EP0830375A1 - Inhibiteur humain du gene 1 de l'apoptose - Google Patents

Inhibiteur humain du gene 1 de l'apoptose

Info

Publication number
EP0830375A1
EP0830375A1 EP95919804A EP95919804A EP0830375A1 EP 0830375 A1 EP0830375 A1 EP 0830375A1 EP 95919804 A EP95919804 A EP 95919804A EP 95919804 A EP95919804 A EP 95919804A EP 0830375 A1 EP0830375 A1 EP 0830375A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
polynucleotide
dna
seq
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95919804A
Other languages
German (de)
English (en)
Other versions
EP0830375A4 (fr
Inventor
Wei Wu He
Peter L. Hudson
Craig A. Rosen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of EP0830375A1 publication Critical patent/EP0830375A1/fr
Publication of EP0830375A4 publication Critical patent/EP0830375A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human inhibitor of apoptosis gene 1, sometimes hereinafter referred to as "hIAP-l". The invention also relates to inhibiting the action of such polypeptides.
  • Programmed cell death is a process through which organisms get rid of unwanted cells.
  • Programmed cell death can be considered as a specific type of terminal cell differentiation.
  • the cells of an organism round up and they have active blebbing at the cell surface, forming apoptotic bodies, the nuclear membranes and some internal structures break down, the nuclear DNA is fragmented by enzymes, and finally the cell breaks into pieces.
  • ced-3 a new mammalian gene which coded for interleukin- /3-converting enzyme (ICE) .
  • ICE interleukin- /3-converting enzyme
  • Apoptosis may be induced by a variety of different extracellular and intracellular stimuli, some of which are still unknown, which can differ depending on cell type. However, the numerous receptors and associated signal transduction pathways that respond to each different induction stimulus may converge on one or more of a limited number of pathways that actually "trigger" the program for apoptotic cell death.
  • the stimuli which can induce apoptosis there is extracellular ATP, actinomycin and oxygen radicals. Actinomycin inhibits the synthesis of RNA and induces apoptosis in some mammalian cell types, including human primary uterine epithelial cells and HL60 leukemic cells (Gerschenson, L.E. and Rotello, R.J., Cold Spring Harbor, Laboratory Press, Cold Spring Harbor, New York, page 175, (1991) and Martin, S.J., et al. , Immunol. , 145:1859 (1990) ) .
  • the baculovirus Cydia pomonella granulosis virus (CpGV)
  • CpGV Cydia pomonella granulosis virus
  • the CpGV gene was sequenced (Crook, N.E. et al., J. Virol., 67:2168 (1993)) and found to have a characteristic zinc finger-like motif.
  • the gene was named iap for inhibitor of apoptosis, and the CpGV gene was called the Cp-IAP.
  • the zinc finger-like motif found in the Cp-IAP polypeptide belongs to a specific class of zinc finger-like motifs (Freemont, P.S. et al., Cell, 64:483 (1991)) usually found at the amino terminus of polypeptides, but it can occur elsewhere, as in the case of the IAP polypeptide, where it is found at the carboxyl terminus.
  • the IAP motif also contains an additional CX 2 C repeat in the amino-terminal portion of the motif, as well as an extra amino acid residue in the central region (CXHX 3 C instead of CXHX 2 C) .
  • CXHX 3 C extra amino acid residue in the central region
  • the zinc finger-like motif in also present in several proteins encoded by vertebrate viruses.
  • the presence of the motif in several regulatory proteins supports the hypothesis that many of the proteins containing this motif may be transcriptional regulatory factors, although DNA binding has been demonstrated thus far for only one particular member of this group (Tagawa, et al., J. Biol. Chem., 265:20021 (1990)).
  • the zinc finger-like motif found in Cp-IAP is also present in a number of cellular polypeptides that may have a role in regulating apoptosis. Several of these are encoded by human proto-oncogenes such as PML, bmi -1 , c-cbl , rfp and mel -18. These proteins are involved in either positive or negative apoptotic control. Thus, Cp-IAP may belong to a class of cellular proteins which control apoptosis and contain this distinctive zinc finger-like motif.
  • the polypeptide of the present invention contains the conserved zinc finger-like motifs and has been putatively identified as a member of this class of proteins.
  • Apoptosis has been shown to play a significant role in cell development, antiviral responses, tissue differentiation, development, tissue homeostasis, Alzheimer's disease, rheumatoid arthritis, septic shock, Parkinson's disease and may be a mechanism by which cells die during strokes, trauma and degenerative diseases. Improper apoptosis, i.e., when cells fail to die when they should, may result in tumors, oncogenesis and viral infection.
  • polypeptide of the present invention is of human origin.
  • nucleic acid molecules encoding a polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments and derivatives thereof.
  • a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes for example, for preventing oncogenesis, to treat Alzheimer's disease, Parkinson's disease, rheumatoid arthritis, septic shock and to prevent the death of cells during strokes, trauma and degenerative diseases.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to nucleic acid sequences of the present invention.
  • Figure 1 illustrates the cDNA sequence and corresponding deduced amino acid sequence of the polypeptide of the present invention.
  • the standard abbreviations for nucleotides and amino acids are used. Sequencing was performed using a 373 automated DNA sequencer (Applied Biosystems, Inc.).
  • Figure 2 is an amino acid sequence alignment of hIAP-1 with Cp-IAP (Cydia pomonella granulosis virus inhibitor of apoptosis) and Op-IAP (Orgyia pseudotsugata nuclear polyhedrosis virus inhibitor of apoptosis) .
  • nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. - on May 11, 1995.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from human jurket cell lines and human osteoclastoma stromal cells. It is structurally related to the inhibitor of apoptosis gene family. It contains an open reading frame encoding a protein of 438 amino acid residues. The protein exhibits the highest degree of homology to Op-IAP with 44 % identity and 64 % similarity over the entire amino acid stretch. As stated previously, the conserved motifs found in genes of this type are preserved in the gene of the present invention.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:l) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO:l) or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non- coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID NO:l) or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polypeptides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:l) or the deposited cDNA(s) .
  • the polynucleotides may have at least 20 bases, preferably 30 bases and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which have an identity thereto, as hereinabove described, which may or may not retain activity.
  • Such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO: 1, or for variants thereof, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
  • the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.
  • the deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 TJ.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • the present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) nor that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide which are employed for purification of the mature polypeptide or a proprotein sequence.
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • polypeptides of the present invention include the polypeptide of SEQ ID NO;2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably a 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably a 90% similarity (more preferably a 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably a 95% similarity (still more preferably a 95% identity) to the polypeptide of SEQ ID NO:2 and to portions of such polypeptide with such portion of the polypeptide generally contains at least 30 amino acids and more preferably at least 50 amino acids.
  • similarity between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis, therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons) .
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the hIAP-1 genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example, LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli. Streptomyces, Salmonella typhimurium
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowes melanoma
  • adenoviruses,- plant cells etc.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)).
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. , (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of esqpressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimuriu and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • Such commercial vectors include, for example, PKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, Wl, USA) . These ⁇ BR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and leetin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • hIAP-1 polypeptides and inhibitory compounds, described below, which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • DNA or RNA polynucleotide
  • cells may be engineered by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector includes one or more promoters.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechni ⁇ ues. Vol. 7, N0:9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and /3-actin promoters) .
  • CMV human cytomegalovirus
  • viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter,- inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters,- viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ,- the ⁇ -actin promoter,- and human growth hormone promoters.
  • the promoter also may be the native promoter which controls the gene en
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, -2, ⁇ -AM, PA12, T19-14X, VT-19-17-H2, ⁇ CKE, ⁇ CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides.
  • retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo.
  • the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • hIAP-1 polypeptide Once the hIAP-1 polypeptide is being expressed intra- cellularly via gene therapy, it may be employed to treat neurodegenerative diseases caused by abnormal apoptosis of neurons, for example, Alzheimer's disease and Parkinson's disease. hIAP-1 may also be employed to prevent cells from dying during trauma such as head injury and strokes.
  • the hIAP-1 protein of the present invention may also be employed to prevent abnormal apoptosis which leads to rheumatoid arthritis.
  • hIAP-l polypeptide may also be employed to prevent oncogenesis which results from abnormal apoptosis.
  • a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.
  • the gene and gene product may be employed as a research tool for discovering diagnostic and therapeutic treatments for human disease and to shed light on the process of apoptosis in humans.
  • Fragments of the full length hIAP-1 gene may be used as a hybridization probe for a cDNA library to isolate the full length hIAP-l gene and to isolate other genes which have a high sequence similarity to the hIAP-l gene or similar biological activity.
  • the probes are at least 20 bases in length, preferably at least 30 and most preferably at least 50.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete hIAP-l gene including regulatory and promotor regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the hIAP-l gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • This invention is also related to the use of the hIAP-l gene as a diagnostic. Detection of a mutated form of hIAP-l will allow a diagnosis of a disease or a susceptibility to a disease which results from underexpression of hIAP-l.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166 (1986)) prior to analysis.
  • RNA or cDNA may also be used for the same purpose.
  • PCR primers complementary to the nucleic acid encoding hIAP-l can be used to identify and analyze hIAP-l mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled hlAP- 1 RNA or alternatively, radiolabeled hIAP-l antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method.
  • cloned DNA segments may be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al . , Science, 230:1242 (1985)).
  • Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
  • nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
  • RFLP Restriction Fragment Length Polymorphisms
  • mutations can also be detected by in situ analysis.
  • the present invention also relates to a diagnostic assay for detecting altered levels of hIAP-l protein in various tissues since an over-expression of the proteins compared to normal control tissue samples can detect the presence of conditions related to abnormally high apoptosis.
  • Assays used to detect levels of hIAP-l protein in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassay ⁇ , competitive-binding assays, Western Blot analysis and preferably an ELISA assay.
  • An ELISA assay initially comprises preparing an antibody specific to the hIAP-l antigen, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme.
  • a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating-with a non-specific protein like BSA.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hIAP-l proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hIAP-l. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of hIAP-l protein present in a given volume of patient sample when - ⁇ compared against a standard curve.
  • a competition assay may be employed wherein antibodies specific to hIAP-l is attached to a solid support and labeled hIAP-l and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of hIAP-l in the sample.
  • This invention provides a method of screening compounds to identify those which block the inhibition of apoptosis by hIAP-l.
  • SF-21 cells are transfected with a known gene which causes apoptosis, for example, annihilator mutant DNA from vAcAnh or vP35Z.
  • the compound to be tested and hlAP are then contacted with the cell, either intracellularly or extracellularly.
  • a survey is then done of the cells under a light microscope three to four days after co-transfection, and the usual characteristics of an apoptotic cell is checked and the ability of the compound to prevent the action of hlAP is analyzed.
  • Human IAP-l is produced and functions intra-cellularly, therefore, any inhibitory compounds must function intra ⁇ cellularly.
  • These compounds include antibodies which are produced intracellularly.
  • an antibody identified as inhibiting hIAP-l may be produced intracellularly as a single chain antibody by procedures known in the art, such as transforming the appropriate cells with DNA encoding the single chain antibody to prevent the function of hIAP-l.
  • an antisense construct prepared using antisense technology used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into hIAP-l polypeptide (Antisense - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)) .
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of hIAP-l.
  • Another example includes a mutated form, or utein, of hIAP-l which recognizes hIAP-l substrates but has impaired function so as not to prevent apoptosis.
  • Another example is a small molecule which is able to pass through the cell membrane and bind to hIAP-l and prevent its biological activity.
  • small molecules include but are not limited to small peptides or peptide-like molecules.
  • These compounds may be employed to inhibit the action of hIAP-l and prevent tumors since oncogenesis results when cells fail to undergo apoptosis at the appropriate time.
  • hIAP-l may also be inhibited by these compounds for the promotion of cell development to allow apoptosis to kill viral infected cells, and to stimulate tissue differentiation and development.
  • the compounds may also be employed to maintain tissue homeostasis.
  • compositions comprise a therapeutically effective amount of the compound, and a pharmaceutically acceptable carrier or excipient.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the compounds may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease. Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 50 or 60 bases.
  • Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988) .
  • the physical position of the sequence on the chromosome can be correlated with genetic map data.
  • genetic map data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) .
  • the relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes) .
  • linkage analysis coinheritance of physically adjacent genes
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering .the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
  • equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA liga ⁇ e ("ligase") per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA liga ⁇ e
  • the DNA sequence encoding hIAP-l is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the processed hIAP-l gene (minus the signal peptide sequence) and the vector sequences 3' to the hIAP-l gene. Additional nucleotides corresponding to hIAP-l are added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer has the sequence 5' GATCGGATCCATGAGTACTGAAGAAGCCAG 3' (SEQ ID NO:3) contains a BamHI restriction enzyme site followed by 20 nucleotides of hIAP-l coding sequence starting from the presumed terminal amino acid of the processed protein.
  • the 3' sequence 5' GACTGGATCCTCTTTAAGAGAGAAATGTACG 3' (SEQ ID NO:4) contains complementary sequences to a BamHI site.
  • the restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA) .
  • pQE-9 encodes antibiotic resistance (Amp r ) , a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0) , a ribosome binding site (RBS) , a 6- His tag and restriction enzyme sites.
  • pQE-9 is then digested with BamHI and dephosphorylated.
  • the amplified sequences are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture is then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan r ) .
  • Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml) . The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG Isopropyl-B-D-thiogalacto pyranoside
  • IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
  • Cells are grown an extra 3 to 4 hours.
  • Cells are then harvested by centrifugation.
  • the cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
  • solubilized hIAP-l protein is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)) .
  • hIAP-l (50% pure) is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.
  • the DNA sequence encoding the full length hIAP-l protein, ATCC # is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' end sequences of the gene:
  • the 5' primer has the sequence 5' GCAGATCTGTAGATCTGG TCACCATGAGTACTG 3' (SEQ ID NO:5) and contains a Bglll restriction enzyme site (in bold) followed by 25 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M. , J. Mol. Biol., 196:947-950 (1987) which is just behind the hIAP-l gene (the initiation codon for translation "ATG" is underlined) .
  • the 3' primer has the sequence 5' GC-AGATCTTTAAGAGAGAAA TGTACG 3' (SEQ ID NO:6) and contains the cleavage site for the restriction endonuclease Bglll and 19 nucleotides complementary to the 3' non-translated sequence of the hIAP-l gene.
  • the amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc. , La Jolla, Ca. ) .
  • the fragment is then digested with the endonuclease Bglll and then purified again on a 1% agarose gel. This fragment is designated F2.
  • the vector pRGl (modification of pVL941 vector, discussed below) is used for the expression of the hIAP-l protein using the baculovirus expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin NO:1555) .
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonuclease BamHI.
  • the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31- 39) .
  • the plasmid is digested with the restriction enzyme BamHI and dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase.
  • E.coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBac hIAP-l) with the hIAP-l gene in the correct orientation using PCR. The sequence of the cloned fragment is confirmed by DNA sequencing. 5 ⁇ g of the plasmid pBac hIAP-l is cotransfected with
  • the plate is rocked back and forth to mix the newly added solution.
  • the plate is then incubated for 5 hours at 27°C.
  • the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added.
  • the plate is put back into an incubator and cultivation continued at 27°C for four days.
  • plaque assay After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .
  • the virus is added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes.
  • the supernatants of these culture dishes are harvested and then stored at 4°C.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells are infected with the recombinant baculovirus V-hIAP-1 at a multiplicity of infection (MOD of 2.
  • MOD multiplicity of infection
  • the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg, MD) .
  • the cells are further incubated for 16 hours before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • hIAP-l HA The expression of plasmid, hIAP-l HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, an SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire hIAP-l precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag corresponds to an epitope. derived from the influenza hemagglutinin protein as previously described (I. Wilson, H.
  • HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding hIAP-l, ATCC # is constructed by PCR using two primers: the 5' primer 5' GCAGATCTGC-AATGAGTACTGAAGAAGCC 3' (SEQ ID NO:7) contains a Bglll site followed by 21 nucleotides of hIAP-l coding sequence starting from the initiation codon,- the 3' sequence 5' GC ⁇ GATC ⁇ Cc ⁇ AGCGTAGTCTGGGACGTCGTATGGGTAAGAGAGAAATGT ACGAACAGT 3' (SEQ ID NO:8) contains complementary sequences to a Bglll site, translation stop codon, HA tag and the last 21 nucleotides of the hIAP-l coding sequence (not including the stop codon) .
  • the PCR product contains a Bglll site, hIAP-l coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and a Bglll site.
  • the PCR amplified DNA fragment is digested with Bglll and the vector, pcDNAl/Amp digested with BamHI restriction enzyme are ligated.
  • the ligation mixture is transformed into E. coli strain XL-1-Blue (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
  • COS cells are transfected with the expression vector by DEAE- DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)).
  • the expression of the hIAP-l HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with 35 S-cysteine two days post transfection.
  • Example 6 Expression of hIAP-l via Gene Therapy Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days.
  • fresh media e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin
  • pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphatase.
  • the linear vector is fractionated on agarose gel and purified, using glass beads.
  • the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively.
  • the 5' primer containing an EcoRI site and the 3' primer, having contains a Hindlll site.
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is used to transform bacteria HB101, which are then plated onto agar- containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .
  • Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
  • the spent media containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
  • the engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.
  • the fibroblasts now produce the protein product.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • Tyr lie Gly Pro Gly Asp Arg Val Ala Cys Phe Ala Cys Gly Gly
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:3: GATCGGATCC ATGAGTACTG AAGAAGCCAG 30
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:7: GCAGATCTGC AATGAGTACT GAAGAAGCC 29

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un inhibiteur humain du polypeptide de l'apoptose et l'ADN (ARN) codant pour un tel polypeptide, ainsi qu'un procédé pour produire ce polypeptide, par des techniques de recombinaison. L'invention concerne, en outre, des procédés pour utiliser de tels polypeptides pour le traitement de maladies dégénératives, de la polyarthrite rhumatoïde, des chocs septiques, comme mécanisme de défense antiviral et pour empêcher la mort de cellules en cas de traumatisme ou d'attaque. L'invention concerne également des antagonistes de tels polypeptides et leur utilisation thérapeutique pour favoriser le développement cellulaire, empêcher les infections virales, favoriser la différentiation cellulaire, favoriser et maintenir l'homéostasie tissulaire (tumeurs). L'invention concerne enfin des méthodes de diagnostic pour détecter les mutations dans la séquence des acides nucléiques codant pour la protéine hIAP-1.
EP95919804A 1995-05-11 1995-05-11 Inhibiteur humain du gene 1 de l'apoptose Withdrawn EP0830375A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CA002220670A CA2220670A1 (fr) 1995-05-11 1995-05-11 Inhibiteur humain du gene 1 de l'apoptose
PCT/US1995/005922 WO1996035703A1 (fr) 1995-05-11 1995-05-11 Inhibiteur humain du gene 1 de l'apoptose

Publications (2)

Publication Number Publication Date
EP0830375A1 true EP0830375A1 (fr) 1998-03-25
EP0830375A4 EP0830375A4 (fr) 2001-11-21

Family

ID=25679809

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95919804A Withdrawn EP0830375A4 (fr) 1995-05-11 1995-05-11 Inhibiteur humain du gene 1 de l'apoptose

Country Status (4)

Country Link
EP (1) EP0830375A4 (fr)
AU (1) AU2548095A (fr)
CA (1) CA2220670A1 (fr)
WO (1) WO1996035703A1 (fr)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6156535A (en) 1995-08-04 2000-12-05 University Of Ottawa Mammalian IAP gene family, primers, probes, and detection methods
AUPN727595A0 (en) * 1995-12-22 1996-01-18 Walter And Eliza Hall Institute Of Medical Research, The Therapeutic compositions
US6133437A (en) * 1997-02-13 2000-10-17 Apoptogen, Inc. Modulation of IAPs for the treatment of proliferative diseases
AU5065098A (en) * 1996-11-15 1998-06-10 University Of Ottawa Modulators of ovarial apoptosis related to iap
US6472172B1 (en) * 1998-07-31 2002-10-29 Schering Aktiengesellschaft DNA encoding a novel human inhibitor-of-apoptosis protein
JP2002538769A (ja) * 1998-10-30 2002-11-19 ユニバーシティ オブ ネブラスカ−リンカーン アポトーシス遺伝子の異種間移入及びそれにより開発されたトランスジェニック植物
WO2000077201A1 (fr) * 1999-06-15 2000-12-21 Astrazeneca Ab Proteine-3 inhibiteur d'apoptose (iap-3), designee sous le nom de livine
DE60327618D1 (de) 2002-03-27 2009-06-25 Aegera Therapeutics Inc Gegen iap gerichtete antisense-nukleobasen und deren verwendungen
US8012944B2 (en) 2003-10-30 2011-09-06 Pharmascience Inc. Method for treating cancer using IAP antisense oligomer and chemotherapeutic agent

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DUCKETT C S ET AL: "A CONSERVED FAMILY OF CELLULAR GENES RELATED TO THE BACULOVIRUS IAP GENE AND ENCODING APOPTOSIS INHIBITORS" EMBO JOURNAL, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 15, no. 11, 1996, pages 2685-2694, XP002032297 ISSN: 0261-4189 *
LISTON P ET AL: "SUPPRESSION OF APOPTOSIS IN MAMMALIAN CELLS BY NAIP AND A RELATED FAMILY OF IAP GENES" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 379, no. 6563, 25 January 1996 (1996-01-25), pages 349-353, XP002032296 ISSN: 0028-0836 *
RAJCAN-SEPAROVIC ET AL: "Assignment of human inhibitor of apoptosis protein (IAP) genes xiap, hiap-1, and hiap-2 to chromosomes Xq25 and 11q22-q23 by fluorescence in situ hybridization" GENOMICS, ACADEMIC PRESS, SAN DIEGO, US, vol. 37, no. 3, 1 November 1996 (1996-11-01), pages 404-406, XP002121939 ISSN: 0888-7543 *
ROTHE M ET AL: "THE TNFR2-TRAF SIGNALING COMPLEX CONTAINS TWO NOVEL PROTEINS RELATED TO BACULOVIRAL INHIBITOR OF APOPTOSIS PROTEINS" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 83, no. 7, 29 December 1995 (1995-12-29), pages 1243-1252, XP002032302 ISSN: 0092-8674 *
ROY N ET AL: "THE GENE FOR NEURONAL APOPTOSIS INHIBITORY PROTEIN IS PARTIALLY DELETED IN INDIVIDUALS WITH SPINAL MUSCULAR ATROPHY" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 80, no. 1, 13 January 1995 (1995-01-13), pages 167-178, XP002032295 ISSN: 0092-8674 *
See also references of WO9635703A1 *
UREN A G ET AL: "CLONING AND EXPRESSION O FAPOPTOSIS INHIBITORY PROTEIN HOMOLOGS THAT FUNCTION TO INHIBIT APOPTOSIS AND/OR BIND TUMOR NECROSIS FACTOR RECEPTOR-ASSOCIATED FACTORS" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 93, May 1996 (1996-05), pages 4974-4978, XP000918891 ISSN: 0027-8424 *
VAUX D L: "TOWARD AN UNDERSTANDING OF THE MOLECULAR MECHANISMS OF PHYSIOLOGICAL CELL DEATH" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, vol. 90, February 1993 (1993-02), pages 786-789, XP000918873 ISSN: 0027-8424 *

Also Published As

Publication number Publication date
CA2220670A1 (fr) 1996-11-14
WO1996035703A1 (fr) 1996-11-14
AU2548095A (en) 1996-11-29
EP0830375A4 (fr) 2001-11-21

Similar Documents

Publication Publication Date Title
US8017349B2 (en) Human neuronal attachment factor-1
US20070154908A1 (en) Connective Tissue Growth Factor-2
US20090197278A9 (en) Antibodies to hADA2
US5710019A (en) Human potassium channel 1 and 2 proteins
US5861272A (en) C5A receptor
EP0830375A1 (fr) Inhibiteur humain du gene 1 de l'apoptose
WO1997035976A9 (fr) Facteur de differenciation epidermique
US5650313A (en) Ubiquitin conjugating enzymes 8 and 9
CA2249254A1 (fr) Facteur de differenciation epidermique
US20030073159A1 (en) Human inhibitor of apoptosis gene 1
US20050123998A1 (en) C5a receptor
US5849286A (en) Ubiquitin conjugating enzymes 7,8 and 9
WO1996039424A1 (fr) Facteur c stimulant les cellules tueuses naturelles
US6537539B2 (en) Immune cell cytokine
WO1997018224A1 (fr) Antigene 2 de cellules-souches humaines
EP0874864B1 (fr) Proteine antivirale
EP0814661A1 (fr) Enzymes 7, 8 et 9 de conjugaison d'ubiquitine
EP0833892A1 (fr) Facteur de croissance de type 2 derive de l'hepatome humain
US6255079B1 (en) Polynucleotides encoding natural killer cell enhancing factor C
US6130061A (en) Human stem cell antigen 2
US5798223A (en) Polynucleotides encoding human amine transporter and methods of using the same
AU716415B2 (en) Pineal gland specific gene-1
US5962268A (en) DNA encoding an immune cell cytokine
EP0842187A1 (fr) Cystatine e humaine
US20030092895A1 (en) Human potassium channel 1 and 2 proteins

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19971205

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 20011005

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20030605

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040622