EP0773993A1 - Gentechnisch veränderte schweine-zellen - Google Patents
Gentechnisch veränderte schweine-zellenInfo
- Publication number
- EP0773993A1 EP0773993A1 EP95928825A EP95928825A EP0773993A1 EP 0773993 A1 EP0773993 A1 EP 0773993A1 EP 95928825 A EP95928825 A EP 95928825A EP 95928825 A EP95928825 A EP 95928825A EP 0773993 A1 EP0773993 A1 EP 0773993A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- transgene
- donor
- cells
- graft
- recipient
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/15—Humanized animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/108—Swine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/01—Animal expressing industrially exogenous proteins
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/02—Animal zootechnically ameliorated
- A01K2267/025—Animal producing cells or organs for transplantation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the invention relates to the field of organ transplantation.
- Technical advances in allogeneic organ transplantation and the availability of nonspecific immunosuppressive agents have revolutionized the field of organ transplantation. This progress has, however, resulted in a shortage of essential organs of suitable size and match.
- Pigs are domesticated, easy to breed, have large litters, and grow rapidly to the size which allow the use of their organs in the very largest human beings.
- pig and man have many anatomical and physiological similarities.
- transplantation of a pig organ into a human results in a vigorous rejection of the graft- organ.
- a genetically engineered swine cell e.g., a cultured swine cell, e.g., a retrovirally transformed cultured swine cell, or a cell derived from a transgenic swine, which includes one or both of: a transgene encoding a graft- supporting protein, e.g., a primate, e.g., a human, hematopoietic peptide; or, a transgene which inhibits the expression or action of a gene product which is graft-antagonistic.
- a transgene encoding a graft- supporting protein e.g., a primate, e.g., a human, hematopoietic peptide
- a transgene which inhibits the expression or action of a gene product which is graft-antagonistic.
- transgenes which inhibit the expression or action of a gene product which is graft-antagonistic include: a transgene which encodes an anti-sense R A which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient- derived protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor graft-antagonistic protein (e.g., the
- the transgene encoding a graft-supporting protein is: a recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
- a recipient MHC gene e.g., a primate, e.g., a non-human primate or a human, MHC gene.
- the transgene is one which inhibits the expression or action of a donor MHC gene product (which gene product is graft-antagonistic).
- the genetically engineered swine cell is a hematopoietic stem cell and the transgene encoding a graft-supporting protein is: a recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human MHC gene.
- the genetically engineered swine cell is a hematopoietic stem cell and the transgene is one which inhibits the expression or action of a donor MHC gene product (which gene product is graft-antagonistic).
- the transgene encoding a graft-supporting protein and/or the transgene which inhibits the expression or action of a gene product which is graft-antagonistic is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
- the genetically engineered swine cell is a hematopoietic stem cell and the transgene encoding a graft-supporting protein and/or the transgene which inhibits the expression or action of a gene product which is graft-antagonistic is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate, MHC gene; or a non-human MHC gene.
- the transgene encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis. Examples of growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
- the transgene encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- human adhesion molecules include VLA-4, c-kit, LFA-1, CD1 la, Mac-1, CR3, CD1 lb, pl50, p95, CD1 lc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
- the transgene encodes a recipient or donor protein, e.g., a cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- a recipient or donor protein e.g., a cytokine
- a cytokine directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine)
- an immune response mounted by donor cells against the recipient e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- the transgene encodes a chimeric molecule, e.g., a chimeric lymphokine, e.g., PIXY123.
- the transgene encodes a graft-supporting protein, e.g., a recipient or donor cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ -
- a graft-supporting protein e.g., a recipient or donor cytokine
- donor tissue e.g., IL-10, IL-4, IL-2, or TGF- ⁇ -
- the transgene inhibits the expression or action of a gene product which is graft-antagonistic, e.g., by decreasing the expression of the gene product.
- the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- a recipient-derived graft-antagonistic protein e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes a dominant negative mutation in a gene product which is graft-antagonistic, e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- graft-antagonistic e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- the transgene includes a nucleic acid encoding a human peptide, e.g., a hematopoietic peptide, operably linked to: a promoter other than the one it naturally occurs with; a swine promoter, e.g., a swine hematopoietic gene promoter; a viral promoter; or an inducible or developmental ly regulated promoter.
- the genetically engineered swine cell is: a swine hematopoietic stem cell, e.g., a cord blood hematopoietic stem cell, a bone marrow hematopoietic stem cell, or a fetal or neonatal liver or spleen hematopoietic stem cell; derived from differentiated blood cells, e.g. a myeloid cell, such as a megakaryocytes, monocytes, granulocytes, or an eosinophils; an erythroid cell, such as a red blood cells, e.g.
- a myeloid cell such as a megakaryocytes, monocytes, granulocytes, or an eosinophils
- an erythroid cell such as a red blood cells, e.g.
- a lymphoid cell such as B lymphocytes and T lymphocytes; derived from a pluripotent hematopoietic stem cell, e.g. a hematopoietic precursor, e.g. a burst-forming units-erythroid (BFU-E), a colony forming unit-erythroid (CFU-E), a colony forming unit-megakaryocyte (CFU-Meg), a colony forming unit-granulocyte-monocyte (CFU- GM), a colony forming unit-eosinophil (CFU-Eo), or a colony forming unit-granulocyte- erythrocyte-megakaryocyte-monocyte (CFU-GEMM); a swine cell other than a hematopoietic stem cell, or other blood cell; a swine thymic cell, e.g., a swine thymic stromal cell; a bone m
- the transgenic cell is: isolated or derived from cultured cells, e.g., a primary culture, e.g., a primary cell culture of hematopoietic stem cells; isolated or derived from a transgenic animal.
- a primary culture e.g., a primary cell culture of hematopoietic stem cells
- the transgenic swine cell is hemizygous for the transgene; the transgenic swine cell is heterozygous for the transgene; the transgenic swine cell is homozygous for the transgene (heterozygous transgenic swine can be bred to produce offspring that are homozygous for the transgene); the transgenic swine cell includes two or more transgenes.
- the invention features, a transgene including a swine promoter, e.g., a swine hematopoietic gene promoter, or a heterologous inducible or developmentally regulated promoter, operably linked to either: a nucleic acid encoding a graft-supporting protein, e.g., a primate or a human graft-supporting protein, e.g., a primate, e.g., a human, hematopoietic peptide; or a nucleic acid which encodes or, a transgene which inhibits the expression or action of a gene product which is graft- antagonistic.
- a swine promoter e.g., a swine hematopoietic gene promoter, or a heterologous inducible or developmentally regulated promoter
- a nucleic acid encoding a graft-supporting protein, e.g., a
- transgenes which inhibit the expression or action of a gene product which is graft-antagonistic include: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protein; a transgene which encodes an inhibitor of a donor- or recipient-derived graft-antagonistic protein, e.g., a competitive inhibitor or a protease or other molecule which specifically inhibits the activity of the graft antagonistic protein; and a transgene which encodes a dominant negative mutation in a gene product which is graft-antagonistic, e.g., a donor cell receptor for a host cytokine.
- the transgene encoding a graft-supporting protein is: a recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
- the transgene is one which inhibits the expression or action of a donor MHC gene product (which gene product is graft-antagonistic).
- the nucleic acid encoding a graft-supporting protein and/or the nucleic acid which inhibits the expression or action of a gene product which is graft-antagonistic is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
- the nucleic acid encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- a human growth factor or cytokine receptor e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL- 11, IL-2, Epo, and uteroferrin.
- the nucleic acid encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- a human adhesion molecule e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- human adhesion molecules include VLA-4, c-kit, LFA-1, CD1 la, Mac-1 , CR3, CD1 lb, pl50, p95, CD1 lc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
- the nucleic acid encodes a recipient or donor protein, e.g., a cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- a recipient or donor protein e.g., a cytokine
- a cytokine directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine)
- an immune response mounted by donor cells against the recipient e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- the nucleic acid encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- a graft-supporting protein e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- the transgene can be one which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes a dominant negative mutation in a gene product which is graft-antagonistic, e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- the transgene encodes a chimeric molecule, e.g., a chimeric lymphokine, e.g., PIXY 123.
- the transgene further includes transcriptional regulatory sequences, e.g. a tissue-specific promoter, e.g., a hematopoietic specific promoter, operably linked to the recombinant human gene sequence.
- transcriptional regulatory sequences e.g. a tissue-specific promoter, e.g., a hematopoietic specific promoter, operably linked to the recombinant human gene sequence.
- the invention features, a transgene which inhibits the action of a gene product which is graft-antagonistic, e.g., by decreasing the expression of the gene product.
- the transgene is a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor graft-antagonistic protein (e.g., the insertion of a transgene results in a knockout for a donor-derived receptor for a recipient-derived protein which is a graft antagonistic protein).
- the transgene is one which inhibits the expression or action of a donor MHC gene product (which gene product is graft-antagonistic).
- the transgene which inhibits the action of a gene product which is graft-antagonistic is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
- the transgene inhibits the expression or action of a gene product which is graft-antagonistic, e.g., by decreasing the expression of the gene product.
- the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor , or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the invention features, a transgenic swine having cells which include one or both of: a transgene encoding a graft-supporting protein, e.g., a primate or a human graft-supporting protein, e.g., a primate, e.g., a human, protein, preferably a hematopoietic peptide; or, a transgene which inhibits the expression or action of a gene product which is graft-antagonistic.
- a transgene encoding a graft-supporting protein, e.g., a primate or a human graft-supporting protein, e.g., a primate, e.g., a human, protein, preferably a hematopoietic peptide
- a transgene which inhibits the expression or action of a gene product which is graft-antagonistic.
- transgenes which inhibit the expression or action of a gene product which is graft-antagonistic include: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor graft-antagonistic protein (e.g., the introduction of
- the transgene encoding a graft-supporting protein is: a recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
- the transgene is one which inhibits the expression or action of a donor MHC gene product (which gene product is graft-antagonistic).
- the transgene encoding a graft-supporting protein and/or the transgene which inhibits the expression or action of a gene product which is graft-antagonistic is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
- the transgene encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- a human growth factor or cytokine receptor e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11 , IL-2, Epo, and uteroferrin.
- the transgene encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- human adhesion molecules include VLA-4, c-kit, LFA-1, CDl la, Mac-1, CR3, CDl lb, pl50, p95, CDl lc, CD49a, LPAM-1 , CD49d, CD44, CD38, and CD34.
- the transgene encodes a recipient or donor protein, e.g., a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- a recipient or donor protein e.g., a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine)
- an immune response mounted by donor cells against the recipient e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- the transgene encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2, or TGF-
- a graft-supporting protein e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2, or TGF-
- the transgene encodes a chimeric molecule, e.g., a chimeric lymphokine, e.g., PIXY123.
- the transgene inhibits the expression or action of a gene product which is graft-antagonistic, e.g., by decreasing the expression of the gene product.
- the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- a donor graft-antagonistic protein e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor
- a donor receptor for a host cytokine e.g., a host cytokine
- the transgene can be one which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- a recipient-derived graft-antagonistic protein e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes a dominant negative mutation in a gene product which is graft-antagonistic, e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- graft-antagonistic e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- the transgene includes a nucleic acid encoding a graft-supporting protein, e.g., a primate or human graft-supporting protein, e.g., a primate or human hematopoietic peptide or a transgene which inhibits the action of a gene product which is a graft-antagonistic, e.g., a gene product which is the donor receptor for a recipient protein which is a graft antagonistic protein operably linked to: a promoter other than the one it naturally occurs with; a swine promoter, e.g., a swine hematopoietic gene promoter; a viral promoter; an inducible promoter; or a developmental ly regulated promoter.
- a graft-supporting protein e.g., a primate or human graft-supporting protein, e.g., a primate or human hematopoietic peptide
- the transgenic swine cell is hemizygous for the transgene; the transgenic swine cell is hemizygous for the transgene; the transgenic swine is heterozygous for the transgene; the transgenic swine is homozygous for the transgene (heterozygous transgenic swine can be bred to produce offspring that are homozygous for the transgene); the transgenic swine includes two or more transgenes.
- Transgenic swine (or swine cells) of the invention can be used as a source for
- Transgenic swine or swine cells of the invention can also be used to measure and/or identify agonists or antagonists of a human growth factor, cytokine, or other molecule involved in hematopoietic regulation.
- Transgenic swine cells of the invention derived, e.g., from retrovirally transformed cultured cells, or from a transgenic animal, can be used to induce immunologic tolerance in a recipient animal to a graft from a donor swine.
- cells of the invention can be combined with methods of inducing tolerance described in USSN 08/126,122, filed September 23, 1993.
- the invention provides for the implantation of swine donor cells which have been engineered to increase desirable interactions between the donor cells and molecules and cells of a recipient, e.g., to promote the engraftment or function of the donor stem cells in the recipient environment.
- stem cells are implanted to induce tolerance to (or otherwise promote acceptance of) donor graft cells.
- the invention also provides for the implantation of donor cells which have been engineered to minimize unwanted interactions between the donor cells and molecules and cells of the recipient which, e.g., promote the rejection of donor graft cells or which inhibit the function of the donor graft cells.
- the invention provides for transplantation methods wherein either, or both, the stem cells and the graft cells are so engineered.
- the invention includes methods in which the donor stem cells and the donor graft differ in that one has an engineered alteration which the other lacks. E.g., in some applications the donor stem cells will have a transgene not present in the graft cells and the donor graft cells will have a transgene not present in the donor stem cells.
- the invention features, a method of inducing tolerance in a recipient mammal, e.g., a primate, e.g., a human, to graft cells (or otherwise promoting the acceptance by a recipient mammal of graft cells) from a donor mammal, e.g., a miniature swine, including: introducing into the recipient, donor hematopoietic stem cells, and introducing into the recipient, donor graft cells, provided that at least one of the following conditions is met: (1) the donor stem cells have been genetically engineered to promote a desirable interaction between the donor stem cells and cells or molecules of the recipient; (2) the donor stem cells have been genetically engineered to inhibit an unwanted interaction between cells or molecules of the recipient and the donor stem cells; (3) the donor graft cells have been genetically engineered to promote a desirable interaction between the donor graft (and/or stem) cells and cells or molecules of the recipient; or (4) the donor graft cells have been genetically engineered to inhibit
- the genetically engineered alteration in (1) or (2) is the insertion of an MHC gene, e.g., a swine MHC, a donor MHC gene, a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene, then one or both of, donor cells which are genetically altered by other than the insertion of an MHC gene, or, genetically altered cells other than hematopoietic stem cells, are also introduced into the recipient.
- an MHC gene e.g., a swine MHC, a donor MHC gene, a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene
- a cell having a transgene which is an MHC gene e.g., a swine MHC, a donor MHC gene, a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene
- a second cell which has a transgene other than an MHC gene, e.g., a swine MHC, a donor MHC gene, or a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene, is also administered to the recipient.
- genetically engineered refers to the inclusion of a transgene; the donor stem cells have a genetically engineered alteration, e.g., a transgene, which the donor graft cells lack; the donor graft cells have a genetically engineered alteration, e.g., a transgene, which the donor stem cells lack; the donor stem cells have a first genetically engineered alteration, e.g., a first transgene, which increases an interaction between the stem cells and molecules or cells of the recipient and the donor graft cells have a second genetically engineered alteration, e.g., a second transgene, which decreases an interaction between the donor graft cells and molecules or cells of the recipient.
- the donor stem cells include a transgene which encodes a graft-supporting protein, e.g., a hematopoietic peptide and the donor graft cells do not include the transgene of the donor stem cells.
- the donor graft cells include a transgene which inhibits the action of a gene product which is a graft-antagonistic, e.g., a gene product which is the receptor for a recipient protein which is a graft antagonistic protein and the donor stem cells do not include the transgene.
- the donor stem cells include a transgene which encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- a graft-supporting protein e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
- the donor stem cells include a transgene encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- a human adhesion molecule e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- human adhesion molecules include VLA-4, c-kit, LFA-1, CDl la, Mac-1, CR3, CDl lb, pi 50, p95, CDl lc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
- the donor stem cells, the donor graft cells, or both include a transgene which encodes a recipient or donor protein, a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- a transgene which encodes a recipient or donor protein
- a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, IL-2, or TGF- ⁇ .
- the donor stem cells, the donor graft cells, or both include a transgene which encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2 or TGF- ⁇ .
- a transgene which encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, IL-2 or TGF- ⁇ .
- the donor stem cells, the donor graft cells, or both include a transgene which inhibits the expression or action of a gene product which is graft-antagonistic.
- transgenes which inhibit the expression or action of a gene product which is graft-antagonistic include: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g.
- the transgene inhibits the expression or action of a gene product which is graft-antagonistic, e.g., by decreasing the expression of the gene product.
- the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- a recipient-derived graft-antagonistic protein e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes a dominant negative mutation in a gene product which is graft-antagonistic, e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- graft-antagonistic e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- the donor stem cells, the donor graft, or both include a transgene which encodes a chimeric molecule, e.g., a chimeric lymphokine, e.g., PIXY 123.
- the donor mammal and the recipient mammal are of different species, e.g., they are discordant primates, e.g., a human recipient and a nonhuman donor; the recipient is a primate, e.g., a human; the donor is a swine e.g., a miniature swine.
- the donor mammal and the recipient mammal are of the same species, e.g., both are primates, e.g., humans; the recipient and donor are of the same species and the donor stem cells include a transgene, introduced e.g., by retroviral transformation of cultured donor stem cells, and the cells of the donor graft do not include a transgene.
- the donor of the stem cells and the donor of the graft are both miniature swine and: the stem cell donor is from a strain which has been genetically engineered to express a graft supporting protein; the graft donor is a strain has been genetically engineered to have decreased expression for a protein which is antagonistic to graft acceptance or function; the graft donor and the stem cell donor are inbred; the graft donor and the stem cell donor are MHC identical.
- the transgene includes a nucleic acid operably linked to; a promoter other than the one it naturally occurs with; a swine promoter, e.g., a swine hematopoietic gene promoter; a viral promoter; or an inducible or developmental ly regulated promoter.
- the genetically engineered swine stem cell is: isolated or derived from cultured cells, e.g., a primary culture, e.g., a primary culture of hematopoietic stem cells; isolated or derived from a transgenic animal; isolated or derived from cord blood; obtained from an individual animal from which the graft cells are obtained; obtained from an individual animal which is syngeneic with the individual animal from which the graft cells are obtained; obtained from an individual animal which is MHC matched, and preferably identical, with the individual animal from which the graft cells are obtained; a cord blood, a bone marrow hematopoietic stem cell, or a fetal or neonatal liver or spleen cell hematopoietic stem cell.
- a primary culture e.g., a primary culture of hematopoietic stem cells
- isolated or derived from a transgenic animal isolated or derived from cord blood
- obtained from an individual animal from which the graft cells are obtained obtained
- the donor graft cells are other than a hematopoietic stem cells, or other blood cells; the donor graft cells are swine thymic cells, e.g., swine thymic stromal cells; the donor graft cells are bone marrow stromal cells; the donor graft cells are swine liver cells; the donor graft cells are swine kidney cells; the donor graft cells are swine epithelial cells; the donor graft cells are swine muscle cells, e.g., heart cells; the donor graft cells are swine neuronal cells; the graft cells include an organ, e.g., a kidney, a liver, or a heart; the donor graft cells include dendritic cells or their precursors.
- the donor graft cells include dendritic cells or their precursors.
- stromal tissue preferably hematopoietic stromal tissue, e.g., fetal liver or thymus.
- the stromal tissue is introduced simultaneously with, or prior to, the hematopoietic stem cells.
- the stromal tissue has been: genetically engineered to promote a desirable interaction between the stromal cells and cells or molecules of the recipient; genetically engineered to inhibit an unwanted interaction between cells or molecules of the recipient and the stromal cells.
- transgenic stem cells are administered to the recipient prior to or simultaneous with transplantation of graft cells; the hematopoietic stem cells home to a site in the recipient; the stem cells are administered by intravenous injection.
- Other preferred embodiments include (preferably prior to administering the stem cells): inactivating the natural killer cells of the recipient mammal, e.g., by introducing into the recipient mammal an antibody capable of binding to natural killer cells of the recipient; inactivating the T cells of the recipient mammal, e.g., by introducing into the recipient an antibody capable of binding to T cells of the recipient.
- Other preferred embodiments include: the step of creating hematopoietic space, e.g., by one or more of, irradiating the recipient with low dose, e.g., between about 100 and 400 rads, whole body irradiation, administering a myleosuppressive drug to the recipient, or administering anti-class I antibodies to the recipient, to deplete or partially deplete the bone marrow of the recipient; the method includes the a step which creates hematopoietic space and the step is performed prior to introducing the transgenic cells into the recipient.
- thymic T cells include inactivating thymic T cells by one or more of: (preferably prior to hematopoietic stem cell transplantation) irradiating the recipient mammal with, e.g., about 700 rads of thymic irradiation; administering one, or preferably two or more, doses of an anti-T cell antibody; or administering to the recipient a short course of an immunosuppressant as described in USSN 08/220,371, filed March 29, 1994.
- Other preferred embodiments include: the step of depleting or otherwise inactivating natural antibodies in the blood of the recipient mammal, e.g., by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a pig or administering a drug, e.g., deoxyspergualin (DSG) which inactivates or depletes natural antibodies; the method includes a step which depletes or otherwise inactivates natural antibodies in the blood of the recipient and the step is performed prior to hematopoietic stem cell transplantation.
- a drug e.g., deoxyspergualin
- Transgenic swine cells of the invention derived, e.g., from retrovirally transformed cultured cells, or from a transgenic animal, can be used in any method calling for the engraftment of swine hematopoietic cells in a xenogeneic environment.
- cells of the invention can be combined with: methods which induce tolerance or otherwise promote the acceptance of a graft by administration of a short course of cyclosporine or similar agents, e.g., the methods described in USSN 08/220,371, filed March 29, 1994; methods which use the implantation of a xenogeneic thymic graft to induce tolerance, e.g., the methods described in USSN 08/163, 912 filed on December 7, 1993; methods of increasing the level of the activity of a tolerance promoting or GVHD inhibiting cytokine or decreasing the level of activity of an a tolerance inhibiting or GVHD promoting cytokine, e.g., the methods described in USSN 08/114,072, filed August 30, 1993; methods of using cord blood cells to induce tolerance, e.g., the methods described in USSN 08/150,739, filed November 10, 1993; the methods of USSN 08/126,122, filed September 23, 1993; and the methods for inducing tolerance disclosed in Sykes and Sachs, PCT
- the invention features, a method of promoting the engraftment and or repopulation of the bone marrow of a xenogeneic recipient, e.g., a primate, e.g., a human, by donor swine hematopoietic stem cells and thereby inducing mixed chimerism in the xenogeneic recipient.
- a xenogeneic recipient e.g., a primate, e.g., a human
- the method includes: providing a genetically engineered swine cell (which may or may not be a hematopoietic stem cell) which has been genetically engineered to promote a desirable interaction between donor stem cells and cells or molecules of the recipient or which have been genetically engineered to inhibit an unwanted interaction between the recipient and donor stem cells; and, implanting the genetically engineered swine cell in the recipient, provided that, if the genetically engineered swine cell is not a swine hematopoietic stem cell, a swine hematopoietic stem cell is also implanted in the recipient.
- the genetically engineered alteration is other than the insertion of an MHC gene, e.g., a swine MHC, a donor MHC gene, a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene.
- genetically engineered refers to the inclusion of a transgene.
- the genetically engineered swine cells include a transgene which encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- a graft-supporting protein e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of hematopoiesis.
- growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-1 1, IL-2, Epo, and uteroferrin.
- the genetically engineered swine cells include a transgene encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- a human adhesion molecule e.g., an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- human adhesion molecules include VLA-4, c-kit, LFA-1, CDl la, Mac-1, CR3, CDl lb, pl50, p95, CDl lc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
- the genetically engineered swine cells include a transgene which inhibits the expression or action of a gene product which is graft- antagonistic.
- transgenes which inhibit the expression or action of a gene product which is graft-antagonistic include: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of
- the genetically engineered swine cells include a transgene which inhibits the action of, e.g., by decreasing the expression of, a gene product which is a graft-antagonistic.
- the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by homologous recombination, results in an endogenous gene which is misexpressed or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an endogenous genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-antagonistic protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- a recipient-derived graft-antagonistic protein e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
- the transgene can be one which encodes a dominant negative mutation in a gene product which is graft-antagonistic, e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- graft-antagonistic e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
- the genetically engineered swine cells include a transgene which encodes a recipient or donor protein, a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, or TGF- ⁇ .
- a transgene which encodes a recipient or donor protein
- a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by donor cells against the recipient, e.g., IL-10, IL-4, or TGF- ⁇ .
- the genetically engineered swine cells include a transgene which encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, or TGF- ⁇ .
- a transgene which encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-10, IL-4, or TGF- ⁇ .
- the genetically engineered swine cells include a transgene which encodes a chimeric molecule, e.g., a chimeric lymphokine, e.g., PIXY123.
- the genetically engineered swine cell is isolated or derived from a cultured cell, e.g., a primary culture, e.g., a primary culture of hematopoietic stem cells; the genetically engineered swine cell is isolated or derived from a transgenic animal; if the genetically engineered swine cell is not a stem cell, then the genetically engineered swine cell and the stem cell which is also administered are obtained from the same animal, from animals which are (except for the alteration of the invention) syngeneic, or from animals which are MHC matched, and preferably MHC identical; the genetically engineered swine cell is a cord blood cell, a bone marrow hematopoietic stem cells.
- the genetically engineered swine cells are other than hematopoietic stem cells, or other blood cells; the genetically engineered swine cells are thymic cells, e.g., swine thymic stromal cells; the genetically engineered swine cells are bone marrow stromal cells; the genetically engineered swine cells are swine liver cells; the genetically engineered swine cells are swine kidney cells; the genetically engineered swine cells are swine epithelial cells; the genetically engineered swine cells are swine muscle cells, e.g., heart cells; the genetically engineered swine cells are swine neuronal cells; the genetically engineered swine cells are swine dentritic cells or their precursors.
- the genetically engineered swine cells are thymic cells, e.g., swine thymic stromal cells
- Other preferred embodiments include (preferably prior to administering the stem cells): inactivating the natural killer cells of the recipient mammal, e.g., by introducing into the recipient mammal an antibody capable of binding to natural killer cells of the recipient; inactivating the T cells of the recipient mammal, e.g., by introducing into the recipient an antibody capable of binding to T cells of the recipient.
- Other preferred embodiments include: the step of creating hematopoietic space, e.g., by one or more of, irradiating the recipient with low dose, e.g., between about 100 and 400 rads, whole body irradiation, administering a myleosuppressive drug to the recipient, or administering anti-class I antibodies to the recipient, to deplete or partially deplete the bone marrow of the recipient; the method includes the a step which creates hematopoietic space and the step is performed prior to introducing the transgenic cells into the recipient.
- thymic T cells include inactivating thymic T cells by one or more of: (preferably prior to hematopoietic stem cell transplantation) irradiating the recipient mammal with, e.g., about 700 rads of thymic irradiation; administering one, or preferably two or more, doses of an anti-T cell antibody; or administering to the recipient a short course of an immunosuppressant as described in USSN 08/220,371, filed March 29, 1994.
- Other preferred embodiments include: the step of depleting or otherwise inactivating natural antibodies in the blood of the recipient mammal, e.g., by hemoperfusing an organ, e.g., a liver or a kidney, obtained from a pig or administering a drug, e.g., deoxyspergualin (DSG) which inactivates or depletes natural antibodies; the method includes a step which depletes or otherwise inactivates natural antibodies in the blood of the recipient and the step is performed prior to hematopoietic stem cell transplantation.
- a drug e.g., deoxyspergualin
- the method includes the step of introducing into the recipient a graft obtained from the donor which is obtained from a different organ than the hematopoietic stem cells, e.g., a liver or a kidney.
- Genetically engineered swine cells of the invention can be made by methods known to those skilled in the art, e.g., by retroviral transduction of swine cells.
- Methods for producing transgenic swine of the invention use standard transgenic technology. These methods include, e.g., the infection of the zygote or organism by viruses including retroviruses; the infection of a tissue with viruses and then reintroducing the tissue into an animal; and the introduction of a recombinant nucleic acid molecule into an embryonic stem cell of a mammal followed by appropriate manipulation of the embryonic stem cell to produce a transgenic animal.
- the invention features a transgenic swine, whose germ cells and somatic cells contain a transgene including a DNA sequence encoding a hematopoietic peptide and a tissue-specific promoter operably linked to the DNA sequence, wherein the tissue-specific promoter effects expression of the hematopoietic peptide in bone marrow cells of the swine, the transgene being introduced into embryonal cells of the animal, or an ancestor of the animal.
- Yet another aspect of the invention features a method for identifying or testing an agent, e.g., a therapeutic agent, e.g., an agent useful in treating a hematopoietic disorder, by evaluating the agent's effect on transgenic swine cells of the invention.
- an agent is administered to a transgenic swine, and the state of a hematopoietic tissue, an aspect of metabolism, or an aspect of gene expression, evaluated and compared with that of a control standard, e.g., that of a control transgenic animal.
- the present method may be employed, for example, to determine the in vivo efficacy of agonists or antagonists of human hematopoietic growth factors. Analogous experiments can be performed with cultured cells.
- xenogeneic donor hematopoietic stem cells when engrafted in xenogeneic recipients, can induce a state of donor-specific tolerance to transplanted donor organs. Even low levels of hematopoietic chimerism can be sufficient to induce this tolerant state. However, the loss of chimerism (which often occurs) is associated with a concomitant loss of tolerance.
- the animals, cells, transgenes, and methods of the invention can be used to promote the formation and maintenance of chimerism.
- transgenes, transgenic cells, transgenic animals, and methods of the invention are also useful in drug testing protocols, e.g., in protocols for identifying agents which interact with human receptor or adhesion molecules, e.g., for identifying agents which act as agonists or antagonists of human growth factors or adhesion molecules.
- the transgenes, transgenic cells, transgenic animals and methods of the invention are also useful for determining the species specificity of an interaction between a human receptor or adhesion molecule and a swine ligand.
- Fig. 1 is a diagram of the GS4.5 retroviral construct.
- Fig. 2 is a diagram of the GS4.5 proviral genome and the expected transcripts.
- Figs. 3a and 3b are representations of flow cytometry profile of transduced cells.
- Fig. 4 is a diagram of the transduction assay.
- Embodiments of the invention relate to genetically engineered swine cells, e.g., to genetically engineered hematopoietic stem cells, which express recombinant peptides, e.g., human peptides.
- the peptides enhance any of: the survival, engraftment, proliferation, or function of swine cells implanted in a xenogeneic host.
- the survival, engraftment, proliferation, or function of stem cells, or the development of the stem cells, into differentiated cell types of the cells, in the presence of a human hematopoietic environment, such as found in human hematopoietic tissues, e.g., bone marrow, is promoted.
- the engineered cells can express, e.g., a human growth factor receptor, e.g., a human growth factor involved in the control of hematopoiesis.
- human growth factor receptors include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
- the engineered cells express a human adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- human adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.
- examples of such molecules include VLA-4, c-kit, LFA-1, CDl la, Mac-1, CR3, CDl lb, pl50, p95, CDl lc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
- xenogeneic hematopoietic cells can be at a competitive disadvantage for reconstitution of a xenogeneic host, especially when transplanted as a part of a non- myleoablative regimen. That is, when stem cells of the host are available, the host cells will generally have a competitive advantage in reconstitution of the host. This competitive advantage can be a major factor preventing reconstitution by engrafted xenogeneic hematopoietic stem cells.
- Several factors may be responsible for the competitive advantage enjoyed by autologous bone marrow over engrafted xenogeneic stem cells. The advantage appears to derive in part, from an inability of the xenogeneic cells to adequately engage growth factors and extracellular matrix (ECM) components of the host.
- ECM extracellular matrix
- both extracellular matrix components and growth factors play important roles in the regulation of hematopoiesis and the maintenance of both stem and differentiated hematopoietic cells, and therefore are of consequence to the survival of xenogeneic cells.
- Stem cell maintenance for example, require growth factor binding as well as close range interactions with surrounding cells for engraftment, e.g. stromal cells.
- both ECM interactions and growth factor binding by hematopoietic cells can be, at least partially, species dependent, such that in xenogeneic settings, the grafted marrow is at a competitive disadvantage relative to autologous marrow in at least one of mitogenic stimulation or engraftment.
- the species specificity of adhesion molecule interactions are thought to be important in hematopoiesis.
- the failure of such adhesion molecules to interact with ligands from the host species may be a major impediment to homing and reconstitution by xenogeneic stem cells.
- a number of growth factors e.g. hematopoietic growth factors, are known to show varying degrees of species of specificity in their receptor interactions.
- G-CSF displays significant, though not absolute, species specificity.
- IL-3 for example, has a very marked species specificity.
- the human c-kit receptor (hereinafter "c-kit"), the ligand for SCF, is engineered into swine stem cells.
- c-kit the human c-kit receptor
- the human c-kit bearing stem cells can interact effectively with human SCF bound to stromal cells, and because human SCF can act as growth factor for this recombinant swine stem cells, some of the competitive advantage enjoyed by human marrow would be lost to the engrafted swine stem cells
- the use of c-kit humanized swine cells can facilitate improved reconstitution of a human subject by swine stem cells.
- the subject "humanized" swine cells can be used in xenografting protocols.
- the humanized cells can be used to improve engraftment and/or survival of swine hematopoietic stem cells, and thereby promote tolerance, in humans subjects.
- Preferred embodiments of the present invention include a method of providing a growth selective advantage to a transgenic cell, relative to the corresponding wild-type cell, when used as a source of xenogeneic graft tissue, by providing a swine cell which expresses a human hematopoietic peptide, e.g., by producing a transgenic mammal having at least 1 cell containing and expressing a recombinant nucleic acid molecule of the present invention.
- the recombinant nucleic acid molecule containing transgenic mammal is maintained for a time period sufficient for the hematopoietic modulator gene present in the recombinant nucleic acid molecule to be expressed in the cell and thereby provide a selective advantage to the transgenic cell, relative to the corresponding wild-type cell, when transplanted into another species.
- the recombinant swine cells particularly transgenic swine bearing such cells, are useful for assaying the efficacy of recombinant human hematopoietic factors.
- a graft-supporting protein refers to a protein which has one or more of the following properties: when expressed in a swine cell, it prolongs or otherwise promotes the acceptance of that cell in a xenogeneic donor; when expressed in a swine cell, it prolongs or otherwise promotes the acceptance of another swine cell in a xenogeneic donor; when expressed in a swine cell, it increases or otherwise promotes the function of that swine cell in a xenogeneic donor; when expressed in a swine cell, it increases or otherwise promotes the function of another swine cell in a xenogeneic donor.
- the graft-supporting protein can be expressed either, or both, prior to, or after, implantation of the cell or tissue it affects is implanted in the xenogeneic host.
- the graft- supporting protein can exert its action on a swine cell or tissue either or both, prior to or after the affected cell or tissue is implanted in a xenogeneic recipient.
- the graft- supporting protein can be expressed in a cultured cells, and then, graft-supporting protein expressing cultured cells implanted (alone or with other swine tissue) in a donor; the graft-supporting protein can be expressed in a transgenic swine, and graft-supporting protein expressing cells from the transgenic swine implanted (alone or with other swine tissue) in a donor.
- an affected cell or tissue is a cell or tissue upon which the graft- supporting protein has a direct or indirect (through its action on another cell) effect; the affected cell or tissue can be the cell or tissue which expresses the graft-supporting protein, or a cell which does not express the graft-supporting protein, e.g., a cell or tissue implanted together with a graft-supporting protein expressing cell.
- graft- supporting proteins include: recipient HLA molecules; recipient growth factor receptors; recipient adhesion molecules; and recipient or donor proteins related to the function of the graft.
- Graft-supporting proteins include hematopoietic proteins.
- a graft-antagonistic protein is a protein the expression of which, by the graft tissue or by the recipient, promotes an immune response directed against donor tissue or against the recipient, or is otherwise antagonistic to the function of the stem cells or graft or is otherwise antagonistic to the acceptance of the donor stem cells or the graft by the recipient.
- graft antagonistic proteins are donor cell surface receptors for host proteins which mediate an immune response against the donor cell, e.g., the donor cell B7, CD27, or LFA-3 receptors, or a donor receptor for a host cytokine.
- transgene means a nucleic acid sequence (encoding, e.g., one or more hematopoietic peptides), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic pig or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
- a transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of the selected nucleic acid, all operably linked to the selected nucleic acid, and may include an enhancer sequence.
- the term "transgenic cell” refers to a cell containing a transgene.
- a "transgenic animal” is any animal in which one or more, and preferably essentially all, of the cells of the animal includes a transgene. The transgene is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
- genetic manipulation does not include classical cross ⁇ breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule.
- This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.
- the transgene causes cells to express a recombinant peptide, (e.g., a recombinant hematopoietic peptide, e.g., a human growth factor or cytokine receptor involved in regulation of hematopoiesis, such as receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL- 11 , IL-2, Epo, or uteroferrin, or a human adhesion molecule involved in engraftment and or maintenance of hematopoietic cells, such as VLA-4, c-kit, LFA-1, CDl la, Mac-1, CR3, CDl lb, pl50, p95, CDl lc, CD49a, LPAM-1, CD49d, CD44, CD38, or CD34), in cells that do not express such hematopoietic peptides in a wild-type, non-transgenic animal.
- Transgenic swine which include one or more transgenes encoding one or more human hematopoietic peptides are within the scope of this invention.
- a double or triple transgenic animal which includes two or three transgenes can be produced.
- germ cell line transgenic animal refers to a transgenic animal in which the transgene genetic information exists in the germ line, thereby conferring the ability to transfer the information to offspring. If such offspring in fact possess some or all of that information then they, too, are transgenic animals.
- hematopoietic gene is used herein to mean any gene whose gene product, preferably a human gene product, which when expressed by a swine hematopoietic cells, is capable of enhancing the ability of a swine hematopoietic stem cell to competitively reconstitute a primate, e.g., a human host.
- the human-gene product can enhance the proliferative ability of recombinant swine cells in human subjects; increase the ability of swine cells to bind to extracellular matrix components; or enhance the functional activity of swine marrow cells.
- the human hematopoietic gene encodes: a cell surface protein; a human hematopoietic growth factor receptor, such as receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL- 11, IL-2, Epo; or uteroferrin, or a human adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells, such as VLA-4, c-kit, LFA-1, CDl la, Mac-1, CR3, CDl lb, pl50, p95, CDl lc, CD49a, LPAM-1, CD49d, CD44, CD38, or CD34.
- a human hematopoietic growth factor receptor such as receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL- 11, IL-2, Epo; or uteroferrin
- human hematopoietic proteins or peptides include human hematopoietic growth factor receptors and human hematopoietic adhesion molecules.
- growth factor or “hematopoietic growth factor” is used to describe biologically active molecules which can, for example, stimulate proliferation of the recombinant swine cell, enhance binding to ECM components and/or increase the functional activity of the cell.
- cytokine is used interchangeably with growth factor.
- hematopoietic growth factors examples include G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-1 1, IL-2, Epo, and uteroferrin.
- Growth factor receptors are protein(s) expressed by cells, typically on the extracellular surface, which facilitate binding of growth factors by the cell and which alone, or in conjunction with other cellular proteins, induce a biological response in the cell to the binding of the growth factor.
- Hematopoietic genes include those which encode a hybrid protein, e.g., a peptide which encodes both human and swine components, e.g., a hybrid receptor with a human extracellular domain and a swine intracellular or transmembrane domain.
- a hematopoietic protein is a protein encoded by a hematopoietic gene.
- operably linked means that selected DNA, e.g., encoding a hematopoietic peptide, is in proximity with a transcriptional regulatory sequence, e.g., tissue-specific promoter, to allow the regulatory sequence to regulate expression of the selected DNA.
- a transcriptional regulatory sequence e.g., tissue-specific promoter
- recombinant swine cells refers to cells derived from swine, preferably miniature swine, which have been used as recipients for a recombinant vector or other transfer nucleic acid, and include the progeny of the original cell which has been transfected or transformed.
- the recombinant swine cell is derived from a swine hematopoietic stem cell, e.g., a swine bone marrow hematopoietic cell, and has been genetically programmed to express a recombinant human peptide.
- Recombinant swine cells include cells in which transgenes or other nucleic acid vectors have been incorporated into the host cell's genome, as well as cells harboring expression vectors which remain autonomous from the host cell's genome.
- transfection means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
- Transformation refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, e.g. the transformed swine cell expresses human cell surface peptides.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- a vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
- Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked.
- Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors”.
- Transcriptional regulatory sequence is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked.
- transcription of the recombinant hematopoietic gene is under the control of a promoter sequence (or other transcriptional regulatory sequence) which naturally controls the expression of the recombinant gene in humans, or which naturally controls expression of the corresponding gene in swine cells.
- the transcription regulatory sequence causes hematopoietic-specific expression of the recombinant protein.
- the recombinant gene can be under the control of transcriptional regulatory sequences different from those sequences naturally controlling transcription of the recombinant protein. Transcription of the recombinant gene, for example, can be under the control of a synthetic promoter sequence.
- the promoter sequence controlling transcription of the recombinant gene is active (i.e., can promote gene expression) in bone marrow cells, especially hematopoietic cells.
- the promoter that controls transcription of the recombinant gene may be of viral origin; examples are promoters sometimes derived from bovine herpes virus (BHV), Moloney murine leukemia virus (MLV), SV40, Swine vesicular disease virus (SVDV), and cytomegalovirus (CMV).
- BHV bovine herpes virus
- MMV Moloney murine leukemia virus
- SV40 Moloney murine leukemia virus
- SVDV Swine vesicular disease virus
- CMV cytomegalovirus
- tissue-specific promoter means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in specific cells, e.g., hematopoietic cells.
- the tissue specific promoter directs expression predominantly, if not exclusively in hematopoietic cells.
- Particularly useful promoter sequences for directing expression of human hematopoietic genes include: promoter sequences naturally associated with the recombinant human gene; promoter sequences naturally associated with the homologous pig gene (i.e.
- promoters which are active primarily in hematopoietic cells, e.g. in lymphoid cells, in erythroid cells, or in myeloid cells; the immunoglobulin promoter described by Brinster et al. (1983) Nature 306:332-336 and Storb et al. (1984) Nature 310:238-231; the immunoglobulin promoter described by Ruscon et al. (1985) Nature 314:330-334 and Grosscheld et al. (1984) Cell 38:647-658; the globin promoter described by Townes et al. (1985) Mol. Cell. Biol.
- hematopoietic promoters are described herein or will be apparent to those skilled in the art, and may include regulatory sequences derived from such lymphoid genes as CDl, CD2, CD3- ⁇ , CD3- ⁇ , CD3- ⁇ , CD3- ⁇ , CD3- ⁇ , CD4, CD5, CD7, CD8, CD19, CD20, CD38, CD40, CD45, CD72, CD76, p56!ck, lL-2R ⁇ chain, Jl Id (heat stable antigen), fyn, NK1, NK2, Fc Rl ⁇ chain, IL-2R ⁇ -chain, ⁇ TCAR, ⁇ TCAR, ⁇ TCAR, Fc ⁇ RIII, RAG-1, RAG-2, Ig- ⁇ (B29), or IgM- ⁇ (MB-1) and genes associated with immunoglobulin isotypes Ig ⁇ ,
- promoters also may include additional DNA sequences that are necessary for expression, such as introns and enhancer sequences.
- the term also covers so-called “leaky” promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.
- Other regulatory elements e.g., locus control regions, e.g., DNase I hypersensitive sites, can be included.
- cell specific expression it is intended that the transcriptional regulatory elements direct expression of the recombinant protein in particular cell types, e.g., bone marrow cells.
- hematopoietic specific expression therefore refers to expression of a recombinant protein which is substantially restricted to hematopoietic cells.
- Graft refers to a body part, organ, tissue, or cells. Grafts may consist of organs such as liver, kidney, heart or lung; body parts such as bone or skeletal matrix; tissue such as skin, intestines, endocrine glands; or progenitor stem cells of various types.
- tissue means any biological material that is capable of being transplanted and includes organs (especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid), cornea, skin, blood vessels and other connective tissue, cells including blood and hematopoietic cells, Islets of Langerhans, brain cells and cells from endocrine and other organs and bodily fluids, all of which may be candidate for transplantation.
- organs especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid
- cornea especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid
- cornea especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid
- cornea especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid
- cornea especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid
- cells including blood and hematopoietic cells
- a discordant species combination refers to two species in which hyperacute rejection occurs when a graft is grafted from one to the other.
- the donor is of porcine origin and the recipient is human.
- Hematopoietic stem cell refers to a cell, e.g., a bone marrow cell, a fetal or neonatal liver or spleen cell, or a cord blood cell which is capable of developing into a mature myeloid and/or lymphoid cell.
- Progenitor cell refers to a cell which gives rise to an differentiated progeny. In contrast to a stem cell, a progenitor cell is not always self renewing and is relatively restricted in developmental potential.
- hematopoietic cells embraces differentiated blood cells, including: cells derived from a myeloid lineage, including megakaryocytes, monocytes, granulocytes, and eosinophils; cells derived from an erythroid lineage, such as red blood cells; and cells of a lymphoid lineage such as B lymphocytes and T lymphocytes.
- hematopoietic stem cells also referred to herein as “hematopoietic stem cells” or “colony-forming stem cells”
- hematopoietic cell also encompasses the various hematopoietic precursor cells from which these differentiated cells develop, such as BFU-E (burst-forming units-erythroid), CFU-E (colony forming unit-erythroid), CFU- Meg (colony forming unit-megakaryocyte), CFU-GM (colony forming unit-granulocyte- monocyte), CFU-Eo (colony forming unit-eosinophil), and CFU-GEMM (colony forming unit-granulocyte-erythrocyte-megakaryocyte-monocyte).
- BFU-E burst-forming units-erythroid
- CFU-E colony forming unit-erythroid
- CFU- Meg colony forming unit-megakaryocyte
- CFU-GM colony forming unit-granulocyte- monocyte
- CFU-Eo colony forming unit-eosinophil
- CFU-GEMM colony forming unit-granul
- MHC antigen refers to a protein product of one or more MHC genes; the term includes fragments or analogs of products of MHC genes which can evoke an immune response in a recipient organism.
- MHC antigens include the products (and fragments or analogs thereof) of the human MHC genes, i.e., the HLA genes.
- MHC antigens in swine e.g., miniature swine, include the products (and fragments and analogs thereof) of the SLA genes, e.g., the DRB gene.
- Miniature swine refers to wholly or partially inbred animal.
- the transgenic donor tissue may come from a cell culture or from a transgenic swine.
- the transgenic swine should express (or be capable of expressing) the recombinant human gene in at least the tissue to be transplanted.
- expression vectors containing the human hematopoietic gene can be constructed by operably linking an appropriate transcriptional regulatory sequence, e.g. a tissue-specific promoter, with a nucleic acid, e.g.
- tissue-specific promoter can be linked to more than one cDNA, each encoding a different human hematopoietic protein, or a human hematopoietic protein and some other foreign protein, e.g., another cell surface antigen.
- DNA can also include a "recombinant intervening sequence" which interrupts the transcribed but untranslated 5' region of the transgene.
- intervening sequences IVS are known in the art.
- sequences as used herein are "homologous recombinant intervening sequences" in that the 5' and 3' RNA splice signals in the IVS are those normally found in an IVS from an endogenous or heterologous gene.
- Recombinant intervening sequences may, however, also comprise a "hybrid intervening sequences”.
- hybrid intervening sequences comprise a 5' RNA splice signal and 3' RNA splice signal from intervening sequences from different sources.
- hybrid IVS comprise at least one "permissive RNA splice sequence".
- a permissive RNA splice signal is an RNA splice signal sequence, preferably a 3' RNA splice signal, from an intron contained within a repertoire of germ line DNA segments which undergo rearrangement during cell differentiation. Examples of such gene repertoires include the immunoglobulin super gene family, including the immunoglobulins and T-cell antigen receptors as well as the repertoire of the major histocompatibility complex (MHC) genes and others.
- MHC major histocompatibility complex
- permissive splice sequences are those obtained from the immunoglobulin repertoire, preferably of the IgG class, and more preferably those 3' splice signal sequences associated with the J-C segment rearrangement of the Ig heavy and light chain, most preferably the heavy chain.
- Hybrid intervening sequences containing permissive RNA splice signals are preferably used when the recombinant DNA corresponds to a cDNA sequence.
- transgenes can include relatively large amounts of 5' and 3' expression regulation sequences.
- the recombinant DNA is preferably derived from genomic clones which may be tens to hundreds of kilobases in length. Based on the present technology for cloning and manipulating DNA, the construction and microinjection of transgenes is practically limited to linearized DNA having a length not greater than about 1 OOkb.
- the transgenes of the invention especially those having a length greater than about 50kb, may be readily generated by introducing two or more overlapping fragments of the desired transgene into an embryonal target cell.
- the overlapping fragments undergo homologous recombination which results in integration of the fully reconstituted transgene in the genome of the target cell.
- it is preferred that such overlapping transgene fragments have 100% homology in those regions which overlap.
- lower sequence homology may be tolerated provided efficient homologous recombination occurs.
- the non-homology does exist between the homologous sequence portions, it is preferred that the non-homology not be spread throughout the homologous sequence portion but rather be located in discrete areas. Although as few as 14 base pairs at 100% homology are sufficient for homologous recombination in mammalian cells (Rubnitz et al. (1984) Mol Cell. Biol.
- longer homologous sequence portions are preferred, e.g. 500bp, more preferably l,000bp, next most preferably 2,000bp and most preferably greater than 2,000bp for each homologous sequence portion. It may also be desirable to use YAC's and MAC's for manipulation of recombinant nucleic acids of the invention.
- the recombinant hematopoietic protein can be a chimeric peptide having a portion encoded by a human hematopoietic gene, and a portion encoded by a swine hematopoietic gene.
- the chimeric protein comprises an extracellular domain of human origin, and an intracellular domain (and transmembrane domain) of swine origin.
- Such a chimeric protein can be useful in circumstances such as where the intracellular domain of the human molecule is less efficient than the swine counterpart at engaging intracellular signal transduction proteins of the swine cell. Techniques for making fusion genes are well known.
- PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments (e.g. between the human gene and the swine gene) which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, Eds. Ausubel et al. John Wiley & Sons: 1992).
- the recombinant swine cells are derived to express the human c-kit gene, or another member of the closely related tyrosine kinase receptor family to which it belongs, such as the colony-stimulating factor I receptor (c-fms), a platelet-derived growth factor receptor (PDGF-Ra and PDGF-RB), or a fetal liver kinase (FLK-1 or FLK-2) (see, for review, Andre et al. (1992) Oncogene 7:685-691).
- c-fms colony-stimulating factor I receptor
- PDGF-Ra and PDGF-RB platelet-derived growth factor receptor
- FLK-1 or FLK-2 fetal liver kinase
- FLK-2 (U.S. Patent No. 5,270,458; PCT Publication No. WO 93/10136; PCT Publication No. WO 93/00349; U.S. Patent No. 5,283,354) have been isolated, and as described below, can be used to generate the expression vectors, including transgenes, required to derive the subject swine cells. Moreover, the promoter sequences, and other transcriptional regulatory sequences, have been characterized for each receptor (Yasuda et al. (1993) Biochem Biophvs Res Commun 191 :893-901; Yamamoto et al.
- the recombinant swine cells are engineered to express the human Granulocyte-Macrophage Colony- Stimulating factor (GM-CSF) receptor.
- GM-CSF Granulocyte-Macrophage Colony- Stimulating factor
- the human GM-CSF receptor has been cloned (Sasaki et al. (1993) J Biol
- transgenic swine which express a first transgene can be crossed with a transgenic swine which expresses a second transgene to provide a transgenic animal which expresses both.
- transgenic swine which expresses only one transgene or the other of the alpha or beta chains, can be cross-bred with the appropriate transgenic mate to yield offspring which are chimeric for both chains.
- the alpha chain need be expressed as it may form active receptor complexes with the swine beta chain.
- the alpha chain provides most of the binding specificity to the receptor complex and is therefor more likely to influence species specific binding of GM-CSF than is the beta chain.
- human IL-3 receptors can be constituted in swine hematopoietic cells utilizing the cloned genes for each of the alpha and beta chain subunits (Sakamaki et al. ( ⁇ 99D EMBOJ 1 1 :3541-3549: and Kitamura et al. (1991) 611 661 165-1174) to derive appropriate expression vectors.
- a nucleotide sequence derived from the cloning of the human hematopoietic gene, encoding all or a selected portion of the human protein can be used to produce a recombinant form of the human protein in swine cells.
- Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting into swine cells can be carried out by standard procedures.
- the recombinant nucleic acid constructs described above may be inserted into any suitable plasmid, bacteriophage, or viral vector for amplification, and may thereby be propagated using methods known in the art, such as those described in Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold
- expression vectors compatible with eukaryotic cells preferably those compatible with vertebrate cells are used.
- Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources.
- the preferred swine expression vectors contain both prokaryotic sequences (to facilitate the propagation of the vector in bacteria), and one or more eukaryotic transcription units that are functional in swine cells.
- such vectors provide convenient restriction sites for insertion of the desired recombinant DNA molecule.
- the pcDNAI, pSV2, pSVK, pMSG, pSVL, pPVV-l/PML2d and pTDTl ATCC, No.
- derived vectors are examples of mammalian expression vectors suitable for transfection of swine cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells. Alternatively, derivatives of viruses such as the bovine papilloma virus (BPV- 1 ), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for expression of proteins in swine cells.
- BBV- 1 bovine papilloma virus
- pHEBo Epstein-Barr virus
- the various methods employed in the preparation of the plasmids and transformation of host cells are well known in the art. For other suitable expression systems for useful in the present invention, as well as general recombinant procedures, see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989
- the construct can be linearized and excess vector sequences will preferably be removed, for example, by cutting the recombinant nucleic acid molecule with one or more restriction endonucleases to produce a linear nucleic acid molecule containing as a minimum, the desired transcriptional regulatory sequences and a human hematopoietic gene.
- the nucleic acid molecule e.g. the transgene
- the nucleic acid molecule is from about 5,000 base pairs to about 100,000 base pairs in length.
- the human protein is more appropriate than its swine counterpart, can be determined using one of the assays described below, and its cDNA can then be determined by standard techniques. For example, according to the invention, one would link a promoter with cDNA encoding human c-kit to create a vector for expression of human c-kit in swine cells. The expression of this promoter-hematopoietic protein transgene can be verified, for example, by direct detection of human c-kit expression in appropriate tissue culture cells. Additionally, the ability of the human gene to potentially provide improved in vivo survival of the transgenic swine cells can be predicted in vitro by comparing the relative biologic activities of the human versus the endogenous protein in swine cells. Improved survival should be correlated with the ability of the recombinant cell to grow in semisolid media in response to a human growth factor.
- transgenic pigs may carry multiple copies of the transgene, with the transgene copies incorporated at different sites in the genome.
- the site of transgene incorporation into the genome can strongly influence transgene expression; therefore, one may correlate transgene expression with discrete transgene restriction fragment length polymorphism patterns.
- two transgenic swine each expressing a different hematopoietic protein, or one hematopoietic protein and some other foreign antigen, e.g. a human MHC peptide, on the same, or different, tissue cells, can be mated to produce an animal that expresses both transgene products. The same effect can be achieved by introducing two separate transgenes into the same embryonal cell.
- Exemplary in vitro assays useful for determining whether a particular human hematopoietic protein is suitable for use in methods of the invention include: (1) assays that measure binding of the ligand, e.g. growth factor of ECM component, to the extracellular domain of the human hematopoietic protein on the cell surface of the recombinant swine cell; and (2) assays that test for activation of the signal transduction pathways that are activated by the interaction of the human cell surface protein and an agonistic ligand.
- the ligand e.g. growth factor of ECM component
- the first class of assays is useful to, for example, identify potential human hematopoietic proteins which may improve viability of xenografted swine marrow by comparing the binding constant of the human ligand (e.g. SCF, IL-3, GM-CSF) for the recombinant swine cell versus the naturally occurring swine cell.
- the second class of assays is preferred to determine which of the human hematopoietic proteins are suitable for use in the present invention based upon their ability to function in the swine cell. III. Genetically Engineered Swine Cells
- Transgenic swine cells of the invention can be produced by any methods known to those in the art.
- Transgenes can be introduced into cells, e.g., stem cells, e.g., cultured stem cells, by any methods which allows expression of these genes at a level and for a period sufficient to promote engraftment or maintenance of the cells. These methods include e.g., transfection, electroporation, particle gun bombardment, and transduction by viral vectors, e.g., by retroviruses.
- Transgenic swine cells can also be derived from transgenic animals.
- Retroviruses are a preferred delivery system. They have been developed extensively over the past few years as vehicles for gene transfer, see e.g., Eglitis et al., 1988 , Adv. Exp. Med. Biol. 241 : 19 .
- the most straightforward retroviral vector construct is one in which the structural genes of the virus are replaced by a single gene which is then transcribed under the control of regulatory elements contained in the viral long terminal repeat (LTR).
- LTR viral long terminal repeat
- a variety of single-gene- vector backbones have been used, including the Moloney murine leukemia virus (MoMuLV).
- Retroviral vectors which permit multiple insertions of different genes such as a gene for a selectable marker and a second gene of interest, under the control of an internal promoter can be derived from this type of backbone, see e.g., Gilboa, 1988, Adv. Exp. Med. Biol. 241 :29.
- the elements of the construction of vectors for the expression of a protein product are known to those skilled in the art.
- the most efficient expression from retroviral vectors is observed when "strong" promoters are used to control transcription, such as the SV 40 promoter or LTR promoters, reviewed in Chang et al., 1989, Int. J. Cell Cloning 7:264. These promoters are constitutive and do not generally permit tissue-specific expression. Other suitable promoters are discussed above.
- Murine retroviral vectors have been useful for transferring genes efficiently into murine embryonic, see e.g., Wagner et al., 1985, EMBO J. 4:663; Griedley et al., 1987 Trends Genet. 3:162, and hematopoietic stem cells, see e.g., Lemischka et al., 1986, Cell 45:917-927; Dick et al., 1986, Trends in Genetics 2:165-170.
- a recent improvement in retroviral technology which permits attainment of much higher viral titers than were previously possible involves amplification by consecutive transfer between ecotropic and amphotropic packaging cell lines, the so-called "ping- pong” method, see e.g., Kozak et al., 1990, J. Virol. 64:3500-3508; Bodine et al., 1989, Prog. Clin. Biol. Res. 319: 589-600.
- Transduction efficiencies can be enhanced by pre-selection of infected marrow prior to introduction into recipients, enriching for those bone marrow cells expressing high levels of the selectable gene, see e.g., Dick et al., 1985, Cell 42:71-79; Keller et al., 1985, Nature 318: 149-154.
- recent techniques for increasing viral titers permit the use of virus-containing supernatants rather than direct incubation with virus- producing cell lines to attain efficient transduction, see e.g., Bodine et al., 1989, Prog. Clin. Biol. Res. 319:589-600.
- Infectious particles containing these vectors were produced at a titer of >1 x 10 ⁇ G418-resistant colony-forming units/ml using both ecotropic and amphotropic packaging cell lines.
- Flow cytometric analysis of DRA-transfected murine fibroblasts subsequently transduced with virus-containing supernatants demonstrated that the transferred sequences were sufficient to produce DR surface expression.
- Cocultivation of murine bone marrow with high-titer producer lines leads to the transduction of 40% of granulocyte/macrophage colony-forming units (CFU-GM) as determined by the frequency of colony formation under G418 selection.
- CFU-GM granulocyte/macrophage colony-forming units
- Fig. 1 Two types of retroviral constructs, GS4.4 and GS4.5, were prepared. The diagram in Fig. 1 depicts the GS4.5 retroviral construct. The arrows in Fig. 1 indicate the directions of transcription.
- telomere sequence (GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTT
- the simian virus 40 3' RNA processing signal was contained within the 142-bp Hpa I-Sma I fragment from the pBLCAT3 plasmid, Luckow et al., (1987) Nucleic Acids Res. 15:5490-5497, (see Fig. 1). Sequence analysis of the junctions of the promoter, the class II cDNA, and the vector sequences confirmed that the elements of the constructs were properly ligated.
- retroviral constructs were transfected into the amphotropic packaging cell line PA317, and transfectants were selected in G418-containing medium.
- 8 and 12 clones were found, respectively, to be positive for DRB, although the DRB signal was consistently weaker for the GS4.4-derived clones.
- Analysis of genomic and spliced transcripts from GS4.5 cells by dot-blot analysis of PEG- precipitated particles revealed heterogeneity among viral transcripts in various clones transfected by GS4.5.
- Amplification of virus titer was achieved by the ping-pong technique. Since there is evidence that psiCRIP packaging cells are less prone to produce helper virus than PA317 when using certain types of vectors, Miller, 1990, Hum. Gene Therapy 1 :5-14, DRB recombinant virions were prepared using the psiCRIP/GP-E-86 producer combination. Titer values > 1 x 10? CFU/ml with no detectable amphotropic helper viruses were obtained, confirming that this strategy produced safe viral particles suitable for in vivo experiments. Northern blot analysis of GS4.5 -producing clones C4, A9, and A4, each derived from a different packaging cell line, showed a conserved hybridization pattern.
- RNA species corresponding to the full-length viral genome, the spliced Neo transcript, and the DRB transcription unit were observed with additional RNA species.
- High molecular size species observed in these experiments may constitute a read-through transcript starting from the TK promoter and ending in the other long terminal repeat (LTR).
- LTR long terminal repeat
- Retrovirus production was estimated by the drug-resistance titer (G418- resistant colony-forming units/ml, CFU/ml) as described, Bodine et al., 1990, Proc. Natl. Acad. Sci. USA 87:3738-3742. Except for the psiCRIP line, G418 (GIBCO) selection was carried out in active component at 500 ⁇ g/ml for 10-12 days.
- drug-resistance titer G418- resistant colony-forming units/ml, CFU/ml
- Hygromycin B selection was applied to psiCRIP-derived packaging clones in medium containing active drug at 50 ⁇ g/ml for 10 days.
- Replication-competent helper virus titer was assayed on PG4 feline cells by the S+L" method, Bassen et al., 1971, Nature 229:564-566.
- PEG precipitation of viral particles was performed as follows. Virions contained in 1 ml of culture supernatant were precipitated with 0.5 ml of 30% (wt/vol) polyethylene glycol (PEG) for 30 min. at 4°C. After centrifugation, the pellets were treated with a mixture of RNase inhibitors (vanadyl ribonuclease complex, BRL), phenol/chloroform- extracted, and ethanol-precipitated. Pellets were then resuspended in 15.7% (vol/vol) formaldehyde and serial dilutions were dotted onto nitrocellulose membrane. Analysis of DRB Transcription in Packaging Cell Clones was performed as follows.
- Fig. 2 depicts the structure of the pro virus genome and the expected sizes of transcripts initiated from either the viral LTR or the TK promoters.
- 3 solid lines indicate DR cell surface expression (anti-DR antibody binding) (22% and 75% of the bulk population of cells 3 days after transduction with GS4.5 C4, (B) and GS4.5 A4 (C), respectively); dashed lines indicate anti-mouse class I antibody binding (positive control); dotted lines indicate anti-pig CD8 antibody binding (negative control). Twenty-two percent of the bulk population of transduced cells were DR-positive and subclones maintained class II expression for more than 5 months. The increase in titer (clone A4) correlated with an increase in the number of cells transduced (75% of the transduced population was DR-positive) and with the brightness of the DR signal.
- the class II transduction assay was performed as diagrammed in Fig. 4.
- NIH 3T3 cells were transfected with the SLA-DRA ⁇ cDNA inserted in a plasmid expression vector, Okayama et al., 1982, Mol. Cell. Biol. 2:161-170.
- Approximately 3 x 10 4 cells of a stable DRA transfectant (clone 11/12.2F) that expressed a high level of DRA mRNA were then transduced overnight with 1 ml of DRB-containing retroviral supernatant.
- Cells were subsequently cultivated in fresh DMEM supplemented with 10% fetal bovine serum and antibiotics for 2 additional days and examined for cell surface expression of the DR antigen by FCM analysis.
- the class II transduction assay described here provides a fast and simple method to test both the expression and functional titer of retroviral constructs.
- DRA deoxyribonucleic acid
- the need for lengthy double selection after transduction by two separated vectors Yang et al., ⁇ 9 l, Mol. Cell Biol. 1 :3923-3928; Korman et al., 1987, Proc. Natl. Acad. Sci. USA 84:2150-2154, is obviated.
- Cell-surface expression of DR heterodimers was demonstrated by FCM analysis 3 days after transduction, providing direct evidence that the transferred sequences were sufficient to produce significant level of DR ⁇ chain. More importantly, this test allows determination of "functional" titers based on the expression of the gene of interest rather than on that of the independently regulated drug-resistance marker.
- the SLA-DRB probe was an EcoRI cDNA fragment containing the complete coding sequence of the DR ⁇ chain, Gustafsson et al., 1990, Proc. Natl. Acad. Sci. USA 87:9798-9802.
- the neomycin phosphotransferase gene (Neo) probe was the Bel I-Xho I fragment of the N2A retroviral plasmid, Hantzopoulos et al., 1989, Proc. Natl. Acad. Sci. USA 86:3519-3523.
- Colonies of cells arisen from CFU-GM were examined for the presence of DRB-specific transcripts by converting RNA into cDNA and then performing PCR amplification as described herein and in Shafer et al., 1991 Proc. Natl. Acad. Sci. USA 88:9670.
- a 360-bp DRB-specific product was detected in five of six G418-selected colonies from freshly transduced marrow, whereas all six colonies similarly derived from transduced progenitors present after 33 days in culture were positive.
- An additional band of 100 bp observed in some of the samples probably reflects the stoichastic nature of nonspecific priming events.
- DRB-specific transcripts were also detected in the bulk population of drug-resistant colonies and in producer cells but were not detected in controls such as a bulk population of untransduced colonies, fibroblasts used to provide carrier RNA, and a bulk population of transduced colonies processed as above but without reverse transcriptase. These latter data demonstrate that the PCR signal was dependent on the synthesis of cDNA, excluding the possibility that provirus, rather than viral message, was responsible for the amplified fragment .
- Bone marrow cells were obtained from the femora of 6- to 12- week-old female C57BL/10 mice and were prepared as described, Ildstad et al., 1984, Nature 307:168-170. Methylcellulose colony assays for granulocyte/macrophage colony-forming units (CFU- GM), Eaves et al., 1978, Blood 52:1196-1210, were performed as described using 5% (vol/vol) murine interleukin 3 culture supplement (Collaborative Research). Long-term Dexter-type bone marrow cultures were initiated in 60-mm culture dishes with 2 x 10 nucleated cells, Eaves et al., 1987, CRC Crit. Rev. Oncol . Hematol. 7:125-138.
- Bone marrow cells were transduced essentially as described, Bodine et al., 1989, Proc. Natl. Acad. Sci. USA 86:8897-8901. Briefly, bone marrow was harvested for 6- 12- week-old female C57BL/10 donors that had been treated 2 days with 5-fluorouracil (150 mg/kg). Prestimulation was performed by incubating 1 x 10 ⁇ cells per ml for 2 days in long-term Dexter-type bone marrow culture medium to which was added 7.5% interleukin 3 culture supplement and recombinant human interleukin 6 (200 units/ml; gift from J. Jule, National Institutes of Health, Bethesda, MD). Marrow cells were transduced for 48 hr by adding 5 x 10 ⁇ cells per 10-cm plate containing nearly confluent virus-producers, Polybrene (8 mg/ml), and the cytokines described above.
- Detection of DRB-Specific Transcripts in CFU-Derived Colonies was performed as follows. Cells corresponding to individual CFU colonies and to colonies present on an entire plate (bulk) were first extracted from methylcellulose cultures by dilution in phosphate-buffered saline and centrifugation. These cells were then combined with 1 x l ⁇ 6 NIH 3T3 cells (to provide carrier RNA), and total RNA was prepared using the guanidine isothiocyanate/CsCl method. First-strand cDNA was prepared from 20 ⁇ g of total RNA using the Invitrogen Red Module kit.
- cDNA was then subjected to 50 cycles of PCR amplification in the presence of the SLA DRB-specific oligonucleotides 04 (5'- CCACAGGCCTGATCCCTAATGG) (Seq. I.D. No. 1) and 17 (5'-
- graftable swine cells e.g., hematopoietic stem cells, e.g., swine bone marrow cells, or other tissue which express one or more recombinant human proteins that facilitate improved survival and/or engraftment of the swine hematopoietic cells in human subjects.
- the present invention includes recombinant swine cells expressing a human hematopoietic gene.
- the human hematopoietic gene is a part of a recombinant nucleic acid molecule that contains a tissue specific promoter, e.g. hematopoietic specific promoter, located proximate to the human gene and regulating expression of the human gene in the swine cell.
- Tissues containing the recombinant human hematopoietic gene may be prepared by introducing a recombinant nucleic acid molecule into a tissue, such as bone marrow cells, using known transformation techniques.
- transformation techniques include transfection and infection by retroviruses carrying either a marker gene or a drug resistance gene. See for example, Current Protocols in Molecular Biology. Ausubel et al. eds., John Wiley and Sons, New York (1987) and Friedmann (1989) Science 244:1275-1281.
- a tissue containing a recombinant nucleic acid molecule of the present invention may then be reintroduced into an animal using reconstitution techniques (See for example, Dick et al. (1985) Cell 42:71).
- the present invention also includes swine, preferably miniature swine, expressing in its bone marrow cells a recombinant human hematopoietic protein which improves the ability of the swine bone marrow cells to reconstitute a human host.
- the recombinant constructs described above may be used to produce a transgenic pig by any method known in the art, including, but not limited to, microinjection, embryonic stem (ES) cell manipulation, electroporation, cell gun, transfection, transduction, retroviral infection, etc.
- Transgenic swine of the present invention can be produced by introducing transgenes into the germline of the swine, particularly into the genome of bone marrow cells, e.g. hematopoietic cells.
- Embryonal target cells at various developmental stages can be used to introduce the human transgene construct.
- different methods are used to introduce the transgene depending on the stage of development of the embryonal target cell.
- One technique for transgenically altering a pig is to microinject a recombinant nucleic acid molecule into the male pronucleus of a fertilized egg so as to cause 1 or more copies of the recombinant nucleic acid molecule to be retained in the cells of the developing animal.
- the recombinant nucleic acid molecule of interest is isolated in a linear form with most of the sequences used for replication in bacteria removed. Linearization and removal of excess vector sequences results in a greater efficiency in production of transgenic mammals. See for example, Brinster et al. (1985) PNAS 82:4438-4442.
- the zygote is the best target for micro-injection. In the swine, the male pronucleus reaches a size which allows reproducible injection of DNA solutions by standard microinjection techniques.
- the use of zygotes as a target for gene transfer has a major advantage in that, in most cases, the injected DNA will be incorporated into the host genome before the first cleavage.
- the animals developing from the injected eggs contain at least 1 copy of the recombinant nucleic acid molecule in their tissues. These transgenic animals will generally transmit the gene through the germ line to the next generation.
- the progeny of the transgenically manipulated embryos may be tested for the presence of the construct by Southern blot analysis of a segment of tissue. Typically, a small part of the tail is used for this purpose.
- the stable integration of the recombinant nucleic acid molecule into the genome of transgenic embryos allows permanent transgenic mammal lines carrying the recombinant nucleic acid molecule to be established.
- Retroviral infection can also be used to introduce transgene into a swine. The developing embryo can be cultured in vitro to the blastocyst stage.
- the blastomeres can be targets for retroviral infection (Jaenich (1976) PNAS 73:1260-1264). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al. (1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
- the viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al. (1985) PNAS 82:6927-6931; Van der Putten et al. (1985) PNAS 82:6148-6152).
- Transfection can be obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart et al. (1987) EMBOJ. 6:383-388). Alternatively, infection can be performed at a later stage. Virus or virus- producing cells can be injected into the blastocoele (Jahner et al. (1982) Nature 298:623- 628). Most of the founders will be mosaic for the transgene since incorporation typically occurs only in a subset of the cells which formed the transgenic swine. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring.
- ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984) Nature 309:255-258; Gossler et al. (1986) PNAS 83:9065-9069; and Robertson et al.
- Transgenes might be efficiently introduced into the ES cells by DNA transfection or by retrovirus-mediated transduction. Such transformed ES cells could thereafter be combined with blastocysts from a swine. The ES cells could be used thereafter to colonize the embryo and contribute to the germ line of the resulting chimeric pig. For review, see Jaenisch (1988) Science 240:1468-1474. Introduction of the recombinant gene at the fertilized oocyte stage ensures that the gene sequence will be present in all of the germ cells and somatic cells of the transgenic "founder" swine.
- founder means the pig into which the recombinant gene was introduced at the one cell embryo stage.
- the presence of the recombinant gene sequence in the germ cells of the transgenic founder animal in turn means that approximately half of the founder animal's descendants will carry the activated recombinant gene sequence in all of their germ cells and somatic cells.
- Introduction of the recombinant gene sequence at a later embryonic stage might result in the gene's absence from some somatic cells of the founder animal, but the descendants of such an animal that inherit the gene will carry the activated recombinant gene in all of their germ cells and somatic cells.
- the transgenic swine of the present invention is produced by: i) microinjecting a recombinant nucleic acid molecule into a fertilized swine egg to produce a genetically altered swine egg; ii) implanting the genetically altered swine egg into a host female swine; iii) maintaining the host female for a time period equal to a substantial portion of the gestation period of said swine fetus. iv) harvesting a transgenic swine having at least one swine cell that has developed from the genetically altered mammalian egg, which expresses a human hematopoietic gene.
- transgenic animal production is typically divided into four main phases: (a) preparation of the animals; (b) recovery and maintenance in vitro of one or two-celled embryos; (c) microinjection of the embryos and (d) reimplantation of embryos into recipient females.
- the methods used for producing transgenic livestock, particularly swine do not differ in principle from those used to produce transgenic mice. Compare, for example, Gordon et al. (1983) Methods in Enzymology 101 :41 1, and Gordon et al. (1980) PNAS 77:7380 concerning, generally, transgenic mice with Hammer et al. (1985) Nature 315:680, Hammer et al.
- One step of the preparatory phase comprises synchronizing the estrus cycle of at least the donor females, and inducing superovulation in the donor females prior to mating.
- Superovulation typically involves administering drugs at an appropriate stage of the estrus cycle to stimulate follicular development, followed by treatment with drugs to synchronize estrus and initiate ovulation.
- pregnant mare's serum is typically used to mimic the follicle-stimulating hormone (FSH) in combination with human chorionic gonadotropin (hCG) to mimic luteinizing hormone (LH).
- FSH follicle-stimulating hormone
- hCG human chorionic gonadotropin
- LH luteinizing hormone
- the efficient induction of superovulation in swine depend, as is well known, on several variables including the age and weight of the females, and the dose and timing of the gonadotropin administration.
- oviducts of fertilized superovulated females can be surgically removed and isolated in a buffer solution/culture medium, and fertilized eggs expressed from the isolated oviductal tissues. See, Gordon et al. (1980) PNAS 77:7380; and Gordon et al.
- the oviducts can be cannulated and the fertilized eggs can be surgically collected from anesthetized animals by flushing with buffer solution/culture medium, thereby eliminating the need to sacrifice the animal. See Hammer et al. (1985) Nature 315:600.
- the timing of the embryo harvest after mating of the superovulated females can depend on the length of the fertilization process and the time required for adequate enlargement of the pronuclei. This temporal waiting period can range from, for example, up to 48 hours for larger breeds of swine.
- Fertilized eggs appropriate for microinjection such as one-cell ova containing pronuclei, or two-cell embryos, can be readily identified under a dissecting microscope.
- the equipment and reagents needed for microinjection of the isolated swine embryos are similar to that used for the mouse. See, for example, Gordon et al. (1983) Methods in Enzymology 101 :411 ; and Gordon et al. (1980) PNAS 77:7380, describing equipment and reagents for microinjecting embryos. Briefly, fertilized eggs are positioned with an egg holder (fabricated from 1 mm glass tubing), which is attached to a micro-manipulator, which is in turn coordinated with a dissecting microscope optionally fitted with differential interference contrast optics.
- a recombinant nucleic acid molecule of the present invention is provided, typically in linearized form, by linearizing the recombinant nucleic acid molecule with at least 1 restriction endonuclease, with an end goal being removal of any prokaryotic sequences as well as any unecessary flanking sequences.
- the recombinant nucleic acid molecule containing the tissue specific promoter and the human hematopoietic gene may be isolated from the vector sequences using 1 or more restriction endonucleases.
- Techniques for manipulating and linearizing recombinant nucleic acid molecules are well known and include the techniques described in Molecular Cloning: A Laboratory Manual. Second Edition. Maniatis et al. eds., Cold Spring Harbor, N.Y. (1989).
- the linearized recombinant nucleic acid molecule may be microinjected into the swine egg to produce a genetically altered mammalian egg using well known techniques.
- the linearized nucleic acid molecule is microinjected directly into the pronuclei of the fertilized eggs as has been described by Gordon et al. (1980) PNAS 77:7380-7384. This leads to the stable chromosomal integration of the recombinant nucleic acid molecule in a significant population of the surviving embryos. See for example, Brinster et al. (1985) PNAS 82:4438-4442 and Hammer et al. (1985) Nature 315:600-603.
- the microneedles used for injection can also be pulled from glass tubing.
- the tip of a microneedle is allowed to fill with plasmid suspension by capillary action.
- the microneedle is then inserted into the pronucleus of a cell held by the egg holder, and plasmid suspension injected into the pronucleus. If injection is successful, the pronucleus will generally swell noticeably.
- the microneedle is then withdrawn, and cells which survive the microinjection (e.g. those which do not lysed) are subsequently used for implantation in a host female.
- the genetically altered mammalian embryo is then transferred to the oviduct or uterine horns of the recipient.
- Microinjected embryos are collected in the implantation pipette, the pipette inserted into the surgically exposed oviduct of a recipient female, and the microinjected eggs expelled into the oviduct.
- any surgical incision can be closed, and the embryos allowed to continue gestation in the foster mother. See, for example, Gordon et al. (1983) Methods in Enzymology 101 :41 1; Gordon et al. (1980) PNAS 77:7390; Hammer et al. (1985) Nature 315:600; and Wall et al. (1985) Biol. Reprod. 32:645.
- the host female mammals containing the implanted genetically altered mammalian eggs are maintained for a sufficient time period to give birth to a transgenic mammal having at least 1 cell, e.g. a bone marrow cell, e.g. a hematopoietic cell, which expresses the recombinant nucleic acid molecule of the present invention that has developed from the genetically altered mammalian egg.
- a transgenic mammal having at least 1 cell, e.g. a bone marrow cell, e.g. a hematopoietic cell, which expresses the recombinant nucleic acid molecule of the present invention that has developed from the genetically altered mammalian egg.
- a transgenic pig may be produced by the methods as set forth in Example 1.
- Example 2 Production Of Transgenic Pigs which express human c-kit (the receptor for human SCF) Estrus is synchronized in sexually mature gilts (>7 months of age) by feeding an orally active progestogen (allyl trenbolone, AT: 15 mg/gilt/day) for 12 to 14 days.
- AT allyl trenbolone
- AT intramuscular injection
- PMSG pregnant mare serum gonadotropin
- HCG Human chorionic gonadotropin
- donor and recipient gilts are checked twice daily for signs of estrus using a mature boar.
- Donors which exhibited estrus within 36 hours following HCG administration are bred at 12 and 24 hours after the onset of estrus using artificial and natural (respectively) insemination.
- one- and two-cell ova are surgically recovered from bred donors using the following procedure.
- General anesthesia is induced by administering 0.5 mg of acepromazin/kg of bodyweight and 1.3 mg ketamine/kg of bodyweight via a peripheral ear vein.
- the reproductive tract is exteriorized following a midventral laparotomy.
- a drawn glass cannula (O.D. 5 mm, length 8 cm) is inserted into the ostium of the oviduct and anchored to the infundibulum using a single silk (2-0) suture.
- Ova are flushed in retrograde fashion by inserting a 20 g needle into the lumen of the oviduct 2 cm anterior to the uterotubal junction.
- Sterile Dulbecco's phosphate buffered saline (PBS) supplemented with 0.4% bovine serum albumin (BSA) is infused into the oviduct and flushed toward the glass cannula.
- the medium is collected into sterile 17 x 100 mm polystyrene tubes. Flushings are transferred to 10 x 60 mm petri dishes and searched at lower power (50 x). All one- and two-cell ova are washed twice in Brinster's Modified Ova Culture-3 medium
- BMOC-3 supplemented with 1.5% BSA and transferred to 50 ml drops of BMOC-3 medium under oil. Ova are stored at 38°C under a 90% N2, 5% O2, 5% CO2 atmosphere until microinjection is performed.
- One- and two-cell ova are placed in an Eppendorf tube (15 ova per tube) containing 1 ml HEPES Medium supplemented with 1.5% BSA and centrifuged for 6 minutes at 14000 x g in order to visualize pronuclei in one-cell and nuclei in two-cell ova. Ova are then transferred to a 5-10 ml drop of HEPES medium under oil on a depression slide. Microinjection is performed using a Laborlux microscope with Nomarski optics and two Leitz micromanipulators.
- 10-1700 copies of a DNA construct which includes the human c-kit gene operably linked to a promoter (1 ng/ml of Tris-EDTA buffer) are injected into one pronuclei in one-cell ova or both nuclei in two-cell ova.
- Microinjected ova are returned to microdrops of BMOC-3 medium under oil and maintained at 38°C under a 90% N2, 5% CO2, 5% O2 atmosphere prior to their transfer to suitable recipients. Ova are transferred within 10 hours of recovery. Only recipients which exhibited estrus on the same day or 24 hours later than the donors are utilized for embryo transfer. Recipients are anesthetized as described above. Following exteriorization of one oviduct, at least 30 injected one and/or two-cell ova and 4-6 control ova are transferred in the following manner. The tubing from a 21 g x 3/4 butterfly infusion set is connected to a lcc syringe. The ova and one to two mis of BMOC-3 medium are aspirated into the tubing. The tubing is then fed through the ostium of the oviduct until the tip reached the lower third or isthmus of the oviduct. The ova are subsequently expelled as the tubing is slowly withdrawn.
- the exposed portion of the reproductive tract is bathed in a sterile 10% glycerol/ 0.9% saline solution and returned to the body cavity.
- the connective tissue encompassing the linea alba, the fat and the skin are sutured as three separate layers.
- An uninterrupted Halstead stitch is used to close the lina alba.
- the fat and skin are closed using a simple continuous and mattress stitch, respectively.
- a topical antibacterial agent (Furazolidone) is then administered to the incision area.
- the animals of the invention can be used as models to test for agents which act as agonists or antagonists of human growth factors.
- the agent to be tested can be administered to an animal of the invention and proliferation of the transgenic hematopoietic cells can be monitored.
- the following procedure was designed to lengthen the time an implanted swine organ (a xenograft) survives in a xenogeneic host prior to rejection.
- the organ can be any organ, e.g., a liver, e.g., a kidney, e.g., a heart.
- the main strategies are elimination of natural antibodies by organ perfusion, transplantation of tolerance-inducing transgenic swine stem cells, and optionally, the implantation of donor stromal tissue.
- Preparation of the recipient for transplantation includes any or all of these steps. Preferably they are carried out in the following sequence.
- a preparation of horse anti-human thymocyte globulin is intravenously injected into the recipient.
- the antibody preparation eliminates mature T cells and natural killer cells. If not eliminated, mature T cells would promote rejection of both the bone marrow transplant and, after sensitization, the xenograft itself. Of equal importance, the ATG preparation also eliminates natural killer (NK) cells. NK cells probably have no effect on the implanted organ, but would act immediately to reject the newly introduced bone marrow.
- Anti-human ATG obtained from any mammalian host can also be used, e.g., ATG produced in pigs, although thus far preparations of pig ATG have been of lower titer than horse-derived ATG.
- ATG is superior to anti-NK monoclonal Antibodies, as the latter are generally not lytic to all host NK cells, while the polyclonal mixture in ATG is capable of lysing all host NK cells.
- Anti-NK monoclonal antibodies can, however, be used.
- the presence of donor antigen in the host thymus during the time when host T cells are regenerating post-transplant is critical for tolerizing host T cells. If donor hematopoietic stem cells are not able to become established in the host thymus and induce tolerance before host T cells regenerate repeated doses of anti-recipient T cell antibodies may be necessary throughout the non-myeloablative regimen. Continuous depletion of host T cells may be required for several weeks. Alternatively, e.g. if this approach is not successful, and tolerance (as measured by donor skin graft acceptance, specific cellular hyporesponsiveness in vitro, and humoral tolerance) is not induced in these animals, the approach can be modified to include host thymectomy.
- thymectomized recipients host T cells do not have an opportunity to differentiate in a host thymus, but must differentiate in the donor thymus. If this is not possible, then the animal has to rely on donor T cells developing in donor thymus for immunocompetence. Immunocompetence can be measured by the ability to reject a non-donor type allogeneic donor skin graft, and to survive in a pathogen-containing environment. It may also be necessary or desirable to splenectomize the recipient in order to avoid anemia.
- the recipient is administered low dose radiation in order to create hematopoietic space.
- natural antibodies are absorbed from the recipient's blood by hemoperfusion of a swine liver.
- Pre-formed natural antibodies are the primary agents of graft rejection.
- Natural antibodies bind to xenogeneic endothelial cells and are primarily of the IgM class. These antibodies are independent of any known previous exposure to antigens of the xenogeneic donor.
- B cells that produce these natural antibodies tend to be T cell-independent, and are normally tolerized to self antigen by exposure to these antigens during development. The mechanism by which newly developing B cells are tolerized is unknown.
- the liver is a more effective absorber of natural antibodies than the kidney.
- the fourth step in the non-myeloablative procedure is to implant donor stromal tissue, preferably obtained from fetal liver, thymus, and/or fetal spleen, into the recipient, preferably in the kidney capsule.
- donor stromal tissue preferably obtained from fetal liver, thymus, and/or fetal spleen
- Stem cell engraftment and hematopoiesis across disparate species barriers is enhanced by providing a hematopoietic stromal environment from the donor species.
- the stromal matrix supplies species-specific factors that are required for interactions between hematopoietic cells and their stromal environment, such as hematopoietic growth factors, adhesion molecules, and their ligands
- the thymus is the major site of T cell maturation.
- Each organ includes an organ specific stromal matrix that can support differentiation of the respective undifferentiated stem cells implanted into the host.
- fetal tissue obtained sufficiently early in gestation is preferred because it is free from mature T lymphocytes which can cause GVHD. Fetal tissues also tend to survive better than adult tissues when transplanted.
- thymic stromal tissue can be irradiated prior to transplantation, e.g., irradiated at 1000 rads.
- fetal liver cells can be administered in fluid suspension. (The use of transgenic "humanized" swine cells (which can more effectively compete with host stem cells to repopulate the host) may eliminate the need for this step.)
- transgenic swine bone marrow stem cells e.g., swine BMC engineered to express the human c-kit gene
- Donor BMC home to appropriate sites of the recipient and grow contiguously with remaining host cells and proliferate, forming a chimeric lymphohematopoietic population.
- newly forming B cells and the antibodies they produce) are exposed to donor antigens, so that the transplant will be recognized as self.
- Tolerance to the donor is also observed at the T cell level in animals in which hematopoietic stem cell, e.g., BMC, engraftment has been achieved.
- the donor of the implant and the individual that supplies either the tolerance- inducing hematopoietic cells or the liver to be perfused should be the same individual or should be as closely related as possible. For example, it is preferable to derive implant tissue from a colony of donors that is highly inbred.
- a graft recipient it is often desirable to expose a graft recipient to irradiation in order to promote the development of mixed chimerism. It is possible to induce mixed chimerism with less radiation toxicity by fractionating the radiation dose, i.e., by delivering the radiation in two or more exposures or sessions. Accordingly, in any method of the invention calling for the irradiation of a recipient, e.g., a primate, e.g., a human, recipient, of a xenograft, the radiation can either be delivered in a single exposure, or more preferably, can be fractionated into two or more exposures or sessions.
- a recipient e.g., a primate, e.g., a human, recipient
- the sum of the fractionated dosages is preferably equal, e.g., in rads or Gy, to the radiation dosage which can result in mixed chimerism when given in a single exposure.
- the fractions are preferably approximately equal in dosage.
- a single dose of 700 rads can be replaced with, e.g., two fractions of 350 rads, or seven fractions of 100 rads.
- Hyperfractionation of the radiation dose can also be used in methods of the invention.
- the fractions can be delivered on the same day, or can be separated by intervals of one, two, three, four, five, or more days. Whole body irradiation, thymic irradiation, or both, can be fractionated.
- hemoperfusion e.g., hemoperfusion with a donor organ
- Other methods for depleting or otherwise inactivating natural antibodies can be used with any of the methods described herein.
- drugs which deplete or inactivate natural antibodies e.g., deoxyspergualin (DSG) (Bristol), or anti-IgM antibodies
- DSG deoxyspergualin
- anti-IgM antibodies can be administered to the recipient of an allograft or a xenograft.
- DSG or similar drugs
- anti-IgM antibodies, and hemoperfusion can be used to deplete or otherwise inactivate recipient natural antibodies in methods of the invention.
- DSG at a concentration of 6 mg/kg/day, i.v. has been found useful in suppressing natural antibody function in pig to cynomolgus kidney transplants.
- Some of the methods described herein use lethal irradiation to create hematopoietic space, and thereby prepare a recipient for the administration of xenogeneic genetically engineered stem cells.
- it is preferable to create hematopoietic space for the administration of such cells by non-lethal means e.g., by administering sub-lethal doses of irradiation, bone marrow depleting drugs, or antibodies.
- the use of sublethal levels of bone marrow depletion allows the generation of mixed chimerism in the recipient.
- Mixed chimerism is generally preferable to total or lethal ablation of the recipient bone marrow followed by complete reconstitution of the recipient with administered stem cells.
- Other embodiments are within the following claims.
- ADDRESSEE Lahive & Cockfield
- B STREET: 60 State Street
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US29256594A | 1994-08-19 | 1994-08-19 | |
| US292565 | 1994-08-19 | ||
| PCT/US1995/010250 WO1996006165A1 (en) | 1994-08-19 | 1995-08-10 | Genetically engineered swine cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP0773993A1 true EP0773993A1 (de) | 1997-05-21 |
| EP0773993A4 EP0773993A4 (de) | 2000-07-05 |
Family
ID=23125208
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP95928825A Withdrawn EP0773993A4 (de) | 1994-08-19 | 1995-08-10 | Gentechnisch veränderte schweine-zellen |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP0773993A4 (de) |
| JP (1) | JPH10507906A (de) |
| AU (1) | AU711183B2 (de) |
| CA (1) | CA2196311A1 (de) |
| WO (1) | WO1996006165A1 (de) |
Families Citing this family (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2227584A1 (en) * | 1995-08-04 | 1997-02-20 | The General Hospital Corporation | Transgenic swine and swine cells having human hla genes |
| EP0979101B1 (de) | 1996-07-03 | 2010-10-27 | Merial, Inc. | Rekombinanter hunde-adenovirus 2 (cav2), welcher exogene dna enthält |
| US6011197A (en) | 1997-03-06 | 2000-01-04 | Infigen, Inc. | Method of cloning bovines using reprogrammed non-embryonic bovine cells |
| US6224882B1 (en) | 1997-11-07 | 2001-05-01 | Protein Science Corp. | Insect cells or fractions as adjuvant for antigens |
| US6558662B2 (en) | 1997-11-14 | 2003-05-06 | The General Hospital Corporation | Treatment of hematologic disorders |
| US6001651A (en) * | 1998-03-20 | 1999-12-14 | Isis Pharmaceuticals Inc. | Antisense modulation of LFA-3 |
| US6197294B1 (en) | 1998-10-26 | 2001-03-06 | Neurotech S.A. | Cell surface molecule-induced macrophage activation |
| US6700037B2 (en) | 1998-11-24 | 2004-03-02 | Infigen, Inc. | Method of cloning porcine animals |
| US6258998B1 (en) | 1998-11-24 | 2001-07-10 | Infigen, Inc. | Method of cloning porcine animals |
| DK1534819T3 (da) | 2002-08-21 | 2010-04-19 | Revivicor Inc | Griselignende dyr, som mangler enhver ekspression af funktionel alfa-1,3-galactosyltransferase |
| EP1685148A2 (de) | 2003-11-05 | 2006-08-02 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Porcines isoglobosid-3-synthaseprotein, cdna, genomische organisation und regulatorische region |
| CN104721883A (zh) | 2004-03-17 | 2015-06-24 | 雷维维科公司 | 来源于缺乏任何功能性α1,3半乳糖基转移酶表达的动物的组织产品 |
| JP5721620B2 (ja) | 2008-05-02 | 2015-05-20 | キャンサー・リサーチ・テクノロジー・リミテッドCancer Research Technology Limited | 免疫応答を刺激するための作製物および方法 |
| EP2545071A2 (de) | 2010-03-09 | 2013-01-16 | Maksyutov, Amir | Polyepitopkonstrukte sowie verfahren zu ihrer herstellung und verwendung |
| WO2012023033A2 (en) | 2010-08-18 | 2012-02-23 | Purdue Pharma L.P. | Improved peptide immunogens |
| JP6161828B2 (ja) * | 2015-04-20 | 2017-07-12 | 国立大学法人 岡山大学 | がんの非ヒトモデル動物及びその作製方法、がん幹細胞及びその製造方法 |
| KR20250035053A (ko) | 2022-06-07 | 2025-03-11 | 리제너론 파아마슈티컬스, 인크. | T 세포 활성을 조절하기 위한 다중특이적 분자 및 이의 용도 |
| WO2023240124A1 (en) | 2022-06-07 | 2023-12-14 | Regeneron Pharmaceuticals, Inc. | Pseudotyped viral particles for targeting tcr-expressing cells |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU633958B2 (en) * | 1989-07-25 | 1993-02-11 | Cell Genesys, Inc. | Homologous recombination for universal donor cells and chimeric mammalian hosts |
| SG72614A1 (en) * | 1989-10-12 | 2000-05-23 | Imutran Ltd | Modified biological material |
| JPH09508277A (ja) * | 1994-01-27 | 1997-08-26 | ブレサゲン リミテッド | ヒト異種移植における超急性拒絶の管理のための物質及び方法 |
| DE69535752D1 (de) * | 1994-04-13 | 2008-06-26 | Biotransplant Inc | Alpha(1,3)galactosyltransferase-negatives schwein |
-
1995
- 1995-08-10 CA CA002196311A patent/CA2196311A1/en not_active Abandoned
- 1995-08-10 WO PCT/US1995/010250 patent/WO1996006165A1/en not_active Ceased
- 1995-08-10 JP JP8508145A patent/JPH10507906A/ja active Pending
- 1995-08-10 EP EP95928825A patent/EP0773993A4/de not_active Withdrawn
- 1995-08-10 AU AU32435/95A patent/AU711183B2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| CA2196311A1 (en) | 1996-02-29 |
| EP0773993A4 (de) | 2000-07-05 |
| JPH10507906A (ja) | 1998-08-04 |
| WO1996006165A1 (en) | 1996-02-29 |
| AU711183B2 (en) | 1999-10-07 |
| AU3243595A (en) | 1996-03-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6030833A (en) | Transgenic swine and swine cells having human HLA genes | |
| AU711183B2 (en) | Genetically engineered swine cells | |
| CN1487996B (zh) | 用于生产人类抗体的转基因转染色体啮齿动物 | |
| US7041282B2 (en) | Ligands for flt3 receptors | |
| US20150017130A1 (en) | Methods and compositions for inhibition of immune responses | |
| WO1992022645A1 (en) | Transgenic immunodeficient non-human animals | |
| JP2002510973A (ja) | ヒトFc受容体を発現するトランスジェニック動物 | |
| NZ267541A (en) | Method of regulation of progenitor and stem cells wing fh-3l polypeptides | |
| US20070274954A1 (en) | Cloning B and T lymphocytes | |
| CN1051199A (zh) | 经修饰的生物材料 | |
| EP0601585B1 (de) | Nucleinsäurekonstrukt zur Hemmung oder Regulierung der Funktionen eines Immunantwortgens, dessen Verwendung in einem Verfahren und immunologisch kompatibles System, das dieses Konstrukt enthält | |
| WO2013063076A1 (en) | Compositions for and methods of modulating complications, risks and issues with xenotransplantation | |
| US6255555B1 (en) | Transgenic mouse expressing human fusin and human CD4 | |
| WO1998033387A1 (en) | Tolerance to natural antibody antigens | |
| AU760600B2 (en) | Transgenic swine and swine cells having human HLA genes | |
| US20020114787A1 (en) | Tolerance to natural antibody antigens | |
| AU4753702A (en) | Tolerance to natural antibody antigens | |
| HK1064708B (en) | Transgenic transchromosomal rodents for making human antibodies | |
| MXPA94003806A (en) | Ligands for receivers f |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 19970227 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
| RIC1 | Information provided on ipc code assigned before grant |
Free format text: 6C 12N 15/00 A, 6A 01K 67/027 B, 6C 07K 14/715 B, 6C 12N 5/10 B |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20000518 |
|
| AK | Designated contracting states |
Kind code of ref document: A4 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE |
|
| 17Q | First examination report despatched |
Effective date: 20010912 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20020123 |