CN107630049B - The biological preparation method of ephedrine - Google Patents
The biological preparation method of ephedrine Download PDFInfo
- Publication number
- CN107630049B CN107630049B CN201710214572.3A CN201710214572A CN107630049B CN 107630049 B CN107630049 B CN 107630049B CN 201710214572 A CN201710214572 A CN 201710214572A CN 107630049 B CN107630049 B CN 107630049B
- Authority
- CN
- China
- Prior art keywords
- ephedrine
- compound
- alcohol
- formula
- buffer solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of biological preparation methods of ephedrine, include the following steps：Benzaldehyde and acetaldehyde, pyruvic acid or acetonate react under the catalytic action of biological enzyme in buffer solution, and purifying obtains 2 carbonyl of optically pure formula (R) 1 phenyl, 3 propyl alcohol；2 carbonyl of optically pure (R) 1 phenyl, 3 propyl alcohol reacts 2 methylamino phenylpropyl alcohol alkane of generation (1R, 2S), 1 alcohol, as ephedrine under the catalytic action of biological enzyme with methylamine in buffer solution.Raw material supply of the present invention is sufficient, cheap, is not required to separately prepare, reagent price is cheap, the easy recrystallization purifying of product, at low cost；Enzymatic direct bioconversion produces ephedrine, and reaction condition is mild, is suitble to industrialized production；Easily-controlled reaction conditions, easy to operate, technological process is simple, to equipment without particular/special requirement, is suitable for large-scale production.
Description
Technical field
The present invention relates to the preparation methods of bulk pharmaceutical chemicals and pharmaceutical intermediate, in particular to a kind of biological preparation side of ephedrine
Method.
Background technology
Drug herba ephedrae has good medical value, has the advantages that drug safety is reliable, tolerance is strong, Small side effects.It
Principle active component be ephedrine and pseudoephedrine.Ephedrine belongs to quasi- adrenal gland excitomotor, is mainly used for treating bronchus
The diseases such as asthma, various coughs, allergic reaction, low blood pressure also have relaxing smooth muscle, vasoconstriction, cardioacceleration, increase blood pressure
And central nervous excitation effect.Pseudoephedrine is sympathetic transmitter releasers, and there are upper respiratory tract mucosa vasoconstrictor effects, boosting to make
With and with significant diuresis, also there is anti-inflammatory effect.In American-European countries, the drug containing ephedrine reaches more than 300
Kind, in addition, foreign countries have using ephedrine as food additives, excited maincenter simultaneously inhibits enterocinesia with control body weight, main to use
In diet, weight-reducing.
Production to ephedrine, it is domestic mainly to use plant extraction method, ephedrine is directly extracted from Herba Ephedrae.This biography
Uniting, technique process is cumbersome, and labor intensity is big；Production cost is high, directly relies on Chinese ephedra grass resource, yield is small and unstable.In addition,
Chemical synthesis is directly used in the production of German company ephedrine, is first produced the racemic modification of L- ephedrines and D-PSEUDOEPHEDRINE, is needed
It further splits, resolution reagent is expensive, of high cost.Using biotransformation method production ephedrine, there are many advantages, both at home and abroad
It reports a kind of method of half bioconversion production ephedrine, first converts benzaldehyde to R- phenyl acetyls with pyruvate decarboxylase
Methanol, further chemical synthesis ephedrine, but yield is not high.And it and has not been reported both at home and abroad directly biological using enzymatic
The method of conversion production ephedrine.
Therefore, a kind of efficient method for producing ephedrine using enzymatic direct bioconversion of research and development, which seems, very must
It wants.
Invention content
Problem to be solved by this invention is exactly to overcome the shortcomings of above-mentioned background technology, provides a kind of biology system of ephedrine
Preparation Method, this method produces ephedrine using enzymatic direct bioconversion, on the basis of ensureing high conversion, simplifies production
Technique and reduction production cost.
In order to solve the above technical problems, the biological preparation method of ephedrine provided by the present invention, including：Type I compound
Benzaldehyde, IV compound of formula and methylamine constitute reaction system under enzyme catalysis with buffer solution, react, and purifying obtains formula
V compound (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as ephedrine；The chemical formula of IV compound of formula is
Wherein, R is selected from H, COOH, COONa, COOK.
Preferably, the biological preparation method of ephedrine, including two steps, respectively：
Step 1：Type I compound benzaldehyde and IV compound of formula constitute reactant under enzyme catalysis with buffer solution
System reacts, and purifying obtains II compound of formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol；
Reaction equation is as follows：
Step 2：II compound of optical voidness formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol obtained by step 1 is urged with methylamine in enzyme
Change effect is lower and buffer solution constitutes reaction system, and reaction is obtained containing V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol
The conversion fluid of alkane -1- alcohol, purifying, obtains V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as ephedrine；
Reaction equation is as follows：
Further, in step 1, enzyme is biological enzyme and coenzyme, and biological enzyme is propiophenone synzyme, and propiophenone synzyme can
With the full cell of commercially available or genetic engineering bacterium or crude enzyme liquid, coenzyme is diphosphothiamine, and MgCl is added in reaction system2
Or MgSO4。
Further, in step 1, DMF and polyethylene glycol are also added in reaction system, control MgCl2A concentration of 3-
8mM controls a concentration of 0.5-2mM of DMF, controls a concentration of 1-3mM of polyethylene glycol.
Further, in step 1, biological enzyme is the gene of the propiophenone synzyme from Zymomonas mobilis
The full cell of engineering bacteria, external source propiophenone closes in the genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis
Encoding gene at enzyme is SEQ ID NO in sequence table：Nucleotide sequence shown in 1；Control derives from Zymomonas
A concentration of 50-100g/L of the full cell of genetic engineering bacterium of the propiophenone synzyme of mobilis controls coenzyme b1thiaminpyrophosphate
A concentration of 3-5mM.
Further, in step 2, enzyme is biological enzyme and coenzyme, and biological enzyme is N- methylaminos acidohydrogenase and glucose
Dehydrogenase.
Further, in step 2, biological enzyme is the N- methyl ammonia from Pseudomonas putida ATCC12633
Glucose is added in reaction system in base acidohydrogenase and glucose dehydrogenase (EC1.1.1.47), using NADH or NAD+ as
Coenzyme.By glucose dehydrogenase mediate coenzyme circular regeneration system be routine techniques, generally include glucose, coenzyme NAD H or
NAD+ and glucose dehydrogenase, those skilled in the art can select suitable component and content according to actual conditions.Grape
Glucocorticoid dehydrogenase can the full cell of commercially available or genetic engineering bacterium or crude enzyme liquid.
Further, in step 2, biological enzyme is the N- methyl ammonia from Pseudomonas putida ATCC12633
The full cell of genetic engineering bacterium and glucose dehydrogenase of base acidohydrogenase, it is described to derive from Pseudomonas putida
The encoding gene of external source N- methylamino acidohydrogenases is in the genetic engineering bacterium of the N- methylamino acidohydrogenases of ATCC12633
SEQ ID NO in sequence table：Nucleotide sequence shown in 2；Control is from Pseudomonas putida ATCC12633's
A concentration of 18-50g/L of the full cell of genetic engineering bacterium of N- methylamino acidohydrogenases, it is described in the step 1 and step 2
Buffer solution is selected from phosphate buffer solution, carbonate buffer solution, Tri-HCl buffer solutions, borate buffer solution, sweet ammonia
One kind in acid buffering solution, citrate buffer solution, MOPS buffer solutions.
Further, the conversion fluid for containing V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol is carried out pure
Change, includes the following steps：Cell is collected by centrifugation, the supernatant liquor NaOH solution of 10M is adjusted into Ph to 7-9, uses rotary evaporation
Instrument is concentrated into volume to 1/2, then is adjusted with the HCl of 10M and stood overnight at Ph to 7,0-8 DEG C, and the solid to be formed is collected by filtration, will
Obtained solid incorporates the NaOH solution of 1M, then adjusts Ph to 7 with the HCl of 10M, with alcohol crystal, washs, vacuum drying obtains
Ephedrine crystal.
As another technical solution, type I compound benzaldehyde, IV compound of formula and methylamine are in propiophenone synzyme, N-
Under methylamino acidohydrogenase and glucose dehydrogenase catalytic action, buffered using diphosphothiamine and NADH as coenzyme
One pot reaction in solution obtains the conversion fluid containing V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, purifying,
Obtain V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as ephedrine.
From the genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis, specific preparation method is：
(1) expression vector containing propiophenone synthase gene is built：
The genomic DNA for extracting the propiophenone synzyme of Zymomonas mobilis is used as template, with comprising NdeI with
The following nucleotide sequences of XhoI restriction enzyme sites carry out PCR amplification as primer：
Primer 1:5’—GTTAACATATGAGCTATACCGTGGGC—3’
Primer 2:5’—GGCCTCGAGCTACAGCAGTTTG—3’
NdeI restriction enzyme sites and XhoI restriction enzyme sites are introduced respectively in the underscore part at 5 ' ends of above-mentioned primer.
PCR amplification system is：Genomic DNA 2uL, primer 1 and primer 2 each 2uL, dNTP 4uL, 10 × Taq buffer solution
5uL, Taq enzyme 1uL, ddH2O 34uL；
PCR response procedures are：94 DEG C of pre-degeneration 2min；94 DEG C are denaturalized 30s, then 55 DEG C of annealing 1min, 72 DEG C of extensions
1min is recycled 30 times, last 72 DEG C of extensions 10min.
(2) structure of recombinant plasmid
Pcr amplification product is recycled, through restriction enzyme NdeI and XhoI double digestion, digestion system is：PCR product
50uL, NdeI 2.5uL, XhoI 2.5uL, 10 × Taq buffer solution 10uL, ddH2O 35uL.PCR product after digestion is passed through
DNA Purification Kits are connected with the plasmid pET-28a by the purifying of same double digestion under the action of T4 ligases
It connects, coupled reaction system is：The PCR product 4uL of digestion purifying, pET-28a plasmids 4uL, T4 the ligase 1uL of digestion purifying,
10 × T4 ligase buffer solutions 1uL.16h is connected at 16 DEG C, obtains pET-28a recombinant plasmids.
(3) in recombinant plasmid transformed to host cell
By in recombinant plasmid transformed to competent E.coli BL21 (DE3), it is coated on containing 50ug/mL kanamycins
On LB solid mediums, 37 DEG C of culture 20-24h obtain preliminary positive colony.
(4) it screens to obtain positive colony through resistance culture base
The preliminary positive colony of picking is in the LB liquid medium that 5mL contains 50ug/mL kanamycins respectively, 37 DEG C,
200rpm overnight incubations extract plasmid, and through restriction enzyme NdeI and XhoI double digestion plasmid, electrophoresis is verified, and to extraction
Plasmid order-checking, after verification is errorless, the bacterium colony with the plasmid is positive colony, as derives from Zymomonas mobilis'
Propiophenone synthase gene engineering bacteria.The encoding gene of external source propiophenone synzyme is SEQ ID in sequence table in genetic engineering bacterium
NO：Nucleotide sequence shown in 1.
The expression of propiophenone synzyme：To include SEQ ID NO：The genetic engineering bacterium of nucleotide sequence shown in 1
It is inoculated in the LB liquid medium for being added to 50ug/mL kanamycins, 37 DEG C of shaking table cultures are stayed overnight；Again with 2-10% (v/v)
Inoculum concentration be transferred in the LB liquid medium of the kanamycins containing 50ug/mL cultivate 5-7h after, be added IPTG induced,
The final concentration of 0.2-1mmol/L of IPTG, is cooled to 25-30 DEG C, and after inducing 12-20h, thalline were collected by centrifugation to get to source
In the full cell of genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis.
From the genetic engineering bacterium of the N- methyl l-amino acid dehydrogenases of Pseudomonas putida ATCC12633,
Specifically preparation method is：
(1) expression vector containing N- methylamino dehydrogenase genes is built：
The genomic DNA of the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633 is extracted as mould
Plate carries out PCR amplification using the following nucleotide sequences comprising NdeI and XhoI restriction enzyme sites as primer：
Primer 3:5’—GAATCATGTCCGCACCTTCCACCAGCA—3’
Primer 4:5’—GGCCTCGAGTCAGCCAAGCAGCTC—3’
NdeI restriction enzyme sites and XhoI restriction enzyme sites are introduced respectively in the underscore part at 5 ' ends of above-mentioned primer.
PCR amplification system is：Genomic DNA 2uL, primer 1 and primer 2 each 2uL, dNTP 4uL, 10 × Taq buffer solution
5uL, Taq enzyme 1uL, ddH2O 34uL；
PCR response procedures are：94 DEG C of pre-degeneration 2min；94 DEG C are denaturalized 30s, then 50 DEG C of annealing 1min, 72 DEG C of extensions
1min is recycled 25 times, last 72 DEG C of extensions 10min.
(2) structure of recombinant plasmid
Pcr amplification product is recycled, through restriction enzyme NdeI and XhoI double digestion, digestion system is：PCR product
50uL, NdeI 2.5uL, XhoI 2.5uL, 10 × Taq buffer solution 10uL, ddH2O 35uL.PCR product after digestion is passed through
DNA Purification Kits are connected with the plasmid pET-28a by the purifying of same double digestion under the action of T4 ligases
It connects, coupled reaction system is：The PCR product 4uL of digestion purifying, pET-28a plasmids 4uL, T4 the ligase 1uL of digestion purifying,
10 × T4 ligase buffer solutions 1uL.16h is connected at 16 DEG C, obtains recombinant plasmid.
(3) in recombinant plasmid transformed to host cell
By in recombinant plasmid transformed to competent E.coli BL21 (DE3), it is coated on containing 50ug/mL kanamycins
On LB solid mediums, 37 DEG C of culture 20-24h obtain preliminary positive colony.
(4) it screens to obtain positive colony through resistance culture base
The preliminary positive colony of picking is in the LB liquid medium that 5mL contains 50ug/mL kanamycins respectively, 37 DEG C,
200rpm overnight incubations extract plasmid, and through restriction enzyme NdeI and XhoI double digestion plasmid, electrophoresis is verified, and to extraction
Plasmid order-checking, after verification is errorless, the bacterium colony with the plasmid is positive colony, as derives from Pseudomonas putida
The N- methylamino dehydrogenase gene engineering bacterias of ATCC12633.External source N- methylamino acidohydrogenases in genetic engineering bacterium
Encoding gene is SEQ ID NO in sequence table：Nucleotide sequence shown in 2.
The expression of N- methylamino acidohydrogenases：To include SEQ ID NO：The gene of nucleotide sequence shown in 2
Engineering bacteria is inoculated in the LB liquid medium for being added to 50ug/mL kanamycins, and 37 DEG C of shaking table cultures are stayed overnight；Again with 2-10%
(v/v) inoculum concentration is transferred in the LB liquid medium of the kanamycins containing 50ug/mL after culture 5-7h, and IPTG is added and is lured
It leads, the final concentration of 0.2-1mmol/L of IPTG, is cooled to 25-30 DEG C, after inducing 12-20h, thalline were collected by centrifugation, as source
In the full cell of genetic engineering bacterium of the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633.
Advantages of the present invention is mainly reflected in following several respects：
First, raw material supply of the present invention is sufficient, and it is cheap, it is not required to separately prepare, reagent price is cheap, and product is easily tied again
Crystalline substance purifying, it is at low cost；
Second, enzymatic direct bioconversion of the present invention produces ephedrine, reaction condition is mild, is suitble to industrialized production；
Third, easily-controlled reaction conditions of the present invention, can one pot reaction, easy to operate, technological process is simple, to equipment without
Particular/special requirement is suitable for large-scale production.
Specific implementation mode
Below in conjunction with specific embodiment, the present invention is described in further detail, but the embodiment should not be construed pair
The limitation of the present invention, it is only for example.Simultaneously by illustrating that advantages of the present invention will become clearer and be readily appreciated that.
Embodiment 1
From the genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis, specific preparation method is：
(1) expression vector containing propiophenone synthase gene is built：
The genomic DNA for extracting the propiophenone synzyme of Zymomonas mobilis is used as template, with comprising NdeI with
The following nucleotide sequences of XhoI restriction enzyme sites carry out PCR amplification as primer：
Primer 1:5’—GTTAACATATGAGCTATACCGTGGGC—3’
Primer 2:5’—GGCCTCGAGCTACAGCAGTTTG—3’
NdeI restriction enzyme sites and XhoI restriction enzyme sites are introduced respectively in the underscore part at 5 ' ends of above-mentioned primer.
PCR amplification system is：Genomic DNA 2uL, primer 1 and primer 2 each 2uL, dNTP 4uL, 10 × Taq buffer solution
5uL, Taq enzyme 1uL, ddH2O 34uL；
PCR response procedures are：94 DEG C of pre-degeneration 2min；94 DEG C are denaturalized 30s, then 50 DEG C of annealing 1min, 72 DEG C of extensions
1min is recycled 25 times, last 72 DEG C of extensions 10min.
(2) structure of recombinant plasmid
Pcr amplification product is recycled, through restriction enzyme NdeI and XhoI double digestion, digestion system is：PCR product
50uL, NdeI 2.5uL, XhoI 2.5uL, 10 × Taq buffer solution 10uL, ddH2O 35uL.PCR product after digestion is passed through
DNA Purification Kits are connected with the plasmid pET-28a by the purifying of same double digestion under the action of T4 ligases
It connects, coupled reaction system is：The PCR product 4uL of digestion purifying, pET-28a plasmids 4uL, T4 the ligase 1uL of digestion purifying,
10 × T4 ligase buffer solutions 1uL.2h is connected at 37 DEG C, obtains recombinant plasmid.
(3) in recombinant plasmid transformed to host cell
By in recombinant plasmid transformed to competent E.coli BL21 (DE3), it is coated on containing 50ug/mL kanamycins
On LB solid mediums, 37 DEG C of culture 20-24h obtain preliminary positive colony.
(4) it screens to obtain positive colony through resistance culture base
The preliminary positive colony of picking is in the LB liquid medium that 5mL contains 50ug/mL kanamycins respectively, 37 DEG C,
200rpm overnight incubations extract plasmid, and through restriction enzyme NdeI and XhoI double digestion plasmid, electrophoresis is verified, and to extraction
Plasmid order-checking, after verification is errorless, the bacterium colony with the plasmid is positive colony, as derives from Zymomonas mobilis'
Propiophenone synthase gene engineering bacteria.The encoding gene of external source propiophenone synzyme is SEQ ID in sequence table in genetic engineering bacterium
NO：Nucleotide sequence shown in 1.
The expression of propiophenone synzyme：To include SEQ ID NO：The genetic engineering bacterium of nucleotide sequence shown in 1
It is inoculated in the LB liquid medium for being added to 50ug/mL kanamycins, 37 DEG C of shaking table cultures are stayed overnight；Again with 2-10% (v/v)
Inoculum concentration be transferred in the LB liquid medium of the kanamycins containing 50ug/mL cultivate 5-7h after, be added IPTG induced,
The final concentration of 0.2-1mmol/L of IPTG, is cooled to 25-30 DEG C, and after inducing 12-20h, thalline were collected by centrifugation to get to source
In the full cell of genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis.
From the genetic engineering bacterium of the N- methyl l-amino acid dehydrogenases of Pseudomonas putida ATCC12633,
Specifically preparation method is：
(1) expression vector containing N- methylamino dehydrogenase genes is built：
The genomic DNA of the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633 is extracted as mould
Plate carries out PCR amplification using the following nucleotide sequences comprising NdeI and XhoI restriction enzyme sites as primer：
Primer 3:5’—GAATCATGTCCGCACCTTCCACCAGCA—3’
Primer 4:5’—GGCCTCGAGTCAGCCAAGCAGCTC—3’
NdeI restriction enzyme sites and XhoI restriction enzyme sites are introduced respectively in the underscore part at 5 ' ends of above-mentioned primer.
PCR amplification system is：Genomic DNA 2uL, primer 1 and primer 2 each 2uL, dNTP 4uL, 10 × Taq buffer solution
5uL, Taq enzyme 1uL, ddH2O 34uL；
PCR response procedures are：94 DEG C of pre-degeneration 2min；94 DEG C are denaturalized 30s, then 50 DEG C of annealing 1min, 72 DEG C of extensions
1min is recycled 25 times, last 72 DEG C of extensions 10min.
(2) structure of recombinant plasmid
Pcr amplification product is recycled, through restriction enzyme NdeI and XhoI double digestion, digestion system is：PCR product
50uL, NdeI 2.5uL, XhoI 2.5uL, 10 × Taq buffer solution 10uL, ddH2O 35uL.PCR product after digestion is passed through
DNA Purification Kits are connected with the plasmid pET-28a by the purifying of same double digestion under the action of T4 ligases
It connects, coupled reaction system is：The PCR product 4uL of digestion purifying, pET-28a plasmids 4uL, T4 the ligase 1uL of digestion purifying,
10 × T4 ligase buffer solutions 1uL.2h is connected at 37 DEG C, obtains recombinant plasmid.
(3) in recombinant plasmid transformed to host cell
By in recombinant plasmid transformed to competent E.coli BL21 (DE3), it is coated on containing 50ug/mL kanamycins
On LB solid mediums, 37 DEG C of culture 20-24h obtain preliminary positive colony.
(4) it screens to obtain positive colony through resistance culture base
The preliminary positive colony of picking is in the LB liquid medium that 5mL contains 50ug/mL kanamycins respectively, 37 DEG C,
200rpm overnight incubations extract plasmid, and through restriction enzyme NdeI and XhoI double digestion plasmid, electrophoresis is verified, and to extraction
Plasmid order-checking, after verification is errorless, the bacterium colony with the plasmid is positive colony, as derives from Pseudomonas putida
The N- methylamino dehydrogenase gene engineering bacterias of ATCC12633.External source N- methylamino acidohydrogenases in genetic engineering bacterium
Encoding gene is SEQ ID NO in sequence table：Nucleotide sequence shown in 2.
The expression of N- methylamino acidohydrogenases：To include SEQ ID NO：The gene of nucleotide sequence shown in 2
Engineering bacteria is inoculated in the LB liquid medium for being added to 50ug/mL kanamycins, and 37 DEG C of shaking table cultures are stayed overnight；Again with 2-10%
(v/v) inoculum concentration is transferred in the LB liquid medium of the kanamycins containing 50ug/mL after culture 5-7h, and IPTG is added and is lured
It leads, the final concentration of 0.2-1mmol/L of IPTG, is cooled to 25-30 DEG C, after inducing 12-20h, thalline were collected by centrifugation.As source
In the full cell of genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis.
Embodiment 2
Type I compound benzaldehyde and IV compound of formula are reacted under the catalytic action of biological enzyme in buffer solution, purifying,
Obtain II compound of formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol；
Specific reaction process is as follows：Reaction carries out in 1L shaking flasks, and reaction system control is 300mL, with type I compound benzene
Formaldehyde (30g, 0.28mol) and IV compound pyruvic acid (35.2g, 0.4mol) of formula are substrate, are buffered with citric acid-sodium citrate
Solution is solvent, using the full cell of genetic engineering bacterium of the propiophenone synzyme from Zymomonas mobilis as catalyst,
Add coenzyme b1thiaminpyrophosphate.Control is complete from the genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis
A concentration of 70g/L of cell controls a concentration of 2.5mM of coenzyme b1thiaminpyrophosphate.MgCl is added into reaction system2, DMF
(n,N-Dimethylformamide), polyethylene glycol control MgCl2A concentration of 5mM, control a concentration of 1mM of DMF, control poly- second
A concentration of 2mM of glycol, the pH value for controlling transformation system are 6.5, and the temperature of system conversion is 28 DEG C, and the rotating speed control of shaking table is
160r/min is monitored using HPLC-MS and HPLC, until substrate is fully utilized, obtains formula II compound (R) -1- phenyl -
The conversion fluid of 2- carbonyl -3- propyl alcohol, purifying, obtain II compound of formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol (37.53g,
0.25mol), the yield of optical purity 99.2%, conversion process is 89.36%.
Reaction equation is as follows：
Embodiment 3
II compound of optical voidness formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol and methylamine under the catalytic action of biological enzyme
Reaction generates ephedrine in buffer solution；
Reaction carries out in 1L shaking flasks, and reaction system control is 300mL, with II compound of formula (R) -1- phenyl -2- carbonyls -
3- propyl alcohol (37.5g, 0.25mol) and first ammonium (15.5g, 0.5mol) are substrate, addition glucose (45g, 0.25mol), with phosphorus
Hydrochlorate buffer solution is solvent, with from the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633
The full cell of genetic engineering bacterium and glucose dehydrogenase it is (commercially available) be catalyst, addition coenzyme NAD+.Control derives from
The full cell concentration of genetic engineering bacterium of the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633 is 25g/
L, control coenzyme NAD+a concentration of 0.4g/L.The pH value for controlling transformation system is 7.5, and conversion temperature is 30 DEG C, and shaking table turns
Speed control is 160r/min, transformation time 18h.It is obtained after conversion containing V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol
The conversion fluid of alkane -1- alcohol.
Reaction equation is as follows：
Embodiment 4
The conversion fluid obtained to embodiment 3 purifies, and includes the following steps：Cell is collected by centrifugation, supernatant liquor is used
The NaOH solution of 10M adjusts Ph to 8, and volume is concentrated into 1/2 with Rotary Evaporators, then adjusts Ph to 7,0-8 with the HCl of 10M
It is stood overnight at DEG C, the solid to be formed is collected by filtration, obtained solid is incorporated to the NaOH solution of 1M, then Ph is adjusted with the HCl of 10M
It to 7, with alcohol crystal, washs, vacuum drying obtains V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as
Ephedrine crystal, optical purity 98.4%.
Embodiment 5
Reaction carried out in 1L shaking flasks, reaction system control be 300mL, with type I compound benzaldehyde (30g,
0.28mol), IV compound pyruvic acid (35.2g, 0.4mol) of formula and first ammonium (27.9g, 0.9mol) are substrate, add glucose
(90g, 0.5mol) uses coke under propiophenone synzyme, N- methylaminos acidohydrogenase and glucose dehydrogenase catalytic action
The one pot reaction in buffer solution is obtained using phosphoric acid hydrochloric acid buffer solution as solvent as coenzyme by thiamine phosphoric acid and NADH
Conversion fluid containing V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, to derive from Zymomonas mobilis
Propiophenone synzyme the full cell of genetic engineering bacterium, the N- methyl ammonia from Pseudomonas putida ATCC12633
(commercially available) the full cell of genetic engineering bacterium of base acidohydrogenase, glucose dehydrogenase are catalyst, and control derives from
A concentration of 91g/L of the full cell of genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis, control derive from
The full cell concentration of genetic engineering bacterium of the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633 is 48g/
L, controls a concentration of 3.5mM of coenzyme b1thiaminpyrophosphate, and a concentration of 0.5g/L of control coenzyme NAD H controls transformation system
PH value is 7, and conversion temperature is 30 DEG C, and the rotating speed control of shaking table is 160r/min, transformation time 26h.Contained after conversion
The conversion fluid of V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol.Purifying, obtains V compound of formula (1R, 2S) -2-
Methylamino-phenylpropyl alcohol alkane -1- alcohol (21.45g, 0.13mol), as ephedrine crystal, conversion ratio 46.43%, optical purity are
97.1%.
Reaction equation is as follows：
The content not being described in detail in this specification belongs to the prior art well known to those skilled in the art.
<110>Wuhan Yin Maote Bioisystech Co., Ltd
<120>The biological preparation method of ephedrine
<160> 6
<211> 1707
<212> DNA
<213> Zymomonas mobilis
<400> 1
atgagctata ccgtgggcac ctatctggcg gaacgtctgg tgcagattgg cctgaaacat 60
cattttgcgg tggcgggcga ttataacctg gtgctgctgg ataacctgct gctgaacaaa 120
aacatggaac aggtgtattg ctgcaacgaa ctgaactgcg gctttagcgc ggaaggctat 180
gcgcgtgcga aaggcgcggc ggcggcggtg gtgacctata gcgtgggcgc gctgagcgcg 240
tttgatgcga ttggcggcgc gtatgcggaa aacctgccgg tgattctgat tagcggcgcg 300
ccgaacaaca acgatcatgc ggcgggccat gtgctgcatc atgcgctggg caaaaccgat 360
tatcattatc agctggaaat ggcgaaaaac attaccgcgg cggcggaagc gatttatacc 420
ccggaagaag cgccggcgaa aattgatcat gtgattaaaa ccgcgctgcg tgaaaaaaaa 480
ccggtgtatc tggaaattgc gtgcaacatt gcgagcatgc cgtgcgcggc gccgggcccg 540
gcgagcgcgc tgtttaacga tgaagcgagc gatgaagcga gcctgaacgc ggcggtggaa 600
gaaaccctga aatttattgc gaaccgtgat aaagtggcgg tgctggtggg cagcaaactg 660
cgtgcggcgg gcgcggaaga agcgccggtg aaatttgcgg atgcgctggg cggcgcggtg 720
gcgaccatgg cggcggcgaa aagctttttt ccggaagaaa acccgcatta tattggcacc 780
agctggggcg aagtgagcta tccgggcgtg gaaaaaacca tgaaagaagc ggatgcggtg 840
attgcgctgg cgccggtgtt taacgattat agcaccaccg gctggaccga tattccggat 900
ccgaaaaaac tggtgctggc ggaaccgcgt agcgtggtgg tgaacggcat tcgttttccg 960
agcgtgcatc tgaaagatta tctgacccgt ctgctgcaga aagtgagcaa aaaaaccggc 1020
gcgctggatt tttttaaaag cctgaacgcg ggcgaactga aaaaagcggc gccggcggat 1080
ccgagcgcgc cgctggtgaa cgcggaaatt gcgcgtcagg tggaagcgct gctgaccccg 1140
aacaccacca ttattgcgga aaccggcgat agctggttta acgcgcagcg tatgaaactg 1200
ccgaacggcg cgcgtgtgga atatgaaatg cagtggggcc atattggctg gagcgtgccg 1260
gcggcgtttg gctatgcggt gggcgcgccg gaacgtcgta acattctgat ggtgggcgat 1320
ggcagctttc agctgaccgc gcaggaagtg gcgcagatgg tgcgtctgaa actgccggtg 1380
attatttttc tgattaacaa ctatggctat accattgaag tgatgattca tgatggcccg 1440
tataacaaca ttaaaaactg ggattatgcg ggcctgatgg aagtgtttaa cggcaacggc 1500
ggctatgata gcggcgcggg caaaggcctg aaagcgaaaa ccggcggcga actggcggaa 1560
gcgattaaag tggcgctggc gaacaccgat ggcccgaccc tgattgaatg ctttattggc 1620
cgtgaagatt gcaccgaaga actggtgaaa tggggcaaac gtgtggcggc ggcgaacagc 1680
cgtaaaccgg tgaacaaact gctgtag 1707
<110>Wuhan Yin Maote Bioisystech Co., Ltd
<120>The biological preparation method of ephedrine
<160> 6
<211> 1026
<212> DNA
<213> Pseudomonas putida
<400> 2
atgtccgcac cttccaccag caccgttgtg cgcgtgcctt ttaccgagct gcaaagcctg 60
ttgcaggcca ttttccagcg ccatgggtgc agcgaggccg tggcccgggt gctggcccac 120
aactgcgcca gcgcccagcg tgatggcgcc catagccatg gggtgttccg catgcccggt 180
tatgtctcga ccttggccag cggctgggtc gatggccagg ccacgccaca ggtcagcgac 240
gtggccgccg gctatgtgcg tgtcgatgct gcgggcggtt ttgcccagcc agcactggcg 300
gcggcccgtg agctgttggt ggcgaaggcg cgcagcgcag gcattgccgt gctggcgatc 360
cacaactcgc accacttcgc cgcgctatgg ccggatgtcg agccgttcgc cgaagagggc 420
ctggtagccc tcagcgtggt caacagcatg acctgcgtgg tgccgcatgg tgcacgcaag 480
ccgctgttcg gtaccaaccc catcgctttt gctgcgcctt gcgccgagca tgacccgatc 540
gttttcgaca tggccaccag tgccatggcc catggcgatg tgcagattgc cgcgcgcgcc 600
ggccagcaat tgccggaggg catgggggtg gatgccgatg gccagccgac caccgacccg 660
aaggcgatcc tggaaggcgg cgccttgctg ccatttggcg ggcacaaggg ctcggcgttg 720
tcgatgatgg tcgagctgct ggcggcggcg ctgaccggcg gtcatttctc ctgggagttc 780
gattggtccg ggcatccggg ggcgaaaacg ccatggaccg ggcagttgat catcgtcatc 840
aacccaggca aggccgaggg cgagcgcttt gcccagcgca gccgcgagct ggtggagcac 900
atgcaggcgg tggggctgac gcgcatgccg ggcgagcggc gctaccgtga gcgcgaggtg 960
gccgaggagg agggggtggc ggtgaccgag caggagttgc aaggcctgaa agagctgctt 1020
ggctga 1026
<110>Wuhan Yin Maote Bioisystech Co., Ltd
<120>The biological preparation method of ephedrine
<160> 6
<211> 26
<212> DNA
<213>It is artificial synthesized
<223>Primer 1
<400> 3
gttaacatatgagctataccgtgggc
<110>Wuhan Yin Maote Bioisystech Co., Ltd
<120>The biological preparation method of ephedrine
<160> 6
<211> 22
<212> DNA
<213>It is artificial synthesized
<223>Primer 2
<400> 4
ggcctcgagctacagcagtttg
<110>Wuhan Yin Maote Bioisystech Co., Ltd
<120>The biological preparation method of ephedrine
<160> 6
<211> 27
<212> DNA
<213>It is artificial synthesized
<223>Primer 3
<400> 5
gaatcatgtccgcaccttccaccagca
<110>Wuhan Yin Maote Bioisystech Co., Ltd
<120>The biological preparation method of ephedrine
<160> 6
<211> 24
<212> DNA
<213>It is artificial synthesized
<223>Primer 4
<400> 6
ggcctcgagtcagccaagcagctc
Claims (7)
1. a kind of biological preparation method of ephedrine, which is characterized in that including type I compound benzaldehyde, IV compound of formula and first
Amine reacts under enzyme catalysis, and purifying obtains V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as Chinese ephedra
Alkali；Including two steps, respectively：
Step 1：Type I compound benzaldehyde and IV compound of formula constitute reaction system under enzyme catalysis with buffer solution, instead
It answers, purifies, obtain II compound of formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol；
Reaction equation is as follows：
Step 2：II compound of optical voidness formula (R) -1- phenyl -2- carbonyl -3- propyl alcohol obtained by step 1 is made with methylamine in enzymatic
Reaction system is constituted with buffer solution with lower, reaction is obtained containing V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1-
The conversion fluid of alcohol, purifying, obtains V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as ephedrine；
Reaction equation is as follows：
Wherein, R is selected from H, COOH, COONa, COOK；
In the step 1, enzyme is biological enzyme and coenzyme, and biological enzyme is propiophenone synzyme, and coenzyme is diphosphothiamine, reaction
MgCl is added in system2Or MgSO4；
In the step 2, enzyme is biological enzyme and coenzyme, and biological enzyme is N- methylaminos acidohydrogenase and glucose dehydrogenase；It is raw
Object enzyme is that the genetic engineering bacterium of the N- methylamino acidohydrogenases from Pseudomonas putida ATCC12633 is entirely thin
Born of the same parents and glucose dehydrogenase, the N- methylamino acidohydrogenases from Pseudomonas putida ATCC12633
The encoding gene of external source N- methylamino acidohydrogenases is SEQ ID NO in sequence table in genetic engineering bacterium：Nucleotide shown in 2
Sequence.
2. the biological preparation method of ephedrine according to claim 1, which is characterized in that in the step 1, reaction system
In also add DMF and polyethylene glycol, control MgCl2A concentration of 3-8mM, control a concentration of 0.5-2mM of DMF, control poly- second
A concentration of 1-3mM of glycol.
3. the biological preparation method of ephedrine according to claim 2, which is characterized in that in the step 1, biological enzyme is
From the full cell of genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis, Zymomonas is derived from
The encoding gene of external source propiophenone synzyme is SEQ ID in sequence table in the genetic engineering bacterium of the propiophenone synzyme of mobilis
NO：Nucleotide sequence shown in 1；Control is complete from the genetic engineering bacterium of the propiophenone synzyme of Zymomonas mobilis
A concentration of 50-100g/L of cell controls a concentration of 3-5mM of coenzyme b1thiaminpyrophosphate.
4. the biological preparation method of ephedrine according to claim 1, which is characterized in that in the step 2, biological enzyme is
From the N- methylaminos acidohydrogenase and glucose dehydrogenase of Pseudomonas putida ATCC12633, reaction system
Middle addition glucose, using NADH or NAD+ as coenzyme.
5. the biological preparation method of ephedrine according to claim 4, which is characterized in that control derives from
A concentration of 18- of the full cell of genetic engineering bacterium of the N- methylamino acidohydrogenases of Pseudomonas putida ATCC12633
50g/L, in the step 1 and step 2, the buffer solution is selected from phosphate buffer solution, carbonate buffer solution, Tri-
One in HCl buffer solutions, borate buffer solution, glycine buffer, citrate buffer solution, MOPS buffer solutions
Kind.
6. the biological preparation method of ephedrine according to claim 1, which is characterized in that contain V compound of formula (1R,
2S) conversion fluid of -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol is purified, and is included the following steps：Cell is collected by centrifugation, by supernatant liquor
Adjust pH to 7-9 with the NaOH solution of 10M, volume be concentrated into 1/2 with Rotary Evaporators, then with the HCl adjusting pH of 10M to
It is stood overnight at 7,0-8 DEG C, the solid to be formed is collected by filtration, obtained solid is incorporated to the NaOH solution of 1M, then the HCl with 10M
PH to 7 is adjusted, with alcohol crystal, is washed, vacuum drying obtains ephedrine or pseudoephedrine crystal.
7. the biological preparation method of ephedrine according to claim 1, which is characterized in that type I compound benzaldehyde, formula IV
Compound and methylamine use coke under propiophenone synzyme, N- methylaminos acidohydrogenase and glucose dehydrogenase catalytic action
Thiamine phosphoric acid and the NADH one pot reaction in buffer solution as coenzyme, obtain containing V compound of formula (1R, 2S) -2- first
The conversion fluid of amino-phenylpropyl alcohol alkane -1- alcohol, purifying, obtains V compound of formula (1R, 2S) -2- methylaminos-phenylpropyl alcohol alkane -1- alcohol, as
Ephedrine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710214572.3A CN107630049B (en) | 2017-04-01 | 2017-04-01 | The biological preparation method of ephedrine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710214572.3A CN107630049B (en) | 2017-04-01 | 2017-04-01 | The biological preparation method of ephedrine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107630049A CN107630049A (en) | 2018-01-26 |
| CN107630049B true CN107630049B (en) | 2018-09-21 |
Family
ID=61099227
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710214572.3A Expired - Fee Related CN107630049B (en) | 2017-04-01 | 2017-04-01 | The biological preparation method of ephedrine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107630049B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564788B (en) * | 2019-09-30 | 2021-05-04 | 江南大学 | Method for producing ephedrine by using imine reductase |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1192244A (en) * | 1995-05-26 | 1998-09-02 | 于利奇研究中心有限公司 | Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and DNA sequences of the PDC gene coding them |
| CN104685061A (en) * | 2013-02-19 | 2015-06-03 | 株式会社Api | Production method for l-lysine hydroxylase and hydroxy-l-lysine using same, and production method for hydroxy-l-pipecolic acid |
| CN104805148A (en) * | 2015-04-30 | 2015-07-29 | 苏州汉酶生物技术有限公司 | Bio-preparation method for (1R,2S)-N-pyrrolidyl norephedrine |
| CN105408489A (en) * | 2013-06-10 | 2016-03-16 | 于利奇研究中心有限公司 | Process for producing cathine |
-
2017
- 2017-04-01 CN CN201710214572.3A patent/CN107630049B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1192244A (en) * | 1995-05-26 | 1998-09-02 | 于利奇研究中心有限公司 | Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and DNA sequences of the PDC gene coding them |
| CN104685061A (en) * | 2013-02-19 | 2015-06-03 | 株式会社Api | Production method for l-lysine hydroxylase and hydroxy-l-lysine using same, and production method for hydroxy-l-pipecolic acid |
| CN105408489A (en) * | 2013-06-10 | 2016-03-16 | 于利奇研究中心有限公司 | Process for producing cathine |
| CN104805148A (en) * | 2015-04-30 | 2015-07-29 | 苏州汉酶生物技术有限公司 | Bio-preparation method for (1R,2S)-N-pyrrolidyl norephedrine |
Non-Patent Citations (9)
| Title |
|---|
| Asymmetric synthesis of (S)-phenylacetylcarbinol– closing a gap in C–C bond formation;T. Sehl等;《Green Chemistry》;20161017;第19卷(第2期);第380-384页 * |
| Biotransformation for L-Ephedrine Production;PL Rogers等;《Advances in Biochemical Engineering Biotechnology》;19971231;第56卷;第1-26页 * |
| Biphasic Aqueous/Organic Biotransformation of Acetaldehyde and Benzaldehyde by Zymomonas mobilis Pyruvate Decarboxylase;B Rosche等;《Biotechnology & Bioengineering》;20040510;第86卷(第7期);第788-794页 * |
| Enzymatic synthesis of N-methyl-L-phenylalanine by a novel enzyme, N-methyl-L-amino acid dehydrogenase, from Pseudomonas putida;H. Muramatsu等;《Tetrahedron:Asymmetry》;20040730;第15卷(第18期);第2841-2843页 * |
| N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida.A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily;H Mihara等;《FEBS Journal》;20050331;第272卷(第5期);第1117-1123页 * |
| Tuning and Switching Enantioselectivity of Asymmetric Carboligation in an Enzyme through Mutational Analysis of a Single Hot Spot;C Wechsler等;《Chembiochem : a European Journal of Chemical Biology》;20151021;第16卷(第18期);第2580-2584页 * |
| 微生物转化法生产d-伪麻黄碱;董世建等;《无锡轻工大学学报》;20040331;第23卷(第2期);第5-7，16页 * |
| 生物转化法生产L-苯基乙酰基甲醇的研究进展;李丹等;《过程工程学报》;20090228;第9卷(第1期);第190-199页 * |
| 登录号：AB190215.1;H Muramatsu等;《GenBank》;20050216;第1-1026位 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107630049A (en) | 2018-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR100676160B1 (en) | Microorganisms transformed with gene encoding malic enzyme and method for preparing succinic acid using the same | |
| KR100679638B1 (en) | Microorganisms transformed with gene encoding formate ddehydrogenase d or e and method for preparing succinic acid using the same | |
| CN106929521B (en) | Aldehyde ketone reductase gene recombination co-expression vector, engineering bacterium and application thereof | |
| CN107686850B (en) | Method for producing alpha-ketoglutaric acid by converting co-expression recombinant strain | |
| CN106701840A (en) | Biological preparation method for (1R, 2S)-2-(3,4-difluorophenyl) cyclopropylamine D-mandelate (I) | |
| CN104388373A (en) | Construction of escherichia coli system with coexpression of carbonyl reductase Sys1 and glucose dehydrogenase Sygdh | |
| WO2021139689A1 (en) | Use of biological enzyme for preparing orlistat intermediate, and preparation method | |
| CN113234698B (en) | Preparation method of cyano reductase and gabapentin | |
| CN106520651A (en) | Method for producing L-norvaline through enzymatic transformation | |
| CN109182410B (en) | Enzymatic preparation method of (S) -N-Boc-3-hydroxypiperidine | |
| CN106520715B (en) | A kind of short-chain dehydrogenase and its gene, recombinant expression carrier, genetic engineering bacterium and its application in the synthesis of astaxanthin chiral intermediate | |
| WO2022127310A1 (en) | Method for preparing (s)-2-(3-pyridine)-pyrrolidine | |
| CN106868030A (en) | Recombinant vector, the engineering bacteria containing it and the application in product KG | |
| WO2009140929A1 (en) | A method for co-production of 1, 3-propanediol, 2,3-butanediol and polyhydroxypropionic acid by fermentation of constructed genetic engineering bacteria | |
| US11802299B2 (en) | Enzyme-catalyzed method for synthesizing (2S, 3R)-2-substituted aminomethyl-3-hydroxybutyrate | |
| CN107630049B (en) | The biological preparation method of ephedrine | |
| CN111235123A (en) | Carbonyl reductase with high-concentration tolerance of alcoholic solution and application thereof | |
| CN108410831B (en) | Ketoacid reductase, gene, engineering bacterium and application in synthesis of chiral aromatic 2-hydroxy acid | |
| CN109679978B (en) | Recombinant co-expression system for preparing L-2-aminobutyric acid and application thereof | |
| CN108715827B (en) | Extracellular expression of tyrosine phenol lyase and application thereof | |
| WO2023240794A1 (en) | Recombinant escherichia coli for producing l-homoserine and use thereof | |
| CN114921392B (en) | Method for efficiently co-producing gluconic acid and allitol | |
| WO2017202193A1 (en) | Applications of recombinant ketoreductase in preparation of (r)-3-quinuclidinol | |
| CN110684705B (en) | Recombinant escherichia coli for producing 5-methylpyrazine-2 carboxylic acid | |
| CN107630050A (en) | The biological preparation method of pseudoephedrine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180921 Termination date: 20200401 |