CA2180426A1 - Association of kinesin with sensitivity to chemotherapeutic drugs - Google Patents

Abstract

The invention provides genetic suppressor elements that confer upon a cell resistance to one or more chemotherapeutic drug, methods for identifying and obtaining such elements, and methods of using such elements. The invention also provides cloned genes associated with sensitivity to chemotherapeutic drugs, particularly a cloned human kinesin heavy chain gene involved in resistance to DNA damaging agents,

Description

~ wo 95/188~7 2 i 8 0 4 2 6 ASSOCIATION OF KINESIN WITH SEI~ Vl~ ~' TO CHEMOTHERAPEUTIC DRUGS
BACKGROUND OF THE INVENTION
1. Field Of The Tnve~
The invention relates to genetic factors associated with sensitivity to ,' ' , drugs. More ~uliLul~llly, the invention relates to methods for identifying such factors as well as to uses for such factors. The invention 10 specifically provides genetic suppressor elements derived from l~ iAll kinesin genes, and therapeutic and diagnostic uses related thereto.

2. ~ ~v Of The Rclated Art A broad variety of .l.. ll,.. ,.l,~.. li.. agents are used in the treatment of 15 human cancer. For example the textbook CANCER: Principles & Practice of Oncology, 2d Edition, (De Vita et al., eds.), J.B. Lippincott Company, ~.'1-.1. Ij,l.'~, PA (1985) discloses as major ~ /u~ ;, agents the plant alkaloids vincristine, vinblastine, and vindesine; the antibiotics aLLiuullly.,;u-D, du,.ulub;L;~
IUi(Ll~Ully~.;U, mitomycin C and bleomycin; the ~luul~ bolitL;~ ul~,illoi , 5-20 IlUL~luulllLil, 5-lluuludc~"~yu~idll~, 6-l~ L~ J~ , 6-~ , cytosine ~lbil-o~idc, 5-aza-cytidineand~.JI.u~yulL~, thealkylatingagents~:y~
melphalan, busulfan, CCNU, MeCCNU, BCNU, ~Ll~ ~,1..,..~.., ;., ,1~1 .,..",1.... ;1 bis-,1;~.\.;,.. .1;. l l ,.u-platinum, ~~ and the . ;~. 'l- . ., - agents ~L~ IC~ mAMSA and UllC.
ZS These and other LIl~ uLh~ a;L agents such as etoposide and amsacrine have proven to be very useful in the treatment of cancer. U.~l i 'y, some tumor cells become resistant to specific . l;. ---lh- ., agents, in some instances even to multiple l l -- --lh ~'l' --l;- agents. Such drug resistance or multiple drug resistance can theoretically arise from either the presence of genetic factors that confer resistance to the drugs, or from the absence of genetic factors that confer sensitivity to the drugs. The former type of factors have been identified, and include the multiple drug resistance gene mdr-l (see Chen et a~., lg86, Cell 47: 381-389).
However, the latter type of factor remains largely unknown, perhaps in part because the absence of such factors would tend to be a recessive trait.

wo 95/18857 . ~ . .2 2l ~`b~

T.~ ~ of genes associated with sensitivity to l~ .ll,. "I'` -';~ agents is desirable, because tbe discovery of such genes can lead to both diagnostic and tberapeutic approaches for cancer cells and for drug resistant cancer cells, as well as to . U~,.ll.,.lt~ in gene therapy and rational drug design. Recently, some 5 v~ lv~ have been made in the difficult area of isolating recessive genetic elements, including those involved irl cytotoxic drug ser~sitivity. Roninson et al., U.S. Patent No. 5,217,889 (issued June 8, 1993) teach a g~n~r~ 7pd method for obuining genetic suppressor elements (GSEs), whuch are dominant negative factorsthat confer the recessive-t.~fpe phenotype for the gene to which the particular GSE
lo ~ù~u~v~. (See also Holzmayer et a~., 1992, Nucleic Acids Res. 20: 711-717).GudkoY et al., 1993, Proc. Natl. Acad. Sci. USA 90: 3231-3235 teach isolation ofGSEs from lul,,~ 11 cDNA that induce resistance to Lul~v;~v~ ..a~e Il-interactive drugs. Co-pending U.S. Patent Application Serial No. 08/033,986, filed March 3, 1993, discloses the discover~f by the present inventors of a novel and 15 unPyr~rt~d result of ~AIJ~ performed to identif~f GSEs isolated from RNA of cells resistant to the anticancer DNA damaging agent, etoposide. This reference discloses that a GSE encoding an aMisense RNA l~ .t~ to a portion of a mouse kinesin heavy chain gene has the capacity to confer etoposide resistance to cells expressing the GSE. The ~ described in this reference also ~- -20 that under-expression of the particular kinesin heavy chain gene disclosed therein was associated with naturally-occurring etoposide resistance in cultures of dlU~ .d human ad~,l.v-~.,.i.lu..-d cells. These results were p~ ,ui~ly un~Tr~ct~d because the role of kinesin genes in etoposide resistance was unknown in the art prior to the instant inventors' discoveries.
The kinesins comprise a family of motor proteins involved in .. l."~f 11.. 1-.
movement of vesicles or l~ lu~vl~.,ules along 1ll;.,ll ' ' ' in eukaryotic cells (see Vale, 1987, Ann. Rev. Cell Biol. 3: 347-378; and Endow, 1991, Trends Biochem.
Sci. 16: 221-225 for reviews). Among the family of kinesin genes are encoded kinesin light chains and kinesin heavy chains that assemble to form mature kinesin.
30 A number of kinesin genes have been isolated in the prior art.
Gauger and Goldstein, 1993, J. Biol. Chem. ~: 13657-13666 disclose cloning and sequencing of a Drosopf~ila kinesin light cham gene.

~ W0 95/18857 2 1 8 Q 4 2 6 r~ . s Navone el al., 1992, J. Cell. Biol. 117: 1263-1275 disclose cloning and sequencing of a human kinesin heavy chain gene.
Kato, 1991, J. Neurosci. _: 704-711 disclose sloning and S~qll~on~inE Of a mouse kinesin heavy chain gene.
Cyr et al., 1991, Proc. Natl. Acad. Sci. USA 88: 10114-10118 disclose cloning and sequencing of a rat kinesin light chain gene.
McDonald & Goldstein, 1990, Cefl 61: 991-1000 disclose isolation of a Drosop)lila kinesin heavy chain gene.
Kosik et al., 1990, J. Biol. Chem. 265: 3278-3283 disclose isolation of a squid kinesin heavy chain gene.
The present inventors have ~' ' that a heretofore ................... ~ gene, a kinesin heavy chain gene, is involved in cellular sensitivity to the anticancer drug etoposide, and that down-regulation of functional expression of this kinesin heavy chain gene is associated with resistance to this drug. Further ~ . disclosed 15 herein, have suggested that the role of kinesin genes in ..1...,.~.11...,.~....:;. drug resistance may not be limited to this single member of the kinesin gene family.
These results further underscore the power of the GSE techmology developed by these inventors to elucidate unexpected .,.. ~ of drug resistance in cancer cells, thereby providing the u,u~u~ and the means for U.~.lUU~llillg drug 20 resistance in cancer patients. Reagents and methods directed towards such goals are provided in this disclosure.
BRIEF SUMMARY OF THE INVENTION
The invention provides genetic suppressor elements (GSEs) that are random fragments derived from genes associated with sensitivity to .1 .. 11.. ,.~ ;-. drugs, and that confer resistance to . l.. - --lh- "I" -lil drugs and DNA damaging agents upon cells expressing such GSEs. The invention specifically provides GSEs derived from cDNA and genomic DNA encoding kinesin genes. Diagnostic assays useful in .~ UUI candidate cancer patients bearing tumors likely to be 30 successfully reduced or eliminated by ~' of particular anticancer treatment modalities, including ,' l drugs and other DNA damaging agents, are provided by the invention, on the basis of levels of kinesin gene Wo 95/18857 2 t 8 ~ ~ 2 ~ r~l,u~

expression in the tumor cells borne by such cancer patients. In vitro drug screening and rational drug design methods are also within the scope of the instant disclosure.
The invention is based in part on the discoveries disclosed in co-pending U.S.
Patent Application Serial No. 08/033,086, filed March 3, 1993 and i~ ulr ' by 5 reference, providing a method for identifying and isolating GSEs that confer resistance to any ~ drug for which resistance is possible. Particularly provided herein are methods for identifying GSEs derived from any kinesin gene, said GSEs being capable of conferring resistance to DNA damaging agents on cellsexpressing the GSEs. This method utilizes . h.. ,ll.. ,.1.. li. drug selection of cells 10 that harbor clones from a random fragment expression library derived from kinesin-specific cDNA, and subsequent rescue of library inserts from drug-resistant cells.
In a second aspect, the invention provides GSEs comprising ,~ r~ and/or peptides derived from kinesin genes that function as GSEs in vivo and confer on cells expressing said GSEs resistance to DNA damaging agents, including certain 5 . ~.. "h. ~ drugs. In a third aspect, the invention provides a method for obtaining GSEs having optimized suppressor activity for a kinesin gene associated with sensitivity to a ' - ' - r `' drug. This method utilizes . h.. lh drug selection of cells that harbor clones from a r~mdom fragment expression library derived from DNA of a kinesin gene associated with sensitivity to tbat 20 chFmr)tl - drug, and subsequent rescue of the library inserts from drug resistant cells. P~ ul~l~ and preferably provided are such optimized GSEs derived from a mouse or human kinesin gene. In a fourth aspect, the invention provides synthetic peptides and ~ l; l , that confer upon cells resist mce to DNA damaging agents, including certain . h ll '' 1" ;' drugs. These synthetic 25 peptides and ~I;L~ IF~ are designed based upon the sequence of a drug-resistance conferring GSE derived from a mouse or human kinesin gene accordimg to the invention.
In a fifth aspect, the invention provides a diagnostic assay for tumor cells that are resistant to one or more therapeutic DNA damaging agents and, at the same time, 30 sensitive to tberapeutic anti-ll.;.,lut~.~lcu agents, due to the absence of expression or under-expression of a kinesin gene. This diagnostic assay comprises ~ -'; e the level of expression of any particular kinesin gene product in a particular tumor cell ~ W095118857 21dO~26 P~ 2 sample to be tested, and comparing the expression levels so obtained with a set of cell lines expressing varying amounts of kinesm gene mRNA
and/or protein amd having different degrees of resistance to .1,..,.. ,~ drugs and DNA damaging agents associated with their levels of kinesin gene expression.5 In preferred ~ , such a ~ set of cell lines is matched by tissue type with the tissue type of the tumor cells to be evaluated.
In a sixth aspect, the invention provides methods for .i. ~....;..;.~ the .~,u.ul,l of candidates for particular cancer ~ treatment modalities. In one preferred ' ' t, the invention provides a means for 10 ~ "L, whether a cancer patient is an ~ u~Jlidt~, candidate for treatment with DNA damaging .1.. 1.. ~ drugs or other DNA damaging agents such as radiation, the method ~ r, whether a kinesin gene, such as the kinesin heavy chain gene disclosed herein and in co-pending U.S. Patent Application Serial No.08/033,086, is over-expressed or under-expressed in tumor cells borne by a cancer 15 patient, relative to a ~ set of cell lines as disclosed herein. Using this method, ~ UU~ candidates for treatment with DNA damaging agents, including certain . l . . ,ll ,. "~ drugs, will be those patients whose tumor cells over-express tile kinesm gene. In another . ' ~' t, the invention provides a means for whether a carlcer patient is an ~ IIU~ . candidate for treatment with 20 anti--,.i, -u~ul,ula- ~}l.~--ur~ r - drugs. Using this aspect of the method, .u~, candidates for anti-~ ulubul~ agent treatment will be those patients whose tumor cells under-express the kinesin gene compared with expression levelsin a ~1.. l- .l;,. ~I set of cell lines. In a particularly useful ~.. 1.. 1;.. 1 of this aspect of the invention, potential candidate cancer patients for treatment with anti-25 ...i~,., ' ' anticancer agents will have failed or proven resistant to a course of cancer 1, ~ ~lh ~ .Y using DNA damaging agents.
In a seventh aspect, the invention provides a starting point for the rational design of pl .~ I products that are useful against tumor cells that are resistant to ~ drugs. By examining the structure, function, lnr~li7 l~inn amd 30 pattern of expression of kinesin genes associated with resistance to DNA damagmg agents and sensitivity to anti-microtubular, ' ' , drugs, strategies can be developed for creating l' I products that will overcome drug resistance ?180426 Wo 95/~88~7 in tumor cells in which such kinesm genes are either over-expressed or under-expressed.
Specific preferred ' ~ ' of the present invention will become evident from the following more detailed ~PC~ ~ir~i- n of certain preferred l ."l .o~l;, .~ .l~ and 5 the claims.
BRE~F DESCRIPTION OF THE DRAWINGS
Figures lA and IB show a scheme for ~ i..., of a random fragment expression library (RFEL) from NIH 3T3 cDNA. Figure IA shows the overall 10 ~.. ~:..., li...~ scheme. Figure lB shows ,.~."",~li, l;...~ of the cDNA fragments. In Figure lB, t represents total ~,.lrl ' cDNA, s and d represent the simgle-stranded and double-stranded fractions separated by ~l~ydlu~ kl time points mdicate the period of rP:lnnP~ , and tubulin, c-yc, and c-fos indicate the probes used in Southern l,~I,I;~i~liol. with the total, single-stranded and double-strarlded 15 fractions.
Figure 2 shows the structure of the LNCX vector and the adaptor used in cDNA cloning. The nucleotide sequences are shown for the ATG-sense (SEQ.lD.No.:1) and ATG-antisense (SEQ.ID.No.:2) strands of the adaptor.
Figure 3 shows the overall scheme for selecting cell lines containing 20 1 ".Ih. .,~ il drug resistance-conferring GSEs and rescuing the GSEs from these cells.
Figures 4A and 4B show etoposide resistance conferred by preselected virus (Figure 4A) and PCR analysis of the selected and unselected 1,, ~ ' (Figure 4B). Figure 4C illustrates a schema dor recloning individual PCR-amplified fragments into the LNCX vector in the same position and orientation as in the original plasmid.
Figures 5A and 5B show resistance to various ~ of etoposide, conferred upon the cells by the GSE anti-khcs under an IPTG-inducible promoter (Figure 5A), and the scheme for this t~ (Figure 5B).
Figure 6 shows the nucleotide sequence of the GSE anti-khcs (SEQ.lD.No.:3).

~ Wo95rl8857 2~ao~26 ~ u~.~
Figure 7 shows the nucleotide sequence of most of the coding region of the mouse khcs cDNA (SEQ.ID.No.:4).
Figures 8A through 8D show the dot matrix alignments of khcs protein sequence deduced from tile nucleotide sequence in Figure 7 with kinesin heavy chain 5 sequences from human (Figure 8A), mouse (Figure 8B), fruit fly (Figure 8C), and GSE-C (Figure 8D).
Figures 9A and 9B iilustrates the F'l"';"'''-'-' protocol for d~L~ cd production of kinesin-derived GSEs (Figure 9A) and the structure of the adaptorsused for the ulc~ ull of a random fragment KHCS cDNA library (Figure 9B).
lû Figure 10 shows etoposide resistance in HT1080 cells carrying insert-free vector virus or a random fragment library of human KHCS cDNA.
Figure 11 shows the effects of different dlugs on 4-day growth of NIH 3T3 cells infected with irlsert-free vector virus or with a virus encoding anti-khcs. Cell growth in the absence of the drug differed less than 5 % for the compared 15 p--l.u~ Drug are given in ng/mL. A .et,.c..~ ivc series of parallel assays, carried out in triplicate, is shown.
Figure 12 shows growtil of cells carrying anti-khcs (solid lines) and control cells (broken lines) after treatment with colchicine or vinblastine. Cells were incubated with the drugs for 4 days, foliowed by 2 or 4 days in drug-free media, as 20 indicated. Cell growth, presented in arbitrary units, was evaluated by methylene blue staining.
Figure 13 shows a kinetic analysis of cell growth of anti-khcs GSE-carrying cells (black lines) and control cells (grey lines) incubated with different drugs. Cell growth was measured as described for Figure 13. Cells were plated and one day 25 iater (indicated by the first arrow) the indicated drugs were added at: ~
as described. Four days later (indicated by the second arrow), the drugs were removed from some of the plates. Solid lines indicate cell growth in the continuous presence of the drug, and broken lines indicate cell growth after removal of the drug.
Figure 14 ~ increased i...,..u. ~liLCItiUll of primary mouse embryo 30 fibroblasts by infection with the LNCX vector containing the anti-khcs GSE, relative to cells infected with the LNCX vector alone or uninfected (control) cells.

wo gstl8857 2 t 8 ~ ~ ~ 6 . ~
Figure 15 ~' increased immortalization of primary human skin fibroblasts by infection with the LNCX vector containmg the anti-khcs GSE (anti-khcs) at the 4th passage after infection, relative to human skin fibroblasts in growth crisis (control).
Figure 16 shows cDNA-PCR 4uf l.. itdlivc analysis of expression of the human khcs gene im various unselected and etoposide-selected human HeLa cells. Lanes ashows results for clone CS(O), lands a' for clone CX(200), lanes b for clone ~:/11(0), lanes b' for clone ~11 (1000), lanes c for clone 6(0), lanes c' for clone 6(1000), lanes d for clone ~20(0) and lanes d' for clone ~20 (1000). The numbers10 in pf~lCII(~ for each clone name indicaoe the cull~cllLlf~iull of etoposide (ng/ml) present in the growth media. Bands indicative of khcs expression are shown alongwith bands for ,B-2 ~ ,lo~lub~dil~ expression as an internal control.
DETAILED DESCRIPTION OF THE l ~h~l) EMBODIMENTS
The invention relates to means for :~U~ ' ,, specific gene functions that are associated with sensitivity and resistance to . l...." ~ ;' drugs. The inventionprovides genetic suppressor elements (GSEs) derived from kinesin genes that havesuch :~U~J~llCD~ , effect and thus confer Rsistance to DNA damaging agents including . l .. ., ,~ ,ll .. . ,,l,~ ~ l ;f drugs. The invention further provides methods for identifying such 20 GSEs, as well as methods for their use.
For the purposes of this invention, the term "kinesin gene" will be understood to encompass any kinesin gene, ~flli.,UI~ ;,... and preferably mouse or human, kmesin genes. Kinesins comprise a family of related genes encoding a number of related motor proteins involved in in~r~rf ll-ll~r movement of vesicles or 25 macromolecules along utul,~ in eukaryotic cells (see B..~6L.~ ~ of the Invention). The mature, functional kinesin molecule is comprised of products of a kinesin heavy chain gene and a kinesin light chain gene. The instant imvention GSEs derived from both kinesin light chain and kinesin heavy chain genes. The invention specifically is intended to contam within its scope all kinesin 30 genes and GSEs derived therefrom that are capable of causing resistance or sensitivity to DNA damagmg agents.

~ W0 95118857 2 1 1~ 0 ~ 2 6 P~ s~ 2 The DNA damaging agents that fall within the scope of this invention are all DNA damaging agents, includmg but not limited to ioni_ing and ultraviolet radiation, and certain, ' ' , drugs, including amsacrine, etoposide, dUAUlLuici (A~iallly, ), cisplatin, and ....I,I..lh.. ;., In a first aspect, tbe invention provides a GSE derived from the cDNA of a mouse kinesin heavy chain gene isolated from a n~ i7~ ri, random fragment expression library made from total cellular mRNA from NIH 3T3 cells and isolatedon the basis of its ability to confer resistance to the l..~ 11 drug, etoposide (described in Examples 14 herein and co-pending U.S. Paoent Application Serial No.
08/033,086, filed March 3, 1993 and illCUlLJ~ ' ' by reference). Prior to the discovery by the present inventors, there was no suspicion that kinesin was in any way implicated in etoposide sensitivity. These results ~ I the ability of the general method for identifying GSEs to provide much new and surprising; ..r..., .. -, ;....
about the genetic basis for resistance to, ' ' , drugs.
In addition, the kinesin-derived GSE conferring resistance to etoposide caused cellular effects suggesting that kinesin may be involved in l~luol~ulllllcl cell death.
The method according to this aspect of the invention therefore also provides valuable i lrU~I~Liull about the genetic basis for senescence and cell death. This may have important . 1 for studying genes involved in d~ ,lu~ , since GSEs used 20 to identify genes associated with l ,Ih. ~ drug resistance or senescence can also be expressed as transgenes in embryos to determine the role of such genes in d~,v~,lu~ . The elucidation of the structure of the mouse kinesin heavy chain gene Lullcr _ to this drug resistance-related GSE is described in Example 5 and functional analyses of the drug resistance capacity of this GSE is disclosed in Example 7.
In a second aspect, the invention provides a method for identifying kinesin gene-derived GSEs that confer resistance to a DNA damaging agent. The GSEs identifled by this method will be l -' O to a kinesin gene. For purposes of the invention, the term "1~ tor a kinesin gene has two different meanings, depending on whether the GSE acts through an antisense I ' or antigene -.. (i.e., through a ' of Illt~,,l'~,,~,n~,e at the protein level). In the former case, a GSE that is an antisense or antigene I ' ,, ' ' or p~ lidc WOg~/18857 2180426 r~.,u.~l )5~ ~

is IIU~ OCJU~ to a gene if it has a nucleotide sequence that hybridi~es under I~IIJ ~ lo~;;~l conditions to the gene or its mRNA transcript by Hoogsteen or Watson-Crick base-pairing. In the latter case, a GSE that interferes with a protein molecule is ~ lh~v ~ to the gene encoding that protein molecule if it has an amino acid 5 sequence tbat is the same as that encoded by a portion of the gene encoding the protein, or tbat would be the same, but for . v~ , amino acid ~ ..c In either case, as a practical matter, whether the GSE is l."",nlh~,J..~ to a gene is rnin~d by assessing whether the GSE is capable of inhibiting or reducing the function of the gene; m particular, any kinesin gene, preferably any mouse or human 10 kinesin gene, as disc~osed herein.
The method according to this aspect of the invention comprises the step of screening a kinesin-specific cDNA or kinesin-specific genomic DNA random fragment expression library pll.,llul~h,/llly to identify clones that confer resistance to a DNA damaging ageM such as certain ~ h Ih- ~ il drugs. Preferably, the 15 library of random fragments of kinesin-specific cDNA or kinesin-specific genomic DNA is cloned into a retroviral expression vector. ln this preferred .. I.o,l;.. ,1 retrovirus particles containing the library are used to infect cells and the infected cells are tested for their ability to survive in a Ch :"-l;,. ~ of a DNA damaging agent that kills uninfected cells. Preferably, the inserts in the library will range from about 100 b.p. to about 700 b.p. and more preferably, from about 200 b.p. to about 500 b.p. Once a clonal population of cells that are resistant to the DNA damaging agent has been isolated, the library clone encoding the GSE is rescued from the cells.
At this stage, the nucleotide sequence of the insert of the expression library may be , . ""....1 in clones derived from a kinesin gene-specific cDNA random fragment expression library, the nucleotide sequence is expected to be l~.. hlhe,.. ,.~ to a portion of the kinesin gene cDNA nucleotide sequerlce. Alternatively, the rescued library clone may be further tested for its ability to confer resistance to DNA damagingagents and h ~ drugs in additional ~ f 1;- ~- . or infection and selection assays, prior to nucleotide sequence .' D.t~ of the 30 nucleotide sequence, of course, results in the ;,l. . l;1;. -:;.." of the GSE. This method is further illustrated m Example 6.

wo 95/18857 2 ~ 8 ~ 4 2 ~ ;2 Thus, the invention provides a method for obtaining kinesin gene-derived GSEs having optimized suppressor activity. By screening a random fragment expression library made ~.A,IU~ from krnesin gene-specific fragments, a much greater variety of GSEs derived specifically from the kinesin gene can be obtained, 5 compared with a random fragment library prepared from total cDNA as in Example1. C. . l.~, the likelihood of obtaining optimized GSEs, i.e., those kinesin-derived GSEs conferring an optimal level of resistance to a ~ drug, is maximized using the single gene random fragment library approach, as is shownm greater detail in Example 6.
An additional feature of this aspect of the invention is the production of a ~uul~ y of kinesin-specific GSEs by drug selection of cells producing infectiousretroviral ~ o~ of the kinesin-derived GSEs of the invention. In this aspectl ecotropic cells infected with a kinesin cDNA or kinesin genomic DNA-specific random fragment expression library are subjected to selection with a DNA damaging 15 agent, preferably and most practically a ~ l . lll. Al. ;. drug such as etoposide.
A population of resistant clones are thereby obtained, each containing a drug resistance-conferring, kinesin-derived GSE. Since these cells are capable of producing infection retroviral .~...1..~.1;..,..,l~ of the GSEs of the invention, a luulli~ ,iLy of kinesin-derived GSEs, pre-selected for the ability to confer drug 20 resistance, can be easily and efficiently produced.
In a fourth aspect, the invention provides synthetic peptides and ol;~.l I~u~ thatarecapableofinhibitingthefunctionofkinesingenesassociated with sensitivity to I I- - --IllI- 'AlI~ ~l;~ drugs. Synthetic peptides according to the invention have amino acid sequences that correspond to amino acid sequences 25 encoded by GSEs according to the invention. Synthetic ~'iv ' ' according to the invention have nucleotide sequences c~lllc~ùlldulo to the nucleotide sequences of GSEs according to the invention. Once a GSE has been discovered and sequenced, and its orientation is (~'r~lmint~1~ it is ~ iollLrul~Ald to prepare an UIIC:~IJulldillo to the nucleotide sequence of the GSE (for antisense-30 oriented GSEs) or amino acid sequence encoded by the GSE (for sense-oriented GSEs). In certain ~ ' " , such synthetic peptides or l ~ O '~ ' may have the complete sequence encoded by the GSE or may bave only part of the WO 95/188~.7 ~ I a Q ~ ~ ~ r~

sequence presen~ in the GSE, I~D~L~ Y In cer~ain other ~ ;. t~ the peptide or rl;g~,.",. 1- v~ may haYe only a portion of the GSE-encoded or GSE
sequence. In such latter ~ l.v~ undue ~ l" is avoided by the uL.,~ iiu.. that many ', ' GSE clones collc~,uvlldill~ to a particular gene 5 will have the same 5' or 3' terminus, but generally not both. This suggests that many GSE's have one critical endpoint, from which a simple walking ~
will determine the minimum size of peptide or nl;~,~",... 1. .~li~l~ necessary to inhibit gene function. For peptides, functional domains as small as 6-8 amino acids havebeen identified for .' ` lin binding regions. Thus, peptides or peptide 10 mimetics having these or larger dimensions can be prepared as GSEs. For antisense nl;, ~-.. If v~ , inhibition of gene function can be mediated by ~ C
having sufficient length to hybridize to their Cu.lcD~o...:li..g mRNA under v~ ,;olo~,i,dlconditions. Generally,r/li~,.." I~v~ havingaboutl20rmorebases will fit this fi~crrirtit~n Preferably, such r~ f ~ if C will have from about 1215 to about 100 ~rl~oti~irs As used herein, the term ~ includes modified v~ f c having nuclease-resistant i.,t~ v~ r linkages, such as 1J1IO~7IV~J~ illy~ ,VIIUDIVIIUI~ . i .
I ' . ' , sulfone, siloxane, carbonate, ~ lbu~ ylll.,llyl~7L~.~ a~ ' , csrbamate, thioether, bridged ~' . ' ' , bridged methylene ~' , ' and bridgedl'~,' .:' ;"ir", l~v~ linkages. Thesynthesisof~l;"., l v~
containing these modified linkages is well known in the art. (See, e.g., Uhlmannand Peyman, 1990, Chemical Reviews 2Q: 543-584; Schneider and Banner, 1990, Tetrahedron Letters ~1: 335). The term r~ - - If v~ , also includes r,l;f ,.... ,. I~V~ ., having modified bases or modified ribose or dcv~.ylil)u~7c sugars.
In a fifth aspect, the invention provides dominant selectable markers that are useful in gene co-transfer studies. Since GSEs according to the invention conferresistance to . I .- - -- -~ drugs, the presence of a vector that expresses tbe GS~
can readily be selected by growth of a vector-transfected cell in a ~ of the dlJI)lUUl' ' cytotoxic drug that would be cytotoxic in the absence of the GSE.
GSEs according to the invention are ~ILi~ula~ well suited as dominant ælectable markers because their small size allows them to be easily illcv.l), ' along with a gene to be co-transferred even into viral vectors having limited packaging capacity.

wo 95/18857 2 1 8 0 4 2 6 ~,IJ~J.,,~. ~9~

In a sixth aspect, the invention provides a diagnostic assay for turnor cells that are resistant to one or more DNA damaging agents, including certain . .l i. drugs, due to the absence of expression or the under-expression of a kinesin gene. In particular, the class of DNA damaging agents resistance to which 5 mvolves under ~ D;oll of a kinesin gene includes but is not limited to cisplatin, etoposide and , ' To determine whether absence of expression or under-expression of a kinesin gene is a naturally occurring, and thus medically significant basis for . l.. ~ 1.. v: ;~ drug resistance, human tumor cells can be treated with cytotoxic quantities of an a~ u~ drug to select for, 10 drug resistant mutants. These mutants can then be assessed for their level ofexpressing of the particular gene of interest. Absence of expression or a;L-lir 'l, reduced expression indicates a natural ' of . ll....~ ll...,.l..:i. drug resistance. The description of such an ~ disclosing that under-expression of the human kinesin heavy chain gene disclosed herein is associated with naturally-15 occurring resistance to the . ~ drug etoposide in cultures of etoposide-resistant human d~ lO~ ;llUllla (HeLa) cells, is disclosed in Elxample 11 herein and in co-pending U.S. Patent Application Serial No. 08/033,086,filed March 3, l9g3 and ill~.Ul~ll ' ' by refererlce. In a preferred ~o~ of this assay, a Dialldald~ set of tissue-specif~c cell lines, wherein the levels of drug resistance and 20 kinesin gene expression have been quantitated and correlated with each other, are provided for tumors from each tissue type to be assayed.
Alternatively, and preferably, collections of naturally occurring treatment-responding and non-responding tumor tissue samples can be examined for expression levels of kinesin genes, and ull~,la~iO.~ established between treatment outcome, amd 25 ~ ,~bly the drug-resistant I ' thereof, and kinesin gene ~ rrPQQ;~n Accordmgly, such reduced or absent expression can be the basis for a diagnostic assay for tumor cell resistance to a DNA damagrng agent or , h. ~ drug or drugs of mterest. A first ... l .".l: ....: of a diagnostic assay according to this aspect of the invention utilizes an oli~. ' ' or 30 ~ ' that islare l~ to the sequence of a kinesin gene. In this .."l",.~ RNA is extracted from a tumor sample, and RNA specific for a particular kinesin gene is quantitated by standard filter ll,~blidh,a~;u procedures, an W095/18857 2 1 80426 ~l/L--5- l ~

RNase protection assay, or by ~. v~ cDNA-PCR (see Noonan ef al., 1990, Proc. Natl. Acad. Sci. USA 87: 7160-7164). In a second ~ .o.l;. ..l of a diagnostic assay according to this aspect of the invention, antibodies are raised against a synthetic peptide having an amino acid sequence that is identical to a5 portion of the kinesin heavy chain or kinesin light chain protein. Antibodies specific for the human kinesin heavy chain have in fact been disclosed (see Navone et al., supra). These antibodies are then used in a co..~, ' yuallliLa~iv~ -r,-~-y (e.g., RIA or ' ' ' assays) to determine the amount of the gene product of interest present in a sample of proteins extracted from the tumor cells to 10 be tested, or on the surface or at locations within the tumor cells to be tested.
A particular utility for such diagnostic assays of this invention are their clinical use in making treattnent decisions for the alleviation of malignant disease in humans. For example, a ~l. ~ ..,.,;..-~;-... that the kinesin heavy chain gene of this invention is under-expressed in a tumor compared with the levels of expression found 15 in normal cells comprising that tissue would suggest that a patient nearing such a tumor might be a poor candidate for therapeutic i~ Liul~ using DNA damaging agents, since it would be expected that such kinesin under-expressing cells of the tumor would be resistant to such agents. Similarly, tumor cells which rUl~UivJu~ly over-express the kinesin heavy chain gene of the mvention would be expected to be 20 sensitive to such agents and thus to be susceptible to tumor cell killing by these agents. On the other hand, the instant disclosure provides ~ l evidence that kinesin heavy chain gene under-expressors are sensitive to the cytocidal action of anti-~..;c-~ ~vula. agents, including for example colchicine, colcemide, vinblastine, vincristine and vindesine. These results suggest that patients bearing tumors whose 25 cells under-express the kinesin heavy chain gene of the present invention may be responsive to treatment with DNA damaging agents. The present invention thus enables intelligent and inforlned therapeutic i..v_l.,,..Li.~ll based on properties of an individual cancer patient's tumor resistance or sensitivity to DNA damaging agents and other ~ v'; treatment modalities, where treatment choices can be 30 made prior to initiation of treatment based on ~ of resistance specific for DNA damaging agents and mediated by kinesin heavy chain gene over- or under-expression. PalLi~,ulally useful im this aspect of the invention are kinesin-spccific WO 95/18857 2 ~ 8 0 4 2 6 1 l~ .2 amtibodies, such as the anti-kinesin heavy chain antibodies described in Navone, et al., supra, for detection of kmesm expression leYels in tumor samples.
In a seventh aspect, the mvention provides a starting point for the rational design of ~ products tbat can counteract resistance by tumor cells to 5 ' I' - '1l'' '''l'' ';' drugs.
U~ ~1. . .`1- ..1 i . .~ the 1: ' function of the kinesin genes tnat are involved in drug sensitivity is likely to suggest ~ means to stimulate or mimic the function of such genes and thus augment the cytotoxic response to anticancerdrugs. One may also be able to up-modulate gene expression at the level of 10 ~ This can be done by cloning the promoter region of each of the ~:UIIC~I)Olld;ll~ kinesin genes and analyzing the promoter sequences for the presence of cis elements known to provide the response to specific biological - ' Due to the structure of the kinesins in eukaryotic cells, i.e., comprised of both kinesin heavy chain and kinesin light chain proteins, coordinate up-regulation of the 15 expression of both of Lhe ~ JIU~II' ' kmesin light chain and heavy chain proteins would be required for efficacious therapeutic iu,~ .,u.iu.~ based on mo~ l expression o~ kinesin genes.
Al ~.,Iy, kinesin expression in a cancer cell can be increased by co-;IILIOdU~L;O.. of IC~ expression constlucts encoding functional, full-length 20 copies of a kinesin heavy chain and a kinesin light chain, whereby coordinate co-expression of such exogenous kinesins would result in increased expression of functional kinesin molecules in the cancer cells.
The protein structure deduced from the cDNA sequence can also be used for computer-assisted drug design, to develop new drugs that affect this protein in the 25 same manner as the known anticancer drugs. The purified protein, produced in a convenient expression system, can also be used as the critical component of in vitro IJ .~I 1....,:. ,.1 screen systems for new ~ with anticancer activity.
Accordingly, m^ -~ ~li cells tnat express ~ . : i. drug resistance-conferring GSEs acc~rding to the invention are useful for screening ~ u~ for 30 the ability to overcome drug resistance. As with pl ----~methods, both kinesin light chains and heaYy chains should be present in such in wo 95/18857 2 1 ~ O ~ 2 6 P~

vitro screening systems in amounts capable of IC~`I - ;I.,I;Ilg mature kinesin molecules in vltro.
Specific preferred ' ' of the present invention will become evident from the following more detailed description of certain preferred e ~ and 5the claims.

G '- Of a ~ ' Random Fr~gment rn~A ~." In A R~roYiral Vector A normalized cDNA population was prepared using a .. ~ ;.. of the protocol of Patanjali et al. (1991, Proc. Natl. Acad. Sci. USA 88: 1943-1947), illustrated in Figure IA and lB. Poly(A)~ RNA was extracted from NIH 3T3 cells.
To obtain mRNAs for differeM genes expressed at various stages of the cell growth, one half of the RNA was isolated from a rapidly growmg culture and the other half 15 from quiescent cells that had reached complete monolayer r~nflll~n~e To avoidU,~ C~ lLdLiUII of ti~e 5'-end sequences in a r~mdomly primed cDNA population, RNA was r,- c - -~- I by boiling to an average size range of 600-1,OOO l.- - I~Vt;-l;
These RNA fragments were then used for preparing randomly primed double-stranded cDNA. l'his randomly primed cDNA was then ligated to a synthetic 20 adaptor providing ATG codons in all three possible reading frames and in a proper context for translation initiation. The structure of the adaptor (see Figure 2) d~ tPrmin~d its ligation to the blunt-ended fragments of the cDNA in such a way that each fragment started from initiation codons; ~ ly from its, The adaptor was not suppiied with i codons m the opposite strand since the 25 cloning vector pLNCX, contained such codons ~y du...~c of the cloning site. (This vector has been described by Miiler and Rosman, 1989, r . 1 980-986.) The ligated mixture was amplified by PCR, using the "sense" strand of the adaptor as a PCR primer, (in contrast to the metilod of Patanjali et al., which utilized cloning the initial cDNA ,UlC,U~ lLiUII into a phage 30 vector and then using vector-derived sequences as PCR primers to amplify the cDNA
population.) The PCRs were carried out in 12 separate reactiorls that were ~.,1.~.1... l1~ combined, to minimize random over- orurLder-- ,~l.l;l; -~;.... of specific sequences and to increase the yield of the product. The PCR-amplified mixtures was ~ WO9S/18857 21 8042b r_.,O~.s~

si_e-r~ by gel ~ .uu~llv~ , and 200-500 bp fragments were selected for slZbsequent, ..., -;,...l -~ i....~, (in contrast to Patanjali's fragment size tange ûf from 400 to 1,600 bp.) For l~ the cDNA ~cL/~ n was derlatlZred and reannealed, 5 using different time points for .~ ' ~, as described by Patanjali et al., supra, and shown in FiglZre lA. The single-stranded and double-stranded DNAs from each reaMealed mixtlZre were separated by ~l~dlu~.y.~ iLc .,1~ c~ y. The single-stranded DNA fractions from each time point of ~,~IIl.,~lilll~ were PCR-amplified using the adaptûr-derived primer and analy~ed by Soutnern ll~iJlidiL.Iliull for the 10 relative abundance of different mRNA sequences. The fraction that contained similar proportions of tlZbulin, c-~ryc and c-fos cDNA sequences (see Figures lA and lB), cullc;~)ulldi~lZ~ tO high-, medium- and low-expressed genes, lC~ y, was used for the library pl~.ll~iUII.
The nnnnAli7Pd cDNA ~ .. was cloned into a CZ'al site of the 15 MoMLV-based retroviral vector pLNCX, which carries the neo (G418 resistance) gene, transcribed from the promoter contained in the retroviral long terminal repeat (LTR), and which expresses the inserted sequence from a strong promoter of the uylu~ Z,.dvvilu~ (CMV) (see FiglZre 2). The ligation mixture, divided into five portions, was used for five subsequent large-scale j r '' of E. coli. The Ll_-l,ru--.. ~ bacleria were plated on the total of 500 agar plates (150 mm in diameter) and the plasmid population (18 mg total) was isolated from tne colonies washed off the agar. A total of ~~ 'S, 5 x 10~ clones were obtained, more than 60% of which carried the inserts of normalized cDNA, as estimated by PCR
A...l.lirl--li..., of inserts from 50 randomly picked colonies. These results ~ the feasibility of generating a nf~nnAli7pd cDNA library of as many as

3 x 107 lC~ clones in a retroviral plasmid expression vector.

Tl ' " Of A Retroviral RarZdom Fragment Library Iuto Virus-Pork~in~ Cell Lin~s And N~ 3T3 Cells The plasmid library prepared according to Example 1 was converted into a mixture of retroviral particles by i ~ into virus-packaging cells (derivatives of NIH 3T3) that express lotroviral virion proteins. (Examples of such cell lines have Wo 95/18857 2 ~ 8 ~ 4 ~ ~

been described by Markowit7 et al., 1988, Virology 167: 400406.) Ecotropic and vLIu~!i., virus-packagmg cell Imes, GP+ E86 and GP+envAml2, l~ ly~
were mixed at a 1:1 ratio and 107 cells of this mixture were transfected with the plasmid library under standard calcium phosphate cu~ conditions. This S ~ resulted m the packagmg and secretion of ecotropic and a~ vllull;c virus particles, which rapidly spread through the packaging cell porlllqtir~n since ecotropic viruses are capable of infecting a~ lluLIu~, packaging cells and vice versa The yield of the virus, as measured by the number of G418-resistant colonies obtained after the infection of NIH 3T3 cells, reached 105 infectious units per 1 mL
10 of media during the stage of transient llr l-r-~l;l... (1-3 days), then decreased (4-8 days) and then rapidly increased due to the expression of proviral genomes that became stably integrated in most of the packaging cells. The yield of the virus 9-12 days after Llall~rt~,liull reached > 106 per 1 mL of media ~ At this stage, the library showed fairly even lc~ llLaliull of different fragments, but at later 15 stages individual virus-producing clones began to ~,~,' in the pnplllqtirm leading to uneven ~CIJIC ' ' ûf cDNA-derived inserts. The uniformity of sequence Ic~)lc~.. a~iùll in the retroviral population was monitored by rapid extraction of DNA from cells infected with the virus-containing ~ . followed by PCR . ~,.l;l;. ,~1;..l. of inserts. The inserts were analy7ed first by the production 20 of a continuous smear in ethidium bromide-stained agarose gel and then by Southern llybl;ll;~aL;ull with different probes, including Icl~l V~ ..11, c-myc and tubulin.
As long as each gene was ~ ' by a smear of multiple fragments, the ICIJI~, ' "vily of the library was corlsidered to be Oali~ra~,~vl~.
In other ~ , for l ~ the random-fragment nrlnn~li7.~d cDNA
25 library into NIH 3T3 cells, without loss of Icl~l~,OcllLaliv;Ly, NIH 3T3 cells were irlfected either with a virus produced at the transient stage of LlallDf~,~.Liull (days 1-3), or with the hightiter virus collected 10-12 days after ~ l ;. l" In the latter case, 100 ml of viral suspension contained more than 108 infectious units. In the case of the "transient" virus, NIH 3T3 cells were infected with at least 107 l~r~
30 ICLluvil,.O~O by using 500 ml of media from virus-producing cells (five rounds of infection, 100 ml of media in each). These results r' the feasibility of ~ W095118857 2180426 converting a large and complex random fragment library into retroviral form and delivering it to a non-packaging cell line without loss of Cu~ .AiLy.
E:XAMPLE 3 Isolation of GSEs C~ r To The (~ utic Vru~ Etoposide The overall scheme for the selection of GSEs conferring etoposide resistance is illustrated in Figure 3. This selection was carried out directly on virus-producing packaging cells, in the ~ .. that cells whose resistant phenotype is caused by 10 the GSE expression will produce virus particles carrying such a GSE. The mixture of ~ JIluLIu~);., and ecotropic packaging cells was transfected with the cDNA library in the LNCX vector, prepared accordmg to Example 1, and the virus was allowed to spread through the population for 9 days. Analysis of a small part of the population for G418 resistance showed that practically 100% of the cells carried the neo-containing provirus. The cells were then exposed to 350ng/mL etoposide for 15 days and then allowed to grow without drug for two more weeks. No difference wasobserved between the numbers of colonies obtained in the experiment and in the control (uninfected cells or cells infected with the insert-free LNCX virus) after etoposide selection. The virus present in the media ~ of the surviving cells 20 was then used to infect NIH 3T3 cells followed by etoposide selection using essentially the same protocol. NIH 3T3 cells infected with the library-derived virus produced by packaging cells that were selected with etoposide showed a major increase in the number of etoposide-resistant cells relative to the control cells infected with the insert-free LNCX virus, indicating the presence of b;~lu~ dly 25 active GSEs in the preselected virus population (see Figure 4A).
The proviral inserts contained in the etoposide-selected NIH 3T3 cells were analyzed by PCR. This analysis (see Figure 4B) showed an i ' for specific fragments, relative to the unselected population of the infected cells. Individual PCR-amplified fragments were recloned into the LNCX vector in the same position 30 and orientation as in the original plasmid, as illustrated in Figure 4C. A total of 42 proviral inserts, enriched after etoposide selection, were thus recloned, and tested either in batches or illlivid~..lly for the ability to confer increased etoposide resistance after retroviral ~ . into NIH 3T3 cells. Three non-identical .. . .. . ... . . . . . . . . _ . . . . _ _ _ . . . _ wo 95118857 2 ~ 6 1 ".,~

clones were found to induce etoposide resistance, indicating that they containedbiologically active GSl~s. These GSEs were named anti-khcs, VPA and VP9-11.
Etoposide resistance induced by the clone named anti-khcs is illustrated in Figure 5A.
The ability of one of the anti-khcs GSE to mduce etoposide resistance was S further .J... ....~ ~ by using the isoprowl ,~-D-~ u~ , (IPTG)-inducible ,UlU..lU;I,I/~liV. system, as described by Baim e~ al. (1991, Proc. Natl.
Acad. Sci. USA 88: 5072-5076). The ~ of this sySoem include an enhancer-dependent promoter, combined in cis with multiple repeats of the bacterial lac operator, and a gene expressing LAP265, an artificial regulatory protein derived 10 from the lac repressor and a ~ activator. The anti-khcs GSE was cloned into the plasmid pX6.CLN, which contains the inducible promotor used by Baim et al., sup~a (a gift of Dr. T. Shenk) which expresses the inserts from an ( .,~ --.. l. -~ SV40 early gene promoter ~ l.lJl .. lrd with 21 repeats of the lac opeMtor sequence. The resulting plasmid, which contains no selectable markers, 15 was co-transfected into NIH 3T3 cells together with the LNCX plasmid carrying the neo gene. The mass population of G418-selected l"- ~.rr~l- .l~, along with control cells transfected with the insert-free vector, was exposed to increasing of etoposide, in the presence or in the absence of 5 mM IPTG. Even though the co-1 ".., ~. Ii.... protocol usually leads to the integration of the GSE in only a fraction of the G418-resislant cells, ~ f~ with anti-~hcs resulted in a clearly increased etoposide resistance, which was dependent on IPTG (see Figure 5B).

Sequence Analysis of GSEs Confer,ring R- ' To The ('~ 2~1ÇrapfUti'` ~ru~ EtoDoside The GSE anti-khcs, cloned as described in Example 3, was sequenced by the standard dideoxy sequencing procedure, and the deduced sequence is shown in Figure 6. The nucleotide sequence of the "sense" and "antisense" strands, as well as amino acid sequence of the predicted peptides encoded by each of these strands, were analyzed for homology to the nucleic acid and protein sequences present in the National Cenoer for Bi-.~ y T r - data base, using the BLAST network program for homology search. The sequence uo~ u~ldillt~ to the "antisense" strand -~095/18857 2 ~ 80426 r~.,u~

of the anti-khcs GSE, showed strong homology with several genes encoding the heavy chain of kinesins, a family of Illi.,lULL~UI~, motor proteins involved in jntr7n~ movement of organelles or ~ u~Gl~.,L~,s along the 1ll;l,.l ' ' of eukaryotic cells. The highest homology was found with the human kinesin heavy chain (KHC) gene, as described by Navone et al. (1992, J. Cell Biol. 117: 1263-1275). Anti-k)lcs tberefore encodes antisense RNA for a mouse khc gene, which wehave termed khcs for khc associated with sensitivity (to drugs) or s~n~-crl~nne. We refer to the kinesin molecule, formed by the associate of the KHCS protein with kinesin light chains, as kinesin-S, to distinguish it from the other kinesins present in û ~i7n cells. These results .~ tbat . I- .. lh. ~ drug selection for GSEs can lead to the discovery of novel genetic elements, and can also reveal roles of genes in drug sensitivity that had never before been suspected.

Cloning And Analysis Of The Gene From ~hi~b Anti-~.L G~E Gene Was DeriYed The anti-khcs GSE isolated in Example 3 was used as a probe to screen 400,000 clones from each of two cDNA libraries in the lambda gtlû vector. These libraries were prepared by cu..v~ iu,~l procedures from the RNA of mouse BALB/c 20 3T3 cells, either Ull:~.y ' UlliLe;l or at Go ~ Gl transition, as described by Lau and Nathans (1985, E~IBO J. _: 3145-3151 and 1987, Proc. Natl. Acad. Sci. USA 84:
1182-1186, a gift of Dr. L. Lau). Screening of the first library yielded no h,yblidiLill~ clones, but two different clones from the second library were found to contain anti-khcs sequences. These clones were purified and sequenced. Sequence 25 analysis showed that we have isolated the bulk of the mouse khcs cDNA, UUII~ JUllL;II~ to 796 codons (the full-length human KHC cDNA encodes 963 amino acids). This sequence is shown in Figure 7; an additional 252 ..~ encoding 84 amino acids from the amino terminus have been determined from 5'-specific cDNA isolated using the "anchored PCR" technique, as described by Ohara et al.
(1989, Proc. Natl. Acad. Sci. USA 86: 5763-5677.) Additional missing 3' terminalsequences are currently being isolated using this technique.
.

wo 95/18857 i~ ~ 8 ~ ~ 2 6 i ~
The dot-matrix alignment of the sequenced portion of the khcs protein with previously cloned KHC proteins from the human (see Navone e~ al., 1992, J. Cell.Biol. 117: 1263-1275), mouse (see Kato, 1991, J. Neurosci. _: 704-711), and Drosophila (McDonald & Goldstein, 1990, Cell 61: 991-1000) is shown in Figures 5 8A through 8C; homology to GSE-C is shown as a control (Figure 8D). The portion CUllG;~UUlldill~; to the anti-khcs GSE, is shown in brackets. The khcs gene is most highly I ' ~u~ to the human gene (97 % amino acid identity), suggesting that thehuman KHC (KHCS) gene is functionally equivalent to the mouse khcs. The aligmment also shows that the anti-khcs GSE c.~ to the region which is the 10 most highly diverged between different kinesins (shown in the Figure by brackets around these sequences.) G _ ' of a Ramdom Fragment I~CS cDNA Retroviral Library An~ jn~ of)~cs-derived (~.~F.c As described in Example 5 above, the murine khcs gene is highly hnm~ glu~c to the human KFIC (or K~CS) gene described by Navone et a~. (1992, J. Cell Biol.117: 1263-1275). The functional ~4u;v..1.,.~.,c of these genes was also suggested by the Ub~ iUII that the levels of l~HCS mRNA are decreased in human cells selected20 for etoposide resistance (see Example 8). To determine; ~~ ~' ~ hat the humanK~CS gene represents the functional equivalent of the mouse khcs, it was determined whether any random fragment of human ~HCS cDNA could function as an etoposide-resistance GSE.
A library of random DNA~ " ' fragments of a full-length human 25 KHCS cDNA (2.9 kb in length; provided by Dr. R.Vale, University of Californiaat SaQ Francisco) was generated essentially as described above for 1. .~ . n cDNA (see Example 1 in co-pending U.S. Patent Application Serial No. 081033,086,iUl,Ul~J~ ' ' by reference), usmg the protocol illustrated in Figure 9A, with the following ..,.~ Specifically, two synthetic adaptors, instead of one, were 30 used for ligation with DNAase l-generated cDNA fragments. Orle adaptor, containing three ATG codons, carried a ~indlll cloning site (Figure 9B). The other adaptor had translation stop codons m all three reading frames and carried a Clal ~ Wo95/1885~ 21g0426 Y~ 5s eloning site (Figure 9B). After ligation with the equimolar mixture of both adaptors, cDNA fragments were amplified by PCR using sense and aMiserlse strands of the first and seeond adaptor, ~ Li~ . PCR produets were digested with Clal and Hind~l and cloned into the ~ullc~ sites of the pLNCX plasmid. This 5 ..,.~.liri. ~ of the cloning strategy resulted in avoiding the formation of inverted repeats at tbe ends of the cDNA inserts after clorling into the retroviral vector.
A plasmid library of 20,000 r ~ ' insert-carrying clones was obtained and transfected into ecotropic paclcaging cells using the calcium phosphate technique. Virus released by transiently trarlsfected cells was used to infect HT10801pJET-2TGH eells, clone 2, a derivative of human HT1080 rlblv~all,ullld cell line transfected with a plasmid expressmg the murine ecotropic receptor (Albritton et al., 1989, Cell 57: 659-666) and susceptible to infection with ecotropic Ir~luvilUo~ (provided by Dr. G.R. Stark, Cleveland Clinic ruu~laiiull).
After infection and G418 selection, these cells (further referred to as HT1080/ER) were plated at 105 cells per 100 mm plate and cultivated for 12 days in different c( . ~ of etoposide (200-500 ng/mL). After removal of the drug, cells were allowed to grow in media without drug for 7 more days. At this point, some of the plates were fixed and stained with crystal violet, to determine the number of surviving colonies (Figure 10). As illustrated in Figure 10, at drug ~
20 of 250 rlglmL etoposide, there were only several colonies in control plates, compared with about a hundred times more colonies in the plates containing GSE-containingcells.
In a parallel PYr~rim~nt virus-producing mixtures of packaging cells were subjected to similar etoposide selection. At all drug ~ tested, there were 25 mamy more colorlies surviving etoposide treatment in the GSE-carrying cells than in the control cell population.
These results indicated that the retroviral library of random fragments of K~CS cDNA contained numerous GSEs mducing drug resistance in human cells, confrrming that human KHCS is associated with drug resistance. Some of these 30 GSEs are likely to be more potent as selectable markers of drug resistance that the original single GSE from the murine khcs gene. The virus isolated from such etoposide-resistant cells represents a collection of a Illul~ y of kinesin-derive~, wo 95/188~7 ~ l ~ q ~ ;~ 6 1 ~I/U~ .b ~

dwg resistance-conferring GSEs, which multiplicity is itself an aspect of the present invention and is useful in conferring resistance to DNA damaging agents, including drugs, as disclosed herein (~ of l'~ C, Multiple Copies of anti-khcs~;SE:s A 1:1 mixture of ecotropic and . ' v~,ic packaging cells was transfected with retroviral vector pLNCX carrying the anti-~hcs GSE using a standard calciumphosphate procedure. Two weeics later, the virus titer, as measured by the formation of G418-resistant NIH 3T3 colonies, reached > 106 infectious units per mL as a result of "ping-pong" infection (see Bodine et al., 1990, Proc. Natl. Acad. Sci. USA
87: 3738-3742). Thus virus-containing ~ was used to infect NIH 3T3 cells, lO times with 12 hour intervals. Control cells were infected in parallel with the insert-free vector virus obtained by the same procedure. G418 selection showed that 100% of NIH 3T3 cells became infected with the virus. DNA from the infected cells was analyzed by Southern blot llyl,li iiLaliO.. with a virus-specific probe. This analysis showed that the infected ceils contained multiple copies of the integrated proviws.
Freshiy-obtained multiply-infected NIH 3T3 cells were . l -- rl .. . ;,. ;I by a20 decreased growth rate and plating efficiency. After several passages, however, their growth parameters became ;ll~ from the control cells, suggesting the ," of slowly growing cells from the population. At this stage, the cells were frozen and used for the ,A~ described below.

Drug Resistance Pattern of NIH 3T3 Cells Carrying Multiple Cop~es of Anti-khcs ('..CF.~
The infected cell pu~ula~ described in Example 7 were analyzed for resistance to several anticancer drugs by a growth inhibition assay. For this assay,0 10~ cells per well were plated in 12-well plates and exposed to increasing of different dwgs for 4 days. Relative cell numbers were measured by the metilylene blue staining assay (Perry et al., 1992, Mutation Res. 276: 189-197). Despite the relative i.~ .ivily of this assay when carried out with unselected ~ WO 9S118857 2 t 8 0 4 2 ~ P~l/. s ~ .~

h~,L~ Jg~ ,uu~ cell P"l~ , infection with the Yirus carrying an anti-khcs GSE
induced a ~-u~lvull~.~J increase in the }esistance to the cytostatic effects of etoposide and amsacrine and, to a lesser extent, of Adriamycin, - ,~ l and cisplatin (Figure 11). All of these drugs are known to induce DNA damage, a]beit by 5 different, -- h ~-~ Under the same assay conditions, no increase in resistance was observed with colchicine or .~c~ dll D (Figure 11).
To further, l --,.. ;.. the nature of drug resistance conferred by anti-khcs, the above-described short-terrn growth inhibition assays were followed by long-term growth inhibition assays which measured both the cytostatic and the cytotoxic effects 10 of different drugs. These assays were carried out by incubating the cells for four days in the presence of the drugs, followed by either two or six days in the absence of the drug, to allow for 1,l U~;l allull~ cell death, which is frequently associated with recovery from ~ rP~ inhibition (Kung ef al., 1990, Cancer Res. 50: 7307-7317). These assays showed that the GSE-carrying cells were resistant to etoposide 15 and adriamycin, but not to cisplatin, - ~ h .: or ~IcLill~ D. ~ulL~.llllOlc, the GSE-carrying cells were found to be IIylJ~L~ iLiV~ to colchicine and vinblastine, said II~ iLi~iLy being illl,lC~ ;ly more evident with increasing length of the assay.
Thus, in the experiment shown in Figure 12, NIH 3T3 cells carrying the anti-20 khcs GSE and control cells without the GSE were plated at a density of 2 x 104 perculture dish and grown for five days in ~o~ ti~ of either colchicine or vinblastine. The cells were then fixed and stained, and the number of surviving cells ~PtPrminPd and shown as a percentage of cell growth in the absence of drug. These results clearly show that expression of the anti-khcs GSE in these cells was 25 a ~....l. .~ by llY~J.,I viLy to both colchicine and vinblastine.
To further investigate the di~ .ll~ between the results obtained in the short-terrn and long-tertn drug assays, analyses of the dynamics of cell growth during and after treatment with 250 ng/mL etoposide, 20 ng/mL ~ and 40 - ng/mL colchicine were perfortned. In these ~ (shown in Figure 13), NIH
30 3T3 cells were treated with the _- , ' ,, drugs for 5 days, and then incubated for additional 6 days either in the presence or in the absence of the drug. The selected drug ~ 1 ;l l resulted in growth inhibition but little detectable cell WO 95/18857 2 ~ ~ Q ~ ~ 6 ~ s ~

death in continuous presence of the drug. After 11 days of drug exposure the total cellnumberintheetoposide-or~ ulh ~;.,-treatedpu~ of controlcellswas a little lower th~an after 5 days of drug exposure, but in the ul.lli-u.e-treated control cell population a slow cell growth was still detectable. In the c..~ in~ where the 5 drug was removed after 5 days, cell growth was initially activated for all three drugs. After about two days of growth in the absence of the drug, the number of cells treated with etoposide or ~- .y~ l...; decreased, however, due to extensive celi death, so that the final cell number in cell FoFIllqti~nc incubated in the absence of the drugs was Fractically the same as im the cells i.l..,l; ~. ~ly maintained in the 10 presence of colchicine or . - In contrast, cells pre-treated with colchicine undergo oniy limited cell death after removal from the drug, resulting in a relatively minor siowdown in cell growth two days after removal from the drug, and a major increase in the total cell number in the poplllqri--nc removed from the drug relative to those that were constantly mamtained in colchicine (Figure 13).
The expression of the anti-khcs GSE had different effects on the growth inhibition and recovery-associated cell death induced by these drugs. In cells treated with etoposide, anti-khcs decreased the growth-inhibitory effect of the drug to the same, relatively small extent after 5 or 11 days of continuous exposure. In addition, the anti-khcs GSE decreased the amount of cell death in the pU~Ul.lLiul.s released 20 from etoposide inhibition. As a result, the increase in etoposide resistance conferred by this GSE was much more ~lu~lvu~ed after release from the drug than under the conditions of continuous exposure (Figure 13). In cells treated with ~
the GSE resulted in a small decrease of the growth-inhibitory effect of the drug, which was more IJlu~vu~ ;d after 5 days of exposure but was reduced to negligible 25 levels after 11 days of continuous exposure. The decrease in growth inhibition after 5 days of exposure was ~ d by a slight increase in cell death after the removal from the drug, so that the GSE produced no significant long-term difference in ~ - l-t--ll, i,. resistance. In the pu~ c treated with colchicine, the anti-khcs GSE made cells more susceptible to the growth-inhibitory effect of the drug; this 30 effect was mcreased with prolonged exposure and was equally apparent in the released from the drug after 5 days or ~ ;....u~ y maintained im colchicine (Figure 13).

WO 95118857 27 - r~ .2 The results of the above ~ indicated that the anti-khcs GSE acts by irlhibiting the cytostatic effects of different DNA-damagmg drugs. In addition, this GSE appears to decrease the extent of ,u~u,5~ .l.,d cell death occurring after the release from the drug in cells treated with some (etoposide) but not other 5 (~ . ' ) DNA-damaging agents.
The findmg that cells carrying the anti-khcs GSE become lly~ , to the cytostatic effects of colchicine has potentially significant therapeutic; ~ in The observed l~y~ ;Liv;Ly to colchicine, an anti-ll.;,,., ' ' agent, in cells with GSE-mediated inhibition of kinesin is likely to be ".~ . I,- ~ -li. Ally related to the 10 essential functions of kinesin, which moves various structures along the microtubules and may be involved m the sliding of l.~ uLubulci, relative to each other, as well as the assembly and dia~aacllll/ly of IllicluLub~l~,s. The ,ulu~luul~ed effect of the anti-khcs GSE on the sensitivity of cells to anti-llli.,~, ' ' agents also indicates that this GSE affects the general kinesin function in the cells, and is not lirnited to a particular 15 drug-response-specific isoform of kinesin. Since we have d- ' that down-regulation of the KHCS gene represents a natural m~rh~ icm of drug resistance inhuman tumor cells (see Example 11), the ~ 1 v;Ly to colchicine provides an approach to U.~ .UIIIUI~; tnis type of resistance in human cancer.

Accrccment of (~ r Eff~ortc Of Anti-kinesin ~ c The virus carrying the anti-khcs GSE was tested for the ability to increase the life span of primary mouse embryo fibroblasts (MEF). MEF werc prepared form 10 day old mouse embryos by a standard Llyua;ll;L~Iiiull procedure and senescent cells were frozen at different passages prior to crisis. Senescent MEF, two weeks before crisis, were infected with 1~ ' Idluviluaca carrying LNCX vector either without an insert or with anti-khcs. Figure 14 shows MEF cell colonies two weeksafter crisis. Relative to uninfected MEF cells, or cells infected with a control LNCX
virus, cells infected with the anti-khcs showed a great increase in the proportion of 3û cells surviving tne crisis. Post-crisis cells infected with the anti-khcs virus showed no uu~lu~,u,uic_lly visible features of neoplastic j r ~ These results indicate that anti-khcs promotes the ;- ". ,- IAI;~^I ;n~\ of normal senescent fibroblasts.

wo 95/18857 2 1 ~ O ~ 2 6 P

These results suggest that the normal function of kinesim-S may be associated with the induction of ~., O ' cell death occurrmg after exposure to certain cytotoxicdrugs or in the course of cellular c~n~ccPn~. These results also indicate that isolation of GSEs that confe} resistance to h~ i. drugs can provide 5 insight into the cellular genes amd processes involved in cell growth regulation.

FfP-~tC of Mouse Ar~ti-khcs GSE Qn Tl ~ Serleseent Fil,. ~
The ability of the anti-khcs GSE described in Example 4 to promote 10 lal~,~ . of primary mouse embryo fibroblasts (,' ' in Example 9) suggested that kinesin-S may act as a tumor suppressor by preventing immortalization of normal mouse fibroblasts. To deterrnine if this gene may play the same role in human cells, the ability of the anti-khcs GSE to affect the life span of primary human fibroblasts was i~
Primary human fibroblasts, derived from human skin, were obtained from the Aging Cell Repository of the National Institutes of Agirlg. The cells were grown in DMEM with 20% fetal calf serum ~ LI -' I with twice the of amino acids and vitamins normally used to ,, ' normal human skin fibroblast growth in culture. Cells at the fifth passage were infected with either the control pLNCX virus or the virus carrying mouse anti-khcs GSE (produced as described above in Example 3). Four passages later, the control cells went into crisis, but GSE-carrying cells continued to grow (Figure 15) and have so far survived at least five additional passages. These results d ' that the anti-khcs GSE of this invention is also capable of prolonging life span of primary human fibroblasts, indicating that KHCS is a potential tumor suppressor in human cells.

A ' Of The Role Of Decreased khcs Gene ~YI ' In ~turallv Oeeurr ~ Meehanism5 Qf Druo RPC;Ct~
To test whether decreased khcs gene expression is associated with arly naturally occurrmg ' of drug resistance, an assay waS developed for measuring khcs mRNA levels by cDNA-PCR. This assay is a ~ ;., of the .

~ wo 9sll88s7 ;2 ~ 8 0 4 2 6 P~

4U~ILiL~li.., assay described by Noonan etal. (19~0, Proc. Natl. Acad. Sci. USA 87:
7160-7164) for ~ g mdr-1 gene expression. The ~-l;g. ~ u~ primers had the sequences:
AGTGGCTGGAAAACGAGCTA (SEQ.lD.No.:5) and 5 CTTGATCCCTTCTGGTTGAT (SEQ.ID.No. :6) .
Tbese primers were used to amplify a 327 bp segment of mouse khcs cDNA, C~ r~ ; to the anti-k~2cs GSE. Tilese prrmers efficiently amplified the mouse cDNA template but not the genomic DNA, indicating that tiley spamned at least one intron in the genomic DNA. Using these primers, we dl tRrlnir~ d that khcs mRNA
10 is expressed at a higher ievel in the mouse muscle tissue tilan in the kidney, liver or Spleen.
In another experiment a pair of primers amplifying a hnnm~ g~ c segment of the human KHCS cDNA was selected, based on the reported human KHC sequence published by Navone et al. (1992, J. Cell. Biol. 117: 1263-1275). The sequences 15 of these primers are:
AGTGGCTTGAAAATGAGCTC (SEQ . ID . No .: 7) and CTTGATCCCTTCTGGTAGATG (SEQ.ID.No.:8), and they amplify a 327 bp cDNA fragment. These prrmers were used to test for changes in the KHCS gene expression in several i~ IJ~ ly isolated ~ ..I I;.,..c 20 of human HeLa cells, each selected for ~ i... u :-ly acquired etoposide resistance;
,Bz-~ lu~l~ulill cDNA sequences were amplified as an internal control Figure 16 shows the results of the cDNA-PCR assay on the following ~..,1,..1-l;..,,~ CX(0), HeLa population infected with the LNCX vector virus and selected with G418; CX
(200), the same cells selected for resistance to 200 nglmi etoposide; ~ll(O), 6(0) 25 and ~21(0), po~ ri~n~ obtained after infection of HeLa cells with ICC, ~C~lUVilh.,C;, carrying different GSEs derived from L~)ui~vlll~ CY cDNA, as described in Example 1 of co-pending U.S. Patent Application Serial No.
08/033,086, il~Cull~ulaL~ i by reference, and selected with G418:~11 (1000), 6(1000) and ~21(1000), the same ~u~ c selected for resistance to 1 ~Lglml etoposide0 As shown in Figure 16, the yield of the PCR product specific for the khcs gene wasly lower in each of the ~tu~ o,; h,-s~ ,t,,~i ~u~ iul~ than in the control .

wo 95118857 2 ~ 6 P~ . .2 - 30 - .
cells. This result indicates that a decrease in the khcs gene expression is a common natural mechanism for drug resistance.

S IY~nosi~ic Assav Tbe results presented in the above Examples suggest the utility of diagnostic assays for .1 ~ .".; -~.~ the expression levels of kmesin genes in turnor cells of a cancer patient, relative to a :~Ldllddll~ .d set of cell lines in ~itro having well-1, ,- 1. . ;~. J levels of kinesin heavy chain gene expression correlated with their level of resistance to certain . I- - ---lh al~ ~1. drugs such as etoposide. One such aLdlll.ldllliL.,I set of cell lines comprise the HeLa cell lines described im Example 11.
Alternatively, different, tissue-specific aLd.l.L.Idi~l sets of cell lines are developed by drug selection for each cell type to be evaluated, for example, using human K562 cells for evaluating patients having chronic ~ lv~ vu~ leukemia, or human HL60 cells for patientâ having acute ~lulllr.,lu~liu leukemia.
The assay for kinesin would assess the a~ U~I of treatment of human cancer patients with certain anticancer therapeutic regimens. Patients whose tumor cells under-express kinesin may be refractory to treatment with DNA damaging agents, including radiation and the .1 ,.. . ,, .1 1 ... ,.1.. ~ ;. . drugs etoposide, . - . .1.l. ,~1 ... : . .
20 cisplatin and adriamycin. Such patient, however, may be ~dl~i~,UIdlly responsive to treatment with anti-,.,i.,luLubulàl agents such as colchicine, colcemide, vinblastine, vincristine or vindesine. On the other hand, patients whose tumor cells over-express kinesin, for example, may be responsive to treatment with DNA damaging agents and refMctory to treatment with anti-,lli.,.u~ul,uldl agents. These assays provide, for 25 the first time, a basis for making such therapeutic judgments before the fact, rather than after a therapeutic regimen has been tried and failed. The assay also provide a basis for ~ which patients, previously refractory to treatment with DNA
damagmg agents, ~dlLi.ula.l~ certain anticancer dtugs, would benefit from further .I,...,"Ih..,.l,~ using anti-~ .l. b~' agents, by ,' ~ ' ~ kinesin gene-30 mediated drug resistance from other ' of drug resistance expected to resultin cross-resistance to both DNA damaging agents ~nd anti-llli.,lui ' ' drugs.

~ W095/18857 2180426 ~ rr .2 It should be understood that the foregoing disclosure ~ certain specific C~ ' of the rnventiorl and that all . -.liri, ~..,.. or ~
equivalent thereto are within the spirit and scope of the inYention as set forth in the appended clarms.

WO 95/18857 2 1 8 ~ 4 2 6 . ~ ~ C ~
SEQUENCE LISTING
( l ) GENERAL INFORMATION:
( i ) APPLI CANT:
(A) NAME: Board of Trustees of the University of Illinois (B) STRE3ET: 352 ~enry AdminiAtration Building 506 gouth Wright Street C CITY Urbana D STATE: Illinois E ~ COUNTRY USA
F POSTAL CODE (ZIP): 61801 G TELEPHONE:
I H TELEFAX:
(ii) TITLE OF INVENTION: AAon. lAr~nn of Kinesin with Sensitivity To c~ h~r~r~-1'ric Drugs (iii) NUMBER OF SEQUENCES: 8 (iv) COMPUTER READABLE FORM:
A) MEDIUM TYPE: Floppy disk B) COI~PUTER: IBM PC, i hl ~' ~C) OPERATING SYSTEM: PC-DOS/MS-DOS
D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO) (v) CURRENT APPLICATION DATA:
APPLICATION N[~MBER:
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE t~T7D0arTFoTcTIcs:
A. LENGTH: 20 base pairs B TYPE: nucleic acid C STD ~: single D. TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
~iii) HYPOTHETICAL: NO
(iv) DNTI-SENSE: NO
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
A,DTCATC~3AT GGATGGATGG 20 (2) lN~'~ lUN FOR SEQ ID NO:2:
(i) SEQ-JENCE rT~aD~TFT.CTICS:
~, LENGTH: 23 base pair B TYPE: nucleic acid C sTRD~r~EnN~qc single D TOPOLOGY: l inear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

~ WO 95/18857 2 1 8 ~ ~ 2 6 r~ 2 ( 2 ) INFORMATION FOR SEQ ID NO: 3:
(i) SEQ-JENCE rT~A~rTl~TqTICS
A LENGT~: 327 base pairs B TYPE nucleic acid C STi~A~ n~qq single D, TOPOLOGY: li ear ~ii) MOLECULE TYPE cDNA
Y ~U l d~ ~L: NO
~iv) A~TI-SENSE YES
~Xi) SEQUENCE DESCRIPTION SEQ ID NO 3 CTTGATCCCT TCTGGTTGAT GrrAr~ccT CTTCCTGATC CAGCATTTGT ATCTTCAATT 60 TCTCTACCAA lLV~I ll~l TGGTTAATCT CTTCATCCTT aTCATCAAGT TGTTTATACA 120 ATTTAGCAAG ~llCll--l~ CACTTTCTTC TTTCAGCATC qr,T~?ArT~ CCAGCCATTC 180 CGACTGCAGC AGCTGGTTTA TC~CTGGTAA TAGCAATATC l ~ U~l GTGAAGGCTT 2~0 CCAAATTAGC lll--l~LLl~l TCAAACTGCT CATCAATAGG CACTGTCTCC CCGTTACGCC 300 AACGGTTTAG ~ 1 ~ L -- AGCCACT 3 2 7 ~2) INFORMATION FOR SEQ ID NO 4:
~i) SEQUENCE rT~ \rT~qTIcs A LENGT}}: 2389 base pairB
E TYPE: nucleic acid C STRANDEDNESS: single ~DI TOPOLOGY: linear ~ii) MOLECULE TYPE: cDNA
~iii) ~Y~Ul~~ L: NO
~xi ) SEQUENCE uEa~ l luN 8EQ ID NO: 4:
rnl~rD~rAT CATCTGGGAA n,~rrrArArr. ATGGAGGGTA AACTTCATGA TCCAGAAGGC 60 AATTTGGAAT TTCATATTAA GGTTTCATAT TTTGAAATAT ATTTGGATAA C.AT~Arrr,~r 180 TTGTTAGATG TTTCAAAGAC TAACCTTTCA GTCCATGAAG ~r7~n~rrr. TGTTCCCTAT 240 nT7~ rrerT r~rAr~r~rq lLl~ l AGTCCAGATG AAGTCATGGA T~r~z~TDr.AT 300 Cl`'`CCr~7`T rrD~r~r.~r.~ TGTCGCAGTT ACA~ATATGA ATGAACATAG CTCTAGGAGC 360 ~ rAnr~TDT TTCTTATTAA TGTAAAACAA r~ 7~T~r~r ~ rrr7~rA GAAACTCAqT 420 GGA~AGCTTT A~ ~ TTTAGCTGGC AGTGAGAAGG TTAGTAAqAC TGGGGCTGAA 4 8 0 TGGATGAAGC TAAGAACATC AAGAAGTCAC ~TTCTGCACT TGGAAATGTC 540 WO 95118857 2 t ~ ~ 4 2 6 . ~ 2 AI..~ .l TGGCAGAGGG rPr~TprrTr~T GTTCCTTATC rPrPTPrTPP r~Tr~rrpnr 600 ATTCTTCAAG ATTCATTAGG TGGCAACTGT rrr~rrrrTr~ TTGTCATATG ~.~,~.~-~c~ 660 TCATCATACA ATGAGTCTGA GACAAAGTCA ACACTCCTCT TTGGTCAAAG rG~rrr7~ ra 720 ATTAAGAACA CAGTCTGTGT rr~TrTr~r TTAACTGCAG PrrPrTr~ Ar~AGA~GTAT 780 r~ r7~ r rr~ A.. r TAAGACTCTA rrr~rrrrTr~ TTCAGTGGCT rr~r~ rr~ 840 CTA~ACCGTT GGCGTAACGG GGAGACAGTG CCTATTGATG AGCAGTTTGA rPr~r~ r~ goo GCTAATTTGG AAGCCTTCAC PrrrrrTP7~r GATACTGCTA TTACCAGTGA Tr~ rrpr~rT 960 GCTGCAGTCG GAATGGCTGG TAGTTTTACC GATGCTGAAA GAAGA~AGTG TGAAGAAGAA 1020 CTTGCTAAAT TGTATAAACA GCTTGATGAC AAGGATGAAG AGATTAACCA Prr~ ~rrpr 1080 AGGGATCAAG ATAATATGCA AGCTGAACTG AATCGCCTCC r7\rrPr~rr7~ TGATGCTTCT 1200 p~r.rr-.r TCA~AGAAGT TTTACAGGCC TTAGAGGAAC TGGCTGTTAA TTATGATCAG 1260 AaGTCTCAGG AAGTTGAAGA rr~rr~r~r GAATATGAAT TGCTTAGTGA TGAATTGAAT 1320 CAaAAATCTG CAACTTTAGC AaGTATTGAT GCTGAGCTTC r--~rrTr~'~ GGAAATGACC 1380 p7~rrDrrrra pr.7~rrr~r AGCTGAAATG ATGGCATCAT TATTA~a~AGA CCTTGCAGAA 1440 ATAGGAATTG cTaTGGGGAA TAAcGATaTG r~PQrPrrrDr~ AAGGAACTGG TATaATAGAT 1500 GAAGAGTTTA CTGTTGCAAG ACTCTACATT Pr~rPr7'rTrr AATCAGAAGT AaAGACCATG 1560 GTaAAACGCT r,rr7~rrar.rT r"'~rrPrG CAGACTGAGA Grr-~rp7~rr AATGGAAaAA 1620 AATGAGA~AG AGTTAGCAGC ATGCCAGCTT CGGATCTCCC AacATGAAGc cAaaATcAAG 1680 TCACTGACTG AGTACCTTCA GAATGTAGAA rr~ r~ QrrPQrTrrP GGAATCTGTT 1740 aATTcccTTG GTGAGGAGCT AGTCCAACTC rr~rrrrr 7. r, AGAAAGTCCA TGA~ATGGAA 1800 AAAQAQr~rT TaAAcAAGGT TCAGACTGCA AATGAAGTCA AGCAAGCTGT TGAGCAGCAG 1860 ATCCAGAGTC prrr.r~nrr rrPrrrr~4 CAaATCAGTA GCTTGCGAGA TGAaGTTGAG 1920 Grr7\.~\rr~ AGCTAATCAC TGACCTCCAA nr~rrr~r-rr AGAAGATGGT GTTGGAGCAG 1980 r~7~rr7r7rTr7\ GQr-Trr~ rr- TGAGAGGCTG PrrrrTrrDr. Prrr~^~r~r r.ar.rD~ 2040 CTGCATGAGC TCACGGTTAT r,rr''''''PQa rr~ rrP~r rr~ r~r~ CTTGAAGGGT 2100 TTGGAGGAGA CCGTGGCAAA AaAAcTTcAG ACTTTACACA ACCTGCGTAA ~ .- 2160 CAaGACTTGG rTarraQr~r~T C ~ r7~ CCGAGGTCGA CTCTGACGAC arTr.QrQr,rl~ 2220 GTGCTGCACA C~'~rraraaP A-~ TTGAAAACAA CCTTGAaCAG CTCACCAAAG 2280 TGCACAAGCA GTTGGTACGT GATAATGCAG ATCTTCaCTG TGAGCTTCCT AAGTTAGAGA 2340 AACGGCTTAG AacTAcTGcA GAaAGAGTGA AAGCTTTGGA GTCAGCCCG 2389 t2~ INFOD~lATION FOR SEQ ID NO:S:

(i) SEQIJENCE rTI7lDa~
(A) LENGT~: 22 }~ase pairD
(B) TYPE: nucleic acid W0 95118857 2 1 ~ ~ ~ 2 ~ T, ~ 5 '~ ~: 32 .

(C) STR~RnNRqc: slngle (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) ~Y~U1r~1l~AL: NO
(iv) ANTI-SENSE: NO
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

( 2 ) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE rTJ7`v~rTRRTcTIcs:
A) LENGTH: 25 ba~e pair~
B) TYPE: nucleic acid C) sTR7~RnNRqq: single D) TOPOLOGY: linear (ii) MOLEC~LE TYPE: cDNA
(iii) SlY~U1rl~1l~L: NO
( iv ) ANT I - SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CATCCATCCA TA~GCTTGGG AGA~A 25 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQ-JENCE rlT~RprTRRTqTIcs A LENGTH: 24 base pair3 B TYPE: nucleic acid C STR~TnRnNRcq single D TOPOLOGY: linear (ii) MOLECULE TYPE: rDNA
(iii) nr~u,~l~-lcAL: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQ-JENCE rTTDRDrTRRTqTIcs:
A LENGTH: 21 baGe pairs B TYPE: nucleic acid C sTRaNnRnNRqq: ~ingle ~ D TOPOLOGY: lillear (ii) MOLECULE TYPE: cDNA
(iii) !IY~U1~1~11~L: NO

WO95/18857 2 1 8 0 4 26 ~ J c~

(iv~ A-NTI-8ENSE: YES
~xi) SEQUENCE IJ~ lUN: 8EQ ID NO:8:

Claims (23)

WE CLAIM:

1. A method of identifying genetic suppressor elements derived from a kinesin gene that confer upon a cell resistance to one or more DNA damaging agents, the rnethod comprising the steps of:
(a) generating a set of random fragments of cDNA encoding the kinesin gene;
(b) transferring the DNA fragments to an expression vector to yield a library, wherein the expression vector is capable of expressing the DNA fragments in a living cell;
(c) genetically modifying living cells by introducing the random fragment library of step (b) into the living cells;
(d) isolating or enriching for genetically modified living cells containing kinesin-derived genetic suppressor elements by selecting cells in the presence of a DNA damaging agent; and (e) obtaining the genetic suppressor element from the genetically modified cells.

2. A genetic suppressor element identified by the method of claim 1.

3. A genetic suppressor element according to claim 2 having a nucleotide sequence that is homologous to a portion of the human or mouse khcs gene.

4. A mammalian cell that expresses a GSE according to claim 2.

5. A mammalian cell that expresses a GSE according to claim 3.

6. The method of Claim 1, wherein the genetic suppressor element is sense-oriented.

7. The method of Claim 1, wherein the genetic suppressor element is antisense-oriented .

8. A synthetic peptide having an amino acid sequence corresponding to from about 6 amino acids to all of the amino acid sequence encoded by the GSE
produced according to the method of Claim 6.

9. A synthetic oligonucleotide having a nucleotide sequence from about 12 nucleotides to all of the nucleotide sequence of the antisense RNA encoded by the GSE produced by Claim 7.

10. A diagnostic assay comprising the steps of (a) isolating cellular RNA comprising messenger RNA from a tumor or malignant cells from an animal;
(b) measuring a level of expression of kinesin mRNA in the tumor or malignant cells in the animal;
(c) determining whether the level of expression of kinesin mRNA in the tumor or malignant cells indicates that the kinesin gene is over-expressed or under-expressed in the tumor or malignant cells in the animal.

11. A diagnostic assay comprising the steps of (a) isolating cellular protein from a tumor or malignant cells from an animal;
(b) measuring an amount of a kinesin protein in the tumor or malignant cells in the animal;
(c) determining whether the amount of the kinesin protein in the tumor or malignant cells indicates that the kinesin gene is over-expressed or under-expressed in the tumor or malignant cells in the animal.

12. A method of treating an animal having a malignant tumor or malignant cells in the animal's body, the method comprising administering an anticancer drug that is a DNA damaging agent to the animal if the tumor or malignant cells over-express a kinesin gene as determined using the assay of Claims 10 or 11.

13. A method of treating an animal having a malignant tumor or malignant cells in the animal's body, the method comprising administering an anticancer drug that is an anti-microtubule agent to the animal if the tumor or malignant cells under-express a kinesin gene as determined using the assay of Claims 10 or 11.

14. A method of treating an animal having a malignant tumor or malignant cells in the animal's body, the method comprising administering an anticancer drug that is an anti-microtubule agent to tile animal if the tumor or malignant cells under-express a kinesin gene as determined using the assay of Claims 10 or 11 and the animal was previously unsuccessfully treated with an anticancer drug that is a DNA
damaging agent.

15. A method of identifying a multiplicity of genetic suppressor elements derived from a kinesin gene that confer upon a cell resistance to one or more DNA
damaging agents the method comprising the steps of (a) generating a set of random fragments of cDNA encoding the kinesin gene;
(b) transferring the DNA fragments to a retroviral expression vector to yield a retroviral random fragment expression library wherein the retroviral expression vector is capable of expressing the DNA
fragments in a living cell;
(c) genetically modifying a culture of living cells by introducing the retroviral random fragment expression library of step (b) into the living cells of the culture, wherein the living cells of the culture are capable of propagating each of the retroviral expression vectors comprising the library;
(d) isolating or enriching for genetically modified living cells containing kinesin-derived genetic suppressor elements by selecting cells in the presence of a DNA damaging agent; and (e) allowing the drug-resistant, genetically modified living cells of step (d) to propagate the kinesin-derived genetic suppressor elements of the retroviral random fragment expression library to form an amplified random fragment expression library comprising a multiplicity of kinesin-derived genetic suppressor elements.

16. A genetic suppressor element first identified by the method of claim 15.

17. A genetic suppressor element according to Claim 16 having a nucleotide sequence that is homologous to a portion of the human or mouse khcs gene.

18. A mammalian cell that expresses a GSE according to claim 16.

19. A mammalian cell that expresses a GSE according to claim 17.

20. The method of Claim 15, wherein the genetic suppressor element is sense-oriented.

21. The method of Claim 15, wherein the genetic suppressor element is antisense-oriented.

22. A synthetic peptide having an amino acid sequence corresponding to from about 6 amino acids to all of the amino acid sequence encoded by the GSE
produced according to the method of Claim 21.

23. A synthetic oligonucleotide having a nucleotide sequence from about 12 nucleotides to all of the nucleotide sequence of the antisense RNA encoded by the GSE produced by Claim 22.