3. To determine if it interferes with the binding ability of the heparin linker to FGF2-K. Load into the column and elute from the column with 1.8-2.0M NaCl. On the contrary, Unconjugated FGF2-3 elutes from heparin with 1.4-1.6M NaCl. this child Suggests that poly-L-lysine contributes to the heparin binding capacity of FGF2-3 . The heparin binding capacity of poly-L-lysine 152 has not been determined; Elute at about 1.6M NaCl. Histone HI-polylysine was purchased. Cytochrome c Attached to polylysine as described herein.   A sample of FGF2-K is electrophoresed by SDS-PAGE under non-reducing conditions and reducing conditions. This protein moves with the same molecular weight as FGF. Under non-reducing conditions, the conjugate will High charge density prevents gel entry (Figure 1, lanes 1, 2, non-reducing conditions; 3, 4, reduction conditions).   A standard proliferation assay using bovine aortic endothelial cells was performed to Determine whether the order reduces the ability of FGF2-3 to stimulate mitogenesis. The result It is clear that FGF2-K is equivalent to FGF2-3 with respect to stimulation of proliferation (FIG. 2). ). C.FGF2-3- Poly-L-lysine-nucleic acid complex formation   Establish optimal conditions for complex formation. Various amounts (0.2-200μg) of β-gala Plasmid nucleic acid pSVβ or pNASS-β coding for custosidase (promoter ) Was slowly added to 100 μg of FGF2-K in 20 mM HEPES (pH 7.3), 0.15 M NaCl. And mix. The reaction is incubated for 1 hour at room temperature. FGF-lysine complex Nucleic acid binding to the body was cleaved with HincII restriction endonuclease³²P label SV4 Confirm by gel mobility shift assay using 0-β-gal nucleic acid. Briefly, SV40β-gal nucleic acid is digested with HincII restriction endonuclease; After dephosphorylation with rephosphatase, T_FourLabel with PNK.³²P-labeled nucleic acid 35ng each For samples, various amounts of FGF-polylysine conjugate are added to the mixture. That ta Electrophores the protein / nucleic acid mixture on an agarose gel using 1 × TAE buffer . Binding of the complex to radiolabeled DNA shifts the complex to the top of the well. (FIG. 3). As can be seen in Figure 3D, about 10ng of K₈₄But This causes a complete shift of the restriction fragment indicating binding. K₁₃So, 100ng of po Re-L-lysine was required (FIG. 3C). K₂₆₅Required 10 ng (Figure 3E).   Determine the optimal length and weight ratio of poly-L-lysine for different lengths of poly-lysine. Determined by the binding of FGF2-3. DNA encoding β-galactosidase is 0: 1, 5: 1, 2: 1, 1: 1 and 0.5: 1 (lanes 1-5 in FIG. 4 respectively) bound in a (w / w) ratio Complexed with body. The ability of these FGF2-K complexes to bind DNA It was determined by measuring the ability of FGF to promote incorporation into the. FGF2-K connection Coupling delivers pSVβ-gal DNA intracellularly at various ratios of protein to DNA Their capabilities were evaluated (Figure 4).   Briefly, after incubating the complex for 1 hour at room temperature, COS cells were incubated for 48 hours. Added for a while. Cell extracts were prepared and assayed for β-gal enzyme activity. simply Specifically, cells were treated with 1 ml of PBS (Ca⁺²And Mg⁺²(No content) and dissolved. That Lysates were vortexed and cell debris was removed by centrifugation. The solution is manufactured Assays for β-gal activity as recommended by those (Promega, Madison, WI) I did. β-gal activity was normalized to total protein. From lane 3 in Figure 4 Thus, a 2: 1 (w / w) ratio of FGF2-K: DNA gave the greatest enzymatic activity.   In addition, toroid formation correlated with increased gene expression was evaluated by electron microscopy. A typical toroid at a 2: 1 protein to DNA ratio is shown in the upper panel of FIG. Low ratio ( For example, at 0.5: 1), a toroidal structure is not formed at all or only partially formed. (Figure 5 below).   Enriched nucleic acids bind FGF2-K to cognate receptors in a proliferation assay To determine if it had any effect on the ability to stimulate mitogenesis and mitogenesis. This increase The proliferation assay shows that only the highest dose of nucleic acid (200 μg) contains FGF2-3 + poly-L-lysine + DNA Has a slight inhibitory effect on proliferation as compared to (FIG. 6).   Transfer FGF2-K84-DNA with a 2: 1 protein: DNA ratio to COS cells and ABAE endothelial cell lines Enter. Both of these cells express the FGF receptor. Then, those cells Are assayed for β-galactosidase enzyme activity. COS cells and ABAE cells Grow on cover slips and incubate for 48 hours at different FGF2-K: DNA ratios . The cells are then fixed and stained with X-gal. Maximum β-galactosidase enzyme activity Is observed when 50 μg of pSVβ is used per 100 μg of FGF2-3-polylysine conjugate. Will be issued.   FGF2-K84-pSVβ-gal was added to various cell lines at a 2: 1 protein to DNA ratio, Then incubated for 48 hours. Prepare cell extracts and determine β-gal activity and total Assayed for protein. As shown in FIG.7A, COS, B16, NIH3T3, And BHK cell lines were able to take up the complex and express β-gal .   β-gal expression requires FGF2 for targeting into cells. pSVβ or p The NASSβ plasmid DNA was added together with FGF2-K84 (lanes 1 and 2 in FIG. 7B) or FGF2-K8 Incubated for 1 hour at room temperature without 4 (lanes 3, 4). Complex to COS cells 4 Added for 8 hours. Cell extracts are assayed for β-gal activity and total protein Normalized to Unless the plasmid is complexed with FGF2 / K84, Only β-gal activity was found. β-gal expression is dependent on both time and dose Is found to be dependent (FIGS. 7C and 7D).   The sensitivity of this receptor-mediated gene delivery system has been optimized for complex formation Determined using the FGF2-K / DNA ratio. Add various amounts of FGF2-K / DNA complex to cells . 100 μg of FGF2-K was mixed with 50 μg of pSVβ for 1 hour at room temperature. COS cells and endothelial cells Cells with varying amounts of enriched material (0 ng, 1 ng, 10 ng, 100 ng and 10,000 ng). Incubate. Incubate cells for 48 hours, then β-galactosidase Assayed for zealase activity. In addition, 1000 ng of cells grown on cover glass Of FGF2-K-DNA for 48 hours, then fixed and stained with X-gal. That β- The gal enzyme assay shows that enzyme activity increases with increasing amount of material. It becomes apparent (FIG. 7D). When cells are incubated with X-gal, Approximately 3% of the cells on the surface show that the entire cytoplasm is stained blue.   The targeting of the complex is specific for the FGF receptor. First, you can see in Figure 8A Thus, FGF2-K84-pSVβ-gal provided enzymatic activity (lane 1), but FGF2 + K84 + D NA (lane 2), FGF2 + DNA (lane 3), K84 + DNA (lane 4), DNA (lane 5 ), FGF2-K84 (lane 6), FGF2 only (lane 7) and K84 only (lane 8) Showed only background levels of activity. β-gal expression is Addition of isolated FGF2 during transfection is specifically inhibited (FIG. 8B). Furthermore, the addition of heparin attenuates β-gal expression (FIG. 8C). Furthermore, histo HI and cytochrome C had no effect in delivering pSVβ-gal (FIG. 8C). .   Overall, these results indicate that the targeted DNA is mediated through the high affinity FGF receptor. Support the hypothesis that it is introduced into receptor-bearing cells. Histone DNA transfer can bind palin but cannot elicit a signal, Independent of low-affinity FGF receptor or non-specific endocytosis It seems. D.Effects of endosomal disrupting peptides   Targeting is mediated by passage of the complex through the endosome. Trance Chloroquinone added to the complex prior to transfection increases β-gal activity 8-fold (FIG. 9A).   Based on this, the effect of the endosomal disrupting peptide was evaluated. influenza The virus-derived peptide INF7 and GLF EAIEGFIEN GWEGMIDGWYGC were synthesized. FGF2-K A complex of 84 (5 μg) and pSVβ-gal plasmid DNA (5 μg) was formed. This ratio In, about half of the negative charge of DNA was neutralized by the complex. Poly-L-Lysine K84 Further additions and saturation of the binding to the remaining DNA was made. 30 INF7 peptides Minutes later added. The complex was added to COS cells and β-gal activity was Assay shortly afterwards.   Determine the amount of free polylysine required to neutralize DNA and complex INF7 did. 4, 10 or 25 μg of polylysine was added to the FGF2-K48 / pSVβ-gal complex. added. Four concentrations of INF7 were added to each of these complexes. Maximum β- Gal expression was found at 4 μg K84 and 12 μg INF7 (FIG. 13A). More poly -Using lysine resulted in more cell death. Uses 4μg of polylysine Then, the optimal amount of INF7 was determined. As seen in FIG.13B, 24 μg of INF7 was the largest resulted in β-gal activity. At 72 hours, 48 μg of INF7 had maximal β-gal activity ( (20-32 fold increase) (FIG. 13C).   Inclusion of the endosomolytic peptide in the complex increased β-gal expression by a factor of 26. (FIG. 9B). At the same time, the number of cells expressing β-gal also increased. Was. As seen in Figure 9C, the presence of endosomal disrupting peptide (EDP) (Right), 1% to 5% compared to 0.1% to 0.3% when EDP is not present (left) % Of cells expressed β-gal.                                 Example 9       Cytotoxic activity of FGF / poly-L-lysine bound to SAP DNA plasmid   By cytotoxicity assay, cytocide-encoding a gent) to determine the viable cells after transfection. FGF-2 If it is a sceptor-bound internalizing ligand, target FGFR-expressing COS7 cells T47D that does not express FGF-2 receptors at detectable levels , Negative control cells.   Cells were harvested at 38,000 cells / well and 48,000 cells in RPMI 1640 supplemented with 5% FBS Seed / well into 12-well tissue culture plates. Complex FGF2-K / pZ200M (Sapo (A plasmid expressing phosphorus) for 48 hours with COS7 cells or T47D cells. To Controls were FGF2-K only, pZ200M only, and FGF-2 + poly-L- Includes gin + pZ200M. After incubation, Mg⁺⁺And Ca⁺⁺Remove cells with PBS Sensation. Add cells with 0.1% trypsin for 10 minutes, harvest cells and wash . Determine the number of cells from each well with a Coulter particle counter (or equivalent) I do. The number of cells incubated with FGF2-K / pZ200M is Statistically significant reduction compared to Z200M alone indicates sufficient cytotoxicity Shows sex.   The FGF2-polylysine-DNASAP complex shows selective cytotoxicity. In the plant RIP Preferred mammalian motility to optimize expression of certain saporins in mammalian cells Synthesize the saporin gene using codons and use the "Kozak" The sequence was introduced. Next, the synthetic gene was transferred to an SV40 promoter expression vector and And cloned into a promoterless expression vector. SAP Code DNA from SAP Expression is determined by the mammalian ribosome, which synthesizes its protein (SAP) Prior to its inactivation, it is only possible if it can be synthesized, so Was tested for enzymatic activity. SAP to T7 / SP6 promoter It was cloned into Rasmid and sense RNA was prepared using T7 RNA polymerase. Next Then, the RNA was added to the mammal in an in vitro translation assay. This cell-free The results from the in vitro translation assay show that saporin expressed in mammalian It clearly shows that expression of cytoplasmic mutagenesis can be inhibited (FIG. 10). Add to melt In addition, SAP mRNA becomes a protein with the expected molecular weight of saporin protein. Translated (lane 2). Similarly, when luciferase mRNA is added to the lysate, A molecule consistent with the luciferase protein is detected (lane 3). Against this SAP mRNA together with luciferase mRNA or 30 min of luciferase mRNA When added to the lysate before, saporin activity is detected (lanes 4 and 5).   Transfection of cells with SAP DNA shows cytotoxicity. Using CaPO4 Transient expression of saporin-encoding mammalian expression vectors in NIH 3T3 cells The mock-transfected cells (lane 1) or β-gal Cells compared to cells transfected with the DNA to be loaded (lane 2) There is more than a 65% reduction in viability (lane 3) (FIG. 11).   FGF2-K transfers plasmid DNA encoding SAP into FGF receptor-bearing cells. To determine if this was possible, FGF2-K was mixed 2: 1 (w: w) with pSV40-SAP plasmid DNA. ). BHK 21 cells and NIH 3T3 cells were used as target cells . Cells (24,000 cells / well) were transformed with FGF2-K-DNASAP or FGF2-K-DNAβ-gal complex. Incubated with either. After 72 hours incubation, cell number It was determined. As shown in FIG. 12, cells were incubated with the FGF2-K-DNASAP complex. When compared to cells incubated with the FGF2-K-DNAβ-gal complex, A significant decrease in cell number occurs.   For purposes of illustration, this specification describes specific embodiments in the present invention. Various modifications may be made without departing from the spirit and scope of the foregoing description. Will be understood from. Accordingly, the invention is not limited except as by the appended claims. Not done.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI A61K 38/46 AGB A61K 37/02 ADS (81) Designated country EP (AT, BE, CH, DE, DK, ES, FI, FR) , GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE, SN, TD, TG) ), AP (KE, LS, MW, SD, SZ, UG), UA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BB , BG, BR, BY, CA, CH, CN, CZ, DE, DK, EE, ES, FI, GB, GE, HU, IS, JP, KE, KG, KP, KR, KZ , LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, TJ, TM, TR, TT, UA, UG, UZ, VN (72) Inventor Chandler, Royce A. USA 92024, Encinitas, Blue Bonnet Place 1814

Claims (1)

[Claims] 1. A pharmaceutical composition comprising: a receptor binding internalizing ligand_nucleic acid binding domain_cell killing factor-encoding substance, wherein the receptor binding internalizing ligand is a polypeptide reactive with a cell surface receptor The nucleic acid binding domain binds to a nucleic acid, wherein the domain is bound or fused to a receptor binding internalizing ligand; the cell killing factor-encoding substance is a nucleic acid molecule encoding a cell killing factor, wherein the substance is a nucleic acid Binding to a binding domain; and wherein the receptor binding internalized ligand_nucleic acid binding domain_cell killing factor encoding substance binds to the cell surface receptor and encodes a cell killing factor in a cell having the receptor. A pharmaceutical composition that internalizes a substance. 2. A pharmaceutical composition comprising the following formula: receptor-binding internalizing ligand-nucleic acid binding domain-prodrug-encoding substance, wherein the receptor-binding internalizing ligand is a polypeptide reactive with a cell surface receptor. A nucleic acid binding domain binds to a nucleic acid, wherein the domain is bound or fused to a receptor binding internalizing ligand; a prodrug-encoding substance is a nucleic acid molecule encoding a prodrug; And wherein the receptor-binding internalizing ligand-nucleic acid binding domain-prodrug-encoding substance binds to the cell surface receptor and internalizes the prodrug-encoding substance in cells having the receptor. , Pharmaceutical compositions. 3. 3. The composition according to claim 1, wherein the receptor-binding internalized ligand is a polypeptide reactive with an FGF receptor. 4. 3. The composition according to claim 1, wherein the receptor-binding internalized ligand is selected from the group consisting of a polypeptide reactive with VEGF receptor and a polypeptide reactive with HBEGF receptor. 5. 3. The composition according to claim 1, wherein the receptor binding internalizing ligand is a cytokine. 6. The composition according to claim 1, wherein the cell killing factor-encoding substance encodes a protein that inhibits protein synthesis. 7. The composition according to claim 6, wherein the protein is a ribosome-inactivating protein. 8. The composition according to claim 7, wherein the ribosome-inactivating protein is saporin. 9. The composition according to claim 7, wherein the ribosome-inactivating protein is gelonin. 10. 7. The composition of claim 6, wherein said protein inhibits elongation factor 2. 11. 11. The composition according to claim 10, wherein said protein is diphtheria toxin. 12. 3. The composition of claim 2, wherein the prodrug-encoding substance encodes HSV-thymidine kinase. 13. 3. The composition according to claim 1, wherein said growth factor is a polypeptide reactive with FGF receptor and said nucleic acid binding domain is poly-L-lysine. 14． The nucleic acid binding domain is selected from the group consisting of a helix-turn-helix motif protein, a homeodomain protein, a zinc finger motif protein, a steroid receptor protein, a leucine zipper motif protein, a helix-loop-helix motif protein, and a β-sheet motif protein. The composition according to claim 1, wherein 15. The nucleic acid binding domain is selected from the group consisting of AP-1, Sp-1, rev, GCN4, λcro, λcI, TFIIA, myoD, retinoic acid receptor, glucocosteroid receptor, SV40 large T antigen, and GAL4. The composition according to claim 1. 16. 3. The composition according to claim 1, wherein the nucleic acid binding domain is selected from the group consisting of poly-L-lysine, protamine, histone and spermine. 17． The composition of claim 1, wherein the nucleic acid binding domain binds a DNA molecule encoding a ribosome-inactivating protein. 18. The composition according to claim 1, wherein the nucleic acid binding domain binds a coding region of saporin DNA. 19. 2. The composition according to claim 1, wherein said cell killing factor-encoding substance further comprises a tissue-specific promoter. 20. 3. The composition of claim 2, wherein the prodrug-encoding substance further comprises a tissue-specific promoter. 21. The tissue-specific promoter is a group consisting of α-crystallin, tyrosinase, α-fetoprotein, prostate-specific antigen, CEA, α-actin, VEGF receptor, erbB-2, C-myo, cyclin D, FGF receptor and γ-crystallin promoter. 21. The composition according to claim 19, which is selected from: 22. 22. The composition of any of claims 1-21, further comprising at least one linker that increases serum stability or intracellular availability of the nucleic acid binding domain, and the addition of the linker (s). Has the formula: receptor-binding internalized ligand_ (L) _q _nucleic acid binding domain-cell killing factor-encoding substance, or formula: receptor-binding internalized ligand- (L) _{q -nucleic} acid binding domain-prodrug-encoding substance, Wherein: L is at least one linker; and q is one or more; such that the conjugate binds to a cell surface receptor and the cell killing factor-encoding or prodrug-encoding agent is internalized. Maintain its ability to rise, and wherein the cell killing factor-encoding substance or the prod Ggukodo material is attached to the nucleic acid binding domain, composition. 23. 23. The composition of claim 22, wherein said linker increases the flexibility of the conjugate. 24. The linker is (Gly _m Ser _p ) _n , (Ser _m Gly _p ) _n and (AlaAlaProAla) _n (where n is 1 to 6, m is 1 to 6 and p is 1 to 4 24. The composition of claim 23, wherein the composition is selected from the group consisting of: 25. 25. The composition of claim 24, wherein m is 4, p is 1, and n is 2-4. 26. 23. A therapeutically effective amount of any of claims 1, 2 or 22 for use in the manufacture of a medicament for preventing hypercellular proliferation in the eye, comprising contacting the eye with a cell growth inhibiting amount. Wherein the cells to be inhibited are epithelial cells, endothelial cells, fibroblasts or keratocytes. 27. 3. A therapeutically effective amount of a claim 1, for use in the manufacture of a medicament for treating the cancer, comprising contacting the cancer cell with a sufficient amount of the composition to inhibit the growth of the cancer cell. 23. The pharmaceutical composition according to any of 2 or 22. 28. A therapeutic for use in the manufacture of a medicament for treating smooth muscle cell hyperplasia, comprising contacting the smooth muscle cell with a composition in an amount sufficient to inhibit hyperplasia of the smooth muscle cell. An effective amount of a pharmaceutical composition according to any of claims 1, 2 or 22. 29. A pharmaceutical composition comprising a receptor-binding internalizing ligand-cell killing factor-encoding nucleic acid binding domain, wherein the receptor-binding internalizing ligand is a polypeptide reactive with a cell surface receptor. A cell killing factor-encoding substance is a nucleic acid molecule encoding a cell killing factor, wherein the substance is bound to a receptor binding internalizing ligand; and wherein the cell killing factor encoding substance is attached to the nucleic acid binding domain. Binding; and wherein said receptor-binding internalized ligand-cell killing factor-encoding nucleic acid binding domain binds to a cell surface receptor and is internalized in cells having said receptor. 30. 31. The composition of claim 30, wherein said nucleic acid binding domain is poly-L-lysine. 31. 31. The composition of claim 30, wherein said receptor binding internalizing ligand is a polypeptide reactive with an FGF receptor.