CA2196311A1 - Genetically engineered swine cells - Google Patents

Abstract

A genetically engineered cell for inducing tolerance.

Description

219631~
~ WO 96106165 . PCTtUS95/10250 GENETICALLY ENGrNEERED SWINE CELLS

This application is a çnnfin--qtion-in-part of: USSN 08/266,427, filed June 27, 1994; USSN 08/266, 427, filed June 26, 1994; USSN 08/243,653 by Sykes and Sachs,S filed May 16, 1994; USSN 08/220,371, filed March 29, 1994; USSN 08/212,228, f led March 14, 1994; USSN 08/163,912, filed December 7, 1993; USSN 08/150,739, filed November 10, 1993; USSN 08/126,122, filed on September 23, 1993; USSN 08/114,072, filed August 30, 1993; USSN 07/838,595, filed February 19, 1992; PCT/US94/05527,filed May 16, 1994; and PCT/US94/01616, filed February 14, 1994. All ofthe U.S.
patent qpr~ qrinnc and PCT T, llr~ Applications recited herein are hereby ihl~,ul~lulated by reference.
nA. I~ .1 ofthP TnYentinn TheinventionrelatestothefieldoforganllA,,~l,l,..,lAI;nn Technical advances in allogeneic orgam I, A ' ~ ' I i nn amd the availability of,15 nnncpe~-ifir; . "" ~ " ,; ve agents have revolutioni~d the field of organ This progress has, however, resulted in a shortage of essential organs of suitable si~ and match.
The shortage of allograft-organs has led to an increased interest in xenogeneic It was ~ - ' more than twenty-five years ago that transplants from . l .;. . ,~ to man could provide long-term life-supporting function. However, the use of non-human primates as an organ source is of limited applicability. Many primate species are scarce amd protected, and those that are more plentiful, such as the baboon, often do not grow to a size which allows the use of their organs in adults. Moreover, in some cultures, the use of primates as a source of organs is ethically . . . IA~C. ~
Some of these difficulties could be resolved by use of ungulate organs, especially pig organs. Pigs are ~- - -- l, easy to breed, have large litters, and grow rapidly to the si~ which allow the use of their organs in the very largest humam beings. In addition, pig amd man have mamy anatomical and physiological cimilqritirc However, .Iq. ,U.l ;.~., of a pig organ into a human results in a vigorous rejection of the graft-organ.
Sl~mmq~y of tht Inventinn In general, the invention features, a genetically engineered swine cell, e.g., acultured swine cell, e.g., a retrovirally trqn~.rmqç' cultured swine cell, or a cell derived from a transgenic swine, which includes one or both of: a transgene encoding a graft-supporting protein, e.g., a primate, e.g., a human, lL.l.a.vpù;ctic peptide; or, a tramsgene which inhibits the expression or action of a gene product which is graft-A-S~
Examples of transgenes which inhibit the expression or action of a gene product which is graf t ~ - include: a tr~msgene which encodes an amti-sense RNA which, directly WO 96/06165 219 6 3 ~1 ~ 2 ¦ ' PCT/US95/10250--or indirectly, inhibits the expression or action of a recipient-derived grafl . - - ~g " ,: ~1 ;r protein, e.g., an anti-sense RNA which inbibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protein; a transgene which is a mutationally inactivated copy of a gene which 5 encodes a donor grafl-n.,~ ;r protein and which when inserted into the donor genome, e.g., by 1~ ,g~ ,. ,~ .~ ., . ,l .;, . ;~ " " results in an ~ gene which is l~fla~Ap~ ;;d or which is mutationally inactivated, by, e.g., the hlLludu~Liull of a mutation, e.g., a deletion, into an rl ~ genomic copy of the gene which encodes the donor grafl .-, l ug, ,., ;~ protein (e.g., the insertion of a transgene results in a knockout 10 for a donor-derived receptor for a recipient-derived protein which is a graft n l .~ 1 ;r protein); a transgene which encodes an inhibitor of a donor- or recipient-derived grafl-protein~ e g ~ a z ù~ LiLiv(: inhibitor or a protease or other molecule whichspecifically inhibits the activity of the grafl n~ l ;r protein; and a transgene which encodes a dominant negative mutation in a gene product which is grafl-n ~ ;r, e.g., 15 a donor cell receptor for a host cytokine.
In preferred r ~ o~ the transgene encoding a grafl-supporting protein is: a recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
In preferred G".l,o.~ the transgene is one which inhibits the expression or actionofadonorMHCgeneproduct(whichgeneproductisgrafl.- '~,,.":~l;~).
In preferred .. ,.l~o~l .. ~ the genetically engineered swine cell is a h~ lLu~u;~Liu stem cell and the transgene encoding a grafl-supporting protein is: a recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human MHC gene.
In preferred ~ ..,l.c..l; ,.~ the genetically engineered swine cell is a I ~Ul. .i., stem cell and the transgene is one which inhibits the expression or action of a donor MHC
25 gene product (which gene product is grafl-n, ~f ~g ",: I ;r) In preferred c ,.,l.o.l;.. .,1~ the transgene encoding a grafl-supporting protein and/or the transgene which inhibits the expression or action of a gene product which is grafl-n-.~ ;r. is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
In preferred r~ )o~ the genetically engineered swine cell is a h.. llatu~Ju;c;ic stem cell and the transgene encoding a graft-supporting protein and/or the transgene which inhibits the expression or action of a gene product which is grafl-n ~ 1;. is other than: an MHC gene; a swine MHC gene; a recipient MHC gene; a non-primate, MHC gene; or a non-human MHC gene.
Inpreferredr,.,l.ull;.... l~thetransgeneencodesagrafl-supportingprotein,e.g.,a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of ' ,uo;~,~;s. Examples of growth factor or cytokine ~ WO 96106165 2 1 9 6 3 ~ ~ P~

receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-I I, IL-2, Epo, and uteroferrin.
In other preferred r~ c~ t~ the transgene encodes a graft-supporting protein, e.g., a hl31nan adhesion molecule, e.g., an a&esion molecule involved in c..r,,.~
5 and10r " IAl~ 1 C' of I ~ po;~,~ic cells. Examples of human adhesion moleculesinclude VLA-4, c-kit, LFA-I, CDI la, Mac-1, CR3~ CDI Ib, pl50, p95, CDl lc, CD49a, LPAM-I, CD49d, CD44, CD3~, and CD34.
In yet other preferred ~ o~1;., .~ . It~ the transgene encodes a recipient or donor protein, e.g., a cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition 10 of the level of activity of a second cytokine), inhibits an irnmune response mounted by donor cells against the recipient, e.g., IL-I 0, IL-4, IL-2, or TGF-~.
In yet other preferred C. . ,l)v~ the transgene encodes a chimeric molecule,e.g., a chimeric ly~ Lvkillc" e.g., PIXY123.
In yet other preferred rl . ,l)oli;. l .. .l ~ the transgene encodes a graft-supporting 15 protein, e.g., a recipient or donor cytokine, which directly, or indirectly (e.g., by the etimnl~tinn or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL- 10, IL-4, IL-2, or TGF-!3-In yet other preferred ~ .. ,l-o.1: ., ...,1 ~ the transgene inhibits the expression or action 20 of a gene product which is graft-~ ;., e.g., by decreasimg the expression of the gene product. E.g., the transgene is a ml~tl~tinn ~lly inactivated copy of a gene which encodes a donor graft-,.ll~ .", ...i~l;~ protein, e.g., the donor cellsl B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by l ~- -l l lolny,v ~ ' ;fm, results in an 25 rl~iny~ gene which is lll;~A~ a~J or which is mutationally inactivated, by, e.g., the introduction of a mutation, e.g., a deletion, into an rl l.lng... 1.1~1~ genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes an anti-sense RNA which, directly or 30 indirectly, inhibits the expression or action of a recipient-derived graft-", a ~
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 reccptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene product which is graft-,~ , e.g., a donor cell receptor for a host cytokine or donor 35 B-7 receptor, CD27 receptor, or LFA-3 receptor.
In yet other preferred C~ 0ll;111- ~t~ the transgene includes a nucleic acid encoding a human peptide, e.g., a l..,.~._tvl.voi~,.ic peptide, operably linked to: a promoter other than WO 96/06l65 2 1 ~ ~ 3 ~ i 4 PcrlUsssllo25o--the one it naturally occurs with; a swine promoter, e.g., a swine l ,. . " ~ ir I in gene promoter; a viral promoter; or an inducible or .L.v- lu~ 1y regulated promoter.
In yet other preferred rllll ,."l~ the genetically engineered swine cell is: a swine h. ." ~ ,~,n:. 1;. stem cell, e.g., a cord blood l~ tvl~o;~ stem cell, a bone marrow 5 h. .., s ~ ir stem cell, or a fetal or neonatal liver or spleen L~ ;uuo;..;ic stem cell;
derived from d;~rtl~ ' blood cells, e.g. a myeloid cell, such as a ~ ,uLLLyu~"yLts, monocytes, granulocytes, or an Pn~innphilc an erythroid cell, such as a red blood cells, e.g. a Iymphoid cell, such as B IYIII~UIIOU~ 1~" and T Iylllpllouytu." derived from a pluripotent l- ~,uùi~lic stem cell, e.g. a h.,lll_~u~o;~, ic precursor, e.g. a burst-forming 10 units-erythroid (BFU-E), a colony forming unit-erythroid (CFU-E), a colony forrning unit-lllcgah~uyu~u~ (CFU-Meg), a colony forming unit-~;l~lulo~yl~-monocyte (CFU-GM), a colony forrning unit-eosinophil (CFU-Eo), or a colony forrning unit-~;.~lulol,yL~
erythrocyte-l.l.,~;dLuyu.,yl~-monocyte (CFU-GEMM); a swine cell other than a h.,ll~ o;.,;i., stem cell, or other blood cell; a swine thymic cell, e.g., a swine thymic 15 stromal cell; a bone marrow stromal cell; a swine liver cell; a swine kidney cell; a swine epithelial cell; a swine ' ~ ~ progenitor cell; a swine muscle cell, e.g., a heart cell; or a dendritic cell or precursor thereof.
In yet other preferred ., . ,h. 1l;. l . " ~ the transgenic cell is: isolated or derived from cultured cells, e.g., a primary culture, e.g., a primary cell culture of 1~ ~ r ' " stem 20 cells; isolated or derived from a transgenic animal.
In yet other preferred ~,..ho~ the transgenic swine cell is L~ .y~;uu~ for the transgene; the transgenic swine cell is h.,t~.lu4y~;uu~ for the transgene; the transgenic swine cell is IIUIIIU~Y~;UU~ for the transgene Q~ Itlu~y~uu~ transgenic swine can be bred to produce offspring that are hUlllU4y~5UU~ for the transgene); the transgenic swine cell 25 includes two or more transgenes.
In another aspect, the invention features, a transgene including a swine promoter, e.g., a swine L~,.ll~llVJJO;~,Ih, gene promoter, or a heterologous inducible or lul~ ly regulated promoter, operably linked to either: a nucleic acid encoding agraft-supporting protein, e.g., a primate or a human grafl-supporting protein, e.g., a 30 primate, e.g., a human, I ~l~u;.,li~; peptide; or a nucleic acid which encodes or, a transgene which inhibits the expression or action of a gene product which is grafl-~ . ~I h~ Examples of transgenes which inhibit the expression or action of a gene product which is grafl-,l, .~ ~, ., .: J;~ include: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived 35 grafl-., . ~ ;r protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (amd thereby inhibits the action of the recipient-derived protein; a transgene which encodes an inhibitor of a donor- or recipient-derived grafl-~ protein, e.g., a CUIllu~ iVt: inhibitor or a protease or ~wo 96/06165 2 1 9 ~ 3 1 1 PCT/US95/10250 other molecule which specifically inhibits the activity of the graft A~ . " . ~1 ;r protein;
and a transgene which encodes a dominant negative mutation in a gene product which is graft~ ; i" e.g., a donor cell receptor for a host cytokine.
In preferred ~" ,ho.l; I ., ,~ ~ the transgene encoding a graft-supporting protein is: a 5 recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
In preferred . ..,1.o~ the transgene is one which inhibits the expression oraction of a donor MHC gene product (which gene product is graft - - -' ~h ~1 l '1 ;~).
In preferred c~ od;lll.,llL~ the nucleic acid encoding a graft-supporting protein and/or the nucleic acid which inhibits the expression or action of a gene product which is 10 graft-A" I hr" i~ . is other than: an MHC gene; a swine MHC gene; a recipient MHC
gene; a non-primate MHC gene; or a non-human MHC gene.
In preferred rllll.O,l;".. .,1~ the nucleic acid encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of h.,lllaLu~ . Examples of growth factor or cytokine15 receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-I 1, IL-2, Epo, and uteroferrin.
In other preferred c...bouh...,l.~ the nucleic acid encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion molecule involved in and/or~ of h~,llla~ Jo;~.;ccells. Examplesofhumanadhesion molecules include VLA-4, c-kit, LFA-I, CDI 1 a, Mac- I, CR3, CDl Ib, pl 50, p95,CDllc, CD49a, LPAM-l, CD49d, CD44, CD38, and CD34.
In yet other preferred ~mhoriin~pntc the nucleic acid encodes a recipient or donor protein, e.g., a cytokine, which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by donor cells against the recipient, e.g., IL- I 0, IL-4, IL-2, or TGF-,B.
In yet other preferred c...~ ' the nucleic acid encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL- I 0, IL-4, IL-2, or TGF-30 ~3.
The transgene can be one which encodes an anti-sense RNA which, directly or indirectly,inhibitstheexpressionoractionofarecipient-derivedgraft-A~,I~,.-..,~I;-.
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene product which is graft-A"~ , e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.

W096/06165 ~ ! , . ',, PCTtUS9StlO250 . j ~ 6 In yet other preferred . . ,.1 ,c,.l:. " .; ~ the transgene encodes a chimeric molecule, e.g., a chimeric IyllluLohillc, e.g., PIXY123.
In preferred 1 ,.,lto,l;".. .,1~ the transgene further includes trh-nerriptinnh-l regulatory sequences, e.g. a tissue-specific promoter, e.g7 a h ' ~1~~ ~ ;r specific promoter, 5 operably linked to the .~...,.,1.;., --,1 human gene sequence.
In another aspect7 the invention features, a transgene which inhibits the action of a gene product which is graft-.."' .~ .,.:~1;~ e.g., by decreasing the expression ofthe gene product. E.g., the transgene is a transgene which is a m~lt~tinn~lly inactivated copy of a gene which encodes a donor graft~ protein and which when inserted into the 10 donorgenome,e.g.,by l...."rlrg.~ ull~h;ll- ;rm~ resultsinan ~rln~ genewhich is ~ cA~lcaa~,d or which is mutationally inactivated, by, e.g., the i..l . uJ~liu~ of a mutation, e.g., a deletion, into an nl Ir~ genomic copy of the gene which encodes the donor graft ~ .I hr,l 1 S ~1 ;r protein (e.g., the insertion of a transgene results in a knockout for a donor-derived receptor for a recipient-derived protein which is a graft llhpl".:~l;r 1 5 protein).
In preferred rl I ~ho~ the t~ansgene is one which inhibits the expression oraction of a donor MHC gene product (which gene product is graft- .: ~g~ .. ,i~l;. ).
In preferred U. ~ o 1 1 ~ the transgene which inhibits the action of a gene product which is graft-~ . .- - S;. iâ other than: an MHC gene; a swine MHC gene; a 20 recipient MHC gene; a non-primate MHC gene; or a non-human MHC gene.
In yet other preferred r~mhorli~-nte the transgene inhibits the expression or action of a gene product which is graft-~mthgnnieti~ e.g., by decreasing the expression of the gene product. E.g., the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-,- . .I h~ ' protein, e.g., the donor cells' B-7 receptor, CD27 2~ receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by homologous .cc ....l ,;, -';..,. results in an rl rl~ gene which is Ill;~ AUI~ J or which is mutationally iUI~i~ 1, by, e.g., the hlLIuJu.,liu..ofamutation,e.g.,adeletion,intoanr~ genomiccopyofthegene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a 30 donor receptor for a host cytokine.
In another aspect, the invention features, a transgenic swine having cells whichinclude one or both of: a transgene encoding a graft-supporting protein, e.g., a primate or a human graft-supporting protein, e.g., a primate, e.g., a human, protein, preferably a ni. ;r peptide; or, a transgene which inhibits the expression or action of a gene 35 productwhichisgraft-,...l..gl...;~ Examplesoftransgeneswhichinhibittheexpression or ~tion of a gene product which is graft- ~ g. ;~1;. include: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-~ g,. u;. protein, e.g., an anti-sense RNA which inhibits the ~ wo 96/06165 ~ ~ 9 6 3 1 1 P~ J~'IO~V
expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protem; a transgene which is a mntAtinnAlly inactivated copy of a gene which encodes a donor graft-- S Ag~ protein and whichwhen inserted into the donor genome, e.g., by hl~mr~ gml~ '; .,. results in an 5 ~lldo~ .u~ gene which is Ill;~A~ d or which is mutationally hla~ 1, by, e.g., the i~,LIudu.,Livllofamutation,e.g.~adeletion~intoanr~ genomiccopyofthegene which encodes the donor graft .- ~ .". ".~ protein (e.g., the insertion of a transgene results in a knockout for a donor-derived receptor for a recipient-derived protein which is a graft A, ~ l ;r protein); a tr~msgene which encodes an inhibitor of â donor- or 10 recipient-derived graft-A,.~ protein, e.g., a ~;ulll,u.,.iLive inhibitor or a protease or other molecule which specifically inhibits the activity of the graft A~ protein;
amd a transgene which encodes a dominant negative mutation in a gene product which is graf -A . ,l ~,,, .. ,1~l ;~, e.g., a donor cell receptor for a host cytokine.
In preferred . ., .1.o~ . .. 5 ~ the transgene encoding a graft-supporting protein is: a 15 recipient MHC gene, e.g., a primate, e.g., a non-human primate or a human, MHC gene.
In preferred . .,.l-o.l;",. ..I~ the transgene is one which inhibits the expression or action of a donor MHC gene product (which gene product is graft-A l ~g. ." ~
In preferred ( .., .l ,o.l; .. ,... I ~ the tr msgene encoding a graft-supporting protein and/or the transgene which inhibits the expression or action of a gene product which is 20 graft-A ~-g~ s other than: an MHC gene; a swine MHC gene; a recipient MHC
gene; a non-primate MHC gene; or a non-human MHC gene.
In preferred ~..,.l.c..l"". .,1~ the transgene encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of l )~ Examples of growth factor or cytokine 25 receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-67 IL-I I, IL-2, Epo, and uteroferrin.
In other preferred ....,1 "~ the transgene encodes a graft-supporting protein, e.g., a human a&esion molecule, e.g., an adhesion molecule involved in rl ~ A n " , and/o m ~ lA I It, ., -- e of I r,u;~.i., cells. Examples of human a&esion molecules include VLA-4, c-kit, LFA-I, CD 11 a, Mac-l, CR3, CDI I b, pl 50, p95, CDl l c, CD49a, LPAM-I, CD49d, CD44, CD38, and CD34.
In yet other preferred rl~l.OP: ....I~ the transgene encodes a recipient or donor protein, e.g., a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine), inhibits an immune response mounted by 35 donor cells against the recipient, e.g., IL-I0, IL-4, IL-2, or TGF-!3.
In yet other preferred r ~ v~lh1~ the transgene encodes a graft-supporting protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immume . , .. .. . . . ...... : .. .... . .. . .. .. .. . .. . ... . . ... . ... . ... . . ....

WO96/06165 219!6~ PCT/US95/10250 g response mounted by recipient cells against donor tissue, e.g., IL-I 0, IL-4, IL-2, or TGF-13 .
In yet other preferred Pmho~limPnlc the transgene encodes a chimeric molecule, e.g., a chimeric lylll,JhOhil.~, e.g., PIXY123.
S In yet other preferred Pmho~limPntC the transgene inhibits the expression or action of a gene product which is graft-~ g. ~ S~ , e.g., by decreasing the expression of the gene product. E.g., the transgene is a mutationally inactivated copy of a gene which encodes a donor graft-""~ i protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when 10 inserted into the donor genome, e.g., by homologous ~ ,., results in an C gene which is Illi~ c, .~,d or which is mutationally Lld~Li\ ' i, by, e.g., the introduction of a mutation, e.g., a deletion, into an r~ "1~ genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes~n anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-A, .I ~g~", ..; ;~.
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene 20 product which is graft-.. " l ~g.~ e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
In yet other preferred . .~ c~ the transgene includes a nucleic acid encoding a graft-supporting protein, e.g., a primate or human graft-supporting protein, e.g., a primate or human L~ LUI~Uh~I;C peptide or a transgene which inhibits the action of a gene 25 product which is a graft-,.. .~ , e.g., a gene product which is the donor receptor for a recipient protein which is a graft Al l~ i( . protein operably linked to: a promoter other than the one it naturally occurs with; a swine promoter, e.g., a swine h~lll.ltul~u;~L;c gene promoter; a viral promoter; an inducible promoter; or a d~ ly regulated promoter.
In yet other preferred .. hu~l;,., .. 1~ the transgenic swine cell is L~ yguu~ for the transgene; the transgenic swine cell is h~,...;,, ~uu~ for the transgene; the transgenic swine is h~t.,lu~y~;uu~ for the tr~msgene; the transgenic swine is hu~lu~y~uu~ for the transgene (h.,t~,lu~y~5uu~ tramsgenic swine can be bred to produce offspring that are Lulllu~y~uu~ for the transgene); the transgenic swine includes two or more transgenes.
Transgenic swine (or swine cells) of the invention can be used as a source for '~Luulo~ I ' r ' ''~ cells for xenogeneic grafting into human subjects.
Transgenic swine or swine cells of the invention can also be used to measure and/or 219~311 WO 96/06165 ~ ' . 9 identify agonists or antagonists of a human growth factor, cytokine, or other molecule involved in 1 Tc~u;~ , regulation.
Transgenic swine cells of the invention derived, e.g., from retrovirally l r~ .d cultured cells, or from a transgenic animal, can be used to induce S ;~ IrTr,~,;r tolerance m a recipient animal to a grafl from a donor svvine. For example, cells of the invention can be combined with methods of inducing tolerance described in USSN 08/126,122,fi1ed September 23,1993.
The invention provides for the; ~ t ;~ 1 ~ of swine donor cells which have been engineered to increase desrrable intPrrrtinnc betwee~ the donor cells and molecules and 10 cells of a recipient, e.g., to promote the ~ n~ l or function of the donor stem cells in the recipient ~llvhvlll~ L. (Generally, stem cells are implanted to induce tolerance to (or other vise promote acceptance of) donor graft cells.) The invention also provides for the h ~ Tr ~ of donor cells which have been engineered to minimi~ unwanted intPrArtir,nc between the donor cells and molecules and cells of the recipient which, e.g., promote the rejection of donor grafl cells or which inhibit the function of the donor grafl cells. The invention provides for I .. ~1,1 - ~ -' ;, .,~ methods wherein either, or both, the stem cells and the grafl cells are so engineered. Engineered alterations which increase desired ;":..,.. I;.",c between donor stem cells and the recipient may, in some cases, be ". .-1 ~;, ,.1 ~Ir in the cells of the grafl. Likewise engineered alterations which decrease unwantedintrrArtil~nc between the donor grafl cells and the recipient may, in some cases, be, ~, ..lr ~ 1P in tbe donor stem cells. Thus, the invention includes methods in which the donor stem cells and the donor graft differ in that one has an engineered alteration which tbe other lacks. E.g., in some ~ ,iu.,~ the donor stem cells will have a transgene not present in the graft cells and the donor grafl cells will have a transgene not present in the donor stem cells.
~ ccordingly, in amother aspect, the invention features, a method of inducing tolerance in a recipient mammal, e.g., a primate, e.g., a human, to grafl cells (or otherwise promoting the ~ceptance by a recipient marnmal of grafl cells) from a donor mammal, e.g., a miniature swine, including:
'UILIUIIU~,;llg into the recipient, donor h.,.. _tul,u;.lic stem cells, and iu~udu~ g into the recipient, donor grafl cells, provided that at least one of the following conditions is met: (I) the donor stem cells have been genetically engineered to promote a desirable inter~tion between the donor stem cells and cells or molecules of the recipient; (2) the donor stem cells have been genetically engineered to inhibit an unwanted interaction between cells or molecules of the recipient and the donor stem cells; (3) the donor grafl cells have been genetically engineered to promote a desirable inter~tion between the donor grafl (and/or stem) cells and cells or molecules of the recipient; or (4) the donor grafl cells have been genetically WO 96106165 2 1 9 ~ 3 1 1 PCIIUS95/10250 1 engineered to inhibit an unwanted interaction between cells or molecules of the recipient and the donor graft (and/or stem) cells.
In prèferred r " ,l)o~ if the genetically engineered alteration in (l) or (2) is the insertion of an MHC gene, e.g., a swine MHC, a donor MHC gene, a recipient MHC
S gene, a non-primate MHC gene, or a non-human MHC gene, then one or both of, donor cells which are genetically altered by other than the insertion of an MHC gene, or, genetically altered cells other than h~ luyoi~L;c stem cells, are also introduced into the recipient.
In preferred ~ . . ,I~o,l; ~ if a cell having a transgene which is an MHC gene, 10 e.g., a swine MHC, a dûnûr MHC gene, a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene, is a.LIli.li~Ltl.d to the recipient, then a second cell, which has a transgene other than an MHC gene, e.g., a swine MHC, a donor MHC gene, or a recipient MHC gene, a non-primate MHC gene, or a non-human MHC gene, is also adlllilli~Ltl~d to the recipient.
In preferred embodiments: genetically engineered refers to the inclusion of a transgene; the donor stem cells have a genetically engineered alteration, e.g., a transgene, which the donor grafl cells lack; the donor graft cells have a genetically engineered alteration, e.g., a transgene, which the donor stem cells lack; the donor stem cells have a first genetically engineered alteration, e.g., a frst transgene, which increases an 20 interaction between the stem cells and molecules or cells of the recipient and the donor graft cells have a second genetically engineered alteration, e.g., a second transgene, which decreases an interaction between the donor graft cells and molecules or cells of the recipient.
In preferred r',Illol~ the donor stem cells include a transgene which 25 encodes a graft-supporting protein, e.g., a L~ UPO;~1;C peptide and the donor graft cells do not include the transgene of the donor stem cells.
In other preferred rll,l,u.l;.l.r..~. the donor graft cells include a transgene which inhibits the action of a gene product which is a graft-h ~ , e.g., a gene product which is the receptor for a recipient protein which is a graft - ~ ~g~ ;- protein and the donor stem cells do not include the transgene.
In yet other preferred r~ ~.l .o.l;,, l~ the donor stem cells include a transgene which encodes a graft-supporting protein, e.g., a human growth factor or cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of Examples of growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
In yet other preferred r l l 1l lc~ the donor stem cells include a transgene encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., an adhesion moleculeinvolvedin r.ll~Ar~ and/or ~ of 1~ ;rl;Acells. Examples ~ WO 96/06165 219 6 31'~1 pcr/rTsss/lo2so ~ ~ .

of human adhesion molecules include VLA-4, c-kit, LFA-I, CD1 la, Mac-1, CR3, CDllb, pl50, p95, CDllc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
In yet other preferred embodiments: the donor stem cells, the donor graft cells, or both, include a transgene which encodes a recipient or donor protein, a cytokine which 5 directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by donor cells agamst the recipient, e.g., IL-I0, IL-4, IL-2, or TGF-~.
In yet other preferred . . . ,h~v~ the donor stem cells, the donor graft cells, or both, include a transgene which encodes a graR-supporting protein, e.g., a recipient or 10 donor cytokine which directly, or indirectly (e.g., by the strmulation or inhibition of the level of activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-I0, IL-4, IL-2 or TGF-~.
In yet other preferred r~ ~ ~ho~ the donor stem cells, the donor graft cells, or both, include a transgene which inhibits the expression or action of a gene product which 15 is graft-A, . l Ag. .";~ Examples of transgenes which inhibit the expression or action of a gene product which is graft ;~ Ag~ l;r rnclude: a transgene which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-~ protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of 20 the recipient-derived protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-AntAgnni~tif protein and which when inserted into the donor genome, e.g., by hnmnk~ml~ ;nn results in an c" 1 ,~..,.,.,~ gene which is ~ ~A~)lcD~ i or which is mlltAtinnAlly illa~iV i~ by, e.g., the il~luJu~,~iull of a mutation, e.g., a deletion, into an . ".lng, ...., .~ genomic copy of the gene which encodes 25 the donor graft-A" lA"l " ,;~1 ;r protein (e.g., the insertion of a transgene results in a knockout for a donor-derived receptor for a recipient-derived protein which is a graft A. ,~
protein); a transgene which encodes an inhibitor of a donor- or recipient-derived graft-1;. protein, e.g., a ~,UIII~ iV~ inhibitor or a protease or other molecule which specifically inhibits the activity of the graft A ~ - protein; and a transgene which 30 encodes a dominant negative mutation in a gene product which is graft-h"l hgn. ,: ~1 ;., e.g., a donor cell receptor for a host cytokine.
In yet other preferred r~ ~ho~ the transgene inhibits the expression or action of ageneproductwhichisgraft-h"~ ,e.g.,bydecreasingtheexpressionofthe gene product. E.g., the transgene is a mnt~tinnAlly inactivated copy of a gene which 35 encodes a donor gmâft-A.~ ;. protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted mto the donor genome, e.g., by hnmnlngml~ IC~ .h;~ results in an ~ - .1Or" ..~ gene which is llf~AIJIC~ d or which is m--totinnAlly illa~iV ' 1~ by, e.g., the WO 96/06165 ~ PCT/US95/102~0--udu~livll of a mutation, e.g., a deletion, into an r ~ n~ genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes an anti-sense RNA which, directly or 5 indirectly, inhibits the expression or action of a recipient-derived graft-.. " ~
protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokme.
The tMnsgene can be one which encodes a dominant negative mutation in a gene product which is graft~ ;, e.g., a donor cell receptor for a host cytokine or donor I û B-7 receptor, CD27 receptor, or LFA-3 receptor.
In yet other preferred ~,., ,ho~ l; ~, .. . ,1~, the donor stem cells, the donor graft, or both, include a transgene which encodes a chimeric molecule, e.g., a chimeric Iylu~llvhill~, e.g., plXY123.
In yet other preferred rmh~rlimrntc the donor mammal and the recipient 15 mammal are of different species, e.g., they are discordant primates, e.g., a human recipient and a nonhuman donor; the recipient is a primate, e.g., a human; the donor is a swine e.g., a miniature swine.
In yet other preferred r~ .hn.l;. .- ~1~ the donor mammal and the recipient mammal are of the same species, e.g., both are primates, e.g., humans; the recipient and 20 donor are of the same species and the donor stem cells include a transgene, introduced e.g., by retroviral I ....~r...." - ;nn of cultured donor stem cells, amd the cells of the donor graft do not include a transgene.
In yet other preferred Pmhn~limPntc the donor of the stem cells and the donor ofthe graft are both miniature swine and: the stem cell donor is from a strain which has been 25 genetically engineered to express a graft supporting protein; the graft donor is a strain ha been genetically engineered to have decrea ed expression for a protein which is g,~ to gMft acceptance or function; the graft donor amd the stem cell donor are inbred; the graft donor and the stem cell donor are MHC identical.
In yet other preferred emho~liml~ntc the transgene includes a nucleic acid operably 30 linked to; a promoter other than the one it naturally occurs with; a swine promoter, e.g., a swine h 1~ u;~ ;, gene promoter; a viMI promoter; or an inducible or d~ ,lv~lu~lllally regulated promoter.
In yet other preferred . . . ,I)n~ the genetically engineered swine stem cell is:
isolated or derived from cultured cells, e.g., a primary culture, e.g., a primary culture of 35 1 ,~v;~lic stem cells; isolated or derived from a transgenic animal; isolated or derived from cord blood; obtained from an individual animal from which the graft cells are obtained; obtained from an individual animal which is syngeneic with the individual animal from which the graft cells are obtained; obtained from an individual animal which 2~3~1 WO 96/06165 ~ PCT/US95/10250 is MHC matched, and preferably identical, with the individual animal from which the graft cells are obtained; a cord blood, a bone marrow h "- ' ~,u~: ;r stem cell, o} a fetal or neonatal liver or spleen cell l- , stem cell.
In preferred .. I.l,,,.l;........ l~ the donor graft cells are other than a l ~
5 stem cells, or other blood cells; the donor graft cells are swine thymic cells, e.g., swine thymic stromal cells; the donor graft cells are bone marrow stromal cells; the donor graft cells are swine liver cells; the donor graft cells are swine kidney cells; the donor graft cells are swine epithelial cells; the donor graft cells are swine muscle cells, e.g., heart cells; the donor graft cells are swine neuronal cells; the graft cells include an organ, e.g., a 10 kidney, a liver, or a heart; the donor graft cells include dendritic cells or their precursors.
Other preferred ~. . ,T ,o~ include: the step of introducing into the recipient, donor species-specific stromal tissue, preferably I ,,o;.li~ stromal tissue, e.g., fetal liver or thymus. In preferred nlllhO.l;l~ the stromal tissue is introduced u~ ~ly with~ or prior to~ the l~ l tu~o;~ , stem cells. In preferred ~,., .l .o.l;,.... , 15 the stromal tissue has been: genetically engineered to promote a desirable interaction between the stromal cells and cells or molecules of the recipient; genetically engineered to inhibit an unwanted imteraction between cells or molecules of the recipient and the stromal cells.
Otherpreferred ~.. ,l,o.l;.. ..,l~ include those in which: the transgenic stem cells are d~LI;II;vt~ d to the recipient prior to or ~i.. l1,.. ,. u~ ~ with 1, .. "~ ;.... of graft cells;
the I ' r ' ~ stem cells home to a site in the recipient; the stem cells are adllUU;v~ d by hlLl~ lluua injection.
Otherpreferredn",ho.l;"....l~include(preferablypriorto~ d..gthestem cells): hla~.Liv~ g the natural killer cells of the recipient mammal, e.g., by illLlUdU~illg 25 into the recipient mammal am antibody capable of binding to natural killer cells of the recipient; hl~ iillg the T cells of the recipient mammal. e.g., by illllU(IU~illg into the recipient an antibody capable of binding to T cells of the recipient.
Other preferred f-mho~limPntc include: the step of creating h ~ ~: : ;r space, e.g., by one or more of, irradiating the recipient with low dose, e.g., between about 100 30 and 400 rads, whole body irradiation, Alllll;l~;~.S .. ;I~g a myl~oau~ ,vaiv~ drug to the recipient, or ~.l, ...., .~:.. ;.,g anti-class I antibodies to the recipient, to deplete or partially deplete the bone marrow of the recipient; the method includes the a step which creates h. .~ "~ ; space and the step is performed prior to illtlUllU~Ulg the transgenic cells mto the recipient.
Other preferred ~,IlJvodilll~.llLa include hla~,Li VvLillg thymic T cells by one or more of: (preferably prior to h. ~ - 5 ~1'~;: ;r stem cell I, ""~ l ;on) irradiating the recipient mammal with, e.g., about 700 rads of thymic irradiation; ~,l, .,;. I;~lrl; ~ Ig one, or preferably two or more, doses of an anti-T cell antibody; or ~ ' g to the recipient a short WO 96/06165 219 6 ~1~ PCT/US9S/10250--~ } ~ 14;
course of an ;lll.l..,.,..~,.ly,l~aa~lL as described in USSN 081220,371, filed March 29, 1994.
Other preferred r ~ ~ 5 ~ include: the step of depleting or otherwise hla~Liv~Lllg natural antibodies in the blood of the recipient mammal, e.g., by S l ~ p~ ~ r~ lg an organ~ e.g.~ â liver or a kidney~ obtained from a pig or ~ g a drug, e.g., d~,u~a~ ,u~llill (DSG) which inactivates or depletes natura. antibodies; the method includes a step which depletes or othervvise inactivates natural antibodies in the blood of the recipient and the step is performed prior to I ~~oi~Lic stem cell Transgenic swine cells of the invention derived, e.g., from retrovirally 1'..".,. .1 cultured cells, or from a transgenic animal, can be used in amy method callmg for the ~llgl~ 1 of swine ? ~ ' r ' '-~' cells in a xenogeneic ~llvhulull~lL. For example, cells of the invention can be combined with: methods which induce tolerance or otherwise promote the acceptance of a graft by ~ l of a short course of cy~,loa~ulhl~ or similar agents, e.g., the methods described in USSN 08/220,371, filed March29, 1994; methodswhichusethe;~y~ l;"~,ofaxenogeneicthymicgraftto induce tolerance, e.g., the methods described in USSN 08/163, 912 filed on December 7, 1993; methods of increasing the level of the activity of a tolerance promoting or GVHD
inhibiting cytokine or decreasing the level of activity of am a tolerance inhibiting or GVHD promoting cytokine, e.g., the methods described in USSN 08/114,072, filed August 30, 1993; methods of using cord blood cells to induce tolerance, e.g., the methods described in USSN 08rlS0,739, filed November 10, 1993; the methods of USSN 08/126,122, filed September 23, 1993; and the methods for inducing tolerance disclosed in Sykes and Sachs, PCT/US94/01616, filed February 14, 1994.
In another aspect, the invention features, a method of promoting the ~ a, Irl 1land or rrpnp~ ti'~n of the bone marrow of a xenogeneic recipient, e.g., a pr imate, e.g., a human, by donor swine l ,~ol~Lic stem cells and thereby inducing mixed chimerismin the xenogeneic recipient. The method includes: providing a genetica ly engineered swine cell (which may or may not be a I pu;.,;i/, stem cell) which has been genetically engineered to promote a desirable interaction between donor stem cells and cells or molecules of the recipient or which have been genetically engineered to inhibit an unwanted interaction between the recipient and donor stem cells; and, implanting the genetically engineered swine cell in the recipient, provided that, if the genetically engineered swine cell is not a swine l~ y~ stem cell, a swine l, I ~t ~1~u ;;~ stem cell i5 also i?nplanted in fhe recipient In preferred rl I ~l~o~ the genetically engineered alteration is other than the insertion of an MHC gene, e.g., a swine MHC, a donor MHC gene, a recipient MHC
gene, a non-primate MHC gene, or a non-humam MHC gene.

~wo 96/06165 2 1 g ~ 3 1 1: PC'r/US95/10250 ' 15 In preferred embodiments: genetically engineered refers to the inclusion of a tr msgene.
In otberpreferred rll,l.O.l;",. ..1~ the genetically engineered swine cells include a transgene which encodes a graft-supporting protein, e.g., a human growth factor or 5 cytokine receptor, e.g., a growth factor or cytokine receptor involved in the regulation of h~ .., t~ Examples of growth factor or cytokine receptor include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.
In yet other preferred ~" .l .o.l; l . ,~ the genetically engineered swine cellsinclude a transgene encodes a graft-supporting protein, e.g., a human adhesion molecule, e.g., am adhesion molecule mYolved in ., .~, ,. n .. ,1 and/or, . ,,,;. ,l ~, .. ~ of I r,oi~,.;c cells. Examples of human adhesion molecules include VLA-4, c-kit, LFA- I, CD 11 a, Mac-1, CR3, CD1 lb, pl50, p95, CD1 lc, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.
In yet other preferred wlll,o~ L~ the genetically engineered swine cells, include 1~ a transgene which inhibits the expression or action of a gene product which is graft-,1, ~,.."~ Examples of transgenes which inhibit the expression or action of a geneproduct which is graft-h..~ 1; include: a transgene which encodes an anti-sense RNA which, directly or mdirectly, inhibits the expression or action of a recipient-derived graft-,..,lug~ ,. protein, e.g., an anti-sense RNA which inhibits the expression of a 20 donor-encoded receptor for a recipient-derived protein (and thereby inhibits the action of the recipient-derived protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-~ " protein and which when inserted into the donor genome, e.g., by hulllolo~;uu~ .. ~...,.l. ~;.... results in an r,ll~L~ c gene which is ll~ lc ~acd or which is m--tSltion~lly inactivated, by, e.g., the introduction of a 25 mutation, e.g., a deletion, into an rl ,.1nl,~, .. ,..~ genomic copy of the gene which encodes the donor graR-....lu~ l,. protein (e.g., the msertion of a transgene results in a knockout for a donor-derived receptor for a recipient-derived protein which is a graft ~
protein); a transgene which encodes an inhibitor of a donor- or recipient-derived graft-l~nta~nnictjc protem, e.g., a cul.~ ive inhibitor or a protease or other molecule which 30 specifically inhibits the activity of the graft rlntagrmictic protein; and a tramsgene which encodes a dominant negative mutation in a gene product which is graft-~ .1,.~. .,.:~1;., e.g., a donor cell receptor for a host cytokine.
In yet other preferred rll,l,,,ll;.,l- .:~, the genetically engineered swine cells include a tramsgene which inhibits the action of, e.g., by decreasing the éxpression of, a gene 35 product which is a graft-,"-~ E.g., the transgene is a mllts~tinnhlly inactivated copy of a gene which encodes a donor graft .- ~ ~;~ protein, e.g., the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine, and which when inserted into the donor genome, e.g., by hnmnlogl~llc ~c~...,.l.;..,.l;.... results 2~96~

in an ClldU~ lUU:~ gene which is 111;5~ ~pl~a~d or~which is mnt~tifm~lly inactivated, by, e.g., the hlLIudu~,Liull of a mutation, e.g., a deletion, into an f~n~if~g~nf~u~ genomic copy of the gene which encodes the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes an anti-sense RNA which, directly or indirectly, inhibits the expression or action of a recipient-derived graft-, ~ l ~g~ ;f protein, e.g., an anti-sense RNA which inhibits the expression of a donor-encoded B-7 receptor, CD27 receptor, or LFA-3 receptor, or a donor receptor for a host cytokine.
The transgene can be one which encodes a dominant negative mutation in a gene I û product which is graft ~, l .g~ ;f, e.g., a donor cell receptor for a host cytokine or donor B-7 receptor, CD27 receptor, or LFA-3 receptor.
Inyetotherpreferred~,.,l.o.l;.l.~"l~ thegeneticallyengineeredswinecells, include a transgene which encodes a recipient or donor protein, a cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of activity of a second 15 cytokine) inhibits an immune response mounted by donor cells against the recipient, e.g., IL-I0, IL-4, or TGF-~.
In yet other preferred embodiments: the genetically engineered swine cells, include a transgene which encodes a graft-supportmg protein, e.g., a recipient or donor cytokine which directly, or indirectly (e.g., by the stimulation or inhibition of the level of 20 activity of a second cytokine) inhibits an immune response mounted by recipient cells against donor tissue, e.g., IL-I0, IL-4, or TGF-~.
In yet other preferred r~ o~ t~ the genetically engineered swine cells include a transgene which encodes a chimeric molecule, e.g., a chimeric ly~ hoh;lle, e.g., PIXY123.
2~ In yet other preferred ~",l,o.l;.. ,l~ the genetically engineered swine cell is isolated or derived from a cultured cell, e.g., a primary culture, e.g., a primary culture of L~,.llflu~u;~,.ic stem cells; the genetically engineered swine cell is isolated or derived from a transgenic animal; if the genetically engineered swine cell is not a stem cell, then the genetically engineered swine cell and the stem cell which is also ~dll~ d are 30 obtained from the same animal, from animals which are (except for the alteration of the invention) syngeneic, or from animals which are MHC matched, amd preferably MHC
identical; the genetically engineered swine cell is a cord blood cell, a bone marrow L~U~1LUIJO;~L;C stem cell, or a fetal or neonatal liver or spleen cell l- " ~ .p,~.. I ;~. stem cell.
In preferred ~ u~ the genetically engineered swine cells are other than 3~ I..., ... ~ ,p...: ;~ stem cells, or other blood cells; the genetically engineered swine cells are thymic cells, e.g., swine thymic stromal cells; the genetically engineered swine cells are bone marrow stromal cells; the genetically engineered swine cells are swine liver cells;
the genetically engineered swine cells are swine kidney cells; the genetically engineered ~6311 ~ WO 96106165 PCT~US95~10250 ,. 17 swine cells are swine epithelial cells; the genetically engineered swine cells are swine muscle cells, e.g., heart cells; the genetically engineered swine cells are swine neuronal cells, the genetically engineered swine cells are swine dentritic cells or their precursors.
Other preferred t~ubO~ b include (preferably prior to 1 1, .; ": ~ ; l .g the stem 5 cells): iua~,LivaLillg the natural killer cells of the recipient mammal, e.g., by iu~LIudu~,iulg imto the recipient mammal an antibody capable of binding to natural killer cells of the recipient; hla~LiY~Itillg the T cells ofthe recipient mammal, e.g., by h.LIu.lu~,i.lg into the recipient an antibody capable of binding to T cells of the recipient.
Otberpreferred ~",l,o.l,.". .,1~ include: the step of creating l- , ~ space, 10 e.g., by one or more of, irradiating the recipient with low dose, e.g., between about 100 amd 400 rads, whole body irradiation, ~ l8l;~lrl ;"g a lllylLvau~)plc~;vc drug to the recipient, or d'l 1 1 1; 11;~ 1 d 1 Ig anti-class I antibodies to the recipient, to deplete or partially deplete the bone marrow of the recipient; the method includes the a step which creates l,.." ~ Ip.~ ;. spaceandthestepisperformedpriorto hlLludu~ g thetransgeniccells into the recipient.
Other preferred rllll ,oll;l"~ . include hla~,Liv~Lillg thymic T cells by one or more of: (preferably prior to 1 I stem cell ~ Al ion) irradiating the recipient mammalwith,e.g.,about700radsofthymicirradiation;~l",;":~f. .;.,gone,orpreferablytwo or more, doses of an anti-T cell antibody; or ~ u . 81_ to the recipient a short course of an i ~ 'Pl" c~allL as described in USSN 081220,371, filed March 29, 1994.
Other preferred ~ " ,1),~11;", ~1~ include: the step of depleting or otherwise iua~,Livaiillg natural antibodies in the blood of the recipient mammal, e.g., by llp an organ~ e~g~ a liver or a kidney~ obtained from a pig or .~ lrl;llp~ a drug, e.g., d~ y~ ualhl (DSG) which inactivates or depletes natural antibodies; the method includes a step which depletes or otherwise inactivates natural antibodies in the blood of the recipient and the step is performed prior to l~ ;ic stem cell , ~ " ~ ; nn In preferred ~ , the method includes the step of hlLluLlu~illg into the recipient a graft obtained from the donor which is obtained from a different organ than the h~llla~u~Oi~i;c stem cells, e.g., a liver or a kidney.
Genetically engineered swine cells of the invention can be made by methods known to those skilled in the art, e.g., by retroviral transduction of swine cells. Methods for producing tramsgenic swine of the invention use standard transgenic technology.
These methods include, e.g., the infection of the zygote or organism by viruses including cLIuvilu~c:~ the infection of a tissue with viruses and then lchlLIuLh._;llg the tissue into an animal; and the h-LIu-lu-Liu-l of a .~...."1,;"- ,I nucleic acid molecule into an embryonic stem cell of a mammal followed by appropriate n~nir~ tion of the embryonic stem cell WO 96~06165 2 1 9 ~ 3 l i PCT/US9S/10250--to produce a transgenic animal. In particular, the invention features a transgenic swine, whose germ cells amd somatic cells contain a transgene including a DNA sequence encoding a 1.. ." ~ . peptide and a tissue-specific promoter operably linked to the DNA sequence, wherein the tissue-specific prornoter effects expression of the 5 h~ vuv;~,i;c peptide in bone marrow cells of the swine, the transgene being introduced into embryonal cells of the animal, or an ancestor of the animal.
Yet another aspect of the invention features a method for identifying or testing an agent, e.g., a therapeutic agent, e.g., an agent useful in treating a ~ disorder, by evaluating the agent's effect on transgenic swine cells of the invention. In an 10 illustrative . ",l~o":..,..~l an agent is aLIl;ll;~ cl to a transgenic swine, and the state of a h~ v~uoicLic tissue, an aspect of mPt~h-~licm or an aspect of gene expression, evaluated and compared with that of a control standard, e.g., that of a control transgenic animal.
The present method may be employed, for example, to determine the in vivo efficacy of agonisOE or antagonists of human 1~ growth factors. Analogous ~p ;,.,. .,~
15 can be performed with cultured cells.
It has been ,1........ ,~;,. d that xenogeneic donor I - r ' ''~ stem cells, when engrafted in xenogeneic recipients, can induce a state of donor-specific tolerance to 1 donor organs. Even low levels of I c,uvicLic chimerism can be sufficient to induce this tolerant state. However, the loss of chimerism (which often occurs) is associated with a 1.1~ ~ .. i I - .1 Ioss of tolerance. The animals, cells, transgenes, and methods of the invention cam be used to promote the formation amd of chimerism. The transgenes, transgenic cells, transgenic animals, and methods of the invention are also useful in drug testing protocols, e.g., in protocols for identifying agents which interact with human receptor or adhesion molecules, e.g., for identifying agents 25 which act as agonists or antagonists of human growth factors or adhesion molecules. The transgenes, transgenic cells, transgenic animals and methods of the invention are also usefulfoml.~..,.,;";,,gthespeciesspecificityofaninteractionbetweenahumamreceptor or adhesion molecule and a swine ligand.
Other features and advantages of the invention will be apparent from the following detailed d~''ripti~'n and from the claims.
D~t~ De~ril linn of th~ TnvPnlir)n The drawings will first be briefly described.
n~
Fig. I is a diagram of the GS4.5 retroviral construct.
Fig. 2 is a diagram of the GS4.5 proviral genome and the expected transcripts.
Figs. 3a and 3b are lc,wu~cllL~Liull~ of flow cytometry profile of tramsduced cells.
Fig. 4 is a diagram of the 1~ .1 "~.h 1~ 1;1 .l l assay.

~ WO 96/06165 2 1 9 6 3 1 1 PCT/US95~10250 f 19 1. RepoplllAtinn of XrnnPen~ ir Bnne M
F.~ . ~h,o~ of the invention relate to genetically engineered swine cells, e.g., to genetically engineered l~ JO~ stem cells, which express rPrr,mhin:lnt peptides, e.g., human peptides. The peptides enhance any of: the survival, rl 1~ n .. "
S proliferation, or function of swine cells implanted in a xenogeneic host.
In an exemplary clIll,n-l;.. Il the survival, c, ~ i n ,. Il, proliferation, or function of stem cells, or the d., ~ ~.lu~ L of the stem cells, into di~t~c~lLk. ~ l cell types of the cells,inthepresenceofahumanl---,.-l--~,o;~ -lvhu-llll~llL~suchasfoundinhuman . tissues, e.g., bone marrow, is promoted. The engineered cells can express, 10 e.g., a human growth factor receptor, e.g., a human growth factor involved in the conhrol of l r ~ Examples of human growth factor receptors include the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-ll, IL-2, Epo, and uteroferrin. In other exemplary r",hr,.l",.. .;~ the engineered cells express a human adhesion molecule involved in ... ,~, ~ n ., ....~ and/o m l ln l ~ r Of l ,.., ~ ,po;. I ;c cells. Examples of such molecules includeVLA-4,c-kit,LFA-l,CDlla,Mac-l,CR3,CDllb,pl50,p95,CDllc,CD49a, LPAM-I, CD49d, CD44, CD38, and CD34.
Competitive Ir~-ulJ l ~- ;. ., . shldies of discordant bone marrow hransfer have shown tnat ~. .,n~" ... i. ~ r,uh,;ic cells can be at a ~;ullll~.,lilive d;;~adv~ulia~, for rec.nnQtihlhnnofaxenogeneichost,especiallywhenl"."~ .t iasapartofanon-20 IllykualJlaLive regimen. That is, when stem cells of the host are available, the host cells will generally have a cw.l~ ve advantage in recn,nQtihltinn of the host. This ~,ulll~,;ilive advantage c~n be a major factor preventing Ir~ by engrafted n~nosenrir l,. .., ,~ stem cells. Several factors may be I~ Jull~ilJlc for the Cu~ ."iLive advantage enjoyed by autologous bone marrow over engrafted Yrnngenrir 25 stem cells. The advantage appears to derive in part, from an inability of the Y r~ g~ "rir cells to adequately engage growth factors and rYtrAr~ Ar mah ix (ECM) .. , .l.. ; ~ of the host.
Both rYtrAr~lllll~r mahix c.. l... ~- and growth factors play important roles in the regulation of l.. ~ ~ S ~ amd the ,. ,~ - r of both stem and di~el~llLi~Led 30 l ~ ~ ~ s ~I ~. ; ;r cells~ and therefore are of ~ e to the survival of Yrnngen~-ir cells.
~ Stem cell . . . - .S . e, for example, require growth factor binding as well as close r~mge i"~. ,,. l;....~ with ~ Iuu-ldillg cells for r~ "rlll~ 1, e.g. shromal cells. However, both ECM irt~rArtinnQ and growth factor binding by l.~ to~ ,ic cells can be, at leastpartially, species dependent, such that in xenogeneic settings, the grafted marrow is at a 35 ~wll~,.iLive di~adv~lL~Ige relative to autologous marrow in at least one of mitogenic stimulation or r~ n . , .... I For example, the species specificity of adhesion molecule i.. .. - 1.. ~ (such as mediated by VLA-4, c-kit, LFA-I, CDl la, Mac-l, CR3, CDI lb, pl50, p95, CDl lc, CD49a, LPAM-I, CD49d, CD44, CD38, or CD34), are thought to be .. . == = ~ . . __ . .. _ . . ... ... .. ...

u ~

WO96/06165 ~ ' PCT/US95/10250 important in 1- ~- r ' ' The failure of such adhesion molecules to inter~t with ligandsfromthehostspeciesmaybeamajor;~ tohomingandlc...,,J;l,,l;....
by xenogeneic stem cells. Likewise, a number of growth factors, e.g. 1,....,. 1 . ,pf~
growth factors, are known to show varying degrees of species of specificity in their 5 receptor ;., ~ .,.. 1;. ..,~ For instance, G-CSF displays sigmficant, though not absolute, species specificity. IL-3, for example, has a very marked species specificity.
In an illustrative ~ , described in further detail below, the human c-kit receptor (hereinafter "c-kit"), the ligand for SCF, is engineered into swine stem cells.
Because the human c-kit bearing stem cells can interact effectively with human SCF
10 bound to stromal cells, and because human SCF can act as growth factor for this ~c~.~...l~;.."..lswinestemcells,someoftheuull~p~,iilivcadvantageenjoyedbyhuman marrow would be lost to the engrafted swine stem cells Thus, the use of c-kit humani~d swine cells can facilitate improved rec~tihlfif~n of a human subject by swine stem cells.
A similar approach can be used for human I ~I~u;~ , growth factor receptors, such as 1, IL-3 receptors and GM-CSF receptors, as well as for human adhesion molecules that are involved in hC~ LUIJO;~ and for which swine cells do inter~t effectively with the human ligand. Thus, in one aspect of the invention, the subject "hul~ li~d" swine cells can be used in ~ rl If l~ l n;. .g protocols. By virtue of an improved ability to respond to human factors which regulate 1.. s.p~-: :;f cells (relative to the wild-type swine cell), 20 the humanized cells can be used to improve r~a~ 1nlll ~1 and/or survival of swine SJ~ stem cells, and thereby promote tolerance, in humans subjects. Preferred clllbOdilll~,llLa of the present invention include a method of providing a growth selective advantage to a transgenic cell, relative to the ~ullcapulldillg wild-type cell, when used as a source of xenogeneic graft tissue, by providing a swine cell which expresses a human 25 1.. . "~ l ,o:f tif peptide, e.g., by producing a transgenic mammal having at least l cell containing and expressing a lC~ . ,., ,1.:..,..I nucleic acid molecule of the present invention.
The rf-f flmhin~nt nucleic acid molecule containing tramsgenic marnmal is maintained for a time period sufficient for the h. . ., 1. ,po:. 1 ;. modulator gene present in the l~, .. "h; ", ., nucleic acid molecule to be expressed in the cell and thereby provide a selective 30 advantage to the transgenic cell, relative to the uJll~,a~olldillg wild-type cell, when pl,. ~t ~1 into another species. In another aspect, the u ~ "h;lln~l swine cells, ,uf I L;.,ul~ l,v transgenic swine bearing such cells, are useful for assaying the efficacy of .1,;"~.,I humam 1.. .~ p~ factors.
As used herein, a graft-supporting protein refers to a protein which has one or 3 'i more of the following properties: when expressed in a swine cell, it prolongs or other vise promotes the acceptance of that cell in a xenogeneic donor; when expressed in a swine cell, it prolongs or otherwise promotes the acceptance of another swine cell in a xenogeneic donor; when expressed in a swine cell, it increases or otherwise promotes the 21~3~1 function of that swine cell in a xenogeneic donor; when expressed in a swine cell, it irlcreases or otherwise promotes the function of another swine cell in a xenogeneic donor.
The graft-supporting protein can be expressed either, or both, prior to, or after, ., . of the cell or tissue it affects is implanted in the xenogeneic host. The graft-5 supporting protein can exert its action on a swine cell or tissue either or both, prior to or after the affected cell or tissue is implanted in a xenogeneic recipient. E.g., the graft-supporting protein can be expressed in a cultured cells, and then, graft-supporting protein expressing cultured cells implanted (alone or with other swine tissue) in a donor, the graft-supporting protein can be expressed in a transgenic swine, and graft-supporting 10 protein expressing cells from the transgenic swine implanted (alone or with other swine tissue) in a donor. (An affected cell or tissue is a cell or tissue upon which the graft-supporting protein has a direct or indirect (through its action on another cell) effect; the affected cell or tissue can be the cell or tissue which expresses the graft-supporting protein, or a cell which does not express the graft-supporting protein, e.g., a cell or tissue 15 implanted together with a graft-supporting protein expressing cell.) Examples of graft-supporting proteins include: recipient HLA molecules; recipient growth factor receptors;
recipient adhesion molecules; and recipient or donor proteins related to the function of the graft. Graft-supporting proteins include h~ v~ ;ctic proteins.
As used herein, a graft- ~ - protein is a protein the expression of which, 20 by the graft tissue or by the recipient, promotes an immune response directed against donor tissue or against the recipient, or is otherwise ~lla~u~ ic to the function of the stem cells or graft or is otherwise ,~ u. to the acceptance of the donor stem cells or the graft by the recipient. Examples of graft ~IL~UII;.~iC proteins are donor cell surface receptors for host proteins which mediate an immune response against the donor cell, e.g., 25 the donor cell B7, CD27, or LFA-3 receptors, or a donor receptor for a host cytokine.
As used herein, the term "transgene" means a nucleic acid sequence (encoding, e.g., one or more 1 r ' ' peptides), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an rl ,.1, ~;, . .~ .. .~ gene of the transgenic pig or cell into which it is introduced, but which is 30 designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). A transgene can include one or more 1.,- ~, ;1.l ,"" 1 regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of the selected nucleic acid, 35 all operably linked to the selected nucleic acid, and may include an enhancer sequence.
As used herein, the term "transgenic cell" refers to a cell containing a transgene.
As used herein, a "transgenic animal" is any animal in which one or more, and preferably essentially all, of the cells of the animal includes a transgene. The transgene is __ . , . _ . ,, .. , ., .. , :,, . . ., . _, _ .. ... _ . , ., . .... .: .. , . ~, . ,=, ... . .. . ... .

21963i~
WO 96/06165 ~ ~ PCTIUS95/10250 , ,22 introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic monirlllotirln, such as by Ill;.lu;llJ~ ion or by infection with a rec.r,mhino~lt virus. The term genetic ~ does nol include classical cross-breeding, or in ~itro fertilization, but rather is directed to the introduction of a 5 IC~ ",h".,. ,I DNA molecule. This molecule may be integrated within a l_hlullloaullle, or it may be .,Al~ ,LIvllloaull.ally replicating DNA. In the transgenic animals described herein, the transgene causes cells to express a IC~ . ""1,;" -- .I peptide, (e.g., a 1~ . I~II1);I~AIII
h.,lll_t~L~ù;.,i;~, peptide, e.g., a human growth factor or cytokine receptor involved in regulation of I ,L o;~;a, such as receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-10 11, IL-2, Epo, or uteroferrin, or a human adhesion molecule involved in ~"~, r n " ,. . I l and/or~ ,....,.".Pofl---- ' r~- -cells,suchasVLA'4,c-kit,LFA-l,CDlla,Mac-l, CR3, CDI Ib, pl50, p95, CDI lc, CD49a, LPAM-I, CD49d, CD44, CD38, or CD34), in cells that do not express such Lll._'u~u;~lic peptides in a wild-type, non-transgenic animal. Transgenic swine which include one or more transgenes encoding one or more 15 human hPmf~tr~pniPtir peptides are within the scope of this invention. For example, a double or triple transgenic animal, which includes two or three transgenes can be produced.
As used herein, the term "germ cell line transgenic animal" refers to a transgenic animal in which the transgene genetic illr~ ;r~l~ exists in the germ line, thereby 20 conferring the ability to transfer the i l l r. ,. ", ~ l, to offspring If such offspring in fact possess some or all of that ;-, ru. ~ I then they, too, are transgenic animals.
The term "' , gene" is used herein to mean any gene whose gene product, preferably a human gene product, which when expressed by a swine 1- ~ ' r " cells, is capable of enhancing the ability of a swine h~ IUL U;~I;C stem cell 25 to ~,ulllL c~ ullali~ul~ a primate, e.g., a human host. For example, the hurnan-gene product can enhance the proliferative ability of ~ .I swine cells in human subjects; increase the ability of swine cells to bind to P~tr~rP~ or matrix ~ or enhance the functional activity of swine marrow cells. In preferred ....I.o.l; .... .: ~ the human I~- 1, - .uo: ir gene encodes: a cell surface protein; a human 1~ L~r~ g-rowth factor receptor, such as receptors for G-CSF, SCF, GM-CSF, ~L-3, IL-6, IL- 11, IL-2, Epo; or uteroferrin, or a human adhesion molecule involved in rl 1~ n 1 " ,1 and/or ...~i.. ., -- . of' ,,oi~Lic cells, such as VLA-4, c-kit, LFA-I, CDlla, Mac-l, CR3, CDllb,pl50,p95,CDllc,CD49a,LPAM-l,CD49d,CD44,CD38,orCD34. Thegene products of human I ~,uu;~ , genes are referred to herein as "human h~ lllf Lu,uoi..dc 35 proteins or peptides (the terms protein, peptide, and polypeptide are in this sense used hlt~l~.llf ,Igc.l~ly)'', and include human 1~ ." t- ~uk ' ;f growth factor receptors and hurnan h ll,'..~u~ adhesionmolecules. Theterm"growthfactor",or"l~ L.u I; growth factor", is used to desf,rihe biologically active molecules which can, for example, ~ WO 96106165 219 6 ~1 j PCT/US9~/102~i0 stimulate ,ululif,laliull ofthe lc~..,.,l.;,.,~"l swine cell, enhance binding to ECM
c~ ~ ~p~ . a ~ andlor increase the functional activity of the cell. The term "cytokine" is used h t~La~ ,ably with growth factor. Examples of 1- ~,uo;~ic growth factors include G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-I 1, IL-2, Epo, and uteroferrin. "Growth S factor receptors" are protein(s) expressed by cells, typically on the PYtrrrPII~ r surface, which facilitate binding of growth factors by the cell and which alone, or in UU~ ,Liull with other cellular proteins, induce a biological response in the cell to the binding of the growth factor. TT~ .p. ; genes include those which encode a hybrid protein, e.g., a peptide which encodes both human and swine CUIllUOll~ e.g., a hybrid receptor with a 10 human PYt-~rP~ r domain and a swine intrz~rPll~llSIr or I l ,- .~ 1 " , ~. domain. A
hematopoietic protein is a protein encoded by a I r ' " ~ gene.
As used herein, the term "operably linked" means that selected DNA, e.g., encoding a h~ alu,uu;ctic peptide, is in proximity with a Ir m~rrirtil~nrl regulatory sequence, e.g., tissue-specific promoter, to allow the regulatory sequence to regulate expression of the selected DNA.
The term "genetically ,UlU~lallllll~ as used herein means to p~lllall~llLly alter the DNA, RNA, or protein content of a cell. Typically, this genetic pr ~r~mmin~ is a. ~ ,l by hlLlullu~;llg into a swine cell a ~~ .1 nucleic acid molecule which encodes a l~ peptide.
As used herein, the term "I~C~ .I swine cells" refers to cells derived from swine, preferably mrniature swine, which have been used as recipients for a r~ .. 1.;.. -- , vector or other transfer nucleic acid, and include the progeny of the original cell which hasbeentransfectedor l",..~r..,~ Inapreferred 1,~..1.o,l; ..~,.l, the lc~ l swine cell is derived from a swine 1~ t~u~ ~ 1; stem cell. e.g., a swine bone marrow 25 h~llalulJO;~h~ cell, and has been genetically ,ulu~;lall~ ,i to express a IC~'''IIIl;ll~''~l hum~m peptide. ~,r.... ~1. - 1l swine cells include cells in which transgenes or other nucleic acid vectors have been hl-,UI~ ' ' into the host cell's genome, as well as cells harboring expression vectors which remain :~1 a. " " ll l~ from the host cell's genome.
As used herein, the term '~tr~ncf~cti~ means the introduction of a nucleic acid,30 e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
"Tl"..~rl.lll -:;..,l",asusedherein,referstoaprocessinwhichacell'sgenotypeischanged as a result of the cellular uptake of exogenous DNA or RNA, and, e.g. the a ~ r ", swine cell expresses human cell surface peptides.
As used herein, the term "vector" refers to a nucleic acid molecule capable of 35 uall ~uul lillg another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-.,hl ulllusulllàl replication.
Preferred vectors are those capable of autonomous replication and/expression of nucleic wo 96106165 219 6 31 ' 24. PCTIUS95110250 1~

acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors".
"T. n~ regulatory sequence" is a generic term used throughout the ~1,. .;(~ ~I;..,.torefertoDNAsequences,suchasinitiationsignals,enhancers,and 5 promoters, which induce or control 1, n ~ l of protein coding sequences with which they are operably linked. In preferred r. "I .o.l;" .. ,~ . . of the 1~ ~ . .., ,l ,; . .A. , 1,~.,. S~ geneisumderthecontrolofapromotersequence(orotherl.r.,~..,~,l;.", regulatory sequence) which naturally controls the expression of the ~ gene in humans, or which naturally controls expression of the ~ullc~,uulld;llg gene in swine cells.
10 In even more preferred rl ~ ~h~J~l; . . I 11~, the I l n, ~ regulatory sequence causes h~ u~ùicl;c-speciflc expression ofthe rec.-mhinDnt protein. The above rlllhrJll;lll. .,;~
not wi~ .g, it will also be understood that the Ic . .. 1 .1.;. .~ gene can be under the control of I l nl ,~ regulatory sequences different from those sequences naturally controllinglln"~,.;l,l;.~aofthe~.""l,;"n.,lprotein. Tr~D~ne~ripti~nofthe~
15 gene, for example, can be under the control of a synthetic promoter sequence. Preferably, the promoter sequence controlling L~ ,~ ofthe Icl,ulllhhlollL gene is active (i.e., can promote gene expression) in bone marrow cells, especially I - c~,oicL;c cells. The promoter that controls ~ ;- ~, of the ~ " .l ~ gene may be of viral origin;examples are promoters sometimes derived from bovine herpes virus (BHV), Moloney20 murine leukemia virus (MLV), SV40, Swine vesicular disease virus (SVDV), and cytomegalovirus (CMV).
As used herein, the term "tissue-specific promoter" means a DNA sequence that serves as a promoter, i.e., regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in 25 specific cells, e.g., h~ U~O;~L;C cells. The tissue specific promoter directs expression ,ulcdulll;ll~lLly~ if not exclusively in l- , cells. Particularly useful promoter sequences for directing expression of human L~llldLul,oictic genes include: promoter sequences naturally associated with the IC~ .h i ~ . I human gene; promoter sequences naturally associated with the h~ g~ e pig gene (i.e. I,UllC~,UUlldhlg to the 1~.. l".. ~.
30 human gene); promoters which are ~tive primarily in l, ,.- ~.1.,6. :;. cells, e.g. in Iymphoid cells, in erythroid cells, or in myeloid cells; the immlm~-gl-~b~llin promoter described by Brinster et al. (1983) Nat~re 306:332-336 and Storb et al. (1984) Nature 310:238-231; the ;., .., .. ~ gl~b. lin promoter described by Ruscon et al. ~1985) Nature 314:330-334 and Grosscheld et al. (1984) Cell 38:647-658; the globin promoter described by Townes et al. (1985) MoL CelL BioL 5:1977-1983, and Magr. m et al. (1989) MoLCelL Biol 9:4581-4584. Other I .~,ù;.,.i~, promoters are described herein or will be apparent to those skilled in the art, and may include regulatory sequences derived from such Iymphoid genes as CDI, CD2, CD3-r, CD3-o, CD3-~, CD3-~, CD3-71, CD4, CD5, ~ wo 96i06165 ~19 6 3 ~1 PCT~US95/10250 CD7, CD8, CDI9, CD20, CD38, CD40, CD45, CD72, CD76, p561ck, IL-2R~ chain, Jl Id (heat stable antigen), fyn, NKI, NK2, Fc Rly chain, IL-2R ,B-chain, aTCAR, ~TCAR, y TCAR, oTCAE~, FcyRIlI~ RAG-I, RAG-2, Ig-~ (B29), or IgM-a (MB-I) and genes associated with imnn-m~lglnb--lin isotypes Igll, Igo, Igy, Iga, Ig~; Igk and Ig~. Moreover, 5 such promoters also may include additional DNA sequences that are necessary for expression, such as introns and enhancer sequences. The term also covers so-called "leaky" promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well. Other regulatory elements e.g., locus control regions, e.g., DNase I hy~ a~,llD;liv~ sites, can be included.
By "cell specific expression", it is intended that the 1, ,.. 1~, ;pl ;l l ,~1 regulatory elements direct expression of the ~ ,, . ,1,; " ~ protein in particular cell types, e.g., bone marrow cells. The term "h- ~ s~p~ specific expression" therefore refers to expression of a 1~ . .. "1,;,, -, I protein which is substantially restricted to L,lllalu~)O;~,Li~, cells.
"Graft", as used herein, refers to a body part, organ, tissue, or cells. Grafts may consist of organs such as liver, kidney, heart or lung; body parts such as bone or skeletal matrix; tissue such as skin, intestines, endocrine glands; or progenitor stem cells of various types.
The term "tissue" as used herein, means ariy biological material that is capable of being ~ p~ r.1 and includes organs (especially the internal vital organs such as the heart, lung, liver, kidney, pancreas and thyroid), cornea~ skin, blood vessels and other cormective tissue, cells including blood and I cl.oi~ic cells, Islets of T .:lngf~rh~ne brain cells and cells from endocrine and other organs and bodily fluids, all of which may be candidate for ~ p~
"A discordant species ~"."1.;., ~;~"", as used herein, refers to two species in which hyperacute rejection occurs when a graft is grafted from one to the other. In the subject invention, the donor is of porcine origin and the recipient is human.
"TT. ." s ,p.~ . stem cell", as used herein, refers to a cell, e.g., a bone marrow cell, a fetal or neonatal liver or spleen cell, or a cord blood cell which is capable of developing into a mature myeloid and/or Iymphoid cell.
"Progenitor cell", as used herein, refers to a cell which gives rise to an differentiated progeny. In contrast to a stem cell, a progenitor cell is not always self renewmg and is relatively restricted in d~v~,lv~ llal potential.
As used herein, the term "' ,pvi~Lic cells" embraces di~tl~ ' ' ' blood cells, including: cells derived from a myeloid lineage, including Ill~aL~ yv~y t~ monocytes, granulocytes, and er~einAFhile~ cells derived from an erythroid lineage, such as red blood cells; and cells of a Iymphoid lineage such as B Iylllpho~,yLt~ and T Iylll~,hO~,ylts. As is generally Im~l.orstnol1, each of the above lineages mature from "lJh~ Jut".ll 1, ... . ,1,..:.: ;.
stem cells" (also referred to herein as "h~ stem cells" or "colony-forming stem WO 96/06165 219 ~ 3 11 PCTIUS9S/10250 ~

cells"), which undergo a series of d;rf~ iiull steps leading to hl~s~ ly lineage-restricted progenitor cells. Thus, the term h~ cell also r~ the various he~ ,t~,~u;~ic precursor cells from which these dirrtl~ ia~ed cells develop, such as BFU-E (burst-forming units-erythroid), CFU-E (colony forming unit-erythroid), CFU-S Meg (colony forming unit~ e), CFU-GM (colony forming umit-~l~,ulo~ e-monocyte), CFU-Eo (colony forming unit-eosinophil), and CFU-GEMM (colony formingunit-granulocyte-erythrocyte-megakaryocyte-monocyte).
"Stromal tissue", as used herein, refers to the supporting tissue or matrix of an organ, as .l; ~ l.. d from its fimctional elements or pa~ llld.
"Tolerance", as used herein, refers to the inhibition of a graf recipient's immume response which would otherwise occur, e.g., in response to the ;ll~UJdU~iUll of a nonself MHC antigen into the recipient. Tolerance can involve humoral, cellular, or both humoral and cellular responses. Tolerance, as used herein, refers not only to complete ;, . " " . .. ,nln~ . tolerance to an antigen, but to partial imnnnnnlogir tolerance, i.e., a degree 15 of tolerance to an antigen which is greater than what would be seen if a method of the invention were not employed.
"MHC antigen", as used herein, refers to a protein product of one or more MHC
genes, the term includes fragments or analogs of products of MHC genes which canevoke an immune response im a recipient organism. Examples of MHC antigens include 20 the products (and fragments or analogs thereof) of the human MHC genes, i.e., the HLA
genes. MHC antigens in swine, e.g., miniature swine, include the products (and fragments and analogs thereof) of the SLA genes, e.g., the DRB gene.
"Miniature swine", as used herein, refers to wholly or paltially inbred animal.
As described herein, the transgenic donor tissue may come from a cell culture or25 from a transgenic swine. The transgenic swine should express (or be capable of expressing) the l~c~ ..,.l.;., - ~ human gene in at least the tissue to be u ..,.~ Ir~l The practice of the present invention will employ, unless otherwise indicated, techniques which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by 30 Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press:1989); DNA
Cloning, Volumes I and II aD. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J.
Gaited., 1984);Mullisetal.U.S.PatentNo.4,683,195;NucleicAcidHybridizationaB.
D. Hames & S. J. Higgins eds. 1984); TranscriptionAnd Translation (B. D. Hames & S.
J. Higgins eds. 1984); Culture Of Animal Cells a~. I. Freshney, Alan R. Liss, Inc., 1987);
35 ~mmobili~d Cells And Enzymes aRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors ~or Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 ~Wu ~ WO 96106165 2 1 9 6 3 ~ ~ PCT/U595J10251~

et al. eds.), ~ 1, Meth~ods In C~ll And Molecular Biology (Mayer amd Walker, eds., Academic Press, London, 1987); Handbook Of E~ mmunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); 11' , ''AtilZg the Mouse limbryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Although methods and materials similar or equivalent to those described herein cam be used in the practice or testing of the present invention, the preferred methods and materials are described below. All publications mentioned herein are iUl~Ul~)l ' ' by reference. In addition, the materials, methods, and examples are illustrative only and not mtended to be limiting.
IT. R~ ~.,,i.;"~ HnnnAn (~n! c IllLIudu~Liul~ of a human 1 ' r ~ ~ gene into a swine cell of the present invention requires that the Ir~ ~ 1l l Ih l -- .1 human gene be transfected into the cell, or a precursor of the cell. As will be nnri~ rctnAJ~i, the mode of introduction and the desired mtegration phenotype of the resulting swine cell (i.e. whether the vector is integrated into the cell's genome or remains a ' ~ ) can influence the choice of expression vector used to generate the subject lC' ~ h .~ I swine cells. In general, expression vectors containing the human 1 , . - gene can be constructed by operably linking an a~ u~l;a~e 1~ regulatory sequence, e.g. a tissue-specific promoter, with a nucleic acid, e.g. cDNA or genomic DNA, encoding the 1 , protein.
Moreover, a tissue-specific promoter can be linked to more than one cDNA, each encoding a different human 1- r ~ protein, or a human L~llaLulJu~ , protein and some other foreign protein, e.g., another cell surface antigen. Depending on the specific promoter used, it may be desirable to modify the promoter-cDNA construct to include an intron splice site andlor a pOl~ad~,ll.ylaiiull signal.
In addition to the 5' and 3' expression regulation sequences and the 1~ . " "1.;, .~ . , DNA (either genomic or derived from cDNA) the transgenes of the invention can also include a "IC~"'I'h;"'"'l intervening sequence" which interrupts the transcribed but ' 5' region of the transgene. Such intervening sequences (IVS) are known in the art. Such sequences as used herein are "hnm nlngmle, c ~., ~" .1,; ",. . .I h.t., ~ .,l~lg sequences" in that the 5' and 3' RNA splice signals in the IVS are those normally found in am IVS from an ~n ing~n~.l.c or h~,t~uloy,uu~ gene. Re~ , 1,: - .1 ill.~.~,Uillg sequences may, however, also comprise a "hybrid intervening sequences". Such hybrid intervening sequences comprise a 5' RNA splice signal and 3' RNA splice signal from intervening sequences from different sources. In some aspects of the invention, such hybrid IVS
comprise at least one "~ ;ve RNA splice sequence". As used herein, a permissive RNA splice signal is an RNA splice signal sequence, preferably a 3' RNA splice signal, from an intron contained within a repertoire of germ line DNA segments which undergo , . 1. . . I during cell dilF..~ idtion. Lxamples of such gene repertoires include the ~ == . _ _ _ . . _ , . . _ . . ...... _ .. _ . _ _ .. .. _ = ... ... _ .. _ 2~9631'~

immnAA,L;lAIbulin super gene family, including the i~ gll bulil~ and T-cell antigen receptors as well as the repertoire of the major l ,;~ ; h;lity complex (MHC) genes and others. Particularly preferred permissive splice sequences are those obtained from the ;, . " . " .. ,.~lr.l..,l;,. repertoire, preferably of the IgG class, and more preferably those 3' S splice signal sequences associated with the J-C segment Ir-' I ' ' Ig~ of the Ig heavy and light chain, most preferably the heavy chain. Hybrid intervening sequences containing permissive RNA splice signals are preferably used when the l~ lh;
DNA ~UII~ UUlld:~ to a cDNA sequence.
Based on the foregoing, it is apparent that preferred transgenes can include l O relatively large amounts of 5' and 3' expression regulation sequences. FurLher, the .r~.,."h,;,.A..l DNA is preferably derived from genomic clones which may be tens to hundreds of kilobases in length. Based on the present technology for cloning and~ I IA I ~;l ~ lIAl; I IL; DNA, the cu~.~.L u~liu~l and lld~,lu;llJ~,~liull of transgenes is practically limited to linearized DNA having a length not greater than about l OOkb. However, the l S transgenes of the invention, especially those having a length greater than about 50kb, may be readily generated by hlLIudu~ lg two or more u . ~lla~JIJhlg fragments of the desired transgene into an embryonal target cell. When mtroduced, the uv~llalJ,uhlg fragments undergo 1...,, .~ g~ .l . 11.; l . ' ;-111 which results in integration of the fully lr~ . d transgene in the genome of the target cell. In general, it is preferred that such u ~ ,u;llg 20 transgene fragments have 100% homology in those regions which overlap. However, lower sequence homology may be tolerated provided efficient ~ 1IU~ IC~
occurs. If non-homology does exist between the h~ sequence portions, it ispreferred that the non-homology not be spread throughout the h~lmnlog~ sequence portion but rather be located in discrete areas. Although as few as 14 base pairs at 100%
25 homology are sufficient for homologous lr.~ .,..l,;, -';..., in ,.,A..,..,AI;A.. cells (Rubnitz et al. (1984) A~oL CelL ~ioL 4:2253-2258), longer h~ o~ ;u~ ~ sequence portions arepreferred, e.g. 500bp, more preferably l,OOObp, next most preferably 2,000bp and most preferably greater than 2,000bp for each homologous sequence portion. It may also be desirable to use YAC's and MAC's for mRnirll1Rti,A~n of l~ . .I nucleic acids of the 30 invention.
In further ~lllbod;lll.,.lb, the Ir<~ .,.,1; ~ --.11.. ~ t- ~1~~ ' ;~ protein can be a chimeric peptide having a portion encoded by a human h~ gene, amd a portion encoded by a swine h ~ S 'l"~ gene. In a preferred r~ ~ ~hO~ , the chimeric protein comprises an r~trRrl~ Rr domain of human origin, and an intrR~ l1Rr domain (and 35 l, Al ~ r domain) of swine origin. Such a chimeric protein can be useful in UIII:~kUlCI_.~ such as where Lhe intnRr~ lRr domain of the human molecule is less efficient than the swine counterpart at engaging intrRl~ nlDr signal I I A..~ proteins of the swine cell.

~ wo 96/06165 2 1 9 6 ~ . PCT/US9S/10250 Techniques for making fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed inaccordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for d,u~lul terrnini, 5 filling-in of cohesive ends as _p,UlU. ' ', alkaline ~ treatment to avoid uud~ le joining, and enzymatic ligation. Alternatively, PCR A.l~pl;~ ;.... of gene fragments can be carried out using anchor primers which give rise to ~ ..., ~1.l... ,...:A. ,y overhangs between two ~iulla~,-,uLiv~ gene fragments (e.g. between the human gene and the swine gene) which can ~ ly be annealed to generate a chimeric gene 10 sequence (see, for example, Current Protocols in Molecular Biology, Eds. Ausubel et al.
John Wiley & Sons: 1992).
Sincethemid-1980's,anumberûfl~ ;rgrowtllfactorreceptorshave been cloned from human sources and are readily accessible by standard molecular biological techniques for use in the present invention (see, for review, Foxwell et al.
(1992)C~in~.rplrm~n~ol90:161-169). Inmanyinstances,thel.~,~ dl.l;.. ,.Alregulatory sequences naturally associated with the cloned genes have likewise been identified and well ~ - ;,- I Moreover, in light of the present disclosure, it will be apparent to one skilled in the art that other suitable genes can be obtained from human sources, and swine trAAncAription~l regulatory sequences obtained and used with the human gene.
Inoneaspectoftheinvention,thel~ .. ll;.. A 1l swinecellsarederivedtoexpress the human c-kit gene, or another member of the closely related tyrosine kinase receptor family to which it belongs, such as the colony-stimulating factor I receptor (c-fms), a platelet-derived growth factor receptor (PDGF-Ra and PDGF-RB), or a fetal liver kinase (FLK-I or FLK-2) (see, for review, Andre et al. (1992) Oncogene 7:685-691). cDNAclones, and in some instances genomic clones, of each of human c-kit (Ogawa et al.
(1994)ExpHematol22:45-51;Vardenbarketal.(1992)0ncogene7:1259-1266;Yarden etal. (1987)EMBOJ6:3341-3351;Blume-Jensenetal.(1991)EMBOJ10:4121-4128), human c-fms (Bourette et al. (1993) ~Q~ 81: 2511-2520; Dibbs et al. (1990) ~th E~f~2:301-311; Sherr(1988)Leukemia2:1325-1425),humanPDGF-Raandhuman PDGF-Rb (Matsui et al. (1989) 12~ 86:8314-8318), and human FLK- I and human FLK-2 (U.S. Patent No. 5,270,458; PCT Publication No. WO 93110136; PCT Publication No. WO 93/00349; U.S. Patent No. 5,283,354) have been isolated, and as describedbelow, can be used to generate the expression vectors, including transgenes, required to derive the subject swine cells. Moreover, the promoter sequences, and other 1.,.. ,~. ;l.l,.. l regulatory sequences, have been .. l.~ . l ;, d for each receptor (Yasuda et al. (1993) ~iochrm ~;oph,vs Res Commun 191 :893-901; Yamamoto et al. (1993) ,~
Cnn~ pr R~ 84:l l36- l l 44)~ and can be utilized in the ~ ti- gene construct. Al ~Iy, the regulatory sequences flanking the cwl~"uulll;llg swine gene _ . _,, . .. _ . , . _ _ .. . = _ . = .. = . .. .... .. . .. . .. .. ... .... .

WO 96/06165 219 6 31 1 PCT/US9S/102~0 ~

(genomic) can be cloned by standard techniques and emp!oyed to regulate expression of the human gene in the lC ' swine cell.
In another aspect ofthe invention, the lc~ swine cells are engineered to express the human Gl~lulo~ Ma~lu~ Colony-Stimulating factor (GM-CSF) receptor. The human GM-CSF receptor has been cloned (Sasaki et al. (1993) ~
~h~2Z268:13697-13702;Sakamakietal(1992) E~OJ11:3541-3549;Hayashidaetal.
(1992)NipponRinshoS0:1867-1871;Metcalfeetal.(1990)~,~87:4670-i674;
Gearingetal(1989)EMBOJ8:3667-3676;Locketal.(1994)PNAS91:252-256and Kitamuraetal.(1991)1~i88:5082-5086),andfoundtoconsistoftwopolypeptide chains, the "alpha chain" and the "beta chain", the latter of which is utilized by other growth factor receptor complexes, such as the IL-3 receptor and the IL-5 receptor. Each of the two chains cam be expressed from the same expression vector, or from two separate expression vectors within the same cell. A transgenic swine which express a first transgene can be crossed with a transgenic swine which expresses a second transgene to provide a transgenic animal which expresses both. (~fo(1ifir~lfir,n~ of this technique can be used to add third and subsequent genes as well.) Thus, a transgenic swine which expresses only one transgene or the other of the alpha or beta chains, can be cross-bred with the appropriate transgenic mate to yield offspring which are chimeric for both chains. Alternatively, only the alpha chain need be expressed as it may form active receptor complexes with the swine beta chain. The alpha chain provides most of the binding specificity to the receptor complex and is therefor more likely to influence species specific binding of GM-CSF than is the beta chain.
In similar fashion, human IL-3 receptors can be constituted in swine h~ àlu~o;~l;c cells utilizing the cloned genes for each of the alpha and beta chain subunits(Sakamakietal.(1992)1i~MBOJ11:3541-3549;andKitamuraetal.(1991)6/1 661165-1174) to derive appropriate expression vectors.
Thus, a nucleotide sequence derived from the cloning of the humam l S,o;~
gene, encoding all or a selected portion of the human protein, can be used to produce a , ~ ..., .1.: ., - .I form of the human protein in swine cells. Ligating the poly.lul,le~,l;dc 30 sequence into a gene construct, such as an expression vector, and 1,, " r~ ., . . " . .g or 1.,.., F . 1;,,g into swine cells can be carried out by standard procedures.
The l~ ~ ..., .l ... ,~ .I nucleic acid constructs described above may be inserted into any suitable plasmid, b~ I .. ,..~.l .~g~, or viral vector for ~ ;. l, . and may thereby be propagated using methods known in the art, such as those described in Molecular 35 CloningA Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press:1989). In the preferred G,.,l.o,l,.,...,l~, expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells are used. Eukaryotic cell expression vectors are well known in the art amd are available from 21 9 6 3 ~1 WO 96tO6165 :- PCT/US95/10250 several ~,UII~ .;~ sources. The ~nreferred swine expression vectors contain both~-uhal~uLiu sequences (to facilitate the IJlUIJa~dtiUl~ of the vector in bacteria), and one or more eukaryotic 1~ units that are functional in swine cells. Typically, such vectors provide convenient restriction sites for insertion of the desired ~ DNA
5 molecule. The pcDNAI, pSV2, pSVK, pMSG, pSVL, pPVV-I/PML2d and pTDTI
(ATCC, No. 31255) derived vectors are examples of 1l ", 1~-, expression vectors - suitable for 1~ r~. l ;. ", of swine cells. Some of these vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both l luh~uLic and eukaryotic cells. Alternatively, derivatives of 10 viruses such as the bovine papilloma virus (BPV-I), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for expression of proteins in swine cells. The various methods employed in the preparation of the plasmids and ~ r, ~ " of hostcells are well known in the art. For other suitable expression systems for useful in the present invention, as well as general l~ procedures, see Molecular CloningA
15 Laboratory Man21al, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989).
Under those .,h~ ,. . wherein the 1~ nucleic acid molecule is introduced into swine oocytes as a transgene to be ill~.Ulp~ ' ~ into the host genome, the construct can be lineari~d and excess vector sequences will preferably be removed, for 20 example, by cutting the 1,~,~ .,l.;,.~.,l nucleic acid molecule with one or more restriction to produce a linear nucleic acid molecule containing as a minimum, the desired trPn~rriptir,nPl regulatory sequences and a human I r ' gene. Preferablythe nucleic acid molecule (e.g. the transgene) is from about 5,000 base pairs to about 100,000 base pairs in length.
The suitability of particular human l ~ proteins, e.g. whether the humam protein is more appropriate than its swine coumterpart, can be determined using one of the assays described below, and its cDNA can then be determined by st~mdard techniques. For example, according to the invention, one would linh a promoter with cDNA encoding human c-hit to create a vector for expression of human c-hit in swine cells. The expression of this promoter-? r ~ ' ~ ~ protein transgene can be verified, for example, by direct detection of human c-hit expression in appropriate tissue culture cells. Additionally, the ability of the human gene to potentially provide improved in vivo surviva. of the transgenic swine cells can be predicted in vitro by comparing the relative biologic activities of the human versus the ~ h~ protein in swine cells. Improved survival should be correlated with the ability of the ~ ; "~ ~l cell to grow in semisolid media in response to a humam growtb factor.
Some transgenic pigs may carry multiple copies of the transgene, with the tr~msgene copies ;". ~ (1 at different sites in the genome. The site of transgene inrnrrnr:~tion into the genome can strongly influence transgene expression; therefore, one may correlate transgene expression with discrete transgene restriction fragment length polymorphism patterns. In addition, as discussed above, two transgenic swine, each expressing a different l ..., . ~ .. 1 ;r protein, or one I "o;.,ii, protein and some other 5 foreign antigen. e.g. a human MHC peptide, on the same, or different, tissue cells, can be mated to produce an amimal that expresses bnth tr~ncgrn~ products. The same effect can be achieved by introducing two separate tramsgenes into the same embryonal cell.Exemplary in vitro assays useful for ~ g whether a particular human h. . ., ~ protein is suitable for use in methods of the invention include: (I) assays 10 that measure binding of the ligand, e.g. growth factor of ECM rnnnrnnPnt, to the eYtrs~rp~ r domain of the humam h~ protein on the cell surface of the l~.,,,,l.;.,~.,l swine cell; and (2) assays that test for activation ofthe signal s ~.,~.l.,. I;.,, pathways that are activated by the interaction of the human cell surface protein and an agonistic ligand. The first class of assays is useful to, for example, identify potential 15 human h~ tvlJu;~ ; proteins which may improve viability of xr~ nr~l swine marrow by comparing the binding constant of the human ligand (e.g. SCF, IL-3, GM-CSF) for the recnmhin~t swine cell versus the naturally occurring swine cell. The second class of assays is preferred to determine which of the human I ~ proteins are suitable for use in the present invention based upon their ability to function in the swine cell.
20 TTT Gpnptir~l~y Er~in~-Pred SwinP Cplls Transgenic swine cells of the invention can be produced by any methods known to those in the art. Transgenes can be introduced into cells, e.g., stem cells, e.g., cultured stem cells, by any methods which allows expression of these genes at a level and for a periodsufficienttopromote~"~.,.lll"..,lor.,.",l,t .A. ~ ofthecells. Thesemethods25 include e.g., tr:ln~f~rtion, cl~ u~uul~Lion~ particle gun bombardment, and tr:~m~lu~tinn by viral vectors, e.g., by lcllvvh u,c,. Transgenic swine cells can also be derived from transgenic animals.
RPtrovir~ ofTr~nc~enPc Re~...,.l.h,,..lllcLIuvilu,.,,areapreferreddeliverysystem. Theyhavebeen 30 developed extensively over the past few years as vehicles for gene transfer, see e.g., Eglitisetal., 1988 ,Adv. Exp. Med. Biol.241:19 . ThemostaL-~I.L~vlv~al.lretroviral vector construct is one in which the structural genes of the virus are replaced by a single gene which is then transcribed under the control of regulatory elements contained in the viral long terminal repeat (LTR). A variety of single-gene-vector backbones have been 35 used, including the Moloney murine leukemia virus (MoMuLV). Retroviral vectors which permit multiple insertions of different genes such as a gene for a selectable marker and a second gene of interest, under the control of an internal promoter can be derived from this type of backbone, see e.g., Gilboa, 1988, Adv Exp. Med. Biol. 241:29.

~ - 21~211 _ WO 96/06165 ~ V ~J PCr~US95/10250 The elements of the C~ LI u~,Lio-l of Avectors for the expression of a protein product are known to those skilled in the art. The most efficient expression from retroviral vectors is observed when "strong" promoters are used to control transcription, such as the SV 40 promoter or LTR promoters, reviewed in Chang et al ., 1989, Int. J. Cell Cloning 5 7:264. These promoters are ~,ull~LiLuLive and do not gcnerally per nit tissue-specific expression. Other suitable promoters are discussed above.
The use of efficient packaging cell lines can increase both the efficiency and the spectrum of infectivity of the produced 1~ virions, see Miller, 1990, ~uman Gene Therapy I :5. Murine retroviral vectors have been useful for ~ f ,; "g genes efficiently into murine embryonic, see e.g., Wagner et ai., 1985, EMBO J. 4:663;Griedley et al., 1987 Trends Genet. 3 :162, and ~ - - - ApA i~tir stem cells, see e.g., Lemischka et al., 1986, Cell 45:917-927, Dick et al., 1986, Trends in Genetics 2:165-170.
A recent ilU~ IIL in retroviral technology which permits attainment of much higher viral titers than were previously possible involves AmplifirAAtiA,n by c~ c~.uLive 15 transfer bet~-veen ecotropic and ~ll~ L~ ;c p~kaging cell lines, the so-called "ping-pong" method, see e.g., Ko ak et al., 1990, J. Yirol. 64:3500-3508; Bodine et al., 1989, Prog. Clin. BioL Res. 319: 589-600.
T"...~.l... Ii...,efficienciescanbeenhancedbypre-selectionofinfectedmarrow prior to hlL Udu~.Liuu into recipients, enriching for those bone marrow cells expressing high levels of the selectable gene, see e.g., Dick et al., 1985, Cell 42:71 -79; Keller et al., 1985,Nature318:149-154. In~ddition,recenttechniquesforincreasingviraltiters permit the use of virus-containing ~ rather than direct incubation with virus-producing cell lines to attam effcient 1, ,~ -, see e.g., 8Odine et al., 1989, Prog.
Clin. Biol. Res. 319:589-600. BecausereplicationofcellularDNAisrequiredfor integration of retroviral vectors into the host genome, it may be desirable to increase the frequency at which target stem cells which are actively cycling e.g., by inducing target cells to divide by treatment in vitro with grow~h factors, sce e.g., Lemischka et al., 1986, Cell45:917-927,ae..,..1,'~ ,oflL-3andIL-6apparentlybeingthemostefficacious, see e.g., Bodine et al., 1989, Proc. NatL ~cad. Sci. 86:8897-8901, or to expose the recipient to 5-fluorouracil, see e.g., Mori et al., 1984, Jpn. J. Clin. OncoL 14 Suppl.
1:457-463,priortomarrowhalvest,scee.g.,Lemischkaetal., 1986, Cell45:917-927;
Chang et al., 1989, Int. J Cell Cloning 7:264-280.
The inclusion of cytokines or other growth factors in the retroviral I ~ r~
can le~d to more efficient ~ r ~ of tAAArget cells.
~ 35 - Lxample I
Production of retrovirally I, ,. ., ~ r~ l l ., . ~ 1 cells and sustained expression of a swine transgene m murine bone marrow ' - r ' " cells by retroviral-mediated gene tr~msfer 219S31~L ~ . ~
WO9CI06165 r~ s The efficacy of a retroviral gene transfer approach for introducing expressible genes was shown by using double-copy retroviral vectors engineered to express a drug-resistance marker (neomycin) and a swine class II DRB cDNA. Although this example uses the swine class II DRB gene, those skilled in the art will recogmze that other genes 5 described herein, e.g., the human c kit gene, can be substituted therefor.
Infectious particles containing these vectors were produced at a titer of >I x I o6 G418-resistant colony-forming units/ml using both ecotropic and ~ull,uLullu,u;~. packaging cell lines. Flow cytometric analysis of DRA-transfected murine fibroblasts ,"l .~ lly transduced with virus-containing '"l" . . -~ u ~ lrd that the transferred10 sequences were sufficient to produce DR surface expression. CO~ aiiUll of murine bone marrow with high-titer producer lines leads to the ~ .l" ~ . of 40O/o of ~lall~du~,y t~,/ma~lu~lla~;c colony-forrning units (CFU-GM) as determined by thefrequency of colony forrnation under G418 selection. After nearly 5 weeks in long-term bone marrow culture, virus-exposed marrow still contained G418-resistant CFU-GM at a 15 frequency of 25~/o. In addition, virtually all of the transduced and selected colonies contained DRB-specific transcripts. These results show that a significant proportion of very primitive lllr~,lu,uùh,Lic precursor cells can be transduced with the DRB 1~
vector and that vector sequences are expressed in the di~tlcllli_'~,d progeny of these cells.
These ~ ~ 1.. .; ., .~ . .~ ~ are described in detail below.
Details of retroviral constructs are given in Fig. I . Two types of retroviral constructs, GS4.4 and GS4.5, were prepared. The diagram in Fig. I depicts the GS4.5 retroviral construct. The arrows in Fig. I indicate the directions of trslncrrirtir,n In GS4.5, the orientation of DRB cDNA 1.,...~ ;..., is the same as viral tr~n~rrirtinn In GS4.4 (not shown), the TK promoter and the DRB cDNA were inserted into the 3' LTR
25 ûf N2A in the reverse orientation of ~ ti. ~ . with respect to viral tr~ncrriptinn and the simian virus 40 3' RNA processing signal was added. pBSt refers to Bluescript vector sequence (Stratagene). The thymidine kinase (TK) promoter was contained within the 215-base-pair (bp) Pvu II-Pst I fragment from the herpes simplex virus TK gene, McKnight, 1980 Nucleic ~cids Res. 8:5949-5964. The simian virus 40 3' RNA
30 processing signal was contained within the 142-bp Hpa l-Srna I fragment from the pBLCAT3 plasmid, Luckow et al., (1987) Nucleic ,4cids Res. 15:5490-5497, (see Fig. 1).
Sequence analysis of the junctions of the promoter, the class II cDNA, and the vector sequences confirmed that the elements of the constructs were properly ligated.
These retroviral constructs were transfected into the ~l~,uhullu,ul~_ packaging cell line PA317, and 1.. , .~ were selected in G418-containing medium. A total of 24 and 36 clones, transfected, lcDu.~ti~ly, with the GS4.4 and GS4.5 l~ ~....,l,;,.~..l plasmids, were tested by PEG ,ulc~,;,uildliul~ of culture ~ and slot-blot analysis of viral RNA. Of these, 8 and 12 clones were found, lcDu~ ly, to be positive for DRB, 2196~
W~96106165 PCTJUS95/10250 although the DRB signal was cù~ .lLly weaker for the GS4.4-derived clones. Analysis of genomic and spliced transcripts from GS4.5 cells by dot-blot analysis of PEG-~Ul~ 1 ~ particles revealed h~ u~,.l.,;ly among viral transcripts in various clones transfected by GS4.5. In one ~YpPnmPnt~ two clones contained DRB+/Neo+ viral RNA, 5 two con~ained DRB+/Neo~ RNA, two contained DRB~/Neo+ RNA, and one showed no class Il orNeosignaT. G418-resistance (G418r)titer .ll ~. .", 8 . -,"" of ~ ".from DRB-positive clones confirmed that the average titer produced by GS4.5-transfected clones (103-104 CFU/ml) was sig,ir,.,,.ily higher than that of the GS4.4-transfected clones (102-103 CFU/ml). Further ~ i.." ~l~ 8,.. .,1~ were, therefore, conducted withthebestclone,namedGS4.5C4,whichproducedaninitialG418rtiterof3xlO4 CFU/ml.
Plasmid preparation, cloning procedures, DNA sequencing, RNA pl~,p~Liul~s, Northern blots, and RNA slot blots were performed by standard methods, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor Lab., 15 Cold Spring Harbor). Final washes of blots were carried out in 0. I x SSPE (I x SSPE =
0.18 M NaCI/10 mM sodium phosphate, pH 7.411 mM EDTA) at 60~C for 30 min.
The packaging cell lines PA317, Miller et al., 1986, MoL Cell. 13iol. 6:2895-2902, GP+E-86, Markowitz et al., 1988, J. Virol 62: 1120-1124, psiCRIP, Danos et al., 1988, Proc NatL Acad. ScL USA 85:6460-6464, and their derivatives were maintained at 37~C
20 in Dulbecco's modified Eagle's medium (DMEM; GIBCO) with 10% (vol/vol) fetal bovine serum (CELLect Silver; Flow T .Rh~lrRt~Alrir~ P~ t~ 1 with 0.1 mM
l ;AI amino acids (Whittaker Bioproducts), antibiotics penicillin (5 units/ml), and ~LI~,uLul~ ,h~ (5 llglml).
Il111JIU ~ ,lli of the Viral Titer of the C4 Clone. Since recent data indicated 25 that ~ containing high retroviral titers were the best candidates for ~ g bone marrow cells, Bodine et al., 1990, Proc. Natl . Acad. Sci . USA 87:3738-3742, the titer of the C4 producer clone was increased by "ping-pong" - I .1.1; 1~. -~ ;. ." Bestwick et al.,1988, Proc. NatL Acad. Sci. USA 85:5404-5408. SnrPrnAtAnt from nearly confiuent C4 cultures was used to transduce GP+E-86 ecotropic packaging cells and G418 selection 30 was applied. Forty-eight clones were isolated and screened by PEG precipitation for production of viral particles. S~ Ip I ~ from 18 of these clones were DRB-positive by dot-blot analysis of viral RNA and had G418r titers between 0.5 and 3.5 x 104 CFU/ml).
One positive clone was then amplified by the ping-pong technique with the allllJl.ullu~;c Ly~ullly~,;ll-resistant packaging line psiCRlP. Sll~ from 48 I~y~u~y~
35 resist_nt clones were examined for presence of DRB-positive viral RNA by PEG
precipitation and their G418r titers were APtPrminP/1 All of the clones were positive by dot-blot analysis with the DRB probes and produced titers between I x 105 and I x 107 CFT T/ml. A. IJI.UIIU~U;U clone GS4.5 A4, which produced the highest titer, was tested for 2~9~3~

the presence of helper virus by the S + L-assay. No replication-competent helper virus was detected.
.Amplifi~rlti--n of virus titer was achieved by the ping-pong technique. Since there is evidence that psiCRlP packaging cells are less prone to produce helper virus than PA317 when using certain types of vectors, Miller, 1990, Hum. Gene Therapy 1:5-14, DRB ~ virions were prepared using the psiCRlP/GP-E-86 producer i 6 ~ ~ 'fi~ Titer values > I x 107 CFUlml with no detectable i~ LuLIu~ helper viruses were obtained, confrrming that this strategy produced safe viral particles suitable for in vivo I ~ p ;" .
Northem blot analysis of GS4.5-producing clones C4, A9, and A4, each derived from a different packaging cell line, showed a conserved l.~l,.ili~Li.,.. pattern. RNA
species cull~a~nldillg to the full-length viral genome, the spliced Neo transcript, and the DRB ~ unit were observed with additional RNA species. High molecular size species observed in these f A~ ' may constitute a read-through transcript starting from the TK promoter and ending in the other long terminal repeat (LTR). In contrast to many of the virion-producer clones obtained by tr~n~f~-ction that presented erratic DRB
transcripts, those obtained by I, r ~ showed stable DRB hybridization patterns suggesting that no Ir- ~ . ,l .; . ~f ;~ events occurred during the :implifil~til-n procedure.
Retroviral titers were determined as follows. Replication-defective retroviral particles were produced from packaging cell lines initially transfected with l~
construct using the standard calcium phosphate precipitation method, Wigler et al., 1978, CelZ 14:725-733. Retrovirus production was estimated by the drug-resistance titer (G418-resistant colony-forming units/ml, CFU/ml) as described, Bodine et al., 1990, Proc. Natl ~cad. Sci. US~ 87:3738-3742. Except for the psiCRlP line, G418 (GIBC0) selectionwas carried out in active component at 500 llg/ml for 10-12 days. Hygromycin B
selection was applied to psiCRlP-derived packaging clones in medium containing active drug at 50 llg/ml for 10 days. Replication-competent helper virus titer was assayed on PG4 feline cells by the S+L- method, Bassen et al., 1971, Nature 229:564-566. =
PEG precipitation of viral particles was performed as follows. Virions containedin I ml of culture ~ were ~ ' with 0.5 ml of 30% (wVvol) pol,~ lf glycol ~PEG) for 30 min. at 4~C. After ~ u; ru~ the pellets were treated with a mixture of RNase inhibitors (vanadyl rih-~n~ e complex, BRL), phenol/chloroform-extracted, and ethanol~ , ' Pellets were then l'~ ~l .1f d in 15.7% (vol/vol) formaldehyde and serial dilutions were dotted onto nitrocellulose membrane.
35 ~ Analysis of DRB Tr~ in Packaging Cell Clones was performed as follows. To test for accurate ~ .. . of the introduced DRB cDNA within thedifferent producer clones, Northern blots containing RNAs isolated from these clones were hybridized with the DRB and Neo probes. Fig. 2 depicts the structure of the WO 96tO6165 ~ 3 ~ ~ PCT~US95/10250 37 . . fl ;
provuus genome and the expected si~s of transcripts initiated from either the viral LTR
or the TK promoters. Each of the three GS4.5-containing clones, which were derived from PA317 (clone C4), GP + E-86 (clone A9), and psiCRlP (clone A4) cells, showed DRB-positive transcripts. As reported, TTRnt7~-Fol1ln~ et al., 1989, Proc. Natl. Acad. Sci.
USA 86:3519-3523, the unspliced genomic RNA (band a) and the spliced Neo transcript (band b) were observed. In addition a transcript uniquely hylL;di~ lc with the DRB
probe was detected that cull~,uulld~ to the si~ predicted (1700 bases, band c) for the DRB cDNA i A " unit.
Surface Expression of the SLA-DR Antigen on Transduced Fibroblasts was detected as follows. An in vitro assay was developed to examine surface expression of tbe SLA-DR antigen on murine fibroblasts. Flow cytometry (FCM) profiles shown inFig. 3A ,.~ ..S thatG418rtitersof3xl04(cloneC4)weresufficienttopromote expression of the DR antigen on the cell surface of transduced DRA ~ "- f ~ l I ' In Fig.
3 solid lines indicate DR cell surface expression (anti-DR antibody binding) (22% and 75~/O of the bulk population of cells 3 days after ~ ;"" with GS4.5 C4, (B) and GS4.5 A4 (C), respectively); dashed lines indicate anti-mouse class I antibody binding (positive control); dotted lines indicate anti-pig CD8 antibody brnding (negative control).
Twenty-two percent of the bulk population of transduced cells were DR-positive and subclones maintained class II expression for more than 5 months. The increase in titer 20 (clone A4) correlated with an increase in the number of cells transduced (75~/O of the transduced population was DR-positive) and with the brightness of the DR signal.The class 111~,..,~ h 1;..,. assay was performed as (I~ ,. d in Fig. 4. NIH 3T3 cells were transfected with the SLA-DRAd cDNA inserted in a plasmid expression vector, Okayama et al., 1982, MoL Cell. BioL 2: 161 -170. A~ u~d~ ly 3 x 104 cells of a stable DRA ~ .. .1 (clone 11/12.2F) that expressed a high level of DRA mRNA
were then transduced overnight with I ml of DRB-containing retroviral surPTq~RntCells were . .h~ 1y cultivated in fresh DMEM ~ . ". . Ilrd with 10% fetal bovineserum and antibiotics for 2 additional days and examined for cell surface expression of the DR antigen by FCM analysis.
The class 111, ,., .~.1 1 ;. ", assay described here provides a fast and sirnple method to test both the expression and functional titer of retroviral constructs. By using cells transfected with DRA, the need for lengthy double selection after ~ ;, .,. by two separated vectors, Yang et al., 1987, Mol. Cell BioL I :3923-3928; Korrnan et al., 1987, Proc. NafL Acad. Sci USA 84:2150-2154, is obviated. Cell-surface expression of DR
35 }l~,t~lUdilll.,li~ was A,.,.,~1,,'-.l by FCM analysis 3 days after 1.~ ,~AI1;,.", providing direct evidence that the transferred sequences were sufficient to produce significant level of DR ~ chain. More h~ ulL~ILly, this test allows Aqt~qrrninRtinn of "functional" titers .

WO 96~06165 I ' PcTNsssrl02so based on the expression of the gene of interest rather than on that of the 1~ ~ L ~ 11y regulated drug-resistance marker.
The SLA-DRB probe was an EcoRI cDNA fragment containing the complete coding sequence of the DR ,B chain, Gustafsson et al., 1990, Proc. NatL Acad. Sci. USA
87:9798-9802. Theneomycinrl1~n~ U""~r~ . gene(Neo)probewastheBclI-XhoI
fragment of the N2A retroviral plasmid, Hantzopoulos et al., 1989, Proc. NatL Acad. Sci.
USA 86:3519-3523.
Expression of Porcine DRB cDNA Transduced into Murine Bone Marrow Progenitor Cells The efficiency with which myeloid clonogenic precursors were transduced was determined by assaying for CFU-GM with and without a selecting amount of G418 aRer exposure of bone marrow cells to GS4.5-derived virions. Comparison of the number of colonies that formed in the presence and absence of the drug, for two . Alll-l;l~.. .1; ~, indicated that =40% of the initial population of myeloid progenitor cells were transduced.
15 The frequency of G418r CFU-GM was again determined after a sample of the transduced marrow was expanded under long-term culture conditions for 33 days. Twenty-five percent of the progenitors present after 33 days in culture still gave rise to colonies under G418 selection. Colonies of cells arisen from CFU-GM were examined for the presence of DRB-specific transcripts by converting RNA into cDNA and then performing PCR
20 ~ ; r;. ~ ,., as described herein and in Shafer et al., 1991 Proc. Naf L Acad. Sci. USA
88:9670. A 360-bp DRB-specific product was detected in five of six G418-selectedcolonies from freshly transduced marrow, whereas all six colonies similarly derived from transduced progenitors present after 33 days in culture were positive. An additional band of 100 bp observed in some of the samples probably reflects the stoichastic nature of 25 nr,n~perifir priming events. DRB-specific transcripts were also detected in the bulk population of drug-resistant colonies and in producer cells but were not detected in controls such as a bulk population of .1.~ J colonies, fibroblasts used to provide carrier RNA, and a bulk population of transduced colonies processed as above butwitbout reverse ~ These latter data ~ ,..,.~1. ,. Ir that the PCR signal was 30 dependent on the synthesis of cDNA, excluding the possibility that provirus, rather than viral message, was ~ UI~;blC for the amplified fragment .
Recent illllJlU ~ including ., ~I1. r. ~t ;~ of the virus design, increase of viral titers, use of growth factors to stimulate precursor cells, and selection of stem cells prior to I . ,., .~.1. ..1 ;. ., . have been shown to improve long-term expression of transduced 35 genes in the Llll~liU,UU;~LiC UUIII~L/al Ll-l~ , Bo&ne et al., 1990, Proc. NatL Acad. Sci. USA
87:3738-3742; Bodine et al., 1989, Proc. NatL Acad. Sci. USA 86:8897-8901; Wilson et al., 1990, Proc. NafL Acad. Sci USA 87:439443; Kang et al., 1990, Proc. Nafl. Acad.
Sci. USA 8759803-9807; Bender et al., 1989, A~oL CelL BioL 9:1426-1434. The 2~963ll ,. 39 ~ .p..;..,..,l~ herein showthe app,icability ofthe retroviral gene-transfertechnique in achieving expression of major l~ v ~ ;Iity complex class Il genes transferred into 7 r ~ ~ cells. To determine the efficiency with which dcvclvp~ l~ly primitive ? ' l~v;~.Lic cells were tramsduced, the frequency of G418r CFU-GM was assessed after S expanding infected marrow cells kept for 33 days in long-term cultures. Expression of the exogenous DRB cDNA was also monitored in cells derived from transduced CFU-GM present either ' Iy after infection or after an extended culture period.
Virtually all of the colonies individually tested were positive for DRB-specific transcript, suggesting that the DRB .c....,.,~ vecto~ is suitable for expression in murine 0 1 ' r ' " cells.
Bone marrow cells were obtained from the femora of 6- to 12-week-old female C57BL/10 mice and were prepared as descrlbed, Ildstad et al., 1984, Nature 307:168-170.
Methylcellulose colony assays for granulocylt/llla~,lv~lla~, colony-forming umits (CFU-GM),Eaveseta7., 1978,Blood52:1196-1210,wereperformedasdescribedusingS%
(vol/vol) murine interleukin 3 culture 5llrplrmPnt (Collaborative Research). Long-term Dexter-type bone marrow cultures were initiated in 60-mm culture dishes with 2 x 107 nucleated cells, Eaves et al., 1987, CRC Crit. Rev. Oncol . HematoL 7:125-138.
Bone marrow cells were transduced essentially as described, Bodine et al ., 1989, Proc. Natl. Acad. Sci. US~ 86:8897-8901. Briefly, bone marrow was harvested for 6- 12-week-old female C57BL/10 donors that had been treated 2 days with 5-fluorouracil (150 mg/kg). p~ ;. ." was performed by incuba?ing 1 x 106 cells per ml for 2 days in long-term Dexter-type bone marrow culture medium to which was added 7.5%
interleukin 3 cu ture 5~ and .c .,..l,;"--,l human interleukin 6 (200 units/ml; gift from J. Jule, National Institutes of Health, Bethesda, MD). Marrow cells were transduced for 48 hr by addmg 5 x 106 cells per 10-cm plate containing nearly confluent virus-producers, Polybrene (8 mg/ml), and the cytokines described above.
Detection of DRB-Specific Transcripts in CFU-Derived Colonies was performed as follows. Cells Cvllc~ ~' ,, to individual CFU colonies and to colonies present on an entire plate (bulk) were first extracted from methylcellulose cultures by dilution in 30 phosphate-buffered saline and I,;r,.r,r:;, These cells were then combined with 1 x 106 NIH 3T3 cells (to provide carrier RNA), and total RNA was prepared using thegllanidine is~a iO."yal.ctc/CsCl method. First-strand cDNA was prepared from 20 llg of total RNA using the Invitrogen Red Module kit. cDNA was then subjected to 50 cycles of PcR~ llinthepresenceofthesLADRB-speciflcnl~ . .
CCACAGGCCTGATCCCTAATGG) (Seq. I.D. No. 1) and 17 (5'-AGCATAGCAGGAGCCTTCTCATG) (Seq. l.D.7~.7O. 2) u~sing t7ne Cetus GeneAmp kit as ~c ~ ~ ...., 7~ J (Perkin-Elmer/Cetus). Reaction products were visualized after clc~ u~ i, on a 3% NuSieve agarose gel (FMC) by staining with ethidium bromide.

21 ~
WO 96/06165 PCT/US9!iJ10250 FCM analysis was performed with a FAC-Scan II nuu.c~-,cl..,c-activated cell sorter (Becton Dickenson) on cells stained with the anti-DR ~ oc~ l antibody 40D, Pierres et al., 1980, l~ur. J: IrnmunoL 10:950-957, an anti-H-2d allo antiserum, or the anti-porcine CD8 IlI. ",o~ l .1 antibody 76-2-11, Pescovitz et al., 1984, J. ~p. Med.160:1495-1505, followed by fluorescein isothiocyanate-labeled goat anti-mouse ~mtibodies (Boehringer Mannheim).
IV PrerArAtion of TrAns~rnic Swin~
According to another aspect of the invention, there is provided graftable swine cells, e.g., l- ~-~~ r ~ '' stem cells, e.g., swine bone marrow cells, or other tissue which 10 express one or more I .,~ ,~.;,. -- ' human proteins that facilitate improved survival amd/or n " ,. . .1 of the swine L~llla~uuu;cliu cells in human subjects In particular, the present invention includes .c~.-,l,h;,.~ ,I swine cells expressing a human h~lu~Lu~u;~,Lic gene. In a preferred r.l.l~o/l;l"r.,l the human hPmAtoroiPtir gene is apartofa..,~.,-",~,;l,~,lnucleicacidmoleculethatcontainsatissuespecificpromoter,e.g.
15 '~llaLuuu;~t;C specific promoter, located proximate to the human gene and regulating expression of the human gene in the swine cell. Tissues containing the 1. ~ ..., .1.;.._. a human 1.~ u ,~,oi.1 ;. gene may be prepared by introducing a 1~ -. . .1.; . . - .I nucleic acid molecule into a tissue, such as bone marrow cells, using known 1 l .. " r. ",,, , ;, .. .
techniques. These I "...~r, ., ... - ;on techniques include 1. ,.. ,~ rr~ 1 ;.... and infection by 20 IcLluvhu~c~ carrying either a marker gene or a drug resistance gene. See for example, Cnrrrnt Protocols in MolP~ nlslr B;olo~v. Ausubel et al. eds., John Wiley and Sons, New York (1987) and Friedmann (1989) Science 244:1275-1281. A tissue containing a ~. ~.. 1.;., -- .I nucleic acid molecule of the present invention may then be IchlLludul,cd into an animal using . .,~ l; l . .l ;. ., . techniques (See for example, Dick et al. ( 1985) Ce/l 25 42:71). The present invention also includes swine, preferably miniature swine, expressing in its bone marrow cells a l~v~ ....1 ;..,1 a human 1 ~pù;~,.;c protein which improves the ability of the swine bone marrow cells to reconstitute a human host. The I rCI ~ . a constructs described above may be used to produce a transgenic pig by any method known in the art, including, but not limited to, lu;clu;llj~L;u..~ embryonic stem 30 (ES) cell n~ ~nirl~ ti~n eL~ ul.u-~Lion, cell gun, transfection, ~ du~,iiol~, retroviral infection, etc.
Transgenic swine of the present invention can be produced by ;--LIuduc;llg transgenes into the germline of the swine, particularly into the getlome of bone marrow cells, e.g. l...,.~a..lJ.J ~ cells. Embryonal target cells at various d~,~.lu,u~ ,llLdl stages 35 can be used to introduce the human transgene construct. As is generally understood in the art, different methods are used to introduce the transgene depending on the stagc of d., ~IU~UIII~IIL of the embryonal target cell. One technique for tr:-n~Ernir~lly altering a pig is to microinject a IC~ ....1.;" -- ,I nucleic acid molecule into the male pronucleus of a 219~31;~ i, t ~ WO 96/0616~ PCTAUS9~10250 fertilized egg so as to cause I or more copies ofthe Ir...,..h;,..,l nucleic acid molecule to be retained in the cells of the developing anirnal. The ~ nucleic acid molecule of interest is isolated in a linear form with most of the sequences used for replication in bacteria removed. T; . .~ - i, _ l it.l . and removal of excess vector sequences results in a 5 greater efficiency in production of transgenic mammals. See for example, Brinster et al.
(1985) PN~S 82:4438-4442. In general, the zygote is the best target for micro-injection.
In the swine, the male pronucleus reaches a size which allows lcpludu.,;blc injection of DNA solutions by standard lui.,luih;_~liull techniques. Moreover, the use of zygotes as a target for gene tr~msfer has a major advantage in that, in most cases, the injected DNA
10 will be ill~Ul~ into the host genome before the first cleavage. Usuahy up to 40 percent of the animals developing from the injected eggs contain at least I copy of the ~ u . ,1, , - - a nucleic acid molecule in their tissues. These transgenic animals will generally transmit the gene tbrough the germ line to the next generation. The progeny of the 1., ,;.~ .. _lly 1l~ embryos may be tested for the presence ofthe construct by 15 Southern blot analysis of a segment of tissue. Typically, a small part of the tail is used for this purpose. The stable integration of the 1~ ~ ,. . .h, 1 ~, I nucleic acid molecule into the genome of transgenic embryos allows perrnanent transgenic mammal lines carrying the ,~"".1.;.,--,1 nucleicacidmoleculetobetet~hlicl~d Alternative methods for producing a mammal containing a 1~ ..h -.A..I nucleic 20 acid molecule of the present invention include infection of fertilized eggs, embryo-derived stem cells, to potent embryonal carcinoma (Ec) cells, or early cleavage embryos with viral expression vectors containing the Ir~.. 1.;.. --.1 nucleic acid molecule See for example, Palmiter et al. (1986) ~nn. Rev. Genet. 20:465 'L99 and Capecchi (1989) Science 244:1288-1292.
Retroviral infection can also be used to introduce transgene into a swine. The developmg embryo can be cultured ~n vitro to the blastocyst stage. During this time, the 1,1 l-"",~r~canbetargetsforretroviMlinfection(J~nich(1976)PNAS73:1260-1264).
Efficient infection of the hl - ~ is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al. (1986) in ~ qting the Mouse Em~r,vo, Cold Spring Harbor LaboMtory Press, Cold Spring Harbor, N.Y.). The viral vector system used to introduce the tMnsgene is typically a replication-defective retrovirus carrying the transgene (Jabner et al. (1985) PN~S 82:6927-6931; Van der Punen et al. (1985) PN~S
82 6148-6152). Tramsfection can be obtained by culturing the bl-~Lul-..,lc,~ on a monolayer of virus-producing cells (Van der Punen, supra; Stewart et al. (1987) EMBO
6:383-388). Alternatively, infection can be perforrned at a later stage. Virus or virus-producing cells can be injected into tbe blastocoele (Jahner et al. (1982) Nature 298:623-628). Most of the folmders will be mosaic for the transgene since; .. ..1.... ~l ;. ,.. typically occurs only in a subset of the cells which formed the transgenic swine. Further, the 219~3i1 WO 96/06165 ' PCTNS95110250 -founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also possible to introduce tramsgenes into the germ line, albeit with low efficiency, by ill~ U.~.lillC.
retrovirel infection of the mid-gestation embryo (Jahner et al. (1982) supra).
A tbird approach, which may be useful in the l;Ull:~LI U._liUI~ of tansgenic swine, would target transgene hlllullu~liull into an embryonal stem cell (ES). ES cells are obtained from pre-i " ~ ; " . embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984) Nature 309:255-258; Gossler et al.
(1986) PNAS 83:9065-9069; and Robertson et al. (1986) Nature 322:445-448).
Transgenes might be efficiently introduced into the ES cells by DNA ~ f ~ or by retrovirus-mediated trs~nc~ ti(m Such l~ r~ .l ES cells could thereafter be combined with blastocysts from a swine. The ES cells could be used thereafter tocolonize the embryo and contribute to the germ line of the resulting chimeric pig. For review, see Jaenisch (1988) Science 240:1468-1474.
Introduction of the IC~ gene at the fertilized oocyte stage ensures that the gene sequence will be present in all of the germ cells and somatic cells of the tramsgenic "founder" swine. As used herein, foumder (abbl~,~' ' "'F") means the pig into which the .~ .., .1.1, .~ . .I gene was introduced at the one cell embryo stage. The presence of the 1~ ... 1.'. - ' gene sequence in the germ cells of the transgenic founder animal in tum 20 means that ~ y half of the founder animal's df ;~ ,; . will carry the activated 1. ~ .. 1. - - l gene sequence in all of their germ cells amd somatic cells. Introduction of the IC~ ....1,;,. --.1 gene sequence at a later embryonic stage might result in the gene's absence from some somatic cells of the founder animal, but the ~ of such an animal that inherit the gene will carry the activated 1~ ~ . .., ,1, - - ' gene in all of their germ 25 cells and somatic cells.
~;....1;1~, . 1;,1ll of swin~ oocyt.~c In preferred . . . 11 .uS; 1 l - I c the transgenic swine of the present invention is produced by:
i) Illh,luil~ lillg a 1~ .~..Il.,llr.ll nucleic acid molecule into a fertilized swine egg to 30 produce a genetically altered swine egg;
ii) implanting the genetically altered swine egg into a host female swine;
iii) 1 1 ...;. .1 ~, . .; . ~g the host female for a time period equal to a substantial portion of the gestation period of said swine fetus.
iv) harvesting a transgenic swine having at least one swine cell that has developed 35 from the genetically altered ..,--.. .~ . egg, which expresses a human I .~,ù;~.ic gene.
In general, the use of Illi~,luhlj~,~,lion protocols in transgenic animal production is typically divided into four main phases: (a) preparation of the animals; (b) recovery and 21963~I
~ wo 96/06165 P~_l/u~ 1J~v 43 :- -I l IAI. Ia .1 I'f ' 1~ e i n vJtro of one or two-celled embryos; (c) IlliUlU;~ ,.,iiUll of the embryos and (d) ~ ;on of embryo5 into recipient females. The mekhods used for producing kansgenic livestock, pv~ uLuly swine, do not differ in principle from khose used to produce kansgenic mice. Compare, for example, Gordon et al. (1983) Methods in En~vmolo~v 101 :411, and Gordon et al. (1980) PN,45 77:7380 rn,n~ Prnine~ gcnerally, kansgenicmicewithHammeretal.(l985)Nature3ls:68o~Hammeretal.(l986)JAnim Sci63:269-278,Wallet~al.(1985)BiolReprod.3Z:6iS-651,Purseletal.(1989)Science 244:1281-1288,Vizeetal.(1988)JCellScience90:295-300,Mulleretal.(1992)Gene 121:263-270,andVelanderetal(1992)PNAS)89:12003-12007,eachofwhichteach techniques for generating kansgenic swine. See also, PCT Publication WO 90/03432, and PCT Publication WO 92/22646 and references cited therein.
One step of the ~ y phase comprises ~ llul~ g the estrus cycle of at least the donor females, and inducing ~u,u.,luvuLlLion in the donor females prior to mating.
Su,u~lu vulaLiuu typically involves ~ .p drugs at an appropriate stage of the eskus cycle to stimulate follicular d~ ,IV,UUI~IIL, followed by keakment wikh drugs to ,luulli~ eskus and initiate ovulation. As described in the example below, pregnant mare's serum is typically used to mimic the follicle-stimulating hormone (FSH) in r,r,nnhin~tir,n with human chorionic LullàduLlul ill (hCG) to mimic luteinizing hormone (LH). The efficient induction of ~U~IU VULliiUII in swine depend, as is well known, on several variables including the age and weight of the females, amd the dose and timing of the ~;UII~IULIU~;II a-l~ a,';-.l- See for example, Wall et al. (1985) BioL Reprod.
32:645 describing ~u,u~,luvuLlLion of pigs. Sul~ vvululivll increases the likelihood that a large number of healtby embrvos will be available after mating, and further allows the Ul ~,Liliull~,l to conkol the timing Of ~ r After mating, one or two-cell fertilized eggs from the superovulated females areharvested for Illi~luiuljc.livu. A variety of protocols useful in collecting eggs from pigs are known. For example, in one approach, oviducts of fertilized superovulated females can be surgically removed and isolated in a buffer suluLioll.,ullul~ medium, and fertilized eggs expressed from the isolated oviductal tissues. See, Gordon et al. (1980) PNAS
77:7380;andGordonetal.(1983)MethodsinEn~molo~y101:411. Alternavively,the oviducts can be cannulated and the fertilized eggs can be surgically collected from , .. ~;1,.: 1, . ~1 animals by flushing wikh buffer soluliulJ~,ulluu~ medium, thereby cliullluGLillg the need to sacrifice the animal. See Hammer et al. (1985) Nature 315:600.
The timing of the embryo harvest after mating of the ~U,U~,IUV I ' ' females can depend 35 on the length of the fertilization process and the time required for adequate Pnl~rermPnt of the pronuclei. This temporal waiting period can range from, for example, up to 48 hours for larger breeds of swine. Fertilized eggs appropriate for luiuluillj~ iull, such as WO 96~0616S PCT/US9~/102S0 --, 2196311 44 one-cell ova containing pronuclei, or two-cell embryos, can be readily identified under a dissecting ll~;~,lUa~,VUC.
The equipment and reagents needed fomll;.lu;llj~cLiull of the isolated swine embryos are similar to that used for the mouse. See, for example, Gordon et al. (1983) MethodsinEn~y7nolo~y101:411;andGordonetal.(1980)PNAS77:7380,describmg equipment and reagents for 1ll;~ embrvos. Briefly, fertilized eggs are positioned with an egg holder (fabricated from I mm glass tubing), which is attached to a micro-l_ ~r ' ' ~ which is in turn .. ,..,.l; - ' ~I with a dissecting IlI;~lUa~U,u~ optionally fitted with differential i~lt~,lrc~wl~e contrast optics. Where vi~--oli7-tinn of pronuclei is 10 difficult because of optically dense uyLulJl~lll;c material, such as is generally the case with swine embryos, rf ntrifil~ tinn of the embryos can be carried out without l,UIIIplUIII;a;llg embryo viability. Wall et al. (I 985) Biol. Reprod. 32:645 ~"u i rl l~f I ;. .11 will usually be necessary in this method. A Ir~ ,h ~ ,l nucleic ~id molecule ofthe present invention is provided, typically in lineari~d fûrm, by linearizmg the IC~ ...,.1. --15 nucleic acid molecule with at least 1 restriction r",1..,."~1f -.c, with an end goal being removal of any plul~f;uyuL;~ sequences as well as any unecessary flanking sequences. In addition, the Ir~ ...,.1.;.,--.1 nucleic acid molecule containing the tissue specific promoter and the human hf m:~tnpl~if rir gene may be isolated from the vector sequences using 1 or more restriction rll.1l.ll.l.1~ .. Techniques for n~onir~ ting and linearizing 20 Ir~ nucleic acid molecules are well known and include the techniques described in Mrlrr~ r (~Innir~ A L ' M ' $econd Edition. Maniatis et al. eds., Cold Spring Harbor, N.Y. (1989).
The linearized Ir~ .."1,;., -~ nucleic acid molecule may be Ill;~,luh.jf ~,t.,d into the swine egg to produce a genetically altered, . ,~..., ..~1 ;,.., egg using well known techniques.
25 Typically, the linearized nucleic acid molecule is Ill;~,lVh~ ,J directly into the pronuclei ofthefertilizedeggsashasbeendescribedbyGordonetal.(1980)PNAS77:7380-7384.
This leads to the stable ulllVIIIuaullldl integration of the I . .~ "" ,1,; . .,", I nucleic acid molecule in a significant population of the surviving embryos. See for example, Brinster et al. (1985) PNAS 82:4438 4442 and Hammer et al. (1985) Nature 315:600-603. The30 Ill;clull.,cdl.,~ used for injection, like the egg holder, can also be pulled from glass tubing.
T_e tip of a Ill;.,lu..~,~,Jle is allowed to fill with plasmid suspension by capillary action.
By IlI;~lUaLU~)iC ~ ;,. .,.1; ,~ 1 ;~ ." the ~ ,lu..~..,Jlc is then inserted into the pronucleus of a cell held by the egg holder, and plasmid suspension injected into the pronucleus. If injection is successfiul, the pronucleus will generally swell noticeably. The microneedle is 35 then withdrawn, and cells which survive the Illh,~uhlje~,Liw~ (e.g. those which do not Iysed) are ~ y used for imrl~ntotinn in a host female.
The genetically altered ", --, . " ,,.l; - -, embryo is then transferred to the oviduct or uterine horns of the recipient. Mi~u;~ ,J embryos are collected in the implon~otinn 21963~ 1 ~ WO96/0616!i . PCT/US95~10250 pipette, the pipette inserted into the surgically exposed oviduct of a recipient female, and the Ill;ClUlll;~ ,d eggs expelled into the oviduct. After withdrawal of the ;Illp~- ,lAI;
pipette, any surgical incision can be closed, and the embryos allowed to continue gestation in the foster mother. See, for example, Gordon et al. (1983) Methods in S En~vmolo~101:411;Gordonetal.(1980)PNAS77:7390;Hammeretal.(1985)Nature 315:600, and Wall et aL (1985) BioL Reprod. 32:645.
The host female mammals containing the implanted genetically altered , " -- I . . I IA1 i -, eggs are maintained for a sufficient time period to give birth to a transgenic mammal having at least I cell, e.g. a bone mar~row cell, e.g. a I r ' cell, which expresses the 1~ nl ,; ~ ,-, I nucleic acid molecule of the present invention that has developed from the genetically altered ", - - " " IAI iA. . egg.
At two-four weeks of age (post-natal), tail sections are taken from the piglets and digested with Proteinase K. DNA from the samples is phenol-chloroform extracted, then digested with various restriction enzymes. The DNA digests are cl".,l~u~llulcaed on a Tris-borate gel, blotted on nitrocellulose, and hybridiA. ed with a probe consisting of the at least a portion of the coding region of the 1 ~ ~ . ,, "l ,; " - - ,I cDNA of interest which had been labeled by extension of random hexamers. Under conditions of high stringency, this probe should not hybridi~e with the ~ pig gene, and will allow the i,1rn~ifirAAtir,n of trAnsgenic pigs.
According to a preferred specific ~ ., .I .o-l; ", , I of the invention, a transgenic pig may be produced by the methods as set forth in Example 1.
~2 Production Of Transgenic Pigs which express human c-kit (the receptor for human SCF) Estrus is ~ ,Llulu~.,d in sexually mature gilts (:~7 months of age) by feeding an orally active progestogen (allyl trenbolone, AT: 15 mglgilt/day) for 12 to 14 days. On the last day of AT feeding all gilts are given an ;,.~ injection (IM) of ~.~,~,,!A .~1;"
F2a (Lutalyse: 10 I.ig/illjc~,liun) at 0800 and 1600. Twenty-four hours after the last day of AT c~ all donor gilts are given a single IM injection of pregant mare serum gUllddUIlU,u;ll (PMSG: 1500 IU). Hurnan chorionic ~uuadu1~up;ll (HCG: 750 IIJ) is al.,,i.,;,u,lcd to all donors at 80 hours after PMSG.
Following AT withdrawal, donor and recipient gilts are checked twice daily for signs of estrus using a mature boar. Donors which exhibited estrus within 36 hours following HCG Al~ ;",, are bred at 12 and 24 hours after the onset of estrus using artificial and natural (lc,pc~ ., .;, ,A1 ;, Between 59 and 66 hours after the adlll .,;~l.alion of HCG, one- and two-cell ova are surgically recovered frorn bred donors using the following procedure. General anesthesiaisinducedbyA~ gO.5mgofdc.,~ullla~,./kgofbody~._;gl,~andl.3 ..... ... . . . ........ ... .. ......... . _ .. .. . ..... . = . , ... _ _ _ _ . . . .

219~311.

mg ketamine/kg of bo.ly~ ' via a peripheral ear vein. Following ,. "~ ; ".1 ;on, the IC~JlUJU~liVC tract is eYT~ ri~n7~d following a midventral laparotomy. A drawn glass camnula (O.D. 5 mm, length 8 cm) is inserted into the ostium of the oviduct and anchored to the ;~ ~r~ h ll l l usmg a single silk (2-0) suture. Ova are flushed in retrograde fashion 5 by iusertirlg a 20 g needle into the lumen of the oviduct 2 cm anterior to the uterotubal junction. Sterile Dulbecco's phosphate buffered saline (PBS) ~ , s~J with 0.4%
bovine serum albumin (BSA) is infused into the oviduct and flushed toward the glass cannula. The medium is collected into sterile 17 x 100 mm ~oly~Lylcue tubes. Flushings are transferred to 10 x 60 mm petri dishes and searched at lower power (50 x). All one-and two-cell ova are washed twice in Brinster's Modified Ova Culture-3 medium (BMOC-3) s~ rd vvith 1.5% BSA and transferred to 50 ml drops of BMOC-3 medium under oil Ova are stored at 38~C under a 90% N2, 5% ~2, 5~/~ C~2 ~ lo~ L
until ulh,l~ lj.,CLiull is performed~
One- and two-cell ova are placed in an Eppendorf tube ( 15 ova per tube) containing I ml HEPES Medium ~ .1.-",. .t d with 1.5% BSA and centrifuged for 6 minutes at 14000 x g in order to visuali~ pronuclei in one-cell and nuclei in two-cell ova.
Ova are then transferred to a 5-10 ml drop of HEPES medium under oil on a depression slide. Mi~,lu;uj~ ul is performed using a Laborlux microscope with Nomarski optics and two Leit_ nl;~.ll '~ ' 10-1700 copies of a DNA construct which includes the human c-kit gene operably linked to a promoter (I ng/ml of Tris-EDTA buffer) areinjected into one pronuclei in one-cell ova or both nuclei in two-cell ova.
Mi~lohlj~,~t.,l ova are returned to microdrops of BMOC-3 medium under oil and maintained at 38~C under a 90% N2, 5% CO2, 5% ~2 atmosphere prior to their transfer to suitable recipients. Ova are transferred within 10 hours of recovery.
Onl~ recipients which exhibited estrus on the same day or 24 hours later than the donors are utilized for embryo transfer. Recipients are Anl cthr~i7l d as described above.
Following ~ . i. . ;. ." "d ;~n of one oviduct, at least 30 injected one and/or two-cell ova and 4-6 control ova are transferred in the following manner. The tubing from a 21 g x 3/4 butterfly infusion set is connected to a I cc syringe. The ova and one to two mls of BMOC-3 medium are aspirated into the tubing. The tubing is then fed through the ostium of the oviduct until the tip reached the lower third or isthmus of the oviduct, The ova are u. .~lly expelled as the tubing is slowly withdrawn.
The exposed portion of the lc~ lu~,tiYc tract is bathed in a sterile 10% glycerol/
0.9~/O saline solution and returned to the body cavity. The connective tissue ~ ;ug the linea alba, the fat and the skin are sutured as three separate layers. An ullhlt~,,lu~Lcd Halstead stitch is used to close the lina alba. The fat and s,kin are closed using a simple continuous and mattress stitch, l~ ,Li~ly. A topical d . . ~ 1 agent (F-l ,.,..liol. ~"1 ) is then dJIIIilll~t~,lLJ to the incision area.

2 1 9 6 3,~
~ WO96/06165 PCT/US95~10250 Recipients are penned in groups of four and fed 1.8kg of a standard 16% crude protein corn-soybean ration. Beginning on day 18 (day 0 = onset of estrus), all recipients are checked daily for signs of estrus using a mature boar. On day 35, pregnancy detection is performed using ultrasound. On day 107 of gestation recipients are tramsferred to the 5 farrowing suite. In order to ensure attendance at farrowing time, farrowing is induced by the a.l. ., ~ ;. ,., of ,u..,~ ,.l ;., F2a, (10 mg/injection) at 0800 and 1400 hours on day 112 of gestation. Recipients should farrow within about 34 hours of PGF2a V. Use of Trans~eni~ SwinP tn Te~t T~nnnan fTrowth Fa~tnr~
The animals of the mvention can be used as models to test for agents which act as agonists or antagonists of human growth factors. The agent to be tested can be a~ili~L~l~,d to an animal of the invention and proliferation of the transgenic h~ nnafnFoietir cells can be monitored.
Vl. I T~r of Tranc~ ~ni~ Swine T' st~ nn Cells in X~ nr~en.-i~ Tran~rlq~t Tbe following procedure was designed to lengthen the time an implanted swine organ (a xenograft) survives in a xenogeneic host prior to rejection. The organ can be any organ, e.g., a liver, e.g., a kidney, e.g., a heart. The main strategies are elimination of natural antibodies by orgam perfusion, ~ " ~ '~l'~ ' -' ;. . - of tolerance-inducing transgenic swine stem cells, and optionally, the ;~ .,. of donor stromal tissue. Preparation of 20 the recipient for I ~ ;( .., includes any or all of these steps. Preferably they are caTried out in the following sequence.
First, a preparation of horse anti-human thymocyte globulin (ATG) is ihlL a~ u~ly injected mto the recipient. The antibody preparation eliminates mature T
cells and natural killer cells. If not elimmated, mature T cells would promote rejection of 25 both the bone malrow transplant amd, after ,~ a ;,,.. ;.... the xenograft itself. Of equal impnrtan..-, the ATG preparation also eliminates natural killer (NK) cells. NK cells probably have no effect on the implanted organ, but would act i~ n~di~,t~.ly to reject the newly introduced bone malrow. Anti-human ATG obtained from amy " ._, " ", l j,. " host cam also be used, e.g., ATG produced in pigs, although thus far rreraratinn~ of pig ATG
30 have been of lower titer than horse-derived ATG. ATG is superior to anti-NK
mnnnclnnal Antibodies, as the latter are generally not Iytic to all host NK cells, while the polyclonal mixture in ATG is capable of Iysmg all host NK cells. Anti-NK ,n. .. ",.~1. " .al antibodies can, however, be used.
The presence of donor antigen in the host thymus during the time when host T
cells are .~.. ,.I;.. g post-transplant is critical for tolerizing host T cells. If donor - stem cells are not able to become established in the host thymus and mduce tolerance before host T cells regenerate repeated doses of anti-recipient T cell antibodies may be necessary throughout the non-~ ,l.Jal L..iv~ regimen. Continuous _ _ :, .... .. = ..... . ... _. .... ..

WO 96/06165 2 1 9 6 3 1 ~ PCr/lJsss/102so--depletion of hose T cells may be required for several weeks. Alternatively, e.g. if this approach is not successful, and tolerance (as measured by donor skin graft acceptance, specific cellular II,~UUIC~,UUI..;~ in vitro, and humoral tolerance) is not induced in these animals, the approach can be modified to include host Llly~ lvllly. In 5 LLy~ .".,:,~ d recipients, host T cells do not have am uul~ullLIll;ly to .lirrclcl.L;~ ~ in a host thymus, but must dirL~ .Li_'~ in the donor thymus. If this is not possible, then the animal has to rely on donor T cells developing in donor thymus for i~ f ~
T~","".,oc...,.l,. 1.... ~ can be measured by the ability to reject a non-donor type allogeneic donor skin graft, and to survive in a pathogen-containing ~IIVilUIII~I~.I...
It may also be necessary or desirable to cpl~nr-ctr,mi7f the recipient in order to avoid anemia.
Second, the recipient is a~ l;.t~,lGd low dose radiation in order to create hf~ t~p~irtir space. A sublethal dose of between 100 rads and 400 rads whole body radiation, plus 700 rads of local thymic radiation, has been foumd effective for this 15 purpose.
Third, natural antibodies are absorbed from the recipient's blood by hcll~u,u~,lr~;u~ of a swine liver. Pre-formed natural antibodies (nAB) are the primary agents of graft rejection. Natural antibodies bind to xenogeneic endothelial cells and are primarily of the IgM class. These antibodies are ;",1. IJ' ...1. ..1 of any known previous exposure to antigens of the xenogeneic donor. B cells that produce these naturalantibodies tend to be T cell-i . ~ ) s . .~, and are normally tolerized to self antigen by exposure to these antigens during d~ v ~IU~UIII~ L~ The mechanism by which newlydeveloping B cells are tolerized is unknown. The liver is a more effective absorber of natural antibodies than the kidney.
The fourth step in the non~ Ldl~lativc procedure is to implant donor stromal tissue, preferably obtained from fetal liver, thymus, and/or fetal spleen, into the recipient, preferably in the kidney capsule. Stem cell . ..~".r",,. .., and l~. .",.s,~ across disparate species barriers is enhanced by providing a l~ " t .,u: ~; stromal ~.IIVilUIIIII.,I
from the donor species. The stromal matrix supplies species-specific f~tors that are 30 required for ,.. ,-- o ~ between 1 A - ~ ~ cells and their stromal ClIV;lUl~ , such as l )l ~ - growth factors, adhesion molecules, and their ligands The thymus is the major site of T cell maturation. Each organ includes an organ specific stromal matrix that can support differentiation of the respective ~ldirrGlGllLi stem cells implanted into the host. Although adult thymus may be used, fetal tissue 35 obtained sufficiently early in gestation is preferred because it is free from mature T
Lo~"~ ~ which cam cause GVHD. Fetal tissues also tend to survive better than adult tissues when i , ' ' As an added precaution against GVHD, thymic stromal tissue can be irradiated prior to ~ ;.. , e.g., irradiated at 1000 rads. As an alternative or ~ WO 96106165 ~ 1 9 6 ~ 1 1 . PCT/US9!i/10~50 an adjunct to ;~lp~ fetal l,iver cells can be a~LIi~ in fluid qnerPncirln (The use of transgenic "humanized" swine cells (which can more effectively compete with host stem cells to repopulate the host) may eliminate the need for this step.) Fifth, transgenic swine bone marrow stem cells (BMC), e.g., swine BMC
S engineered to express the human c-kit gene, are injected into the recipient. Donor BMC
home to a,u~ , sites of the recipient and grow ~.., : ;~, .. ,. ,~ly with remaining host cells and proliferate, forming a chimeric Iyl l ~ h. ~ population. By thisprocess, newly forming B cells (and the antibodies they produce) are exposed to donor antigens, so that the transplant will be recognized as sel~ Tolerance to the donor is also 10 observed at the T cell level in animals in which b. .,. ' .~o '; stem cell, e.g., BMC, rl".."ll..~ ~I has been achieved. When an organ graft is placed in such a recipient several months after bone marrow chimerism has been induced, natural antibody against the donor will have .L,al,l.~,O.ed, and the graft should be accepted by both the humoral and the cellular arms of the immune system. This approach has the added advantage of15 permitting organ ~ SA~ , to be performed sufficiently long following tramsplant of cells, e.g., BMT, e.g., a fetal liver encrPncinn, that normal health and .- r will have been restored at the time of organ L. A~ I ;rm l'he use Of x~ .... 'r donors allows the possibility of using bone marrow cells and organs from the same animal, or from genetically matched animals.
While any of these procedures may aid the survival of an implanted organ, best results are achieved when all steps are used in .. 1.;.. ~ ;
The donor of the implant and the individual that supplies either the tolerance-inducmg h ., ....~,.. - ;r cells or the liver to be perfused should be the same individual or should be as closely related as possible. For example, it is preferable to derive implant 25 tissue ~rom a colony of donors that is highly inbred.
Othr. F."l1,..1;, ..1~
As is discussed llerein, it is often desirable to expose a graft recipient to irradiation in order to promote the d~ ,Iu"ln~,.ll of mixed chimerism. It is possible to induce mixed chimerism with less radiation toxicity by r. A 1~ ; L the radiation dose, i.e., by 30 delivering the radiation in two or more exposures or sessions. Accordingly, in any method of the invention calling for the irradiation of a recipient, e.g., a primate, e.g., a human, recipient, of a xenograft, the radiation cam either be delivered in a single exposure, or more preferably, can be fla~.Li~ ' mto two or more exposures or sessions.
The sum of the La~,Li, ' dosages is preferably equal, e.g., m rads or Gy, to the35 radiation dosage which cam result in mixed chimerism when given in a single exposure.
The fractions are preferably -yl~l~ 'y equal in dosage. For example, a single dose of 700 rads can be replaced with, e.g., two fractions of 350 rads, or seven fractions of 100 rads. Il~l, . r. ~ . of the radiation dose can also be used in methods of the wo96106165 ~1~ 6 ~ 50 Pcr/uss5llo2so--invention. The fractions can be delivered on the same day, or can be separated by intervals of one, two, three, four, five, or more days. Whole body irradiation, thymic *adiation, or both, can be fi s~rt;( As is discussed herein, l.~ .,.,..~ . r~ , e.g., h~l..u~ ru~;on with a donor organ, 5 can be used to deplete the host of natural antibodies. Other methods for depleting or otherwise \'~iillg natural antibodies can be used with any of the methods described herein. For example, drugs which deplete or inactivate natural antibodies, e.g.,d~ ,u~ lhl (DSG) (Bristol), or anti-IgM antibodies, can be lullll;~ cd to the recipient of an allograft or a xenograft. One or more of, DSG (or similar drugs), anti-IgM
10 antibodies, and l. ~ y~ r, " . can be used to deplete or otherwise inactivate recipient naturalantibodiesinmethodsoftheinvention. DSGata.l..~-~.sl..li..,.of6mg/kg/day, i.v., has been found useful in :~U,U~ ;llg natural antibody function in pig to cynomolgus kidney transplants.
Some of the methods described herein use lethal irradiation to create 15 1 I - space, and thereby prepare a recipient for the ~ of xenogeneic genetically engineered stem cells. In any of the methods described herein, uO~
primate or clinical methods, it is preferable to create I ,,uu;~l;c space for the 1 .1S r~n of such cells by non-lethal means, e.g., by ~ l, .;,.:~ .. .g sub-lethal doses of irradiation, bone marrow depleting drugs, or antibodies. The use of sublethal levels of 20 bone marrow depletion allows the generation of mixed chimerism in the recipient. Mixed chimerism is generally preferable to total or lethal ablation of the recipient bone marrow followed by complete 1~ , .1;. ., . of the recipient with ddlll;ll l~L~,Icid stem cells.
Other ~;lu11od;lll.,llt~ are within the following claims.

~ W 096106165 2 1 9 6 3 11 PCTAUS95/10250 SEQUENCE LISTING

(1) GENERAL INFORMATION:
ti) APPLICANT: David U. Sachs, Megan Sykes, and M_cfred Baetscher (ii) TITLE OF INVENTION: ~nPti~Rlly Engineered Swine cell_ (iii) NUMBER OF SEQUENCE5: 2 (iv) ~ ADDRESS:
(A) ADDRESSEE: Lahive & Cockfield (B) STREET: 60 State street (C) CITY: Bosto~
(D) STATE: Mn~ h.
(E) COUNTRY: U.S.A.
~P) ZIP: 02109 (v) COMPUTER REAOABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC 'ih1~
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFT~ARE: ASCII
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US 000000 (B) FILING DATE: Augu_t 19, 1994 (C~ CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/266,427 (B) FILING DATE: June 27, 1994 (A) APPLICATION NUMBER: 08/266,427 (B) FILING DATE: June 26, 1994 (A) APPLICATION NUMBER: 08/243,653 (B) FILING DATE: May 16, 1994 (A) APPLICATION = ER: 08/220,371 (B) FILING DATE: March 29, 1994 (A) APPLICATION NUMBER: 08/212,228 (B) FILING DATE: March 14, 1994 (A) APPLICATION N~MSER: 08/163,912 (B) FILING DATE: December 7, 1993 (A) APPLICATION NUMBER: 08/150,739 (B) FILING DATE: Novemher 10, 1993 (A) APPLICATION NUMBER: 08/126,122 (B) FILING DATE: september 23, 1933 WO96/06165 ~ PCTrUS95110250 -(A) APPLICATION NUMBER: 08/114,072.
(B) FILING DATE: Augu~t 30, 1993 ..
(A) APPLICATION NUMBER: 08/062,946 (B) FILING DATE: May 17, 1993 (A) APPLICATION NUMBER: 07/838,595 (B~ FILING DATE: February 19, 1992 (A) APPLICATION NUMBER: PCT~U894/01616 (B) FILING DATE: February 14, 1994 1S (viii) ATTORNEY/AGFNT INFORM~TION_ (A) NAME: MYERS, Louis (B) REGISTRATION NUMBER: 35,965 (C) REFERENCE/DOCKET NUMBER:~MGP-015 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (617) 227-7400 (B) TELEFAX: (617) 227-5941 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 1:
(i) SEQUENCE r~rT~RTqTICS:
(A) LENGTH: 22 (B) TYPE: nucleic acid ( C) ~ N ~ 3ingle (D) TOPOLOGY linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

rr~r~r.rr~T GATCCCTAAT GG 22 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 2:
(i) SEQUENCE r~R~rT~TcTIcs (A) LENGTH: 23 (B) TYPE: nucleic acid (C) 5TRP~nN~.qc cingle (D) TOPOLOGY_ linear (xi) SEQUENCE DESCRIPTION: SEQ ID~NO 2: _ L

~rr~T~rr~r GAGCCTTCTC ATG 231=

Claims (64)

What is claimed is:

1. A genetically engineered swine cell which includes one or both of: a transgene encoding a graft-supporting protein or a transgene which inhibits the action of a gene product which is graft-antagonistic, provided that the transgene encoding a graft-supporting protein and/or the transgene which inhibits the action of a gene product which is graft-antagonistic are other than a non-primate MHC gene.

2. The genetically engineered swine cell of claim 1, wherein said graft-supporting protein encoding transgene encodes a human growth factor or cytokine receptor.

3. The genetically engineered swine cell of claim 2, wherein said growth factor or cytokine receptor is chosen from the group of the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.

4. The genetically engineered swine cell of claim 1, wherein said graft-supporting protein encoding transgene encodes an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.

5. The genetically engineered swine cell of claim 4, wherein said human adhesion molecules is chosen from the group of VLA-4, c-kit, LFA-1, CD11a, Mac-1, CR3, CD11b, p150, p95, CD11c, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.

6. The genetically engineered swine cell of claim 1, wherein said graft-supporting protein encoding transgene encodes a recipient or donor protein which inhibits am immune response mounted by donor cells against the recipient.

7. The genetically engineered swine cell of claim 6, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

8. The genetically engineered swine cell of claim 1, wherein said graft-supporting protein encoding transgene encodes a recipient or donor protein which inhibits an immune response mounted by the recipient against donor cells.

9. The genetically engineered swine cell of claim 8, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

10. The genetically engineered swine cell of claim 1, wherein said transgene which inhibits the action of a gene product is: a transgene which encodes an anti-sense RNA which inhibits the expression or action of a recipient-derived graft-antagonistic protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome results in an endogenous gene which is mutationally inactivated by the introduction of a deletion into an endogenous genomic copy of the gene; a transgene which encodes an inhibitor of a donor- or recipient-derived graft-antagonistic protein; or a transgene which encodes a dominant negative mutation in a gene product which is graft-antagonistic.

11. The genetically engineered swine cell of claim 10, wherein the integration of said transgene results in a knockout for the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor.

12. The genetically engineered swine cell of claim 1, wherein said swine cell is isolated or derived from cultured cells, or from a transgenic animal.

13. A transgene comprising a swine promoter operably linked to either: a nucleic acid encoding a graft-supporting protein, or a nucleic acid which encodes a product which inhibits the action of a gene product which is a graft-antagonistic, provided that the transgene encoding a graft-supporting protein and/or the transgene which inhibits the action of a gene product which is graft-antagonistic are other than a non-primate MHC gene.

14. The transgene of claim 13, wherein said graft-supporting protein encoding nucleic acid encodes a human growth factor or cytokine receptor.

15. The transgene of claim 14, wherein said growth factor or cytokine receptor is chosen from the group of the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.

16. The transgene of claim 13, wherein said graft-supporting protein encoding nucleic acid encodes an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.

17. The transgene of claim 16, wherein said human adhesion molecules is chosen from the group of VLA-4, c-kit, LFA-1, CD11a, Mac-1, CR3, CD11b, p150, p95, CD11c, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.

18. The transgene of claim 13, wherein said graft-supporting protein encoding nucleic acid encodes a recipient or donor protein which inhibits an immune response mounted by donor cells against the recipient.

19. The transgene of claim 18, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

20. The transgene of claim 13, wherein said graft-supporting protein encoding nucleic acid encodes a recipient or donor protein which inhibits an immune response mounted by the recipient against donor cells.

21. The transgene of claim 20, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

22. A swine transgene which inhibits the action of a gene product which is graft-antagonistic, provided that the transgene other than a non-primate MHC gene.

23. The transgene of claim 22, wherein said transgene is: a transgene which encodes an anti-sense RNA which inhibits the expression or action of a recipient-derived graft-antagonistic protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome results in an endogenous gene which is mutationally inactivated by the introduction of a deletion into an endogenous genomic copy of the gene; a transgene which encodes an inhibitor of a donor- or recipient-derived graft-antagonistic protein; or a transgene which encodes a dominant negative mutation in a gene product which is graft-antagonistic.

24. The transgene of claim 23, wherein the integration of said transgene results in a knockout for the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor.

25. A transgenic swine having cells which include one or both of: a transgene encoding a graft-supporting protein, or a transgene which inhibits the action of a gene product which is a graft-antagonistic.

26. The transgenic swine of claim 25, wherein the said graft-supporting protein encoding transgene encodes a human growth factor or cytokine receptor.

27. The transgenic swine of claim 26, wherein said growth factor or cytokine receptor is chosen from the group of the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.

28. The transgenic swine of claim 25, wherein said graft-supporting protein encoding transgene encodes an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.

29. The transgenic swine of claim 28, wherein said human adhesion molecules is chosen from the group of VLA-4, c-kit, LFA-1, CD11a, Mac-1, CR3, CD11b, p150,p95, CD11c, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.

30. The transgenic swine of claim 25, wherein said graft-supporting protein encoding transgene encodes a recipient or donor protein which inhibits an immuneresponse mounted by donor cells against the recipient.

31. The transgenic swine of claim 30, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

32. The transgenic swine of claim 25, wherein said graft-supporting protein encoding transgene encodes a recipient or donor protein which inhibits an immuneresponse mounted by the recipient against donor cells.

33. The transgenic swine of claim 32, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

34. The transgenic swine of claim 25, wherein said transgene is: a transgene which encodes an anti-sense RNA which inhibits the action of a recipient-derivedgraft-antagonistic protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome results in an endogenous gene which is mutationally inactivated by the introduction of a deletion into an endogenous genomic copy of the gene; a transgene which encodes an inhibitor of a donor- or recipient-derived graft-antagonistic protein, or a transgene which encodes a dominant negative mutation in a gene product which is graft-antagonistic.

35. The transgenic swine of claim 34, wherein the integration of said transgene results in a knockout for the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor.

36. A method of inducing tolerance in a recipient mammal to graft cells from a donor mammal, including:
introducing into the recipient, donor hematopoietic stem cells, and introducing into the recipient, donor graft cells, provided that at least one of the following conditions is met: (1) the donor stem cells have been genetically engineered to promote a desirable interaction between the donor stem cells and cells or molecules of the recipient; (2) the donor stem cells have been genetically engineered to inhibit an unwanted interaction between the recipient and the donor stem cells; (3) the donor graft cells have been genetically engineered to promote a desirable interaction between the donor graft (and/or stem) cells and cells or molecules of the recipient; or (4) the donor graft cells have been genetically engineered to inhibit an umwanted interaction between the recipient and the donor graft (and/or stem) cells, and further provided that if the genetically engineered alteration in (1) or (2) is the insertion of an MHC gene then one or both of, donor cells which are genetically altered by other than the insertion of an MHC gene, or, genetically altered cells other than hematopoietic stem cells, are also introduced into the recipient.

37. The method of claim 36, wherein said donor stem cells include a transgene which encodes a graft-supporting protein.

38. The method of claim 36, wherein said donor graft cells include a transgene which inhibits the action of a gene product which is a graft-antagonistic.

39. The method of claim 37, wherein the transgene encodes a human growth factor or cytokine receptor.

40. The method of claim 39, wherein said growth factor or cytokine receptor is chosen from the group of the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.

41. The method of claim 37, wherein said transgene encodes an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.

42. The method of claim 41, wherein said human adhesion molecules is chosen from the group of VLA-4, c-kit, LFA-1, CD11a, Mac-1, CR3, CD11b, p150, p95, CD11c, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.

43. The method of claim 36, wherein said transgene encodes a recipient or donor protein which inhibits an immune response mounted by donor cells against the recipient.

44. The method of claim 43, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

45. The method of claim 36, wherein said transgene encodes a recipient or donor protein which inhibits an immune response mounted by the recipient against donor cells.

46. The method of claim 45, wherein said protein is chosen from the group of IL- 10, IL-4, or TGF-.beta..

47. The method of claim 38, wherein said transgene is: a transgene which encodes an anti-sense RNA which inhibits the expression or action of a recipient-derived graft-antagonistic protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome results in an endogenous gene which is mutationally inactivated by the introduction of a deletion into an endogenous genomic copy of the gene; a transgene which encodes an inhibitor of a donor- or recipient-derived graft-antagonistic protein; or a transgene which encodes a dominant negative mutation in a gene product which is graft-antagonistic.

48. The method of claim 47, wherein the integration of said transgene results in a knockout for the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor.

49. The method of claim 48, wherein the recipient is a human and the donor is a miniature swine.

50. A method of promoting the engraftment and or repopulation of the bone marrow of a xenogeneic recipient by donor swine hematopoietic stem cells and thereby inducing mixed chimerism in the xenogeneic recipient, comprising: providing a genetically engineered swine cell (which may or may not be a hematopoietic stem cell) which has been genetically engineered to promote a desirable interaction between donor stem cells and cells of molecules of the recipient or which has been geneticallyengineered to inhibit an unwanted interaction between the recipient and donor stem cells;
and, implanting the genetically engineered swine cell in the recipient, provided that, if the genetically engineered swine cell is not a swine hematopoietic stem cell, a swine hematopoietic stem cell is also implanted in the recipient, and further provided that the genetically engineered alteration is other than the insertion of an MHC gene.

51. The method of claim 50, wherein said genetically engineered swine cells include a transgene which encodes a graft-supporting protein.

52. The method of claim 50, wherein said genetically engineered swine cells include a transgene which inhibits the action of a gene product which is a graft-antagonistic.

53. The method of claim 51, wherein the transgene encodes a human growth factor or cytokine receptor.

54. The method of claim 53, wherein said growth factor or cytokine receptor is chosen from the group of the receptors for G-CSF, SCF, GM-CSF, IL-3, IL-6, IL-11, IL-2, Epo, and uteroferrin.

55. The method of claim 51, wherein said transgene encodes an adhesion molecule involved in engraftment and/or maintenance of hematopoietic cells.

56. The method of claim 55, wherein said human adhesion molecules is chosen from the group of VLA-4, c-kit, LFA-1, CD11a, Mac-1, CR3, CD11b, p150, p95, CD11c, CD49a, LPAM-1, CD49d, CD44, CD38, and CD34.

57. The method of claim 51, wherein said transgene encodes a recipient or donor protein which inhibits an immune response mounted by donor cells against the recipient.

58. The method of claim 57, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

59. The method of claim 51, wherein said transgene encodes a recipient or donor protein which inhibits an immune response mounted by the recipient against donor cells.

60. The method of claim 59, wherein said protein is chosen from the group of IL-10, IL-4, or TGF-.beta..

61. The method of claim 52, wherein said transgene is: a transgene which encodes an anti-sense RNA which inhibits the expression or action of a recipient-derived graft-antagonistic protein; a transgene which is a mutationally inactivated copy of a gene which encodes a donor graft-antagonistic protein and which when inserted into the donor genome results in an endogenous gene which is mutationally inactivated by the introduction of a deletion into an endogenous genomic copy of the gene; a transgene which encodes an inhibitor of a donor- or recipient-derived graft-antagonistic protein; or a transgene which encodes a dominant negative mutation in a gene product which is graft-antagonistic.

62. The method of claim 61, wherein the integration of said transgene results in a knockout for the donor cells' B-7 receptor, CD27 receptor, or LFA-3 receptor.

63. The method of claim 51, wherein the recipient is a human and the donor is a miniature swine.

64. A method for identifying or testing a therapeutic agent, by evaluating the agent's effect on transgenic swine cells comprising administering said agent to a transgenic swine, and evaluating the state of a hematopoietic tissue of said animal and comparing said state to that in a control animal.