EP0828841A2 - Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and dna sequences of the pdc gene coding them - Google Patents
Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and dna sequences of the pdc gene coding themInfo
- Publication number
- EP0828841A2 EP0828841A2 EP96919594A EP96919594A EP0828841A2 EP 0828841 A2 EP0828841 A2 EP 0828841A2 EP 96919594 A EP96919594 A EP 96919594A EP 96919594 A EP96919594 A EP 96919594A EP 0828841 A2 EP0828841 A2 EP 0828841A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- codon
- pdc
- amino acid
- dna sequence
- acid residue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
- C12P7/26—Ketones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
- C07C49/20—Unsaturated compounds containing keto groups bound to acyclic carbon atoms
- C07C49/24—Unsaturated compounds containing keto groups bound to acyclic carbon atoms containing hydroxy groups
- C07C49/245—Unsaturated compounds containing keto groups bound to acyclic carbon atoms containing hydroxy groups containing six-membered aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
Definitions
- the invention relates to a process for the production of acyloin by enzymatic conversion of ⁇ -ketocarboxylic acids and / or aldehydes in the presence of pyruvate decarboxylase (PDC) and it includes a PDC suitable therefor and its production and the gene coding therefor.
- PDC pyruvate decarboxylase
- Acyloins or ⁇ -hydroxyketones are compounds with an optically active carbon atom that play a significant role in the synthesis of more complex compounds, such as, in particular, the (R) - (-) -phenylacetylcarbinol
- PAC which is of great economic interest for the production of ephedrine.
- R enantiomer is of interest, which is formed by fermentative conversion of pyruvate in the presence of benzaldehyde by means of Saccharomyces cerevisiae (DE-PS 548 459 from 1932).
- the pyruvate decarboxylase (PDC) isolated from the yeast also leads to considerable proportions of the 2-hydroxypropiophenone isomeric to PAC in this reaction.
- Such an enzymatic conversion also takes place starting from an aldehyde instead of ⁇ -ketocarboxylic acids, and the aldehyde formed by the decarbooxylation can also act as a "cosubstrate" in the condensation reaction with the formation of homoacyloins
- the PDC from Zymomonas mobilis has also been isolated.
- the process of the type mentioned at the outset is essentially characterized in that an enzyme is used as the PDC in which the tryptophan residue in the substrate channel leading to the active center is replaced by a sterically smaller amino acid residue.
- a sterically smaller amino acid residue is in particular a simple, in particular aliphatic, amino acid, such as specifically alanine, glycine,
- the genetically modified new PDC is obtained by replacing the codon TGG coding for tryptophan at position 392 in position 1174-1176 of the DNA sequence of the PDC gene from Z. mobilis in itself known manner and expression of the PDC in a producer organism, such as in particular E. coli, from which the PDC is isolated.
- the targeted mutation occurs e.g. B. using the polymerase chain reaction using the primers specified on page 9.
- the construction of the expression vector pBTac2 for the mutated PDC was carried out starting from the E. coli expression vector pPDC of the wild-type enzyme.
- the mutated PDC are obtained after harvesting and disruption of the cells from the crude extract in a manner known per se by chromatographic methods.
- An analogous optimization can generally be achieved with thiamine-diphosphate-dependent enzymes, which have an access limitation - be it steric or due to charge influences - in the substrate channel leading to the active center:
- an analogous modification of the DNA sequence of the coding for the enzyme Gene by replacing the codon coding for the access limitation with a codon coding for an amino acid residue which removes the access limitation, a significant increase in the synthesis capacity of the enzyme is achieved.
- linear and / or branched ⁇ -ketocarboxylic acids can be used as the substrate and aromatic, cyclic, longer-chain and / or branched aldehydes can be used as the substrate and / or cosubstrate.
- aromatic, cyclic, longer-chain and / or branched aldehydes can be used as the substrate and / or cosubstrate.
- aldehydes examples include benzaldehyde, cyclohexanaldehyde, furfural, cinnamaldehyde, crotonaldehyde, pyruvate, 2-ketobutyric acid, 2-ketopentanoic acid, 2-keto-4-methyllhexanoic acid,
- Fig. 1 The reaction scheme of the PDC for the example
- Fig. 2 A construction scheme for the formation of the expression vector containing the PDC from Z. mobilis pPDC and
- FIG. 3 A diagram for a production of PAC according to FIG. 1, which is optimized by trapping acetaldehyde by means of alcohol dehydrogenase.
- the vector pBTac2 (Boehringer, Mannheim) was chosen for the expression of the PDC from Zymomonas mobilis.
- the transcription of the foreign gene is under the control of the strong tac promoter, a hybrid of trp and lacUV promoters with 11-fold and 3-fold efficiency parent promoters.
- the operator sequence and ribosome binding region come from the lacZ gene.
- the transcription is thus regulated by the lac repressor of an overexpressing (laciQ) bacterial strain and can be induced by isopropyl- ⁇ -D-thiogalactoside (IPTG).
- the vector contains a single recognition sequence of the restriction endonuclease EcoRI, followed by the initiation codon ATG and then further restriction recognition sequences (sites), so that this vector is universal for expression both for gene sequences with and without its own
- Initiation codon can be used.
- the multiple cloning site is followed by the strong ribosomal RNA transcription terminators rrnB to ensure controlled termination of the transcription.
- the vector pZY134B (G. Sprenger, Inst. Biotechnologie 2, KFA-Jülich) was available as the starting material for cloning the PDC gene from Zymomonas mobilis (ATCC 29191). This plasmid contains a 3.2 kb DNA fragment from Zymomonas mobilis with the complete PDC gene including non-coding regions (FIG. 2). In order to enable the coding sequence to be ligated into the expression vector, it was necessary to introduce a new restriction recognition sequence in the 5 'direction of the initiation codon.
- PCR polymerase, chain reaction
- the required EcoRI restriction site was introduced in the 5 'direction of the initiation codon of the PDC gene by connecting the recognition sequence of the enzyme to the 5' end of the primer complementary to the gene during oligonucleotide synthesis. Since some endonucleases show a strongly reduced activity for the restriction of terminal sequences, four further bases were added upstream to the ECoRI site.
- the Taq polymerase most commonly used for PCR has no 3'-5 'exonuclease activity (proof-reading).
- the sequence it synthesizes is therefore subject to a statistical error rate. Even if this with the choice of suitable reaction conditions 1 / 100,000 can be kept very low, this necessitates the sequencing of each fragment to ensure the integrity of the synthesis. Therefore, not the entire coding region of the PDC gene (1712 bp), but a smaller fragment (890 bp) from the 5'-terminus to a single restriction site (EcoRV) was chosen for the amplification (FIG. 2).
- the PCR product was digested with the corresponding restriction endonucleases EcoRI and EcoRV.
- the missing second part of the PDC gene was obtained from the plasmid pZY134B by restriction with ECoRV and BamHI, the resulting fragment (1.2 kb) at the 3 'end still containing about 350 bp untranslated sequence of the PDC gene. Both fragments were separated by preparative agarose gel electrophoresis, isolated and ligated in the EcoRI and BamHI linearized, isolated pBTac2 (4.6 kb). The cloning was carried out in E. coli JM 109, a strain overexpressing the lac repressor.
- the PDC gene from Z. mobilis in the E. coli expression vector pPDC was available as a starting point (see FIG. 2). DNA isolation was carried out according to standard methods (J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press). The plasmid pPDC served as a template for the synthesis of the two overlapping individual fragments.
- the primers J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press.
- Tm 2 * (A + T) + 3 * (C + G)
- the fragments were separated electrophoretically, isolated, precipitated for concentration with ethanol and taken up again in Tris-HCl buffer, 10 mM, pH 7.4.
- the numbering refers to the 1st (5 ') nucleotide of the PDC sequence
- the mutated bases are underlined.
- this primer is complementary to the vector sequence at the 3 'end following the PDC sequence
- PDC-W392A An enzyme according to the invention (PDC-W392A) was obtained by expression of the modified DNA in E. coli cells.
- the mutated enzyme (mutant) PDC-W392A was expressed according to the following procedure and purified from the cell extract:
- the E. coli cells carrying the expression plasmid for the mutant PDC-W392A were fermented for selection in LB medium including 100 ⁇ g / ml ampicillin.
- the medium was inoculated with pre-cultures in the stationary growth phase in a ratio of 1:50 and at 37 ° C and
- the expression was carried out as described above in an 8 liter fermenter. A pH value of 7.0 and an air flow of 10 l / h were set. The stirring speed was 200 rpm. To avoid excess
- Foaming was added to polypropylene glycol as needed.
- the cells were harvested after 3 hours of expression by chilled continuous centrifugation.
- the digestion was carried out by grinding with glass beads.
- the digestion was carried out in Eppendorf vessels in a Retsch mill or ice-cooled in the Disintegrator S (maximum volume 80 ml). The grinding took place over 10 minutes with maximum performance.
- the suspension was centrifuged, the glass beads washed with buffer and the combined centrifugates filtered (1 ⁇ m).
- the PDC mutants were purified by column chromatography as follows: 1. Anion exchange chromatography
- the crude extract (approx. 110 ml, approx. 1.0-1.5 g protein) was applied to a Q-Sepharose Fast Flow (Pharmacia)
- the combined fractions were adjusted to an ammonium sulfate content of 50% saturation by adding a volume of saturated ammonium sulfate solution.
- the hydrophobic interaction chromatography was carried out on Butyl Sepharose (Pharmacia) (column 5 * 8 cm) at a flow rate of 2 ml / min.
- the material was equilibrated before loading with 40% ammonium sulfate in 50mM Mes / KOH, 2mM MgCl 2 , 0.1mM ThDP.
- the enzyme eluted in the same buffer with a falling ammonium sulfate gradient (40-0%) at 24%.
- the target fractions were again identified using an activity test and pooled (approx. 160 ml).
- the determination of the enzymatic activity was carried out in the coupled enzymatic test, the NADH oxidation being monitored photometrically by the auxiliary enzyme alcohol dehydrogenase from yeast (EC 1.1.1.1).
- the reaction mixture contained 16.9 mM pyruvate, 0.18 mM NADH and 10 U ADH in 50 mM Mes / KOH, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP.
- One enzyme unit PDC (1 U) corresponds to the amount of enzyme that catalyzes the conversion of 1 ⁇ mol substrate in one minute at 30 ° C.
- the enzyme activity is calculated according to:
- Chiral acyloins can be obtained starting from an ⁇ -ketocarboxylic acid or an aldehyde as substrate and a further aldehyde as cosubstrate by means of PDC or PDC mutants.
- PAC synthesis starting from pyruvate and benzaldehyde The synthesis mixture contained 40 mM pyruvate, 70 mM benzaldehyde and 10 U / ml PDC-W392A in Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP. The reaction was carried out for one hour at 37 ° C and the resulting PAC (6.2 mM) was detected by HPLC.
- PAC synthesis approach contained 40 mM acetaldehyde instead of pyruvate. Otherwise the procedure was as described above. After one hour, 3.7 mM PAC had developed.
- the enzymatic conversion was carried out according to FIG. 3.
- the use of alcohol dehydrogenase (ADH) from yeast (EC 1.1.1.1) enables the continuous removal of acetaldehyde and the inactivation of the PDC-W392A which is caused thereby.
- the formate dehydrogenase (FDH) from Candida boidinii (EC 1.2.1.2) is used to regenerate NADH.
- the enzymatic PAC synthesis was carried out in 20 ml of Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP.
- reaction products were separated using preparative reversed-phase HPLC.
- Elution was carried out under isocratic conditions with acetic acid / acetonitrile 0.5% / 12.5% (v / v) at a flow rate of 1.5 ml / min. Under these conditions, the elution times were: PAC, 4.77 min and 2-hydroxypropiophenone, 5.41 min.
- the enantiomer as R - (-) - PAC was assigned using polarimetry using a standard from PAC production (Knoll AG).
- the enantiomer ratio of PAC was determined by chiral gas chromatography to be >> 98%.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a process for obtaining a pyruvate decarboxylase by isolation from a producer organism. The pyruvate decarboxylase is capable of forming (R)-(-)-phenylacetylcarbinole (I) in » 95 % enantiomer unit with a product ratio of (I) to 2-hydroxypropiophenone of » 95 %. In addition, the pyruvate decarboxylase has a specific activity with regard to phenylacetylcarbinole formation of > 1 U/mg. It is the aim of the invention to obtain a pyruvate decarboxylase with improved synthesis capacity concerning the formation of (R)-(-)-phenylacetylcarbinole. The process of the invention developed for this purpose is characterized in that use is made of a producing organism with a gene coding for pyruvate decarboxylase from Zymomonas mobilis, in the DNA sequence of which the tryptophane radical coding codon TGG is replaced at position 1174-1176 by a codon which codes for an amino acid radical with a reduced volume ratio.
Description
B e s c h r e i b u n g Description
Verfahren zur Gewinnung von Acyloinen, dafür geeignete Pyruvat-decarboxylase sowie deren Herstellung und DNA- Sequenz des für diese kodierenden PDC-Gens Process for the production of acyloins, pyruvate decarboxylase suitable therefor as well as their production and DNA sequence of the PDC gene coding for them
Die Erfindung bezieht sich auf ein Verfahren zur Gewinnung von Acyloinen durch enzymatische Umwandlung von α- Ketocarbonsäuren und/oder Aldehyden in Gegenwart von Pyruvat-decarboxylase (PDC) und sie umfaßt eine dafür geeignete PDC sowie deren Herstellung und das für diese kodierende Gen. The invention relates to a process for the production of acyloin by enzymatic conversion of α-ketocarboxylic acids and / or aldehydes in the presence of pyruvate decarboxylase (PDC) and it includes a PDC suitable therefor and its production and the gene coding therefor.
Acyloine bzw. α-Hydroxyketone sind Verbindungen mit einem optisch aktiven C-Atom, die in der Synthese von komplexeren Verbindungen eine erhebliche Rolle spielen, wie insbesondere das (R) - (-) -Phenylacetylcarbinol Acyloins or α-hydroxyketones are compounds with an optically active carbon atom that play a significant role in the synthesis of more complex compounds, such as, in particular, the (R) - (-) -phenylacetylcarbinol
(PAC), das für die Produktion von Ephedrin wirtschaftlich von großem Interessse ist. Hier interessiert das R-Enantiomere, das durch fermentative Umwandlung von Pyruvat in Gegenwart von Benzaldehyd mittels Saccharomyces cerevisiae gebildet wird (DE-PS 548 459 von 1932). (PAC), which is of great economic interest for the production of ephedrine. Here, the R enantiomer is of interest, which is formed by fermentative conversion of pyruvate in the presence of benzaldehyde by means of Saccharomyces cerevisiae (DE-PS 548 459 from 1932).
Bei dieser Synthese von PAC mittels Hefezellen werden auf Grund der Mehrzahl von in der Hefe vorhandenen En
zymen zahlreiche Nebenprodukte gebildet, und das Zellwachstum wird durch die Anwesenheit von Benzaldehyd inhibiert. In this synthesis of PAC by means of yeast cells, due to the majority of the enes present in the yeast Numerous by-products are formed and the cell growth is inhibited by the presence of benzaldehyde.
Auch die aus der Hefe isolierte Pyruvat-decarboxylase (PDC) führt bei dieser Umsetzung zu erheblichen Anteilen des zu PAC isomeren 2-Hydroxypropiophenons. The pyruvate decarboxylase (PDC) isolated from the yeast also leads to considerable proportions of the 2-hydroxypropiophenone isomeric to PAC in this reaction.
Die thiamindiphosphat- und Mg2+-abhängige PDC (E.C. The thiamine diphosphate and Mg 2+ dependent PDC (EC
4.1.1.1) ist weit verbreitet und wird in vielen Pflanzen, Hefen und Pilzen und in einigen Bakterien gefunden. Sie katalysiert die nicht-oxidative Decarboxylierung von Pyruvat zu Acetaldehyd und als Nebenreaktion erfolgt eine Acyloinkondensation unter Bildung von α- Hydroxyketonen, wie aus Fig. 1 ersichtlich ist. 4.1.1.1) is widespread and is found in many plants, yeasts and fungi and in some bacteria. It catalyzes the non-oxidative decarboxylation of pyruvate to acetaldehyde and, as a side reaction, an acyloin condensation takes place with the formation of α-hydroxyketones, as can be seen from FIG. 1.
Eine solche enzymatische Umsetzung erfolgt auch ausgehend von einem Aldehyd an Stelle von α-Ketocarbonsäuren, und an der Kondensationsreaktion kann auch der durch die Decarbooxylierung gebildete Aldehyd als „Cosubstrat" unter Bildung von Homoacyloinen Such an enzymatic conversion also takes place starting from an aldehyde instead of α-ketocarboxylic acids, and the aldehyde formed by the decarbooxylation can also act as a "cosubstrate" in the condensation reaction with the formation of homoacyloins
R-CHOH-CO-R' mit R = R' teilnehmen. Participate R-CHOH-CO-R 'with R = R'.
Isoliert wurde auch bereits die PDC aus Zymomonas mobilis. Ein Vergleich einer aus Hefe isolierten PDC mitThe PDC from Zymomonas mobilis has also been isolated. A comparison of a PDC isolated from yeast with
PDC aus Zymomonas mobilis bzgl. der Bildung von PAC unter vergleichbaren Bedingungen zeigte jedoch eine deut
lieh geringere Synthesekapazität der PDC aus Zymomonas mobilis (S. Bringer-Meyer u. H. Sahm, Biocatalysis 1 (1988) S. 321-331). However, PDC from Zymomonas mobilis with regard to the formation of PAC under comparable conditions showed a clear lent the synthetic capacity of the PDC from Zymomonas mobilis (S. Bringer-Meyer and H. Sahm, Biocatalysis 1 (1988) pp. 321-331).
Es wurde nun überraschend festgellt, daß durch gezielte gentechnologische Abwandlung des PDC-Gens von Z. mobilis eine PDC mit verbesserter Synthesekapazität bzgl. der Bildung von PAC erhalten werden kann, die sich zudem durch eine hohe Selektivität zur Bildung von PAC im Vergleich zu 2-Hydroxypropiophenon auszeichnet. It has now surprisingly been found that through targeted genetic engineering modification of the Z. mobilis PDC gene, a PDC with improved synthetic capacity with regard to the formation of PAC can be obtained, which is also distinguished by a high selectivity for the formation of PAC compared to 2- Hydroxypropiophenone distinguished.
Das erfindungsgemäße Verfahren der eingangs genannten Art ist im wesentlichen dadurch gekennzeichnet, daß man als PDC ein Enzym verwendet, bei dem der Tryptophanrest im zum aktiven Zentrum hinführenden Substratkanal durch einen sterisch kleineren Aminosäurerest ersetzt ist. The process of the type mentioned at the outset is essentially characterized in that an enzyme is used as the PDC in which the tryptophan residue in the substrate channel leading to the active center is replaced by a sterically smaller amino acid residue.
Bei einem sterisch kleineren Aminosäurerest handelt es sich insbesondere um eine einfache, insbesondere aliphatische Aminosäure, wie speziell Alanin, Glycin,A sterically smaller amino acid residue is in particular a simple, in particular aliphatic, amino acid, such as specifically alanine, glycine,
Phenylalanin, Leucin, Isoleucin, Arginin oder Histidin oder auch Serin und Threonin. Phenylalanine, leucine, isoleucine, arginine or histidine or also serine and threonine.
Man erhält die gentechnologisch abgewandelte neue PDC durch Austausch des für Tryptophan an der Stelle 392 kodierenden Kodons TGG in der Position 1174-1176 der DNA-Sequenz des PDC-Gens aus Z. mobilis in an sich be
kannter Weise und Expression der PDC in einem Produzenten-Organismus, wie insbesondere E. coli, aus dem die PDC isoliert wird. Die gezielte Mutation erfolgt z. B. mit Hilfe der Polymerase-Kettenreaktion unter Verwendüng der auf Seite 9 angegebenen Primer. Die Konstruktion des Expressionsvektors pBTac2 für die mutierte PDC wurde ausgehend vom E. coli-Expressionsvektor pPDC des Wildtypenzyms durchgeführt. The genetically modified new PDC is obtained by replacing the codon TGG coding for tryptophan at position 392 in position 1174-1176 of the DNA sequence of the PDC gene from Z. mobilis in itself known manner and expression of the PDC in a producer organism, such as in particular E. coli, from which the PDC is isolated. The targeted mutation occurs e.g. B. using the polymerase chain reaction using the primers specified on page 9. The construction of the expression vector pBTac2 for the mutated PDC was carried out starting from the E. coli expression vector pPDC of the wild-type enzyme.
Die Gewinnung der mutierten PDC erfolgt nach Ernte und Aufschluß der Zellen aus dem Rohextrakt in an sich bekannter Weise durch chromatographische Methoden. The mutated PDC are obtained after harvesting and disruption of the cells from the crude extract in a manner known per se by chromatographic methods.
Durch die erfindungsgemäße Abwandlung der PDC wird ihre PAC-Synthesekapazität um den Faktor 4 verbessert. Diese Verbesserung resultiert aus der gezielten Abschwächung bzw. Beseitigung der Zugangslimitierung im zum aktiven Zentrum des Enzyms hinführenden Substratkanal, wodurch der Zugang voluminöser Sustratmoleküle zum aktiven Zentrum und der Abgang des gebildeten Produkts erleichtert wird. Due to the modification of the PDC according to the invention, its PAC synthesis capacity is improved by a factor of 4. This improvement results from the targeted weakening or elimination of the access limitation in the substrate channel leading to the active center of the enzyme, as a result of which the access of voluminous substrate molecules to the active center and the exit of the product formed are facilitated.
Eine analoge Optimierung ist generell bei thiamin- diphosphat-abhängigen Enzymen zu erreichen, die eine Zugangslimitierung - sei es sterischer oder durch Ladungseinflüsse bedingter Art - im zum aktiven Zentrum führenden Substratkanal aufweisen: Durch analoge Abwandlung der DNA-Sequenz des für das Enzym kodierenden
Gens, und zwar durch Austausch des für die Zugangslimitierung kodierenden Kodons durch ein Kodon, das für einen die Zugangslimitierung beseitigenden Aminosäurerest kodiert, erreicht man eine deutliche Steigerung der Synthesekapazität des Enzyms. An analogous optimization can generally be achieved with thiamine-diphosphate-dependent enzymes, which have an access limitation - be it steric or due to charge influences - in the substrate channel leading to the active center: By analogous modification of the DNA sequence of the coding for the enzyme Gene, by replacing the codon coding for the access limitation with a codon coding for an amino acid residue which removes the access limitation, a significant increase in the synthesis capacity of the enzyme is achieved.
Die gemäß der den Ausgangspunkt der Erfindung bildenden Zielsetzung so erhaltene PDC ist für die PAC-Synthese von erheblichem Interesse, da mit ihr eine hohe optisehe Reinheit des R-(-)-Isomeren (»98%) und ein PAC erhalten werden kann, das nur zu wenigen ProzentenThe PDC thus obtained in accordance with the objective forming the starting point of the invention is of considerable interest for the PAC synthesis, since it can be used to obtain a high optical purity of the R - (-) isomer (»98%) and a PAC which only a few percent
(2-3%) von 2-Hydroxy-propiophenon begleitet wird. Die Gewinnung und Isolierung des Enzyms aus dem geernteten Mikroorganismus ist auf relativ einfache Weise (im Vergleich zur Hefe) möglich. (2-3%) is accompanied by 2-hydroxy-propiophenone. The extraction and isolation of the enzyme from the harvested microorganism is possible in a relatively simple manner (compared to yeast).
Bei der enzymatischen Acyloinkondensation mittels PDC können als Substrat lineare und/oder verzweigte α- Ketocarbonsäuren und als Substrat und/oder Cosubstrat aromatische, cyclische, längerkettige und/oder verzweigte Aldehyde eingesetzt werden. Als Beispiel können hier Benzaldehyd, Cyclohexanaldehyd, Furfurol, Zimtaldehyd, Krotonaldehyd, Pyruvat, 2-Ketobuttersäure, 2-Ketopentansäure, 2-Keto-4-methyllhexansäure, In the case of enzymatic acyloin condensation by means of PDC, linear and / or branched α-ketocarboxylic acids can be used as the substrate and aromatic, cyclic, longer-chain and / or branched aldehydes can be used as the substrate and / or cosubstrate. Examples include benzaldehyde, cyclohexanaldehyde, furfural, cinnamaldehyde, crotonaldehyde, pyruvate, 2-ketobutyric acid, 2-ketopentanoic acid, 2-keto-4-methyllhexanoic acid,
2-Keto-4-methylpentansäure, 2 Keto-4,4-dimethylhexansäure, 3-Phenyl-2-keto-propansäure genannt werden.
Weitere Besonderheiten der Erfindung ergeben sich aus den Patentansprüchen und der nachfolgenden Beschreibung von Ausführungsdetails. Dabei wird Bezug genommen auf die angefügten Zeichnungen; es sind im einzelnen: 2-keto-4-methylpentanoic acid, 2 keto-4,4-dimethylhexanoic acid, 3-phenyl-2-keto-propanoic acid can be mentioned. Further special features of the invention result from the patent claims and the following description of implementation details. Reference is made to the attached drawings; they are:
Fig. 1: Das Reaktionsschema der PDC für das Beispiel Fig. 1: The reaction scheme of the PDC for the example
Pyruvat und Benzaldehyd als Substrat und Cosubstrat mit dem Hauptweg der Decarboxylierung und der Carboligase-Nebenreaktion mit der Bildung von PAC; Pyruvate and benzaldehyde as substrate and cosubstrate with the main route of decarboxylation and the carboligase side reaction with the formation of PAC;
Fig 2: Ein Konstruktionsschema für die Bildung des die PDC aus Z. mobilis enthaltenden Expressionsvektors pPDC und Fig. 2: A construction scheme for the formation of the expression vector containing the PDC from Z. mobilis pPDC and
Fig. 3: Ein Schema für eine durch Abfangen von Acetaldehyd mittels Alkoholdehydrogenase optimierte Produktion von PAC gemäß Fig. 1. 3: A diagram for a production of PAC according to FIG. 1, which is optimized by trapping acetaldehyde by means of alcohol dehydrogenase.
Beispiel example
1. Herstellung des PDC-Mutante PDC-W392A 1. Preparation of the PDC mutant PDC-W392A
1.1 Konstruktion des Expressionsvektors pPDC 1.1 Construction of the expression vector pPDC
Für die Expression der PDC aus Zymomonas mobilis wurde der Vektor pBTac2 (Boehringer, Mannheim) gewählt. Die Transkription des Fremdgens steht unter der Kontrolle des starken tac-Promotors, einem Hybrid aus trp- und lacUV-Promotor mit der 11-fachen bzw. 3-fachen Effizi
enz der parentalen Promotoren. Die Operatorsequenz und Ribosomenbindungsregion entstammen dem lacZ-Gen. Die Regulation der Transkription erfolgt somit durch den lac-Repressor eines überexpremierenden (laciQ) Bakteerienstammes und ist durch Isopropyl-β-D-thiogalactosid (IPTG) induzierbar. Der Vektor enthält eine einzelne Erkennungssequenz der Restriktionssendonuklease EcoRl, gefolgt von dem Initiationskodon ATG und anschließend weiteren Restriktionserkennungssequenzen (sites), so daß dieser Vektor universell zur Expression sowohl für Gensequenzen mit als auch ohne eigenem The vector pBTac2 (Boehringer, Mannheim) was chosen for the expression of the PDC from Zymomonas mobilis. The transcription of the foreign gene is under the control of the strong tac promoter, a hybrid of trp and lacUV promoters with 11-fold and 3-fold efficiency parent promoters. The operator sequence and ribosome binding region come from the lacZ gene. The transcription is thus regulated by the lac repressor of an overexpressing (laciQ) bacterial strain and can be induced by isopropyl-β-D-thiogalactoside (IPTG). The vector contains a single recognition sequence of the restriction endonuclease EcoRI, followed by the initiation codon ATG and then further restriction recognition sequences (sites), so that this vector is universal for expression both for gene sequences with and without its own
Initiationskodon eingesetzt werden kann. Initiation codon can be used.
Der multiplen Klonierungsstelle folgen die starken ribosomalen RNA Transkriptionsterminatoren rrnB, um den kontrollierten Abbruch der Transkription zu gewährleisten. Als Ausgangsmaterial zur Klonierung des PDC-Gens aus Zymomonas mobilis (ATCC 29191) stand der Vektor pZY134B (G. Sprenger, Inst f. Biotechnologie 2, KFA- Jülich) zur Verfügung. Dieses Plasmid beinhaltet ein 3.2 kb großes DNA-Fragment aus Zymomonas mobilis mit dem vollständigen PDC-Gen inklusive nichtkodierender Regionen (Fig. 2). Um eine Ligation der kodierenden Sequenz in den Expressionsvektor zu ermöglichen, war es erforderlich, in 5'-Richtung des Initiationskodons eine neue Restriktionserkennungssequenz einzuführen. Den optimalen Abstand des Initiationskodons von der Shine- Dalgarno-Sequenz des Vektors gewährleistet die Ligation des Gens in die EcoRI-site des pBTac2-Vektors. Eine
elegante und einfache Methode, eine DNA-Sequenz zu modifizieren, bietet die Polymerase, Kettenrektion (PCR). Wiederholte Zyklen von Hitzedenaturierung des DNA- Doppelstrangs und enzymatische Synthese durch eine thermostabile DNA-Polymerase ermöglichen die exponentieile Amplifizierung definierter DNA-Fragmente. Die Größe und Identität der Produkte wird durch die Startpunkte (Primer) der Synthese bedingt. Enthalten die Primer eine Modifikation der ursprünglichen Sequenz, etwa Mutationen, Deletionen oder auch zusätzliche Basen The multiple cloning site is followed by the strong ribosomal RNA transcription terminators rrnB to ensure controlled termination of the transcription. The vector pZY134B (G. Sprenger, Inst. Biotechnologie 2, KFA-Jülich) was available as the starting material for cloning the PDC gene from Zymomonas mobilis (ATCC 29191). This plasmid contains a 3.2 kb DNA fragment from Zymomonas mobilis with the complete PDC gene including non-coding regions (FIG. 2). In order to enable the coding sequence to be ligated into the expression vector, it was necessary to introduce a new restriction recognition sequence in the 5 'direction of the initiation codon. The optimal distance between the initiation codon and the Shine-Dalgarno sequence of the vector is ensured by the ligation of the gene into the EcoRI site of the pBTac2 vector. A polymerase, chain reaction (PCR) offers an elegant and simple method of modifying a DNA sequence. Repeated cycles of heat denaturation of the DNA double strand and enzymatic synthesis by a thermostable DNA polymerase enable the exponential amplification of defined DNA fragments. The size and identity of the products is determined by the starting points (primers) of the synthesis. If the primers contain a modification of the original sequence, such as mutations, deletions or additional bases
(Insertionen), werden diese folglich auch im synthetischen Fragment vorhanden sein. (Insertions), these will consequently also be present in the synthetic fragment.
Mit dieser Methode wurde die benötigte EcoRI-Restriktionssite in 5'-Richtung des Initiationskodons des PDC- Gens eingeführt, indem während der Oligonukleotidsynthese am 5'-Endn des zum Gen komplementären Primers die Erkennungssequenz des Enzyms angeschlossen wurde. Da einige Endonukleasen eine stark verminderte Aktivität für die Restriktion endständiger Sequenzen zeigen, wurden vier weitere Basen stromaufwärts an die ECoRI-site angefügt. With this method, the required EcoRI restriction site was introduced in the 5 'direction of the initiation codon of the PDC gene by connecting the recognition sequence of the enzyme to the 5' end of the primer complementary to the gene during oligonucleotide synthesis. Since some endonucleases show a strongly reduced activity for the restriction of terminal sequences, four further bases were added upstream to the ECoRI site.
Die zur PCR meist verwendete Taq-Polymerase besitzt keine 3'-5'-Exonukleaseaktivität (proof-reading). Die von ihr synthetisierte Sequenz ist folglich mit einer statistischen Fehlerrate behaftet. Auch wenn diese durch die Wahl geeigneter Reaktionsbedingungen mit
1/100.000 sehr gering gehalten werden kann, bedingt dies die Notwendigkeit der Sequenzierung eines jeden Fragments, um die Integrität der Synthese sicherzustellen. Daher wurde nicht die gesamte kodierende Region des PDC-Gens (1712 bp), sondern ein kleineres Fragment (890 bp) vom 5'-Terminus bis zu einer einzelnen Restriktionssite (EcoRV) zur Amplifikation gewählt (Fig. 2). The Taq polymerase most commonly used for PCR has no 3'-5 'exonuclease activity (proof-reading). The sequence it synthesizes is therefore subject to a statistical error rate. Even if this with the choice of suitable reaction conditions 1 / 100,000 can be kept very low, this necessitates the sequencing of each fragment to ensure the integrity of the synthesis. Therefore, not the entire coding region of the PDC gene (1712 bp), but a smaller fragment (890 bp) from the 5'-terminus to a single restriction site (EcoRV) was chosen for the amplification (FIG. 2).
Das PCR-Produkt wurde mit den entsprechenden Restrikti- onsendonukleasen EcoRI und EcoRV verdaut. The PCR product was digested with the corresponding restriction endonucleases EcoRI and EcoRV.
Der fehlende zweite Teil des PDC-Gens wurde durch Restriktion mit ECoRV und BamHI aus dem Plasmid pZY134B gewonnen, wobei das so entstehende Fragment (1.2 kb) am 3'-Ende noch ca 350 bp nicht-translatierte Sequenz des PDC-Gens enthält. Beide Fragmente wurden durch präparative Agarosegelektrophorese separiert, isoliert und in den EcoRI und BamHI linearisierten, isolierten pBTac2 (4.6kb) ligiert. Die Klonierung erfolgte in E. coli JM 109, einem den lac-Repressor überexpremierenden Stamm. The missing second part of the PDC gene was obtained from the plasmid pZY134B by restriction with ECoRV and BamHI, the resulting fragment (1.2 kb) at the 3 'end still containing about 350 bp untranslated sequence of the PDC gene. Both fragments were separated by preparative agarose gel electrophoresis, isolated and ligated in the EcoRI and BamHI linearized, isolated pBTac2 (4.6 kb). The cloning was carried out in E. coli JM 109, a strain overexpressing the lac repressor.
1.2 Molekularbiologische Arbeiten 1.2 Molecular biological work
Für die Gewinnung einer durch Tryptophan/Alanin-For the production of a by tryptophan / alanine
Austausch mutierten PDC an der Position 392 wurde zunächst das beim Wildtyp-Enzym vorhandene Kodon TGG
(Tryptophan) gegen GCG (Alanin) ausgetauscht (Austausch der Position 1174-1176 des Gens der Pyruvatdecarboxylase aus Zymomonas mobilis). Die Einführung der gezielten Mutation erfolgte mit Hilfe der von Ho et al. beschriebenen Polymerasekettenrektion gestützten Methode (S. N. Ho, H.D. Hunt, R.M. Horton, J.K. Pullen, L.R. Pease, Gene 77 (1989) S. 51). Exchange of mutated PDC at position 392 was initially the codon TGG present in the wild-type enzyme (Tryptophan) exchanged for GCG (alanine) (exchange of position 1174-1176 of the gene of pyruvate decarboxylase from Zymomonas mobilis). The targeted mutation was introduced with the help of the Ho et al. described polymerase chain reaction supported method (SN Ho, HD Hunt, RM Horton, JK Pullen, LR Pease, Gene 77 (1989) p. 51).
Als Ausgangspunkt stand das PDC-Gen aus Z. mobilis im E. coli-Expressionsvektor pPDC zur Verfügung (s. Fig. 2). Die DNA-Isolierung erfolgte nach Standardmethoden ( J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press) Als Templat zur Synthese der beiden überlappenden Einzelfragmente diente das Plasmid pPDC. Die Primer The PDC gene from Z. mobilis in the E. coli expression vector pPDC was available as a starting point (see FIG. 2). DNA isolation was carried out according to standard methods (J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press). The plasmid pPDC served as a template for the synthesis of the two overlapping individual fragments. The primer
(Primerseguenzen gemäß Anhang) wurden mit einer Konzentration von 0.2-0.4 nM eingesetzt. Die Reaktion wurde mit Taq-Polymerase (Biomasters, Köln) im von Hersteller angegebenen Reaktionspuffer, zuzüglich 1.5 mM MgCl2 und je 0.2 mM der Nukleotide im „Robo-Cycler" (Stratgene) mit folgendem Temperaturprogramm durchgeführt: 2.5 Minuten 94°C zur Denaturierung, anschließend 30 Zyklen mit einer 1.5-minütigen Denaturierung bei 94°C, 1.2 Minuten Annealing bei 48°C und 2 Minuten Extension bei 72°C, gefolgt von 10 Minuten bei 72°C zur Vervollständigung der Reaktion. Die Annealing-Temperatur variierte zwischen 48°C und 56ºC, je nach theoetischem Schmelz
punkt der verwendeten Primer. Der Schmelzpunkt der Oligonukleotide wurde anhand folgender Formel berechnet: (Primer sequences according to the appendix) were used with a concentration of 0.2-0.4 nM. The reaction was carried out with Taq polymerase (Biomasters, Cologne) in the reaction buffer specified by the manufacturer, plus 1.5 mM MgCl 2 and 0.2 mM each of the nucleotides in the "Robo-Cycler" (Stratgene) with the following temperature program: 2.5 minutes at 94 ° C. for denaturation followed by 30 cycles with a 1.5 minute denaturation at 94 ° C, 1.2 minutes annealing at 48 ° C and 2 minutes extension at 72 ° C, followed by 10 minutes at 72 ° C to complete the reaction 48 ° C and 56 ° C, depending on the theoretical melting point of the primers used. The melting point of the oligonucleotides was calculated using the following formula:
Tm = 2 * (A+T) + 3 * (C+G) Tm = 2 * (A + T) + 3 * (C + G)
Die Fragmente wurden elektrophoretisch separiert, isoliert, zur Konzentrierung mit Ethanol präzipitiert und in Tris-HCl-Puffer, 10 mM, pH 7.4, wieder aufgenommen. The fragments were separated electrophoretically, isolated, precipitated for concentration with ethanol and taken up again in Tris-HCl buffer, 10 mM, pH 7.4.
In der zweiten kombinierten PCR wurden je ca. 50-100 ng der überlappenden Fragmente als Template eingesetzt. Die weiteren Reaktionsbedingungen waren identisch zu ersten Reaktion. Die Wahl der Annealingtemperatur richtete sich nach der Schmelztemperatur der resultierenden Überlappungsregion der Fragmente. Die weiteren Manipulationen (Restriktion, Isolierung, Ligation) zum Ersatz der Wildtyp-DNA im Expressionsvektor pPDC durch die mutierten Fragmente erfolgten nach Standardmethoden In the second combined PCR, approximately 50-100 ng of the overlapping fragments were used as templates. The other reaction conditions were identical to the first reaction. The choice of annealing temperature was based on the melting temperature of the resulting overlap region of the fragments. The further manipulations (restriction, isolation, ligation) to replace the wild-type DNA in the expression vector pPDC by the mutated fragments were carried out using standard methods
(J. Sambrock, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Spring Harbor Laboratory Press).
(J. Sambrock, EF Fritsch, T. Maniatis, Molecular Cloning (1989) Spring Harbor Laboratory Press).
Sequenzen der verwendeten Primer Sequences of the primers used
Die Numerierung bezieht sich auf das 1. (5')-Nukleotid der PDC-Sequenz The numbering refers to the 1st (5 ') nucleotide of the PDC sequence
s=sense, as=anti-sense s = sense, as = anti-sense
Die mutierten Basen sind unterstrichen. The mutated bases are underlined.
Primer zur Synthese des 5'-Einzelfragmentes • PDC867S Primer for the synthesis of the 5 'single fragment • PDC867S
CTACTCCACCACTGGTTGGACG CTACTCCACCACTGGTTGGACG
• PDC1186as • PDC1186as
GAGGATTGAAGGAGAGTCACC Primer zur Synthese des 3'-Einzelfragmentes GAGGATTGAAGGAGAGTCACC Primer for the synthesis of the 3'-single fragment
• PDC1159s • PDC1159s
GAAACCGGTGACTCTGCGTTCAATGC GAAACCGGTGACTCTGCGTTCAATGC
• PBTAC453as • PBTAC453as
ATCTTCTCTCATCCGCCAAACA ATCTTCTCTCATCCGCCAAACA
(dieser Primer ist komplementär zur Vektorsequenz am 3'-Ende anschließend an die PDC-Sequenz) (this primer is complementary to the vector sequence at the 3 'end following the PDC sequence)
Primer zur Synthese des Fusionsfragmentes
• PDC867s Primer for the synthesis of the fusion fragment • PDC867s
CTACTCCACCACTGGTTGGAGG CTACTCCACCACTGGTTGGAGG
• PBTAC453as • PBTAC453as
ATCTTCTCTATCCGCCAAACA ATCTTCTCTATCCGCCAAACA
(dieser Primer ist komplementär zur Vektorsequenz am (This primer is complementary to the vector sequence on
3'-Ende anschließend an die PDC-Sequenz)
3 'end following the PDC sequence)
1.2 Expression und Reinigung 1.2 Expression and purification
Durch Expression der modifizierten DNA in E. coli- Zellen wurde ein erfindungsgemäßes Enzym (PDC-W392A) erhalten. Das mutierte Enzym (Mutante) PDC-W392A wurde gemäß folgender Prozedur exprimiert und aus dem Zellextrakt aufgereinigt: An enzyme according to the invention (PDC-W392A) was obtained by expression of the modified DNA in E. coli cells. The mutated enzyme (mutant) PDC-W392A was expressed according to the following procedure and purified from the cell extract:
Die das Expressionsplasmid für die Mutante PDC-W392A tragenden E.coli-Zellen wurden in LB-Medium inklusive 100 μg/ml Ampicillin zur Selektion fermentiert. Das Medium wurde mit Vorkulturen in der stationären Wachstumsphase im Verhältnis 1:50 angeimpft und bei 37°C undThe E. coli cells carrying the expression plasmid for the mutant PDC-W392A were fermented for selection in LB medium including 100 μg / ml ampicillin. The medium was inoculated with pre-cultures in the stationary growth phase in a ratio of 1:50 and at 37 ° C and
220 rpm inkubiert. Incubated 220 rpm.
Die Induktion der Expression erfolgte bei einer OD600 von 0.6 durch Zugabe von 1 mM IPTG. Die PDC-Mutante wurde unter diesen Bedingungen mit 20% des löslichen Proteins in E. coli überexpremiert. Expression was induced at an OD600 of 0.6 by adding 1 mM IPTG. The PDC mutant was overexpressed with 20% of the soluble protein in E. coli under these conditions.
Zur Produktion ausreichender Enzymmengen wurde die Expression wie oben beschrieben im 8-Liter-Fermenter durchgeführt. Es wurde ein ph-Wert von 7.0 sowie ein Luftstrom von 10 l/h eingestellt. Die Rührgeschwindigkeit betrug 200 rpm. Zur Vermeidung überschüssigerTo produce sufficient amounts of enzyme, the expression was carried out as described above in an 8 liter fermenter. A pH value of 7.0 and an air flow of 10 l / h were set. The stirring speed was 200 rpm. To avoid excess
Schaumbildung wurde nach Bedarf Polypropylenglycol zugesetzt. Die Zellen wurden nach 3-stündiger Expression durch gekühlte kontinuierliche Zentrifugation geerntet.
Der Aufschluß erfolgte durch Vermählen mit Glasperlen. Hierzu wurde eine 30%ige Zellsuspension in Mes/KOH- Puffer, 50 mM, pH 6.5, inklusive 5mM MgCl2 und 0,1 mM ThDP hergestellt und mit einem doppelten Volumen an Glasperlen (d = 0,3 mm) versetzt. Abhängig vom zu bearbeitenden Volumen wurde der Aufschluß in Eppendorfgefäßen in einer Retsch-Mühle oder eisgekühlt im Disintegrator S (Maximalvolumen 80 ml) durchgeführt. Die Vermahlung erfolgte über 10 Minuten mit maximaler Leistung. Die Suspension wurde zentrifugiert, die Glasperlen mit Puffer gewaschen und die vereinigten Zentrifugate filtriert (1μm). Die Aufreinigung der PDC-Mutanten erfolgte säulenchromatographisch wie folgt: 1. Anionenaustauschchromatographie Foaming was added to polypropylene glycol as needed. The cells were harvested after 3 hours of expression by chilled continuous centrifugation. The digestion was carried out by grinding with glass beads. For this purpose, a 30% cell suspension was prepared in Mes / KOH buffer, 50 mM, pH 6.5, including 5 mM MgCl 2 and 0.1 mM ThDP and mixed with a double volume of glass beads (d = 0.3 mm). Depending on the volume to be processed, the digestion was carried out in Eppendorf vessels in a Retsch mill or ice-cooled in the Disintegrator S (maximum volume 80 ml). The grinding took place over 10 minutes with maximum performance. The suspension was centrifuged, the glass beads washed with buffer and the combined centrifugates filtered (1 μm). The PDC mutants were purified by column chromatography as follows: 1. Anion exchange chromatography
Der Rohextrakt (ca. 110 ml, ca. 1.0-1.5 g Protein) wurde auf eine Q-Sepharose Fast Flow (Pharmacia) The crude extract (approx. 110 ml, approx. 1.0-1.5 g protein) was applied to a Q-Sepharose Fast Flow (Pharmacia)
(2.6 * 9.5 cm) mit einer Flußrate von 5 ml/min unter Verwendung einer FPLC-Anlage der Fa. Pharmacia. Das Enzym eluierte durch Anlegen eines linearen NaCl- Gradienten (von 0 - 200 mM) in 10 mM Mes/KOH, pH 6.5, 2 mM MgCl2, 0.1mM ThDP, bei 100 mM NaCl. Die das Zielprotein enthaltenden Fraktionen wurden durch Aktivitätstest (s. unten) identifiziert.
2. Hydrophobe Interaktionschromatographie (HIC) (2.6 * 9.5 cm) with a flow rate of 5 ml / min using an FPLC system from Pharmacia. The enzyme eluted by applying a linear NaCl gradient (from 0 to 200 mM) in 10 mM Mes / KOH, pH 6.5, 2 mM MgCl 2, 0.1mM ThDP, at 100 mM NaCl. The fractions containing the target protein were identified by activity test (see below). 2. Hydrophobic Interaction Chromatography (HIC)
Die vereinigten Fraktionen wurden auf einen Ammoniumsulfatgehalt von 50%-Sättigung durch Zugabe eines Volums gesättigter Ammoniumsulfatlösung eingestellt. Die hydrophobe Interaktionschromatographie wurde an Buthylsepharose (Pharmacia) (Säule 5 * 8 cm) mit einer Flußrate von 2 ml/ min durchgeführt. Das Material wurde vor dem Beladen mit 40% Ammoniumsulfat in 50 mM Mes/KOH, 2 mM MgCl2, 0,1 mM ThDP äqulibriert. Das Enzym eluierte im selben buffer mit einem fallenden Ammoniumsulfatgradienten (40-0%) bei 24%. Die Zielfraktionen wurden wiederum mittels Aktivitätstest identifiziert und vereinigt (ca. 160 ml). The combined fractions were adjusted to an ammonium sulfate content of 50% saturation by adding a volume of saturated ammonium sulfate solution. The hydrophobic interaction chromatography was carried out on Butyl Sepharose (Pharmacia) (column 5 * 8 cm) at a flow rate of 2 ml / min. The material was equilibrated before loading with 40% ammonium sulfate in 50mM Mes / KOH, 2mM MgCl 2 , 0.1mM ThDP. The enzyme eluted in the same buffer with a falling ammonium sulfate gradient (40-0%) at 24%. The target fractions were again identified using an activity test and pooled (approx. 160 ml).
3. Entsalzung über Sephadex G25 und Umpuffern auf 50 mM Mes/KOH, 2 mM MgCl2, 0.1 mM ThDP. Die Flußrate betrug 20 ml/min. Anschließend wurde lyophilisiert. 3. Desalination over Sephadex G25 and rebuffering to 50 mM Mes / KOH, 2 mM MgCl 2 , 0.1 mM ThDP. The flow rate was 20 ml / min. It was then lyophilized.
1.3 Aktivitätstest (Decarboxylierungsreaktion) 1.3 Activity test (decarboxylation reaction)
Die Bestimmung der enzymatischen Aktivität wurde im gekoppelten enzymatischen Test durchgeführt, wobei photometrisch die NADH-Oxidation durch das Hilfsenzym Alkohol-dehydrogenase aus Hefe (E.C. 1.1.1.1) verfolgt wird. Der Reaktionsansatz enthielt 16.9 mM Pyruvat, 0.18 mM NADH und 10 U ADH in 50 mM Mes/KOH, pH 6.5, 20 mM MgSO4, 1.5 mM ThDP. Eine Enzymeinheit PDC (1 U)
entspricht der Enzymmenge, die die Umsetzung von 1μmol Substrat in einer Minute bei 30°C katalysiert. Die Enzymaktivität berechnet sich nach: The determination of the enzymatic activity was carried out in the coupled enzymatic test, the NADH oxidation being monitored photometrically by the auxiliary enzyme alcohol dehydrogenase from yeast (EC 1.1.1.1). The reaction mixture contained 16.9 mM pyruvate, 0.18 mM NADH and 10 U ADH in 50 mM Mes / KOH, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP. One enzyme unit PDC (1 U) corresponds to the amount of enzyme that catalyzes the conversion of 1 μmol substrate in one minute at 30 ° C. The enzyme activity is calculated according to:
ε (NADH) = 6.3 1 * mMol-1 * cm-1 ε (NADH) = 6.3 1 * mmol -1 * cm -1
V = Gesamtvolumen V = total volume
v = Probenvolumen v = sample volume
d = Schichtdicke der Küvette (1 cm) d = layer thickness of the cuvette (1 cm)
ΔE/min = Extinktionsabnähme pro Minute ΔE / min = decrease in absorbance per minute
f = Verdünnungsfaktor der Probe f = dilution factor of the sample
2. Einsatz von PDC-W392 A zur PAC-Synthese 2. Use of PDC-W392 A for PAC synthesis
Die Gewinnung chiraler Acyloine kann ausgehend von einer α-Ketocarbonsäure bzw. einem Aldehyd als Substrat und einem weiteren Aldehyd als Cosubstrat mittels PDC oder PDC-Mutanten erfolgen. Chiral acyloins can be obtained starting from an α-ketocarboxylic acid or an aldehyde as substrate and a further aldehyde as cosubstrate by means of PDC or PDC mutants.
Beispielhaft seien die folgenden Anwendungen genannt: The following applications are mentioned as examples:
PAC-Synthese ausgehend von Pyruvat und Benzaldehyd Der Syntheseansatz enthielt 40 mM Pyruvat, 70 mM Benzaldehyd und 10 U/ml PDC-W392A in Mes/KOH-Puffer, 50 mM, pH 6.5, 20 mM MgSO4, 1.5 mM ThDP.Die Reaktion
wurde eine Stunde bei 37°C durchgeführt und das entstandene PAC (6.2 mM) mittels HPLC detektiert. PAC synthesis starting from pyruvate and benzaldehyde The synthesis mixture contained 40 mM pyruvate, 70 mM benzaldehyde and 10 U / ml PDC-W392A in Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP. The reaction was carried out for one hour at 37 ° C and the resulting PAC (6.2 mM) was detected by HPLC.
PAC-Synthese ausgehend von Acetaldehyd und Benzaldehyd PAC synthesis based on acetaldehyde and benzaldehyde
PAC-Syntheseansatz enthielt anstelle von Pyruvat 40 mM Acetaldehyd. Ansonsten wurde wie oben beschrieben verfahren. Nach einer Stunde waren 3.7 mM PAC entstanden. PAC synthesis approach contained 40 mM acetaldehyde instead of pyruvate. Otherwise the procedure was as described above. After one hour, 3.7 mM PAC had developed.
PAC-Synthese mit PDC-W392A im gekoppelten 3-Enzymsystem PAC synthesis with PDC-W392A in the coupled 3-enzyme system
Die enzymatische Umsetzung erfolgte gemäß Fig. 3. Der Einsatz der Alkohol-dehydrogenase (ADH) aus Hefe (E.C. 1.1.1.1) ermöglicht die kontinuierliche Entfernung von Acetaldehyd und die dadurch bedingte Inaktivierung der PDC-W392A. Die Formiatdehydrogenase (FDH) aus Candida boidinii (E.C. 1.2.1.2) dient zur Regeneration von NADH. Die enzymatische PAC-Synthese wurde in 20 ml Mes/KOH-Puffer, 50 mM, PH 6.5, 20 mM MgSO4, 1.5 mM ThDP, durchgeführt. The enzymatic conversion was carried out according to FIG. 3. The use of alcohol dehydrogenase (ADH) from yeast (EC 1.1.1.1) enables the continuous removal of acetaldehyde and the inactivation of the PDC-W392A which is caused thereby. The formate dehydrogenase (FDH) from Candida boidinii (EC 1.2.1.2) is used to regenerate NADH. The enzymatic PAC synthesis was carried out in 20 ml of Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP.
Der Anssatz enthielt: The approach included:
1.3 U/ml PDC-W392A, 2 U/ml ADH, 2.5 U/ml FDH. Die anfängliche Pyruvalkonzentration betrug 70 mM. Ferner enthielt der Ansatz 2 mM NADH und 200 mM Formiat. Nach 120 min wurden erneut 0.7 ml einer 2.1 M Pyruvatlösung und 0,125 ml einer 8 M Natriumformiatlösung zugegeben.
Die durch die enzymatische Umsetzung resultierende pH- Erhöhung wurde mit Ameisensäure gegentitriert. Nach 7 Stunden waren 6.8 mM PAC entstanden. 1.3 U / ml PDC-W392A, 2 U / ml ADH, 2.5 U / ml FDH. The initial pyruval concentration was 70 mM. The mixture also contained 2 mM NADH and 200 mM formate. After 120 min, 0.7 ml of a 2.1 M pyruvate solution and 0.125 ml of an 8 M sodium formate solution were again added. The pH increase resulting from the enzymatic reaction was counter-titrated with formic acid. After 7 hours, 6.8 mM PAC had formed.
Aufarbeiten und Analytik der enzymatischen Reaktionsprodukte: Processing and analysis of the enzymatic reaction products:
Die Auftrennung der Reaktionsprodukte erfolgte mittels präparativer reversed-phase HPLC. Als stationäre Phase wurde eine C8-MOS Hypersil-Säule, 250 x 4,6 mm, verwendet. Die Elution erfolgte unter isokratischen Bedingungen mit Essigsäure/Acetonitril 0,5 %/12,5 % (v/v) mit einer Flußrate von 1,5 ml/min. Die Elutionszeiten betrugen unter diesen Bedingungen: PAC, 4.77 min und 2- Hydroxypropiophenon, 5.41 min. Die Zuordnung des entstandenen Enantiomeren als R-(-)-PAC erfolgte mittels Polarimetrie anhand eines Standards aus der PAC-Produktion (Knoll AG). The reaction products were separated using preparative reversed-phase HPLC. A C8-MOS Hypersil column, 250 x 4.6 mm, was used as the stationary phase. Elution was carried out under isocratic conditions with acetic acid / acetonitrile 0.5% / 12.5% (v / v) at a flow rate of 1.5 ml / min. Under these conditions, the elution times were: PAC, 4.77 min and 2-hydroxypropiophenone, 5.41 min. The enantiomer as R - (-) - PAC was assigned using polarimetry using a standard from PAC production (Knoll AG).
Das Enantiomerenverhältnis von PAC wurde mittels chiraler Gaschromatographie zu >> 98 % bestimmt.
The enantiomer ratio of PAC was determined by chiral gas chromatography to be >> 98%.
Claims
1. Verfahren zur Gewinnung einer zur Bildung von (R) - (-)-Phenylacetylcarbinol (I) in >95% Enantiomerenrein- heit mit einem Produktverhältnis von I zu 2- Hydroxypropiophenon von >95% befähigten Pyruvatdecarboxylase (PDC) mit einer spezifischen Aktivität bzgl. der Phenylacetylcarbinolbildung von >lU/mg durch Isolierung aus einem Produzenten-Organismus, 1. A process for obtaining a pyruvate decarboxylase (PDC) with a specific activity which is capable of forming (R) - (-) - phenylacetylcarbinol (I) in> 95% enantiomeric purity with a product ratio of I to 2-hydroxypropiophenone of> 95% with regard to the phenylacetylcarbinol formation of> 1U / mg by isolation from a producer organism,
d a d u r c h g e k e n n z e i c h n e t, characterized,
daß man einen Produzenten-Organismus mit einem für PDC kodierenden Gen aus Zymomonas mobilis verwendet, in dessen DNA-Sequenz das für den Tryptophanrest kodierende Kodon TGG an der Position 1174-1176 durch ein Kodon ersetzt ist, das für einen Aminosäurerest mit verminderter Raumerfüllung kodiert. that one uses a producer organism with a gene coding for PDC from Zymomonas mobilis, in whose DNA sequence the codon TGG coding for the tryptophan residue at position 1174-1176 is replaced by a codon which codes for an amino acid residue with reduced space filling.
2. Verfahren nach Anspruch 1 2. The method according to claim 1
d a d u r c h g e k e n n z e i c h n e t, characterized,
daß das Kodon TGG durch ein Kodon ersetzt ist, das für einen einfach Aminosäurerest kodiert. that the codon TGG is replaced by a codon which codes for a simple amino acid residue.
3. Verfahren nach Anspruch 2 , 3. The method according to claim 2,
d a d u r c h g e k e n n z e i c h n e t characterized
daß das Kodon TGG durch ein Kodon ersetzt ist, das für einen aliphatischen Aminosäurerest kodiert. that the codon TGG is replaced by a codon which codes for an aliphatic amino acid residue.
4. Verfahren nach Anspruch 3, 4. The method according to claim 3,
d a d u r c h g e k e n n z e i c h n e t, characterized,
daß das Kodon TGG durch ein Kodon ersetzt ist, das für einen Alaninrest kodiert. that the codon TGG is replaced by a codon which codes for an alanine residue.
5. Pyruvat-decarboxylase befähigt zur Umwandlung von Pyruvat in Gegenwart von Benzaldehyd in (R)-(-)- Phenylacetylcarbinol in >95% Enantiomerenreinheit mit einem Produktverhältnis von I zu 2-Hydroxypropiophenon von >95% mit einer spezifischen Aktivität bzgl. der Produktbildung von >1U/mg, erhältlich nach einem der Ansprüche 1 bis 3, deren Tryptophanrest in Position 392 durch einen Aminosäurerest minderer Größe ersetzt ist. 5. Pyruvate decarboxylase enables the conversion of pyruvate in the presence of benzaldehyde into (R) - (-) - phenylacetylcarbinol in> 95% enantiomeric purity with a product ratio of I to 2-hydroxypropiophenone of> 95% with a specific activity with regard to product formation of> 1U / mg, obtainable according to one of Claims 1 to 3, whose tryptophan residue in position 392 is replaced by an amino acid residue of smaller size.
6. Pyruvat-decarboxylase nach Anspruch 5 6. pyruvate decarboxylase according to claim 5
g e k e n n z e i c h n e t d u r c h marked by
einen den Tryptophanrest an der Position 392 ersetzenden Alaninrest. an alanine residue to replace the tryptophan residue at position 392.
7. Verfahren zur enzymatischen Gewinnung von Acyloinen durch enzymatische Acyloinkondensation von α- Ketocarbonsäuren und/oder Aldehyden in Gegenwart von PDC, 7. Process for the enzymatic production of acyloin by enzymatic acyloin condensation of α-ketocarboxylic acids and / or aldehydes in the presence of PDC,
d a d u r c h g e k e n n z e i c h n e t, characterized,
daß man als PDC ein Enzym nach Anspruch 5 oder 6 verwendet. that an enzyme according to claim 5 or 6 is used as the PDC.
8. Verfahren nach Anspruch 7, 8. The method according to claim 7,
d a d u r c h g e k e n n z e i c h n e t, daß man die Acyloinkondensation ausgehend von α- Ketocarbonsäure unter gleichzeitiger Reduktion von überschüssigem durch Decarboxylierung gebildeten Aldehyd mittels Alkohol-dehydrogenase und NADH durchführt. characterized, that one carries out the acyloin condensation starting from α-ketocarboxylic acid with simultaneous reduction of excess aldehyde formed by decarboxylation by means of alcohol dehydrogenase and NADH.
9. Verfahren nach Anspruch 8, 9. The method according to claim 8,
d a d u r c h g e k e n n z e i c h n e t, characterized,
daß das bei der Umsetzung gebildete NAD in situ durch Formiat-dehydrogenase zu NADH regeneriert wird. that the NAD formed in the reaction is regenerated in situ by formate dehydrogenase to NADH.
10. DNA-Sequenz des Gens für thiamindiphosphat- abhängiges Enzym mit einer Zugangslimitierung im zum aktiven Zentrum führenden Substratkanal 10. DNA sequence of the gene for thiamine diphosphate-dependent enzyme with an access limitation in the substrate channel leading to the active center
d a d u r c h g e k e n n z e i c h n e t characterized
daß an der Stelle des für die Zugangslimitierung kodierenden Kodons ein Kodon eingeführt ist, das für einen die Zuganglimitierung beseitigenden Aminosäurerest kodiertthat in place of the codon coding for the access limitation, a codon is introduced which codes for an amino acid residue which removes the access limitation
11. DNA-Sequenz nach Anspruch 10, 11. DNA sequence according to claim 10,
g e k e n n z e i c h n e t d u r c h marked by
die DNA-Sequenz des PDC-Gens von Zymomonas mobilis mit einem, für einen Aminosäurerest minderer Größe kodierendes Kodon an der Position 1174-1176. the DNA sequence of the Zymomonas mobilis PDC gene with a codon coding for an amino acid residue of smaller size at position 1174-1176.
12. DNA-Sequenz nach Anspruch 11, 12. DNA sequence according to claim 11,
g e k e n n z e i c h n e t d u r c h marked by
ein für einen Rest einer aliphatischen Aminosäure kodierendes Kodon an der Position 1174-1176. a codon encoding an aliphatic amino acid residue at position 1174-1176.
13. DNA-Sequenz nach Anspruch 12, 13. DNA sequence according to claim 12,
g e k e n n z e i c h n e t d u r c h marked by
ein für einen Alaninrest kodierendes Kodon an der Position 1174-1176. a codon for an alanine residue at position 1174-1176.
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19518809 | 1995-05-26 | ||
DE19518809 | 1995-05-26 | ||
DE19523269 | 1995-06-29 | ||
DE19523269A DE19523269C2 (en) | 1995-05-26 | 1995-06-29 | Process for the production of acyloin, pyruvate decarboxylase suitable therefor as well as its production and DNA sequence of the PDC gene coding for it |
PCT/DE1996/000928 WO1996037620A2 (en) | 1995-05-26 | 1996-05-22 | Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and dna sequences of the pdc gene coding them |
Publications (1)
Publication Number | Publication Date |
---|---|
EP0828841A2 true EP0828841A2 (en) | 1998-03-18 |
Family
ID=26015375
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP96919594A Withdrawn EP0828841A2 (en) | 1995-05-26 | 1996-05-22 | Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and dna sequences of the pdc gene coding them |
Country Status (12)
Country | Link |
---|---|
US (1) | US6004789A (en) |
EP (1) | EP0828841A2 (en) |
JP (1) | JPH11505710A (en) |
KR (1) | KR19990021965A (en) |
CN (1) | CN1192244A (en) |
AU (1) | AU714414B2 (en) |
BR (1) | BR9608798A (en) |
CA (1) | CA2222493A1 (en) |
CZ (1) | CZ287619B6 (en) |
DE (1) | DE19523269C2 (en) |
IN (2) | IN186507B (en) |
WO (1) | WO1996037620A2 (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE19736104A1 (en) * | 1997-08-20 | 1999-02-25 | Basf Ag | Preparation of enantiomerically pure phenylacetycarbinol derivatives |
DE19918935A1 (en) * | 1999-04-27 | 2000-11-02 | Forschungszentrum Juelich Gmbh | Stereoselective synthesis of 2-hydroxyketones |
KR100708794B1 (en) * | 2001-05-04 | 2007-04-18 | 유니버시티 오브 플로리다 리서치 파운데이션, 아이엔씨. | Cloning and Sequencing of Pyruvate Decarboxylase PDC Genes from Bacteria and Uses Therefor |
DE10142467A1 (en) | 2001-08-31 | 2003-03-20 | Basf Ag | New pyruvate decarboxylase, its production and use |
DE10142574A1 (en) * | 2001-09-01 | 2003-03-20 | Basf Ag | Process for the preparation of R-phenylacetylcarbinol by an enzymatic process in a two-phase system |
IL147823A (en) | 2002-01-24 | 2008-06-05 | Univ Ben Gurion | Process for preparing chiral aromatic alpha- hydroxy ketones using acetohydroxyacid synthase |
DE10313971A1 (en) * | 2003-03-27 | 2004-10-21 | Degussa Ag | Coupled cofactor-dependent enzymatic reaction system |
DE102014013644A1 (en) * | 2014-09-16 | 2016-03-17 | Forschungszentrum Jülich GmbH | Lyase and DNA coding for the lyase, the DNA-containing vectors, as well as methods for the asymmetric synthesis of (S) -phenylacetylcarbinol |
CN107630049B (en) * | 2017-04-01 | 2018-09-21 | 武汉茵茂特生物技术有限公司 | The biological preparation method of ephedrine |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE548459C (en) * | 1930-04-09 | 1932-04-13 | Gustav Hildebrandt Dr | Process for the preparation of 1-1-phenyl-2-methylaminopropan-1-ol |
-
1995
- 1995-06-29 DE DE19523269A patent/DE19523269C2/en not_active Expired - Fee Related
-
1996
- 1996-05-22 JP JP8535270A patent/JPH11505710A/en active Pending
- 1996-05-22 BR BR9608798A patent/BR9608798A/en not_active Application Discontinuation
- 1996-05-22 KR KR1019970708440A patent/KR19990021965A/en not_active Application Discontinuation
- 1996-05-22 EP EP96919594A patent/EP0828841A2/en not_active Withdrawn
- 1996-05-22 CZ CZ19973691A patent/CZ287619B6/en not_active IP Right Cessation
- 1996-05-22 AU AU58102/96A patent/AU714414B2/en not_active Ceased
- 1996-05-22 WO PCT/DE1996/000928 patent/WO1996037620A2/en not_active Application Discontinuation
- 1996-05-22 CA CA002222493A patent/CA2222493A1/en not_active Abandoned
- 1996-05-22 CN CN96195936A patent/CN1192244A/en active Pending
- 1996-05-24 IN IN946CA1996 patent/IN186507B/en unknown
-
1997
- 1997-11-24 US US08/976,852 patent/US6004789A/en not_active Expired - Fee Related
-
2000
- 2000-11-17 IN IN647KO2000 patent/IN189539B/en unknown
Non-Patent Citations (1)
Title |
---|
See references of WO9637620A2 * |
Also Published As
Publication number | Publication date |
---|---|
AU714414B2 (en) | 2000-01-06 |
IN186507B (en) | 2001-09-22 |
KR19990021965A (en) | 1999-03-25 |
WO1996037620A3 (en) | 1997-02-06 |
CZ369197A3 (en) | 1998-02-18 |
CA2222493A1 (en) | 1996-11-28 |
WO1996037620A2 (en) | 1996-11-28 |
DE19523269C2 (en) | 2000-05-31 |
CN1192244A (en) | 1998-09-02 |
IN189539B (en) | 2003-03-22 |
AU5810296A (en) | 1996-12-11 |
DE19523269A1 (en) | 1996-11-28 |
US6004789A (en) | 1999-12-21 |
JPH11505710A (en) | 1999-05-25 |
BR9608798A (en) | 1999-02-17 |
CZ287619B6 (en) | 2001-01-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0827543B1 (en) | Production of 1,3-propanediol from glycerol by recombinant bacteria expressing recombinant diol dehydratase | |
DE69434148T2 (en) | Alcohol dehydrogenase, DNA coding therefor, preparation and process for the preparation of optically active alcohols | |
EP2313489B1 (en) | Production method | |
DE112010004851T5 (en) | Process and recombinant microorganisms for the production of cadaverine | |
EP2428575A1 (en) | Oxidoreductases for stereo-selective reduction of keto compounds | |
EP2511376B1 (en) | Method for industrially producing (s)-1,1,1-trifluoro-2-propanol | |
EP0828841A2 (en) | Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and dna sequences of the pdc gene coding them | |
WO2007014544A2 (en) | Stereoselective synthesis of chiral diols | |
CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
WO2017220059A1 (en) | Method of producing d-xylonate and coryneform bacterium | |
DE60202227T2 (en) | New enone reductases isolated from Kluyveromyces lactis, methods for their preparation and methods for the selective reduction of carbon-carbon double bonds of alpha, beta-unsaturated ketones using the reductases | |
EP1425392B1 (en) | Novel pyruvate decarboxylase, production and use thereof | |
DE102017210944B4 (en) | Alcohol dehydrogenases and methods for the stereoselective reduction of carbonyl compounds | |
DE10247147A1 (en) | Production of D-mannitol, useful e.g. as sweetener and plasma extender, by culturing organisms that express mannitol-2-dehydrogenase and where substrate is introduced by a non-phosphorylating pathway | |
DE102013104418A1 (en) | Biocatalytic process for the preparation of (R) -3-quinuclidinol | |
EP1499728A2 (en) | Nucleotide sequence coding for a mannitol 2-dehydrogenase and method for the production of d-mannitol | |
DE10220234B4 (en) | Processes and microorganisms for the microbial production of pyruvate from carbohydrates and alcohols | |
DE60126767T2 (en) | NOVEL (R) -2-HYDROXY-3-PHENYLPROPIONATE (D-PHENYL LACTATE) DEHYDROGENASE AND FOR THAT ENCODING GENE | |
EP4317442A1 (en) | Recombinant microorganism for producing 2,3-butanediol with reduced by-product production and method for producing 2,3-butanediol by using same | |
EP2193194B1 (en) | Method for producing 2-methyl-1,2-dihydroxypropane | |
DE102007045092A1 (en) | Enzyme system with the activity of a monooxygenase and method for the oxidation of methyl groups in aliphatic hydrocarbons |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 19971127 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: FORSCHUNGSZENTRUM JUELICH GMBH |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
18W | Application withdrawn |
Effective date: 20030703 |