Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
  • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/136—Screening for pharmacological compounds

Definitions

• the invention relates to genetic factors associated with sensitivity to chemotherapeutic drugs. More particularly, the invention relates to methods for identifying such factors as well as to uses for such factors.
• the invention specifically provides genetic suppressor elements derived from mammalian kinesin genes, and therapeutic and diagnostic uses related thereto.
• chemotherapeutic agents are used in the treatment of human cancer.
• the textbook CANCERr Principles & Practice of Oncology, 2d Edition, (De Vita et al., eds.), J.B. Lippincott Company, Philadelphia, PA (1985) discloses as major antineoplastic agents the plant alkaloids vincristine, vinblastine, and vindesine; the antibiotics actinomycin-D, doxorubicin, daunorubicin, mithramycin, mitomycin C and bleomycin; the antimetabolites methotrexate, 5- fluorouracil, 5-fluorodeoxyuridine, 6-mercaptopurine, 6-thioguanine, cytosine arabinoside, 5-aza-cytidine and hydroxyurea; the alkylating agents cyclophosphamide, melphalan, busulfan, CCNU, MeCCNU, BCNU, streptozotocin, chlorambucil, bis- diamined
• chemotherapeutic agents such as etoposide and amsacrine have proven to be very useful in the treatment of cancer.
• some tumor cells become resistant to specific chemotherapeutic agents, in some instances even to multiple chemotherapeutic agents.
• drug resistance or multiple drug resistance can theoretically arise from either the presence of genetic factors that confer resistance to the drugs, or from the absence of genetic factors that confer sensitivity to the drugs.
• the former type of factors have been identified, and include the multiple drug resistance gene mdr-1 (see Chen et al., 1986, Cell 47: 381-389).
• the latter type of factor remains largely unknown, perhaps in part because the absence of such factors would tend to be a recessive trait.
• the experiments described in this reference demonstrate that under-expression of the particular kinesin heavy chain gene disclosed therein was associated with naturally-occurring etoposide resistance in cultures of drug-selected human adenocarcinoma cells.
• the kinesins comprise a family of motor proteins involved in intracellular movement of vesicles or macromolecules along microtubules in eukaryotic cells ⁇ see Vale, 1987, Ann. Rev. Cell Biol. 3: 347-378; and Endow, 1991, Trends Biochem. Sci. 16: 221-225 for reviews).
• family of kinesin genes are encoded kinesin light chains and kinesin heavy chains that assemble to form mature kinesin. A number of kinesin genes have been isolated in the prior art.
• a heretofore unexpected gene a kinesin heavy chain gene
• a kinesin heavy chain gene is involved in cellular sensitivity to the anticancer drug etoposide, and that down-regulation of functional expression of this kinesin heavy chain gene is associated with resistance to this drug.
• Further experiments, disclosed herein, have suggested that the role of kinesin genes in chemotherapeutic drug resistance may not be limited to this single member of the kinesin gene family.
• the invention provides genetic suppressor elements (GSEs) that are random fragments derived from genes associated with sensitivity to chemotherapeutic drugs, and that confer resistance to chemotherapeutic drugs and DNA damaging agents upon cells expressing such GSEs.
• GSEs genetic suppressor elements
• the invention specifically provides GSEs derived from cDNA and genomic DNA encoding kinesin genes. Diagnostic assays useful in determining appropriate candidate cancer patients bearing tumors likely to be successfully reduced or eliminated by administration of particular anticancer treatment modalities, including chemotherapeutic drugs and other DNA damaging agents, are provided by the invention, on the basis of levels of kinesin gene expression in the tumor cells borne by such cancer patients. In vitro drug screening and rational drug design methods are also within the scope of the instant disclosure.
• the invention is based in part on the discoveries disclosed in co-pending U.S. Patent Application Serial No. 08/033,086, filed March 3, 1993 and incorporated by reference, providing a method for identifying and isolating GSEs that confer resistance to any chemotherapeutic drug for which resistance is possible.
• Particularly provided herein are methods for identifying GSEs derived from any kinesin gene, said GSEs being capable of conferring resistance to DNA damaging agents on cells expressing the GSEs. This method utilizes chemotherapeutic drug selection of cells that harbor clones from a random fragment expression library derived from kinesin- speciflc cDNA, and subsequent rescue of library inserts from drug-resistant cells.
• the invention provides GSEs comprising oligonucleotides and/or peptides derived from kinesin genes that function as GSEs in vivo and confer on cells expressing said GSEs resistance to DNA damaging agents, including certain chemotherapeutic drugs.
• the invention provides a method for obtaining GSEs having optimized suppressor activity for a kinesin gene associated with sensitivity to a chemotherapeutic drug. This method utilizes chemotherapeutic drug selection of cells that harbor clones from a random fragment expression library derived from DNA of a kinesin gene associated with sensitivity to that chemotherapeutic drug, and subsequent rescue of the library inserts from drug resistant cells.
• the invention provides synthetic peptides and oligonucleotides that confer upon cells resistance to DNA damaging agents, including certain chemotherapeutic drugs. These synthetic peptides and oligonucleotides are designed based upon the sequence of a drug- resistance conferring GSE derived from a mouse or human kinesin gene according to the invention.
• the invention provides a diagnostic assay for tumor cells that are resistant to one or more therapeutic DNA damaging agents and, at the same time, sensitive to therapeutic anti-microtubular agents, due to the absence of expression or under-expression of a kinesin gene.
• This diagnostic assay comprises quantitating the level of expression of any particular kinesin gene product in a particular tumor cell sample to be tested, and comparing the expression levels so obtained with a standardized set of cell lines expressing varying amounts of kinesin gene mRNA and/or protein and having different degrees of resistance to chemotherapeutic drugs and DNA damaging agents associated with their levels of kinesin gene expression.
• a standardized set of cell lines is matched by tissue type with the tissue type of the tumor cells to be evaluated.
• the invention provides methods for determining the appropriateness of candidates for particular cancer chemotherapeutic treatment modalities.
• the invention provides a means for determining whether a cancer patient is an appropriate candidate for treatment with DNA damaging chemotherapeutic drugs or other DNA damaging agents such as radiation, the method determining whether a kinesin gene, such as the kinesin heavy chain gene disclosed herein and in co-pending U.S. Patent Application Serial No. 08/033,086, is over-expressed or under-expressed in tumor cells borne by a cancer patient, relative to a standardized set of cell lines as disclosed herein.
• appropriate candidates for treatment with DNA damaging agents including certain chemotherapeutic drugs, will be those patients whose tumor cells over-express the kinesin gene.
• the invention provides a means for determining whether a cancer patient is an appropriate candidate for treatment with anti-microtubular chemotherapeutic drugs.
• appropriate candidates for anti-microtubular agent treatment will be those patients whose tumor cells under-express the kinesin gene compared with expression levels in a standardized set of cell lines.
• potential candidate cancer patients for treatment with anti- microtubular anticancer agents will have failed or proven resistant to a course of cancer chemotherapy using DNA damaging agents.
• the invention provides a starting point for the rational design of pharmaceutical products that are useful against tumor cells that are resistant to chemotherapeutic drugs.
• strategies can be developed for creating pharmaceutical products that will overcome drug resistance in tumor cells in which such kinesin genes are either over-expressed or under- expressed.
• Figures 1A and IB show a scheme for construction of a random fragment expression library (RFEL) from NIH 3T3 cDNA.
• Figure 1A shows the overall construction scheme.
• Figure IB shows normalization of the cDNA fragments.
• t represents total unfractionated cDNA
• s and d represent the single- stranded and double-stranded fractions separated by hydroxy apatite
• time points indicate the period of reannealing
• tubulin, c-myc, and c-fos indicate the probes used in Southern hybridization with the total, single-stranded and double-stranded fractions.
• Figure 2 shows the structure of the LNCX vector and the adaptor used in cDNA cloning.
• the nucleotide sequences are shown for the ATG-sense (SEQ.ID.No.: l) and ATG-antisense (SEQ.ID.No.:2) strands of the adaptor.
• Figure 3 shows the overall scheme for selecting cell lines containing chemotherapeutic drug resistance-conferring GSEs and rescuing the GSEs from these cells.
• Figures 4A and 4B show etoposide resistance conferred by preselected virus
• Figure 4C illustrates a schema dor recloning individual PCR-amplified fragments into the LNCX vector in the same position and orientation as in the original plasmid.
• Figures 5 A and 5B show resistance to various concentrations of etoposide, conferred upon the cells by the GSE anti-r.t. ⁇ . under an IPTG-inducible promoter (Figure 5A), and the scheme for this experiment (Figure 5B).
• Figure 6 shows the nucleotide sequence of the GSE an -khcs
• Figure 7 shows the nucleotide sequence of most of the coding region of the mouse khcs cDNA (SEQ.ID.No.:4).
• Figures 8A through 8D show the dot matrix alignments of khcs protein sequence deduced from the nucleotide sequence in Figure 7 with kinesin heavy chain sequences from human ( Figure 8A), mouse ( Figure 8B), fruit fly (Figure 8C), and GSE-C ( Figure 8D).
• Figures 9A and 9B illustrates the experimental protocol for drug-selected production of kinesin-derived GSEs (Figure 9A) and the structure of the adaptors used for the preparation of a random fragment KHCS cDNA library ( Figure 9B).
• Figure 10 shows etoposide resistance in HT1080 cells carrying insert-free vector virus or a random fragment library of human KHCS cDNA.
• Figure 11 shows the effects of different drugs on 4-day growth of NIH 3T3 cells infected with insert-free vector virus or with a virus encoding anti-khcs. Cell growth in the absence of the drug differed less than 5% for the compared populations. Drug concentrations are given in ng/mL. A representative series of parallel assays, carried out in triplicate, is shown.
• Figure 12 shows growth of cells carrying anti-khcs (solid lines) and control cells (broken lines) after treatment with colchicine or vinblastine.
• Cells were incubated with the drugs for 4 days, followed by 2 or 4 days in drug-free media, as indicated.
• Figure 13 shows a kinetic analysis of cell growth of anti-khcs GSE-carrying cells (black lines) and control cells (grey lines) incubated with different drugs.
• Cell growth was measured as described for Figure 13.
• Cells were plated and one day later (indicated by the first arrow) the indicated drugs were added at concentrations as described.
• Solid lines indicate cell growth in the continuous presence of the drug, and broken lines indicate cell growth after removal of the drug.
• Figure 14 demonstrates increased immortalization of primary mouse embryo fibroblasts by infection with the LNCX vector containing the anti-khcs GSE, relative to cells infected with the LNCX vector alone or uninfected (control) cells.
• Figure 15 demonstrates increased immortalization of primary human skin fibroblasts by infection with the LNCX vector containing the anti-khcs GSE (anti- khcs) at the 4th passage after infection, relative to human skin fibroblasts in growth crisis (control).
• Figure 16 shows cDNA-PCR quantitative analysis of expression of the human khcs gene in various unselected and etoposide-selected human HeLa cells.
• Lanes a shows results for clone CS(O), lands a' for clone CX(200), lanes b for clone ⁇ /ll(O), lanes b' for clone ⁇ l l (1000), lanes c for clone 6(0), lanes c' for clone 6(1000), lanes d for clone ⁇ 20(O) and lanes d' for clone ⁇ 20 (1000).
• the numbers in parentheses for each clone name indicate the concentration of etoposide (ng/ml) present in the growth media. Bands indicative of khcs expression are shown along with bands for ⁇ -2 macroglobulin expression as an internal control.
• the invention relates to means for suppressing specific gene functions that are associated with sensitivity and resistance to chemotherapeutic drugs.
• the invention provides genetic suppressor elements (GSEs) derived from kinesin genes that have such suppressive effect and thus confer resistance to DNA damaging agents including chemotherapeutic drugs.
• GSEs genetic suppressor elements
• the invention further provides methods for identifying such GSEs, as well as methods for their use.
• kinesin gene will be understood to encompass any kinesin gene, particularly mammalian, and preferably mouse or human, kinesin genes.
• Kinesins comprise a family of related genes encoding a number of related motor proteins involved in intracellular movement of vesicles or macromolecules along microtubules in eukaryotic cells ⁇ see Background of the Invention).
• the mature, functional kinesin molecule is comprised of products of a kinesin heavy chain gene and a kinesin light chain gene.
• the instant invention encompasses GSEs derived from both kinesin light chain and kinesin heavy chain genes.
• the invention specifically is intended to contain within its scope all kinesin genes and GSEs derived therefrom that are capable of causing resistance or sensitivity to DNA damaging agents.
• the DNA damaging agents that fall within the scope of this invention are all DNA damaging agents, including but not limited to ionizing and ultraviolet radiation, and certain chemotherapeutic drugs, including amsacrine, etoposide, doxorubicin (Adriamycin), cisplatin, and camptothecin.
• the invention provides a GSE derived from the cDNA of a mouse kinesin heavy chain gene isolated from a normalized, random fragment expression library made from total cellular mRNA from NIH 3T3 cells and isolated on the basis of its ability to confer resistance to the topoisomerase II drug, etoposide (described in Examples 1-4 herein and co-pending U.S. Patent Application Serial No. 08/033,086, filed March 3, 1993 and incorporated by reference).
• etoposide described in Examples 1-4 herein and co-pending U.S. Patent Application Serial No. 08/033,086, filed March 3, 1993 and incorporated by reference.
• the kinesin-derived GSE conferring resistance to etoposide caused cellular effects suggesting that kinesin may be involved in programmed cell death.
• the method according to this aspect of the invention therefore also provides valuable information about the genetic basis for senescence and cell death. This may have important implications for studying genes involved in development, since GSEs used to identify genes associated with chemotherapeutic drug resistance or senescence can also be expressed as transgenes in embryos to determine the role of such genes in development.
• the elucidation of the structure of the mouse kinesin heavy chain gene corresponding to this drug resistance-related GSE is described in Example 5 and functional analyses of the drug resistance capacity of this GSE is disclosed in Example 7.
• the invention provides a method for identifying kinesin gene-derived GSEs that confer resistance to a DNA damaging agent.
• the GSEs identified by this method will be homologous to a kinesin gene.
• the term "homologous to" a kinesin gene has two different meanings, depending on whether the GSE acts through an antisense mechanism or antigene mechanism ⁇ i.e. , through a mechanism of interference at the protein level).
• a GSE that is an antisense or antigene oligonucleotide or polynucleotide is homologous to a gene if it has a nucleotide sequence that hybridizes under physiological conditions to the gene or its mRNA transcript by Hoogsteen or Watson- Crick base-pairing.
• a GSE that interferes with a protein molecule is homologous to the gene encoding that protein molecule if it has an amino acid sequence that is the same as that encoded by a portion of the gene encoding the protein, or that would be the same, but for conservative amino acid substitutions.
• whether the GSE is homologous to a gene is determined by assessing whether the GSE is capable of inhibiting or reducing the function of the gene; in particular, any kinesin gene, preferably any mouse or human kinesin gene, as disclosed herein.
• the method according to this aspect of the invention comprises the step of screening a kinesin-specific cDNA or kinesin-specific genomic DNA random fragment expression library phenotypically to identify clones that confer resistance to a DNA damaging agent such as certain chemotherapeutic drugs.
• the library of random fragments of kinesin-specific cDNA or kinesin-specific genomic DNA is cloned into a retroviral expression vector.
• retrovirus particles containing the library are used to infect cells and the infected cells are tested for their ability to survive in a concentration of a DNA damaging agent that kills uninfected cells.
• the inserts in the library will range from about 100 b.p. to about 700 b.p.
• the library clone encoding the GSE is rescued from the cells.
• the nucleotide sequence of the insert of the expression library may be determined; in clones derived from a kinesin gene-specific cDNA random fragment expression library, the nucleotide sequence is expected to be homologous to a portion of the kinesin gene cDNA nucleotide sequence.
• the rescued library clone may be further tested for its ability to confer resistance to DNA damaging agents and chemotherapeutic drugs in additional transfection or infection and selection assays, prior to nucleotide sequence determination. Determination of the nucleotide sequence, of course, results in the identification of the GSE.
• This method is further illustrated in Example 6.
• the invention provides a method for obtaining kinesin gene-derived GSEs having optimized suppressor activity. By screening a random fragment expression library made exclusively from kinesin gene-specific fragments, a much greater variety of GSEs derived specifically from the kinesin gene can be obtained, compared with a random fragment library prepared from total cDNA as in Example 1.
• An additional feature of this aspect of the invention is the production of a multiplicity of kinesin-specific GSEs by drug selection of cells producing infectious retroviral embodiments of the kinesin-derived GSEs of the invention.
• ecotropic cells infected with a kinesin cDNA or kinesin genomic DNA-specific random fragment expression library are subjected to selection with a DNA damaging agent, preferably and most practically a chemotherapeutic drug such as etoposide.
• a population of resistant clones are thereby obtained, each containing a drug resistance-conferring, kinesin-derived GSE. Since these cells are capable of producing infection retroviral embodiments of the GSEs of the invention, a multiplicity of kinesin-derived GSEs, pre-selected for the ability to confer drug resistance, can be easily and efficiently produced.
• the invention provides synthetic peptides and oligonucleotides that are capable of inhibiting the function of kinesin genes associated with sensitivity to chemotherapeutic drugs.
• Synthetic peptides according to the invention have amino acid sequences that correspond to amino acid sequences encoded by GSEs according to the invention.
• Synthetic oligonucleotides according to the invention have nucleotide sequences corresponding to the nucleotide sequences of GSEs according to the invention.
• oligonucleotide corresponding to the nucleotide sequence of the GSE (for antisense- oriented GSEs) or amino acid sequence encoded by the GSE (for sense-oriented GSEs).
• synthetic peptides or oligonucleotides may have the complete sequence encoded by the GSE or may have only part of the sequence present in the GSE, respectively.
• the peptide or oligonucleotide may have only a portion of the GSE-encoded or GSE sequence.
• GSEs In such latter embodiments, undue experimentation is avoided by the observation that many independent GSE clones corresponding to a particular gene will have the same 5' or 3' terminus, but generally not both. This suggests that many GSE's have one critical endpoint, from which a simple walking experiment will determine the minimum size of peptide or oligonucleotide necessary to inhibit gene function. For peptides, functional domains as small as 6-8 amino acids have been identified for immunoglobulin binding regions. Thus, peptides or peptide mimetics having these or larger dimensions can be prepared as GSEs.
• oligonucleotides having sufficient length to hybridize to their corresponding mRNA under physiological conditions oligonucleotides having about 12 or more bases will fit this description.
• oligonucleotides will have from about 12 to about 100 nucleotides.
• oligonucleotide includes modified oligonucleotides having nuclease-resistant intemucleotide linkages, such as phosphorothioate, methylphosphonate, phosphorodithioate, phosphoramidate, phosphotriester, sulfone, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate and bridged phosphorothioate intemucleotide linkages.
• nuclease-resistant intemucleotide linkages such as phosphorothioate, methylphosphonate, phosphorodithioate, phosphoramidate, phosphotriester, sulfone, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate and bridged phosphorot
• oligonucleotides also includes oligonucleotides having modified bases or modified ribose or deoxyribose sugars.
• the invention provides dominant selectable markers that are useful in gene co-transfer studies. Since GSEs according to the invention confer resistance to chemotherapeutic drugs, the presence of a vector that expresses the GSE can readily be selected by growth of a vector-transfected cell in a concentration of the appropriate cytotoxic drug that would be cytotoxic in the absence of the GSE.
• the invention provides a diagnostic assay for tumor cells that are resistant to one or more DNA damaging agents, including certain chemotherapeutic drugs, due to the absence of expression or the under-expression of a kinesin gene.
• the class of DNA damaging agents resistance to which involves under-expression of a kinesin gene includes but is not limited to cisplatin, etoposide and camptothecin.
• human tumor cells can be treated with cytotoxic quantities of an appropriate chemotherapeutic drug to select for spontaneous drug resistant mutants. These mutants can then be assessed for their level of expressing of the particular gene of interest. Absence of expression or significantly reduced expression indicates a natural mechanism of chemotherapeutic drug resistance.
• collections of naturally occurring treatment- responding and non-responding tumor tissue samples can be examined for expression levels of kinesin genes, and correlations established between treatment outcome, and presumably the drug-resistant mechanisms thereof, and kinesin gene expression.
• a first embodiment of a diagnostic assay according to this aspect of the invention utilizes an oligonucleotide or oligonucleotides that is/are homologous to the sequence of a kinesin gene.
• RNA is extracted from a tumor sample, and RNA specific for a particular kinesin gene is quantitated by standard filter hybridization procedures, an RNase protection assay, or by quantitative cDNA-PCR ⁇ see Noonan et al., 1990, Proc. Natl. Acad. Sci. USA 87: 7160-7164).
• antibodies are raised against a synthetic peptide having an amino acid sequence that is identical to a portion of the kinesin heavy chain or kinesin light chain protein.
• Antibodies specific for the human kinesin heavy chain have in fact been disclosed ⁇ see Navone et al. , supra).
• These antibodies are then used in a conventional quantitative immunoassay ⁇ e.g. , RIA or immunohistochemical assays) to determine the amount of the gene product of interest present in a sample of proteins extracted from the tumor cells to be tested, or on the surface or at locations within the tumor cells to be tested.
• a particular utility for such diagnostic assays of this invention are their clinical use in making treatment decisions for the alleviation of malignant disease in humans. For example, a determination that the kinesin heavy chain gene of this invention is under-expressed in a tumor compared with the levels of expression found in normal cells comprising that tissue would suggest that a patient nearing such a tumor might be a poor candidate for therapeutic intervention using DNA damaging agents, since it would be expected that such kinesin under-expressing cells of the tumor would be resistant to such agents. Similarly, tumor cells which fortuitously over-express the kinesin heavy chain gene of the invention would be expected to be sensitive to such agents and thus to be susceptible to tumor cell killing by these agents.
• the instant disclosure provides experimental evidence that kinesin heavy chain gene under-expressors are sensitive to the cytocidal action of anti-microtubular agents, including for example colchicine, colcemide, vinblastine, vincristine and vindesine.
• kinesin heavy chain gene under-expressors are sensitive to the cytocidal action of anti-microtubular agents, including for example colchicine, colcemide, vinblastine, vincristine and vindesine.
• the invention provides a starting point for the rational design of pharmaceutical products that can counteract resistance by tumor cells to chemotherapeutic d gs.
• kinesin expression in a cancer cell can be increased by co- introduction of recombinant expression constructs encoding functional, full-length copies of a kinesin heavy chain and a kinesin light chain, whereby coordinate co- expression of such exogenous kinesins would result in increased expression of functional kinesin molecules in the cancer cells.
• the protein structure deduced from the cDNA sequence can also be used for computer-assisted dmg design, to develop new dmgs that affect this protein in the same manner as the known anticancer dmgs.
• the purified protein produced in a convenient expression system, can also be used as the critical component of in vitro biochemical screen systems for new compounds with anticancer activity. Accordingly, mammalian cells that express chemotherapeutic dmg resistance- conferring GSEs according to the invention are useful for screening compounds for the ability to overcome dmg resistance.
• both kinesin light chains and heavy chains should be present in such in vitro screening systems in amounts capable of reconstituting mature kinesin molecules in vitro.
• RNA was fragmented by boiling to an average size range of 600-1,000 nucleotides. These RNA fragments were then used for preparing randomly primed double- stranded cDNA. This randomly primed cDNA was then ligated to a synthetic adaptor providing ATG codons in all three possible reading frames and in a proper context for translation initiation.
• the structure of the adaptor (see Figure 2) determined its ligation to the blunt-ended fragments of the cDNA in such a way that each fragment started from initiation codons independently from its orientation.
• the adaptor was not supplied with termination codons in the opposite strand since the cloning vector pLNCX, contained such codons immediately downstream of the cloning site. (This vector has been described by Miller and Rosman, 1989, Biotechniques 7: 980-986.)
• the ligated mixture was amplified by PCR, using the "sense" strand of the adaptor as a PCR primer, (in contrast to the method of Patanjali et al.
• PCRs were carried out in 12 separate reactions that were subsequently combined, to minimize random over- or under-amplification of specific sequences and to increase the yield of the product.
• the PCR-amplified mixtures was size-fractionated by gel electrophoresis, and 200-500 bp fragments were selected for subsequent manipulations, (in contrast to Patanjali's fragment size range of from 400 to 1,600 bp.)
• the cDNA preparation was denatured and reannealed, using different time points for reannealing, as described by Patanjali et al., supra, and shown in Figure 1 A.
• the single-stranded and double-stranded DNAs from each reannealed mixture were separated by hydroxyapatite chromatography.
• the single- stranded DNA fractions from each time point of reannealing were PCR-amplified using the adaptor-derived primer and analyzed by Southern hybridization for the relative abundance of different mRNA sequences.
• the fraction that contained similar proportions of tubulin, c-myc and c-fos cDNA sequences (see Figures 1A and IB), corresponding to high-, medium- and low-expressed genes, respectively, was used for the library preparation.
• the normalized cDNA preparation was cloned into a Clal site of the MoMLV-based retroviral vector pLNCX, which carries the neo (G418 resistance) gene, transcribed from the promoter contained in the retroviral long terminal repeat (LTR), and which expresses the inserted sequence from a strong promoter of the cytomegalovims (CMV) (see Figure 2).
• the ligation mixture divided into five portions, was used for five subsequent large-scale transformations of E. coli.
• the transformed bacteria were plated on the total of 500 agar plates (150 mm in diameter) and the plasmid population (18 mg total) was isolated from the colonies washed off the agar.
• the plasmid library prepared according to Example 1 was converted into a mixture of retroviral particles by transfection into vims-packaging cells (derivatives of NIH 3T3) that express retroviral virion proteins.
• vims-packaging cells derivatives of NIH 3T3
• retroviral virion proteins include butyl-like proteins, glycation-associated proteins, and others.
• Ecotropic and amphotropic vims-packaging cell lines, GP+ E86 and GP+e/ ⁇ vAml2, respectively were mixed at a 1:1 ratio and 10 7 cells of this mixture were transfected with the plasmid library under standard calcium phosphate coprecipitation conditions.
• the library showed fairly even representation of different fragments, but at later stages individual vims-producing clones began to predominate in the population, leading to uneven representation of cDNA-derived inserts.
• the uniformity of sequence representation in the retroviral population was monitored by rapid extraction of DNA from cells infected with the vims-containing supernatant, followed by PCR amplification of inserts.
• the inserts were analyzed first by the production of a continuous smear in ethidium bromide-stained agarose gel and then by Southern hybridization with different probes, including topoisomerase II, c-myc and tubulin. As long as each gene was represented by a smear of multiple fragments, the representativity of the library was considered to be satisfactory.
• NIH 3T3 cells were infected either with a vims produced at the transient stage of transfection (days 1-3), or with the high-titer vims collected 10-12 days after transfection. In the latter case, 100 ml of viral suspension contained more than 10 8 infectious units.
• NIH 3T3 cells were infected with at least 10 7 recombinant retrovimses by using 500 ml of media from vims-producing cells (five rounds of infection, 100 ml of media in each).
• the overall scheme for the selection of GSEs conferring etoposide resistance is illustrated in Figure 3. This selection was carried out directly on vims-producing packaging cells, in the expectation that cells whose resistant phenotype is caused by the GSE expression will produce vims particles carrying such a GSE.
• the mixture of amphotropic and ecotropic packaging cells was transfected with the cDNA library in the LNCX vector, prepared according to Example 1 , and the vims was allowed to spread through the population for 9 days. Analysis of a small part of the population for G418 resistance showed that practically 100% of the cells carried the ne ⁇ -containing provims. The cells were then exposed to 350ng/mL etoposide for 15 days and then allowed to grow without dmg for two more weeks.
• NIH 3T3 cells infected with the library -derived vims produced by packaging cells that were selected with etoposide showed a major increase in the number of etoposide-resistant cells relative to the control cells infected with the insert- free LNCX vims, indicating the presence of biologically active GSEs in the preselected vims population (see Figure 4A).
• the proviral inserts contained in the etoposide-selected NIH 3T3 cells were analyzed by PCR. This analysis (see Figure 4B) showed an enrichment for specific fragments, relative to the unselected population of the infected cells. Individual PCR-amplified fragments were recloned into the LNCX vector in the same position and orientation as in the original plasmid, as illustrated in Figure 4C. A total of 42 proviral inserts, enriched after etoposide selection, were thus recloned, and tested either in batches or individually for the ability to confer increased etoposide resistance after retroviral transduction into NIH 3T3 cells.
• the components of this system include an enhancer-dependent promoter, combined in cis with multiple repeats of the bacterial l ⁇ c operator, and a gene expressing LAP265, an artificial regulatory protein derived from the l ⁇ c repressor and a mammalian transcriptional activator.
• the anti-khcs GSE was cloned into the plasmid pX ⁇ .CLN, which contains the inducible promotor used by Bairn et ⁇ l. , supra (a gift of Dr. T. Shenk) which expresses the inserts from an enhancerless SV40 early gene promoter supplemented with 21 repeats of the lac operator sequence.
• the resulting plasmid which contains no selectable markers, was co-transfected into NIH 3T3 cells together with the LNCX plasmid carrying the neo gene.
• the co- transfection protocol usually leads to the integration of the GSE in only a fraction of the G418-resistant cells, transfection with anti-khcs resulted in a clearly increased etoposide resistance, which was dependent on IPTG (see Figure 5B).
• Anti-khcs therefore encodes antisense RNA for a mouse khc gene, which we have termed khcs for khc associated with .sensitivity (to dmgs) or .senescence.
• khcs for khc associated with .sensitivity (to dmgs) or .senescence.
• kinesin-S formed by the associate of the KHCS protein with kinesin light chains, as kinesin-S, to distinguish it from the other kinesins present in mammalian cells.
• Example 3 The anti-khcs GSE isolated in Example 3 was used as a probe to screen
• the khcs gene is most highly homologous to the human gene (97% amino acid identity), suggesting that the human KHC ⁇ KHCS) gene is functionally equivalent to the mouse khcs.
• the alignment also shows that the anti-khcs GSE corresponds to the region which is the most highly diverged between different kinesins (shown in the Figure by brackets around these sequences.)
• the murine khcs gene is highly homologous to the human KHC (or KHCS) gene described by Navone et ⁇ l. (1992, J. Cell Biol.
• a library of random DNAasel-generated fragments of a full-length human KHCS cDNA (2.9 kb in length; provided by Dr. R.Vale, University of California at San Francisco) was generated essentially as described above for topoisomerase II cDNA ⁇ see Example 1 in co-pending U.S. Patent Application Serial No. 08/033,086, incorporated by reference), using the protocol illustrated in Figure 9A, with the following modifications.
• two synthetic adaptors instead of one, were used for ligation with DNAase I-generated cDNA fragments.
• One adaptor, containing three ATG codons carried a H dIII cloning site ( Figure 9B).
• the other adaptor had translation stop codons in all three reading frames and carried a CM cloning site ( Figure 9B).
• cDNA fragments were amplified by PCR using sense and antisense strands of the first and second adaptor, respectively.
• PCR products were digested with Cla ⁇ and Hindl ⁇ l and cloned into the corresponding sites of the pLNCX plasmid. This modification of the cloning strategy resulted in avoiding the formation of inverted repeats at the ends of the cDNA inserts after cloning into the retroviral vector.
• a plasmid library of 20,000 independent insert-carrying clones was obtained and transfected into ecotropic packaging cells using the calcium phosphate precipitation technique. Vims released by transiently transfected cells was used to infect HT1080/pJET-2TGH cells, clone 2, a derivative of human HT1080 fibrosarcoma cell line transfected with a plasmid expressing the murine ecotropic receptor (Albritton et al. , 1989, Cell 57: 659-666) and susceptible to infection with ecotropic retrovimses (provided by Dr. G.R. Stark, Cleveland Clinic Foundation).
• HT1080/ER After infection and G418 selection, these cells (further referred to as HT1080/ER) were plated at 10 5 cells per 100 mm plate and cultivated for 12 days in different concentrations of etoposide (200-500 ng/mL). After removal of the dmg, cells were allowed to grow in media without dmg for 7 more days. At this point, some of the plates were fixed and stained with crystal violet, to determine the number of surviving colonies ( Figure 10). As illustrated in Figure 10, at dmg concentrations of 250 ng/mL etoposide, there were only several colonies in control plates, compared with about a hundred times more colonies in the plates containing GSE-containing cells.
• the retroviral library of random fragments of KHCS cDNA contained numerous GSEs inducing dmg resistance in human cells, confirming that human KHCS is associated with dmg resistance. Some of these GSEs are likely to be more potent as selectable markers of dmg resistance that the original single GSE from the murine khcs gene.
• the vims isolated from such etoposide-resistant cells represents a collection of a multiplicity of kinesin-derived, dmg resistance-conferring GSEs, which multiplicity is itself an aspect of the present invention and is useful in conferring resistance to DNA damaging agents, including chemotherapeutic dmgs, as disclosed herein.
• a 1 : 1 mixture of ecotropic and amphotropic packaging cells was transfected with retroviral vector pLNCX carrying the anti-khcs GSE using a standard calcium phosphate procedure. Two weeks later, the vims titer, as measured by the formation of G418-resistant NIH 3T3 colonies, reached > 10° infectious units per mL as a result of "ping-pong" infection ⁇ see Bodine et ⁇ l. , 1990, Proc. Natl. Acad. Sci. USA 87: 3738-3742). This vims-containing supernatant was used to infect NIH 3T3 cells, 10 times with 12 hour intervals.
• Control cells were infected in parallel with the insert-free vector vims obtained by the same procedure. G418 selection showed that 100% of NIH 3T3 cells became infected with the vims. DNA from the infected cells was analyzed by Southern blot hybridization with a vims-specific probe. This analysis showed that the infected cells contained multiple copies of the integrated provims.
• Freshly-obtained multiply-infected NIH 3T3 cells were characterized by a decreased growth rate and plating efficiency. After several passages, however, their growth parameters became indistinguishable from the control cells, suggesting the elimination of slowly growing cells from the population. At this stage, the cells were frozen and used for the experiments described below.
• Example 7 The infected cell populations described in Example 7 were analyzed for resistance to several anticancer dmgs by a growth inhibition assay. For this assay, 10 4 cells per well were plated in 12-well plates and exposed to increasing concentrations of different dmgs for 4 days. Relative cell numbers were measured by the methylene blue staining assay (Perry et ⁇ l., 1992, Mutation Res. 276: 189-
• GSE-carrying cells were resistant to etoposide and adriamycin, but not to cisplatin, camptothecin or actinomycin D. Furthermore, the GSE-carrying cells were found to be hypersensitive to colchicine and vinblastine, said hypersensitivity being increasingly more evident with increasing length of the assay.
• NIH 3T3 cells carrying the anti- khcs GSE and control cells without the GSE were plated at a density of 2 x 10 4 per culture dish and grown for five days in concentrations of either colchicine or vinblastine. The cells were then fixed and stained, and the number of surviving cells determined and shown as a percentage of cell growth in the absence of dmg.
• the anti-khcs GSE made cells more susceptible to the growth- inhibitory effect of the dmg; this effect was increased with prolonged exposure and was equally apparent in the populations released from the dmg after 5 days or continuously maintained in colchicine ( Figure 13).
• GSE appears to decrease the extent of programmed cell death occurring after the release from the dmg in cells treated with some (etoposide) but not other (camptothecin) DNA-damaging agents.
• the pronounced effect of the anti- khcs GSE on the sensitivity of cells to anti-microtubule agents also indicates that this GSE affects the general kinesin function in the cells, and is not limited to a particular dmg-response-specific isoform of kinesin. Since we have demonstrated that down- regulation of the KHCS gene represents a natural mechanism of dmg resistance in human tumor cells ⁇ see Example 11), the hypersensitivity to colchicine provides an approach to overcoming this type of resistance in human cancer.
• MEF primary mouse embryo fibroblasts
• Post-crisis cells infected with the anti-khcs vims showed no microscopically visible features of neoplastic transformation. These results indicate that anti-fc ⁇ s promotes the immortalization of normal senescent fibroblasts. These results suggest that the normal function of kinesin-S may be associated with the induction of programmed cell death occurring after exposure to certain cytotoxic dmgs or in the course of cellular senescence. These results also indicate that isolation of GSEs that confer resistance to chemotherapeutic drags can provide insight into the cellular genes and processes involved in cell growth regulation.
• Example 4 The ability of the anti-khcs GSE described in Example 4 to promote immortalization of primary mouse embryo fibroblasts (demonstrated in Example 9) suggested that kinesin-S may act as a tumor suppressor by preventing immortalization of normal mouse fibroblasts. To determine if this gene may play the same role in human cells, the ability of the anti-khcs GSE to affect the life span of primary human fibroblasts was investigated. Primary human fibroblasts, derived from human skin, were obtained from the
• a G T G G C T T G A A A A T G A G C T C ( S E Q . I D . N o . : 7 ) a n d CTTGATCCCTTCTGGTAGATG (SEQ.ID.No. :8), and they amplify a 327 bp cDNA fragment.
• These primers were used to test for changes in the KHCS gene expression in several independently isolated populations of human HeLa cells, each selected for spontaneously acquired etoposide resistance; /3 2 -microglobulin cDNA sequences were amplified as an internal control.
• Figure 16 shows the results of the cDNA-PCR assay on the following populations: CX(0), HeLa population infected with the LNCX vector vims and selected with G418; CX (200), the same cells selected for resistance to 200 ng/ml etoposide; ⁇ ll(O), 6(O) and ⁇ 21(O), populations obtained after infection of HeLa cells with recombinant retrovimses carrying different GSEs derived from topoisomerase cDNA, as described in Example 1 of co-pending U.S. Patent Application Serial No.
• results presented in the above Examples suggest the utility of diagnostic assays for determining the expression levels of kinesin genes in tumor cells of a cancer patient, relative to a standardized set of cell lines in vitro having well- characterized levels of kinesin heavy chain gene expression correlated with their level of resistance to certain chemotherapeutic drags such as etoposide.
• One such standardized set of cell lines comprise the HeLa cell lines described in Example 11.
• tissue-specific standardized sets of cell lines are developed by drag selection for each cell type to be evaluated, for example, using human K562 cells for evaluating patients having chronic myelogenous leukemia, or human HL60 cells for patients having acute promyelocytic leukemia.
• the assay for kinesin would assess the appropriateness of treatment of human cancer patients with certain anticancer therapeutic regimens.
• Patients whose tumor cells under-express kinesin may be refractory to treatment with DNA damaging agents, including radiation and the chemotherapeutic dmgs etoposide, camptothecin, cisplatin and adriamycin.
• DNA damaging agents including radiation and the chemotherapeutic dmgs etoposide, camptothecin, cisplatin and adriamycin.
• anti-microtubular agents such as colchicine, colcemide, vinblastine, vincristine or vindesine.
• patients whose tumor cells over-express kinesin for example, may be responsive to treatment with DNA damaging agents and refractory to treatment with anti-microtubular agents.
• assays provide, for the first time, a basis for making such therapeutic judgments before the fact, rather than after a therapeutic regimen has been tried and failed.
• the assay also provide a basis for determining which patients, previously refractory to treatment with DNA damaging agents, particularly certain anticancer drags, would benefit from further chemotherapy using anti-microtubular agents, by distinguishing kinesin gene- mediated drag resistance from other mechanisms of dmg resistance expected to result in cross-resistance to both DNA damaging agents and anti-microtubular drags.
• MOLECULE TYPE CDNA
• HYPOTHETICAL NO
• ANTI-SENSE YES
• SEQUENCE DESCRIPTION SEQ ID NO:2: CCATCCATCC ATCGATGATT AAA 23
• TCTCTACCAA TTGGCTTTGT TGGTTAATCT CTTCATCCTT GTCATCAAGT TGTTTATACA 120
• MOLECULE TYPE cDNA
• HYPOTHETICAL NO
• SEQUENCE DESCRIPTION SEQ ID NO:4:
• MOLECULE TYPE cDNA
• HYPOTHETICAL NO
• SEQUENCE DESCRIPTION SEQ ID NO:7:

Applications Claiming Priority (3)

Publications (1)

Family

ID=22649124

Family Applications (1)

Country Status (8)

Families Citing this family (6)

Family Cites Families (2)

• 1995
  • 1995-01-05 JP JP7518581A patent/JPH09508006A/ja active Pending
  • 1995-01-05 WO PCT/US1995/000092 patent/WO1995018857A1/en not_active Application Discontinuation
  • 1995-01-05 ZA ZA9544A patent/ZA9544B/xx unknown
  • 1995-01-05 KR KR1019960703713A patent/KR100249915B1/ko not_active IP Right Cessation
  • 1995-01-05 CA CA002180426A patent/CA2180426A1/en not_active Abandoned
  • 1995-01-05 EP EP95906165A patent/EP0738321A1/en not_active Withdrawn
  • 1995-01-05 AU AU14488/95A patent/AU689840B2/en not_active Ceased
• 1996
  • 1996-07-04 NO NO962828A patent/NO962828L/no not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events