EP0828841A2

EP0828841A2 - Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and dna sequences of the pdc gene coding them

Info

Publication number: EP0828841A2
Application number: EP96919594A
Authority: EP
Inventors: Heike Bruhn; Martina Pohl; Katrin Mesch; Maria-Regina Kula
Original assignee: Forschungszentrum Juelich GmbH
Current assignee: Forschungszentrum Juelich GmbH
Priority date: 1995-05-26
Filing date: 1996-05-22
Publication date: 1998-03-18
Also published as: AU714414B2; IN186507B; KR19990021965A; WO1996037620A3; CZ369197A3; CA2222493A1; WO1996037620A2; DE19523269C2; CN1192244A; IN189539B; AU5810296A; DE19523269A1; US6004789A; JPH11505710A; BR9608798A; CZ287619B6

Abstract

The invention relates to a process for obtaining a pyruvate decarboxylase by isolation from a producer organism. The pyruvate decarboxylase is capable of forming (R)-(-)-phenylacetylcarbinole (I) in » 95 % enantiomer unit with a product ratio of (I) to 2-hydroxypropiophenone of » 95 %. In addition, the pyruvate decarboxylase has a specific activity with regard to phenylacetylcarbinole formation of > 1 U/mg. It is the aim of the invention to obtain a pyruvate decarboxylase with improved synthesis capacity concerning the formation of (R)-(-)-phenylacetylcarbinole. The process of the invention developed for this purpose is characterized in that use is made of a producing organism with a gene coding for pyruvate decarboxylase from Zymomonas mobilis, in the DNA sequence of which the tryptophane radical coding codon TGG is replaced at position 1174-1176 by a codon which codes for an amino acid radical with a reduced volume ratio.

Description

Process for the production of acyloins, pyruvate decarboxylase suitable therefor as well as their production and DNA sequence of the PDC gene coding for them

The invention relates to a process for the production of acyloin by enzymatic conversion of α-ketocarboxylic acids and / or aldehydes in the presence of pyruvate decarboxylase (PDC) and it includes a PDC suitable therefor and its production and the gene coding therefor.

Acyloins or α-hydroxyketones are compounds with an optically active carbon atom that play a significant role in the synthesis of more complex compounds, such as, in particular, the (R) - (-) -phenylacetylcarbinol

(PAC), which is of great economic interest for the production of ephedrine. Here, the R enantiomer is of interest, which is formed by fermentative conversion of pyruvate in the presence of benzaldehyde by means of Saccharomyces cerevisiae (DE-PS 548 459 from 1932).

In this synthesis of PAC by means of yeast cells, due to the majority of the enes present in the yeast Numerous by-products are formed and the cell growth is inhibited by the presence of benzaldehyde.

The pyruvate decarboxylase (PDC) isolated from the yeast also leads to considerable proportions of the 2-hydroxypropiophenone isomeric to PAC in this reaction.

The thiamine diphosphate and Mg ²⁺ dependent PDC (EC

4.1.1.1) is widespread and is found in many plants, yeasts and fungi and in some bacteria. It catalyzes the non-oxidative decarboxylation of pyruvate to acetaldehyde and, as a side reaction, an acyloin condensation takes place with the formation of α-hydroxyketones, as can be seen from FIG. 1.

Such an enzymatic conversion also takes place starting from an aldehyde instead of α-ketocarboxylic acids, and the aldehyde formed by the decarbooxylation can also act as a "cosubstrate" in the condensation reaction with the formation of homoacyloins

Participate R-CHOH-CO-R 'with R = R'.

The PDC from Zymomonas mobilis has also been isolated. A comparison of a PDC isolated from yeast with

However, PDC from Zymomonas mobilis with regard to the formation of PAC under comparable conditions showed a clear lent the synthetic capacity of the PDC from Zymomonas mobilis (S. Bringer-Meyer and H. Sahm, Biocatalysis 1 (1988) pp. 321-331).

It has now surprisingly been found that through targeted genetic engineering modification of the Z. mobilis PDC gene, a PDC with improved synthetic capacity with regard to the formation of PAC can be obtained, which is also distinguished by a high selectivity for the formation of PAC compared to 2- Hydroxypropiophenone distinguished.

The process of the type mentioned at the outset is essentially characterized in that an enzyme is used as the PDC in which the tryptophan residue in the substrate channel leading to the active center is replaced by a sterically smaller amino acid residue.

A sterically smaller amino acid residue is in particular a simple, in particular aliphatic, amino acid, such as specifically alanine, glycine,

Phenylalanine, leucine, isoleucine, arginine or histidine or also serine and threonine.

The genetically modified new PDC is obtained by replacing the codon TGG coding for tryptophan at position 392 in position 1174-1176 of the DNA sequence of the PDC gene from Z. mobilis in itself known manner and expression of the PDC in a producer organism, such as in particular E. coli, from which the PDC is isolated. The targeted mutation occurs e.g. B. using the polymerase chain reaction using the primers specified on page 9. The construction of the expression vector pBTac2 for the mutated PDC was carried out starting from the E. coli expression vector pPDC of the wild-type enzyme.

The mutated PDC are obtained after harvesting and disruption of the cells from the crude extract in a manner known per se by chromatographic methods.

Due to the modification of the PDC according to the invention, its PAC synthesis capacity is improved by a factor of 4. This improvement results from the targeted weakening or elimination of the access limitation in the substrate channel leading to the active center of the enzyme, as a result of which the access of voluminous substrate molecules to the active center and the exit of the product formed are facilitated.

An analogous optimization can generally be achieved with thiamine-diphosphate-dependent enzymes, which have an access limitation - be it steric or due to charge influences - in the substrate channel leading to the active center: By analogous modification of the DNA sequence of the coding for the enzyme Gene, by replacing the codon coding for the access limitation with a codon coding for an amino acid residue which removes the access limitation, a significant increase in the synthesis capacity of the enzyme is achieved.

The PDC thus obtained in accordance with the objective forming the starting point of the invention is of considerable interest for the PAC synthesis, since it can be used to obtain a high optical purity of the R - (-) isomer (»98%) and a PAC which only a few percent

(2-3%) is accompanied by 2-hydroxy-propiophenone. The extraction and isolation of the enzyme from the harvested microorganism is possible in a relatively simple manner (compared to yeast).

In the case of enzymatic acyloin condensation by means of PDC, linear and / or branched α-ketocarboxylic acids can be used as the substrate and aromatic, cyclic, longer-chain and / or branched aldehydes can be used as the substrate and / or cosubstrate. Examples include benzaldehyde, cyclohexanaldehyde, furfural, cinnamaldehyde, crotonaldehyde, pyruvate, 2-ketobutyric acid, 2-ketopentanoic acid, 2-keto-4-methyllhexanoic acid,

2-keto-4-methylpentanoic acid, 2 keto-4,4-dimethylhexanoic acid, 3-phenyl-2-keto-propanoic acid can be mentioned. Further special features of the invention result from the patent claims and the following description of implementation details. Reference is made to the attached drawings; they are:

Fig. 1: The reaction scheme of the PDC for the example

Pyruvate and benzaldehyde as substrate and cosubstrate with the main route of decarboxylation and the carboligase side reaction with the formation of PAC;

Fig. 2: A construction scheme for the formation of the expression vector containing the PDC from Z. mobilis pPDC and

3: A diagram for a production of PAC according to FIG. 1, which is optimized by trapping acetaldehyde by means of alcohol dehydrogenase.

example

1. Preparation of the PDC mutant PDC-W392A

1.1 Construction of the expression vector pPDC

The vector pBTac2 (Boehringer, Mannheim) was chosen for the expression of the PDC from Zymomonas mobilis. The transcription of the foreign gene is under the control of the strong tac promoter, a hybrid of trp and lacUV promoters with 11-fold and 3-fold efficiency parent promoters. The operator sequence and ribosome binding region come from the lacZ gene. The transcription is thus regulated by the lac repressor of an overexpressing (laciQ) bacterial strain and can be induced by isopropyl-β-D-thiogalactoside (IPTG). The vector contains a single recognition sequence of the restriction endonuclease EcoRI, followed by the initiation codon ATG and then further restriction recognition sequences (sites), so that this vector is universal for expression both for gene sequences with and without its own

Initiation codon can be used.

The multiple cloning site is followed by the strong ribosomal RNA transcription terminators rrnB to ensure controlled termination of the transcription. The vector pZY134B (G. Sprenger, Inst. Biotechnologie 2, KFA-Jülich) was available as the starting material for cloning the PDC gene from Zymomonas mobilis (ATCC 29191). This plasmid contains a 3.2 kb DNA fragment from Zymomonas mobilis with the complete PDC gene including non-coding regions (FIG. 2). In order to enable the coding sequence to be ligated into the expression vector, it was necessary to introduce a new restriction recognition sequence in the 5 'direction of the initiation codon. The optimal distance between the initiation codon and the Shine-Dalgarno sequence of the vector is ensured by the ligation of the gene into the EcoRI site of the pBTac2 vector. A polymerase, chain reaction (PCR) offers an elegant and simple method of modifying a DNA sequence. Repeated cycles of heat denaturation of the DNA double strand and enzymatic synthesis by a thermostable DNA polymerase enable the exponential amplification of defined DNA fragments. The size and identity of the products is determined by the starting points (primers) of the synthesis. If the primers contain a modification of the original sequence, such as mutations, deletions or additional bases

(Insertions), these will consequently also be present in the synthetic fragment.

With this method, the required EcoRI restriction site was introduced in the 5 'direction of the initiation codon of the PDC gene by connecting the recognition sequence of the enzyme to the 5' end of the primer complementary to the gene during oligonucleotide synthesis. Since some endonucleases show a strongly reduced activity for the restriction of terminal sequences, four further bases were added upstream to the ECoRI site.

The Taq polymerase most commonly used for PCR has no 3'-5 'exonuclease activity (proof-reading). The sequence it synthesizes is therefore subject to a statistical error rate. Even if this with the choice of suitable reaction conditions 1 / 100,000 can be kept very low, this necessitates the sequencing of each fragment to ensure the integrity of the synthesis. Therefore, not the entire coding region of the PDC gene (1712 bp), but a smaller fragment (890 bp) from the 5'-terminus to a single restriction site (EcoRV) was chosen for the amplification (FIG. 2).

The PCR product was digested with the corresponding restriction endonucleases EcoRI and EcoRV.

The missing second part of the PDC gene was obtained from the plasmid pZY134B by restriction with ECoRV and BamHI, the resulting fragment (1.2 kb) at the 3 'end still containing about 350 bp untranslated sequence of the PDC gene. Both fragments were separated by preparative agarose gel electrophoresis, isolated and ligated in the EcoRI and BamHI linearized, isolated pBTac2 (4.6 kb). The cloning was carried out in E. coli JM 109, a strain overexpressing the lac repressor.

1.2 Molecular biological work

For the production of a by tryptophan / alanine

Exchange of mutated PDC at position 392 was initially the codon TGG present in the wild-type enzyme (Tryptophan) exchanged for GCG (alanine) (exchange of position 1174-1176 of the gene of pyruvate decarboxylase from Zymomonas mobilis). The targeted mutation was introduced with the help of the Ho et al. described polymerase chain reaction supported method (SN Ho, HD Hunt, RM Horton, JK Pullen, LR Pease, Gene 77 (1989) p. 51).

The PDC gene from Z. mobilis in the E. coli expression vector pPDC was available as a starting point (see FIG. 2). DNA isolation was carried out according to standard methods (J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press). The plasmid pPDC served as a template for the synthesis of the two overlapping individual fragments. The primer

(Primer sequences according to the appendix) were used with a concentration of 0.2-0.4 nM. The reaction was carried out with Taq polymerase (Biomasters, Cologne) in the reaction buffer specified by the manufacturer, plus 1.5 mM MgCl ₂ and 0.2 mM each of the nucleotides in the "Robo-Cycler" (Stratgene) with the following temperature program: 2.5 minutes at 94 ° C. for denaturation followed by 30 cycles with a 1.5 minute denaturation at 94 ° C, 1.2 minutes annealing at 48 ° C and 2 minutes extension at 72 ° C, followed by 10 minutes at 72 ° C to complete the reaction 48 ° C and 56 ° C, depending on the theoretical melting point of the primers used. The melting point of the oligonucleotides was calculated using the following formula:

Tm = 2 * (A + T) + 3 * (C + G)

The fragments were separated electrophoretically, isolated, precipitated for concentration with ethanol and taken up again in Tris-HCl buffer, 10 mM, pH 7.4.

In the second combined PCR, approximately 50-100 ng of the overlapping fragments were used as templates. The other reaction conditions were identical to the first reaction. The choice of annealing temperature was based on the melting temperature of the resulting overlap region of the fragments. The further manipulations (restriction, isolation, ligation) to replace the wild-type DNA in the expression vector pPDC by the mutated fragments were carried out using standard methods

(J. Sambrock, EF Fritsch, T. Maniatis, Molecular Cloning (1989) Spring Harbor Laboratory Press).

Sequences of the primers used

The numbering refers to the 1st (5 ') nucleotide of the PDC sequence

s = sense, as = anti-sense

The mutated bases are underlined.

Primer for the synthesis of the 5 'single fragment • PDC867S

CTACTCCACCACTGGTTGGACG

• PDC1186as

GAGGATTGAAGGAGAGTCACC Primer for the synthesis of the 3'-single fragment

• PDC1159s

GAAACCGGTGACTCTGCGTTCAATGC

• PBTAC453as

ATCTTCTCTCATCCGCCAAACA

(this primer is complementary to the vector sequence at the 3 'end following the PDC sequence)

Primer for the synthesis of the fusion fragment • PDC867s

CTACTCCACCACTGGTTGGAGG

• PBTAC453as

ATCTTCTCTATCCGCCAAACA

(This primer is complementary to the vector sequence on

3 'end following the PDC sequence)

1.2 Expression and purification

An enzyme according to the invention (PDC-W392A) was obtained by expression of the modified DNA in E. coli cells. The mutated enzyme (mutant) PDC-W392A was expressed according to the following procedure and purified from the cell extract:

The E. coli cells carrying the expression plasmid for the mutant PDC-W392A were fermented for selection in LB medium including 100 μg / ml ampicillin. The medium was inoculated with pre-cultures in the stationary growth phase in a ratio of 1:50 and at 37 ° C and

Incubated 220 rpm.

Expression was induced at an OD600 of 0.6 by adding 1 mM IPTG. The PDC mutant was overexpressed with 20% of the soluble protein in E. coli under these conditions.

To produce sufficient amounts of enzyme, the expression was carried out as described above in an 8 liter fermenter. A pH value of 7.0 and an air flow of 10 l / h were set. The stirring speed was 200 rpm. To avoid excess

Foaming was added to polypropylene glycol as needed. The cells were harvested after 3 hours of expression by chilled continuous centrifugation. The digestion was carried out by grinding with glass beads. For this purpose, a 30% cell suspension was prepared in Mes / KOH buffer, 50 mM, pH 6.5, including 5 mM MgCl ² and 0.1 mM ThDP and mixed with a double volume of glass beads (d = 0.3 mm). Depending on the volume to be processed, the digestion was carried out in Eppendorf vessels in a Retsch mill or ice-cooled in the Disintegrator S (maximum volume 80 ml). The grinding took place over 10 minutes with maximum performance. The suspension was centrifuged, the glass beads washed with buffer and the combined centrifugates filtered (1 μm). The PDC mutants were purified by column chromatography as follows: 1. Anion exchange chromatography

The crude extract (approx. 110 ml, approx. 1.0-1.5 g protein) was applied to a Q-Sepharose Fast Flow (Pharmacia)

(2.6 * 9.5 cm) with a flow rate of 5 ml / min using an FPLC system from Pharmacia. The enzyme eluted by applying a linear NaCl gradient (from 0 to 200 mM) in 10 mM Mes / KOH, pH 6.5, 2 mM MgCl _2, 0.1mM ThDP, at 100 mM NaCl. The fractions containing the target protein were identified by activity test (see below). 2. Hydrophobic Interaction Chromatography (HIC)

The combined fractions were adjusted to an ammonium sulfate content of 50% saturation by adding a volume of saturated ammonium sulfate solution. The hydrophobic interaction chromatography was carried out on Butyl Sepharose (Pharmacia) (column 5 * 8 cm) at a flow rate of 2 ml / min. The material was equilibrated before loading with 40% ammonium sulfate in 50mM Mes / KOH, 2mM MgCl ₂ , 0.1mM ThDP. The enzyme eluted in the same buffer with a falling ammonium sulfate gradient (40-0%) at 24%. The target fractions were again identified using an activity test and pooled (approx. 160 ml).

3. Desalination over Sephadex G25 and rebuffering to 50 mM Mes / KOH, 2 mM MgCl ₂ , 0.1 mM ThDP. The flow rate was 20 ml / min. It was then lyophilized.

1.3 Activity test (decarboxylation reaction)

The determination of the enzymatic activity was carried out in the coupled enzymatic test, the NADH oxidation being monitored photometrically by the auxiliary enzyme alcohol dehydrogenase from yeast (EC 1.1.1.1). The reaction mixture contained 16.9 mM pyruvate, 0.18 mM NADH and 10 U ADH in 50 mM Mes / KOH, pH 6.5, 20 mM MgSO ₄ , 1.5 mM ThDP. One enzyme unit PDC (1 U) corresponds to the amount of enzyme that catalyzes the conversion of 1 μmol substrate in one minute at 30 ° C. The enzyme activity is calculated according to:

ε (NADH) = 6.3 1 * mmol ^-1 * cm ^-1

V = total volume

v = sample volume

d = layer thickness of the cuvette (1 cm)

ΔE / min = decrease in absorbance per minute

f = dilution factor of the sample

2. Use of PDC-W392 A for PAC synthesis

Chiral acyloins can be obtained starting from an α-ketocarboxylic acid or an aldehyde as substrate and a further aldehyde as cosubstrate by means of PDC or PDC mutants.

The following applications are mentioned as examples:

PAC synthesis starting from pyruvate and benzaldehyde The synthesis mixture contained 40 mM pyruvate, 70 mM benzaldehyde and 10 U / ml PDC-W392A in Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO ₄ , 1.5 mM ThDP. The reaction was carried out for one hour at 37 ° C and the resulting PAC (6.2 mM) was detected by HPLC.

PAC synthesis based on acetaldehyde and benzaldehyde

PAC synthesis approach contained 40 mM acetaldehyde instead of pyruvate. Otherwise the procedure was as described above. After one hour, 3.7 mM PAC had developed.

PAC synthesis with PDC-W392A in the coupled 3-enzyme system

The enzymatic conversion was carried out according to FIG. 3. The use of alcohol dehydrogenase (ADH) from yeast (EC 1.1.1.1) enables the continuous removal of acetaldehyde and the inactivation of the PDC-W392A which is caused thereby. The formate dehydrogenase (FDH) from Candida boidinii (EC 1.2.1.2) is used to regenerate NADH. The enzymatic PAC synthesis was carried out in 20 ml of Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO ₄ , 1.5 mM ThDP.

The approach included:

1.3 U / ml PDC-W392A, 2 U / ml ADH, 2.5 U / ml FDH. The initial pyruval concentration was 70 mM. The mixture also contained 2 mM NADH and 200 mM formate. After 120 min, 0.7 ml of a 2.1 M pyruvate solution and 0.125 ml of an 8 M sodium formate solution were again added. The pH increase resulting from the enzymatic reaction was counter-titrated with formic acid. After 7 hours, 6.8 mM PAC had formed.

Processing and analysis of the enzymatic reaction products:

The reaction products were separated using preparative reversed-phase HPLC. A C8-MOS Hypersil column, 250 x 4.6 mm, was used as the stationary phase. Elution was carried out under isocratic conditions with acetic acid / acetonitrile 0.5% / 12.5% (v / v) at a flow rate of 1.5 ml / min. Under these conditions, the elution times were: PAC, 4.77 min and 2-hydroxypropiophenone, 5.41 min. The enantiomer as R - (-) - PAC was assigned using polarimetry using a standard from PAC production (Knoll AG).

The enantiomer ratio of PAC was determined by chiral gas chromatography to be >> 98%.

Claims

Patent claims

1. A process for obtaining a pyruvate decarboxylase (PDC) with a specific activity which is capable of forming (R) - (-) - phenylacetylcarbinol (I) in> 95% enantiomeric purity with a product ratio of I to 2-hydroxypropiophenone of> 95% with regard to the phenylacetylcarbinol formation of> 1U / mg by isolation from a producer organism,

characterized,

that one uses a producer organism with a gene coding for PDC from Zymomonas mobilis, in whose DNA sequence the codon TGG coding for the tryptophan residue at position 1174-1176 is replaced by a codon which codes for an amino acid residue with reduced space filling.

2. The method according to claim 1

characterized,

that the codon TGG is replaced by a codon which codes for a simple amino acid residue.

3. The method according to claim 2,

characterized

that the codon TGG is replaced by a codon which codes for an aliphatic amino acid residue.

4. The method according to claim 3,

characterized,

that the codon TGG is replaced by a codon which codes for an alanine residue.

5. Pyruvate decarboxylase enables the conversion of pyruvate in the presence of benzaldehyde into (R) - (-) - phenylacetylcarbinol in> 95% enantiomeric purity with a product ratio of I to 2-hydroxypropiophenone of> 95% with a specific activity with regard to product formation of> 1U / mg, obtainable according to one of Claims 1 to 3, whose tryptophan residue in position 392 is replaced by an amino acid residue of smaller size.

6. pyruvate decarboxylase according to claim 5

marked by

an alanine residue to replace the tryptophan residue at position 392.

7. Process for the enzymatic production of acyloin by enzymatic acyloin condensation of α-ketocarboxylic acids and / or aldehydes in the presence of PDC,

characterized,

that an enzyme according to claim 5 or 6 is used as the PDC.

8. The method according to claim 7,

characterized, that one carries out the acyloin condensation starting from α-ketocarboxylic acid with simultaneous reduction of excess aldehyde formed by decarboxylation by means of alcohol dehydrogenase and NADH.

9. The method according to claim 8,

characterized,

that the NAD formed in the reaction is regenerated in situ by formate dehydrogenase to NADH.

10. DNA sequence of the gene for thiamine diphosphate-dependent enzyme with an access limitation in the substrate channel leading to the active center

characterized

that in place of the codon coding for the access limitation, a codon is introduced which codes for an amino acid residue which removes the access limitation

11. DNA sequence according to claim 10,

marked by

the DNA sequence of the Zymomonas mobilis PDC gene with a codon coding for an amino acid residue of smaller size at position 1174-1176.

12. DNA sequence according to claim 11,

marked by

a codon encoding an aliphatic amino acid residue at position 1174-1176.

13. DNA sequence according to claim 12,

marked by

a codon for an alanine residue at position 1174-1176.