EP0686040A1 - Composition de cicatrisation de plaies - Google Patents

Composition de cicatrisation de plaies

Info

Publication number
EP0686040A1
EP0686040A1 EP94907292A EP94907292A EP0686040A1 EP 0686040 A1 EP0686040 A1 EP 0686040A1 EP 94907292 A EP94907292 A EP 94907292A EP 94907292 A EP94907292 A EP 94907292A EP 0686040 A1 EP0686040 A1 EP 0686040A1
Authority
EP
European Patent Office
Prior art keywords
igf
igfbp
pharmaceutical composition
wound
ratio
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP94907292A
Other languages
German (de)
English (en)
Inventor
George N. Cox
Thomas A. Northwestern Univ. Med. School Mustoe
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Boulder Inc
Original Assignee
Amgen Boulder Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Amgen Boulder Inc filed Critical Amgen Boulder Inc
Publication of EP0686040A1 publication Critical patent/EP0686040A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/27—Growth hormone [GH], i.e. somatotropin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/65—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/28—Insulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22—Hormones
    • A61K38/30—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C07K1/113—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides without change of the primary structure
    • C07K1/1133—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides without change of the primary structure by redox-reactions involving cystein/cystin side chains
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4743—Insulin-like growth factor binding protein

Definitions

  • This invention relates to pharmaceutical compositions for wound healing comprising the combination of insulin-like growth factor and insulin-like growth factor binding protein and to methods of using the compositions.
  • IGF-1 and IGF-2 Insulin-like growth factors 1 and 2
  • IGF-l and IGF-2 are growth and differentiation factors for most cells in the body and are present at high concentrations in serum (about 300 ng/ml for IGF-l and 1000 ng/ml for IGF-2) .
  • Circulating levels of IGF-l are determined primarily by growth hormone, which stimulates the liver to make IGF-l. Most of the growth-promoting effects of growth hormone are believed to be mediated by IGF-l.
  • the combination of growth hormone and IGF-l is shown to stimulate linear growth and weight gain as described in PCT Patent Application No. US91/03841.
  • IGF-2 was shown to be an effective treatment for wounds, as reported in U.S. Patent 4,885,163 to Sharr and Smith. IGF-l alone, however, was not effective in partial thickness wounds, but acted synergistically in combination with PDGF (platelet derived growth factor) to promote connective tissue and epithelial growth, as described in Lynch, et al., J. Clin. Invest. 84:640-646, 1989 and Van Brunt and Klausner, Bio/Technology 6:25-30, 1988.
  • PDGF platelet derived growth factor
  • IGF-l and IGF-2 circulate in blood bound to specific binding proteins of which six are now known (IGFBP-1 to IGFBP-6) .
  • the binding proteins bind 95% or more of the IGFs in blood.
  • IGF-l and IGF-2 are prevented from interacting with cell surface receptors which mediate their biological functions.
  • Insulin like growth factor binding protein- 1 (IGFBP-1, or BP-1) is a 23 kDa IGF binding protein. A published in vivo experiment that has been performed with IGFBP-1 indicates that IGFBP-1 acts as an IGF-l inhibitor in vivo.
  • IGFBP-1 inhibited the hypoglycemic response of rats given intravenous infusions of IGF-l, which promotes glucose uptake by cells. This property can lead to hypoglycemia when IGF-l is present in sufficient amounts. Publications by other groups indicate that IGFBP-1 is expressed in vivo during periods of growth arrest (e.g., starvation and diabetes), also suggesting that IGFBP-1 might act as an IGF-l inhibitor.
  • IGFBP-1 potentiates or inhibits the effects of IGF- 1 on cells and tissues.
  • IGFBP-1 was reported to inhibit the effects of IGF-l on cultured endometrial cells (Rutanen et al., J. Clin. Endocrinol. Metab. 60:173-180, 1988), choriocarcinoma cells (Ritvos et al., Endocrinology, 122:2150-2157, 1988), thyroid follicular cells (Frauman et al., Endocrinology, 124:2289-2296, 1989), fibroblasts (Liu et al., Biochem. Biophys. Res. Com .
  • the present invention provides a novel composition for wound healing. Summary of the Invention The present invention describes the use of a combination of IGF-l and IGFBP, particularly IGFBP-1, in a composition for non- systemic administration for wound healing. Since it has been known that IGFBP-1 inhibits the activity of IGF-l systemically, it is indeed surprising to discover that IGFBP-1 potentiates IGF- 1 when used in non-systemic administration for wound healing.
  • IGFBP-1 acts as an IGF-l inhibitor in vitro and when given systemically in vivo. In contrast, they have found that IGFBP-1 potentiates the growth- promoting effects of IGF-l when applied non-systemically for wound healing.
  • the potentiating effect of IGFBP-1 in non- systemic healing may be due to the ability of IGFBP-1 to prolong the half-life of IGF-l at a wound site, the ability of IGFBP-1 to protect IGF-l from extracellular proteases in the wound, or a true synergistic interaction of the two factors.
  • This invention is directed to a composition comprising IGF-l and IGFBP and a pharmaceutically acceptable carrier suitable for non-systemic administration for use in wound healing.
  • this invention is directed to a method for promoting the rate or improving the quality of wound healing, which comprises non-systemically administering to such wound IGF- 1 and IGFBP in a therapeutically effective amount to promote wound healing.
  • the present invention relates to pharmaceutical compositions comprising IGF-l, IGFBP and a pharmaceutically acceptable carrier suitable for non-systemic administration for use in wound healing.
  • IGF binding protein 1 IGFBP-1 or BP-1
  • the present inventors contemplate the use of any of the six known IGF binding proteins.
  • IGF refers to any polypeptide that binds to the
  • IGF type I Receptor including, for example, IGF-l, IGF-2, (desl-1)
  • IGF-l Due to this common receptor binding, the teachings of the present invention which are described with respect to IGF-l are intended to encompass IGF-2, (desl-3)IGF-l, met-IGF-1, insulin, and any active fragments which bind to the type I Receptor.
  • IGF-l refers to natural human IGF-l, recombinantly produced human IGF-l, met-IGF-1, and any active fragments of IGF-l.
  • IGFBP refers to any of the six known IGF binding proteins or to active fragments of these binding proteins which bind to IGF.
  • pharmaceutically acceptable carrier refers to a physiologically-compatible, aqueous or non-aqueous solvent.
  • patient refers to any human or animal in need of treatment for wound healing.
  • non-systemic refers to any route of administration which does not directly involve the use of blood or blood vessels.
  • formulations useful for non- systemic administration include salves, ointments, creams, gels, lotions, aerosols, powders, liquids or solids.
  • Non-systemic administration includes topical routes, intrader al injections, suppositories, enema, inhaled aerosol, oral routes, and any non- circulatory route of administration.
  • compositions of the present invention comprise IGF-l and IGFBP, particularly IGFBP-1, in a pharmaceutically acceptable carrier.
  • IGF-l can be obtained commercially from Bachem in Torrance, California. IGF-l can also be purified from natural sources, for example from serum. IGF-l can also be prepared by methods well known to those skilled in the art including, for example, recombinant techniques such as those set forth in the examples below. Although the expression system of the reco binant methods described in the examples employs a particular bacterium, it is contemplated that yeast, bacterial, mammalian, insect or other expression systems can also be used. IGF-l can also be synthesized using conventional methods known in the art
  • IGFBP-1 can be purified from natural sources such as amniotic fluid, or can be produced in accordance with procedures described in PCT Application publication WO 89/09792, published on October 19, 1989, incorporated herein by reference. IGFBP-1 can also be produced by employing the procedures used by the inventors of the present application, as set forth in the examples below. The present inventors have performed in vitro and in vivo experiments to determine the interaction of recombinant IGFBP-1 with IGF-l.
  • compositions containing a molar ratio of IGF-l to IGFBP-1 between 1:100 and 100:1 are contemplated. It is believed compositions containing concentrations of IGF-l of less than 0.01 ⁇ g/25 mm 2 of surface area of wound may not be effective while compositions containing concentrations of IGF-l of more than 500 ⁇ g/25 mm 2 of surface area of wound may have undesirable side effects, such as elevated levels of circulating IGF-l.
  • the frequency of dosing will depend on pharmacokinetic parameters of the IGF-l and IGFBP-1 in the formulation used and can be readily determined by those skilled in the art.
  • the formulations of this invention are designed for non- systemic administration.
  • One formulation incorporates IGF-l and IGFBP-1 into liquid form in which physiological saline solution may be used as a carrier. It is contemplated that other pharmaceutically acceptable carriers may also be used.
  • the liquid formulations comprise protein and a carrier, such as phosphate buffered saline (PBS) .
  • PBS phosphate buffered saline
  • the liquid form may be applied directly to the wound, injected intradermally, or used to saturate an occlusive dressing.
  • a formulation may incorporate IGF-l and IGFBP-1 into a salve, ointment, cream, gel, lotion, topical aerosol, or powder.
  • Ointments generally are prepared using either (1) an oleaginous base, i.e., one consisting of fixed oils or hydrocarbons, such as white petrolatum or mineral oil, or (2) an absorbent base, i.e., one consisting of an anhydrous substance or substances which can absorb water, for example, anhydrous lanolin.
  • an oleaginous base i.e., one consisting of fixed oils or hydrocarbons, such as white petrolatum or mineral oil
  • an absorbent base i.e., one consisting of an anhydrous substance or substances which can absorb water, for example, anhydrous lanolin.
  • the active ingredients IGF-l and IGFBP- 1
  • Creams and lotions are oil/water emulsions. They consist of an oil phase (internal phase) , comprising typically fixed oils, hydrocarbons, and the like, such as water-soluble substances, including, for example, added salts.
  • the two phases are stabilized by use of an emulsifying agent, for example, a surface active agent, such as sodium lauryl sulfate, hydrophilic colloids, such as acacia colloidal clays, veegum, and the like.
  • a surface active agent such as sodium lauryl sulfate
  • hydrophilic colloids such as acacia colloidal clays, veegum, and the like.
  • Gels comprise a base selected from an oleaginous base, water, or an emulsion-suspension base, as previously described.
  • a gelling agent which forms a matrix in the base, increasing its viscosity.
  • gelling agents are hydroxypropyl cellulose, acrylic acid polymers, and the like.
  • the active ingredients e.g., IGF-l and IGFBP-1 are added to the formulation at the desired concentrations prior to the addition of the gelling agent.
  • the carrier and the active ingredients are formulated in a physiologically- compatible, slow-release formulation.
  • the primary solvent in such a formulation may be either aqueous or non-aqueous in nature.
  • the formulation may contain other pharmacologically-acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, odor, rate of dissolution, absorption, or release of the active ingredients.
  • excipients are those substances usually and customarily employed to formulate dosages for administration in either unit dose or multi-dose form.
  • the therapeutic composition may be stored in sterile vials or containers as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration. Formulations containing IGF-l and IGFBP-1 are stored and administered at or near physiological pH. It is presently believed that storage and administration in a formulation at a high pH (i.e. greater than 8) or at a low pH (i.e. less than 5) is undesirable.
  • the present invention also relates to methods for treating wounds by administering the above described pharmaceutical compositions to a patient in need thereof.
  • the manner of administering the therapeutic compositions of the present invention containing for example, IGF-l and IGFBP-1 can be via non-systemic methods, including topical applications, intradermal injection, suppositories, enema, inhaled aerosol, or oral routes.
  • non-systemic methods including topical applications, intradermal injection, suppositories, enema, inhaled aerosol, or oral routes.
  • repeated doses may be administered. Any of these methods are intended to create a preselected concentration range of IGF-l and IGFBP-1.
  • Those skilled in the art can readily determine the appropriate mode of administration and dosage depending on various factors including, for example, the type and location of the wound, the age and condition of the patient, and the formulation used.
  • Examples of the types of wounds treatable using the compositions of the present invention are chemical or thermal burns; skin graft donor and transplant sites; cutaneous ulcers, including but not limited to decubitus ulcers, diabetic ulcers, venous stasis ulcers, and necrobiosis lipoidicum ulcers; surgical wounds, wound dehiscence, including but not limited to the abdominal, thigh, and chest areas; corneal trauma and transplants; tooth extractions and oral surgery; disruption of a mucous membrane, including but not limited to the gastrointestinal tract (ulcerative colitis) and bladder; and any of a wide range of other traumatic interruptions of connective tissue, e.g., abrasions.
  • compositions of the present invention are particularly useful for dermal wounds.
  • the effects of IGF-l and IGFBP-1 alone and in combination on wound healing were tested using the rabbit ear dermal ulcer model, as described more fully in the examples below. Briefly, IGF-l and IGFBP-1 in varying ratios or control buffer were applied to an induced wound in the models. Tissues from the wound site were subjected to histologic analysis. IGF-l or IGFBP-1 alone did not have a significant effect on healing compared with controls. The combination of IGF-l with IGFBP-1 showed significantly increased wound healing compared with controls. The enhancement was greatest when IGF-l was in molar excess.
  • mice which are diabetic and exhibit delayed wound-healing compared to normal mice or heterozygous db/+ mice.
  • Experiments were designed to compare the effects of IGF-l and IGFBP-1 alone and in combination on wound-healing in this model. Parameters measured were: (1) percent re-epithelialization; (2) new granulation tissue; and (3) capillary number.
  • the combination of IGF-l + IGFBP-1 caused a dose-dependent increase in each of these wound healing parameters.
  • the responses to the combination of IGF-l and IGFBP-1 were better than the responses to either protein alone.
  • the IGF-l gene was assembled in two stages. Initially, the DNA sequence encoding IGF-l was joined to DNA sequences encoding the secretory leader sequence of the E ⁇ _ coli OMP A protein (ompA L ) . This gene fusion was constructed in order to determine whether IGF-l could be efficiently secreted from E ⁇ _ coli. A second construct, in which IGF-l is expressed as an intracellular protein in E. coli. was created by deleting DNA sequences encoding the OmpA leader sequence and replacing them with DNA sequences that allow intracellular expression of IGF-l. Construction of the OmpA ⁇ -IGF-l gene fusion
  • the resulting Ba HI/Haelll restriction fragment coding for a translational start signal and the first 21 amino acids of the ompA signal sequence was purified.
  • This DNA fragment was mixed with BamHI + Pstl-digested PUC18 DNA (Boehringer Mannhein Biochemicals, Indianapolis, IN) and the two synthetic oligonucleotides [IGF-l (1-14) U + L] (SEQ ID NO:5 and SEQ ID NO:6) were ligated together.
  • the ligation mixture was used to transform E . coli strain JM109 (New England Biolabs, Beverly, MA) and individual colonies isolated.
  • These plasmids (0mpA L IGF-lpUC18) have a translational start signal followed by DNA sequences encoding the OmpA signal sequence and the first 14 amino acids of IGF-l.
  • An M13 phage containing DNA sequences encoding amino acids 15 through 70 of IGF-l was created by ligating together the two complementary pairs of oligonucleotides (IGF1U + 1L and IGF2U + 2L) (SEQ ID NO:7 and SEQ ID NO:8) and cloning the DNA fragment into PstI + Hindlll-digested M13 mpl9 DNA (New England Biolabs, Beverly, MA) . Double-stranded DNA was purified from a phage clone and the Pstl/Hindlll fragment encoding amino acids 15-70 of the IGF-l protein were isolated.
  • This DNA fragment was ligated together with PstI + Hindlll-digested plasmid OmpA L IGF- lpUCl ⁇ DNA and used to transform E ⁇ . coli strain JM107 (GIBCO BRL, Gaithersburg, MD) .
  • the BamHI/HindiII fragment containing the IGF-l gene fused to the OmpA L sequence was isolated and cloned into the BamHI + Hindlll generated site of plasmid pT3XI-2 (described in PCT Application publication WO 91/08285 published on June 13, 1991).
  • the completed plasmid containing the ompA L - IGF-1 gene fusion is called pT3XI-2 ⁇ lO c (TC3)ompA L IGF-l. Construction of the Methionyl-IGF-1 gene
  • the BamHI/HindiII fragment containing the OmpA L -IGF-l gene fusion described above was purified from plasmid pT3XI- 2 ⁇ lO c (TC3)ompA L IGF-l and digested with Hinfl.
  • the approximate 200 bp Hinfl/Hindlll DNA fragment was mixed with the annealed, complementary synthetic oligonucleotides (MetlGFlU + 1L) (SEQ ID NO:9 and SEQ ID NO:10) and ligated with BamHI + Hindlll-digested plasmid pT3XI2 DNA, and used to transform E ⁇ . coli JM107.
  • the completed plasmid construct is called ⁇ l0 c (TC3)IGF-lpT3XI-2 and contains an extra alanine residue in between the initiator methionine and the beginning of the IGF-l sequence.
  • the BamHI/Hindlll fragment containing the mutant IGF-l gene was isolated and ligated into the BamHI + Hindlll generated site of plasmid pT5T (described in Nature, Vol. 343, No. 6256, pp. 341- 346, 1990).
  • the ligation mixture was used to transform J s _ coli BL21/DE3 described in US Patent 4,952,496 and the resulting individual colonies were isolated. This construct was named 010 C (TC3)IGF-lpT5T.
  • Uracil-containing single-stranded template DNA was prepared following propagation of the phage in ] _ coli strain CJ236 (supplied with Muta-Gene Kit, Bio-Rad Laboratories, Richmond, CA) .
  • the oligonucleotide used for mutagenesis had the sequence: 5 1 - GATGATTAAATGGGTCCGGAGACT - 3' (SEQ ID NO 11).
  • the mutagenesis reaction product was used to transform E_j_ coli strain JM109 and individual plaques picked.
  • Double-stranded replicative form DNA from individual phage ⁇ was isolated, digested with BamHI + Hindlll and the -200 bp fragment containing the IGF-l gene purified.
  • the purified DNA was cloned into the BamHI + Hindlll generated site of plasmid pT5T and used to transform E_;_ coli strain BL21/DE3.
  • Several isolates were sequenced, and all were correct.
  • One bacterial colony with the correct plasmid was named 010(TC3)mutIGF-lpT5T.
  • E_j_ coli strain 01O(TC3)mutIGF-lpT5T was diluted 1:100 into 800 ml of Luria Broth (10 g/liter tryptone, 5 g/liter yeast extract and 10 g/liter NaCl, pH 7.5) medium containing 15 ⁇ g/ml tetracycline and grown at 37° until the optical density at 600 nm was 0.7-0.9.
  • IPTG isopropyl-jS-D-thiogalactopyranoside (Sigma Chemical Company, St. Louis, MO) was added to a final concentration of 1 mM and the culture grown for an additional 2.5-3.0 hours at 37°C.
  • the cells were harvested by centrifugation.
  • the cell pellet was washed once with ice-cold buffer A (50 mM Tris-HCl pH 7.5/ 25 mM NaCl/1 mM DTT) and stored frozen at -70°C or resuspended in buffer A and used immediately.
  • E. coli strain 010(TC3)mutIGF- lpT5T was grown in a 10 liter fermenter at 37°C in complex media
  • E. coli cells were suspended in Buffer A (50 mM Tris, pH 7.5, 20 mM NaCl and 1 mM DTT), and were disrupted at 1800 psi using a French pressure cell. The suspension was centrifuged at 20,000 x g for 30 minutes, and aliquots of the pellet and the supernatant were analyzed by SDS-PAGE. A major band corresponding to Met-IGF-I was present in the pellet, but not the supernatant. The pellet was resuspended in Buffer A (40 ml/10 g cell paste), and re-centrifuged at 20,000 x g for 30 minutes. This wash procedure was repeated 2 times.
  • Buffer A 50 mM Tris, pH 7.5, 20 mM NaCl and 1 mM DTT
  • the final pellet containing Met-IGF-I was resuspended in 6 M guanidine, 50 mM Tris, pH 7.5, 6 mM DTT (25 ml/10 g cell paste) using a ground glass homogenizer, and the suspension was incubated at room temperature for 15 minutes. The undissolved protein was removed by centrifugation at 20,000 x g for 30 minutes. SDS-PAGE analysis of the pellet and supernatant showed that Met-IGF-I was present in the supernatant only. Refolding of Met-IGF-1
  • the denatured and reduced Met-IGF-1 was subjected to a three-step refolding protocol.
  • oxidized glutathione (GSSG) was added to the supernatant from Example 2 to a final concentration of 25 mM, and incubated at room temperature for 15 minutes.
  • step (3) The solution from step (2) was incubated overnight at 4°C to allow completion of disulfide exchange, and then centrifuged at 20,000 x g for 15 minutes. SDS-PAGE analysis of the pellet and the supernatant showed that the supernatant was composed of relatively homogeneous Met-IGF-I.
  • Peak I Peak I at 56.5 minutes
  • Peak II at 58.2 minutes. In addition, a minor peak was present at 60 minutes, and a broad peak at 75-79 minutes containing improperly refolded Met-IGF-I species. Based on the integration of the HPLC chromatogram, Peak I and Peak II represented approximately 25% and 30% of the crude Met-IGF-I protein loaded onto the reverse phase column, respectively. N-terminal sequence analysis of Peak I and Peak II gave the sequence MetGlyProGluThrLeu... (SEQ ID NO:12), which matches the N-terminal amino acid sequence of human IGF-I except for the extra methionine residue at the N-terminus. Recombinant human Met-IGF-I (Bachem, Torrance, CA) eluted at a retention time identical to Peak II.
  • Peak II represents correctly refolded Met-IGF-I, as evidenced by retention time identical to the purchased standard as well as biological activity identical to the purchased standard.
  • IGF-l which has not been correctly refolded exhibits reduced or no biological activity.
  • the supernatant from the refolding procedure of Example 2 (6700 ml) was concentrated 10- fold and exhaustively dialyzed against 20 mM HEPES, pH 7.5.
  • the dialyzed sample was centrifuged 20,000 x g for 15 minutes to remove precipitated proteins, passed through a 0.2 ⁇ filter (Corning, Corning, NY) and loaded onto an S-Sepharose column (5.0 x 40 cm, Pharmacia LKB, Piscataway, NJ) previously equilibrated with the same buffer, at a flow rate of 40 ml/minute.
  • the bound met-IGF-1 was eluted with a 5000 ml linear gradient to 0.5 M NaCl at a flow rate of 40 ml/minute. 25 ml fractions were collected. Two symmetrical peaks were resolved: Peak A eluting at 0.12 M NaCl, and Peak B eluting at 0.15 M NaCl. SDS-PAGE analysis of aliquots of Peaks A and B showed that they contained relatively homogeneous IGF-l (> 90% homogeneous) ; however, several high molecular weight E. coli proteins were still present. The S- Sepharose fractions corresponding to Peaks A and B were pooled separately.
  • the S-Sepharose pool B was made to 2 M NaCl, 20 mM HEPES, pH 7.5, and loaded at a flow rate of 30 ml/minute onto a Toyopearl Butyl-650S 5.0 x 25 cm( Supelco, Beliefonte, PA) hydrophobic interaction column previously equilibrated with 20 mM HEPES, pH 7.5, 2M NaCl.
  • the bound protein was eluted with a
  • the major peak eluting at 17.5% ethanol contained homogeneous, correctly refolded met-IGF-1. Fractions containing this peak were pooled, concentrated to 2 mg/ml, dialyzed against 100 mM HEPES, 44 mM sodium phosphate, pH 6.0, and stored at - 70°C.
  • Relatively small quantities (50-100 ⁇ g) of pure, correctly folded recombinant met-IGF-1 could be obtained by injecting 75-150 mg of S-Sepharose pool B (in 1 ml of 0.05% TFA, Buffer C) onto a reverse phase column (RP-4, 4.6 x 250 mm) and eluting with 80% acetonitrile in water, 0.042% TFA (Buffer D) using a linear gradient (an increase of 1% Buffer D/min) at a flow rate of 0.5 ml/min.
  • an aminopeptidase isolated from Aeromonas proteolytica using a modification of a previously described method (Lorand, L. , 1976, Meth. Enzymol. 15: 53-543, incorporated herein by reference) was used to remove the N-terminal methionine.
  • Recombinant met-IGF-1 was incubated in the presence or absence of the purified aminopeptidase in a 100 ⁇ l reaction mixture containing 120 ⁇ g met-IGF-1, 20 mM Tricine, pH 8.0, 1 ⁇ g aminopeptidase for 30 minutes at 25° C. The reaction was stopped by the addition of 1 ml 0.05% TFA in water.
  • E. coli cells expressing the IGFBP-1 were suspended in Buffer A (50 mM Tris, pH 7.5, 20 mM NaCl and 1 mM DTT) at a concentration of 40 ml/10 g cell paste, and were disrupted at 1800 psi using a French pressure cell. The suspension was centrifuged 20,000 x g for 30 minutes, and aliquots of the pellet & supernatant were analyzed by SDS-PAGE. A major band corresponding to the IGFBP-1 was present in the pellet, but not the supernatant. The pellet was suspended in Buffer A (40 ml/10 g cell paste), and re-centrifuged at 20,000 x g for 30 minutes. This wash procedure was repeated 2 times.
  • Buffer A 50 mM Tris, pH 7.5, 20 mM NaCl and 1 mM DTT
  • the final pellet containing the IGFBP-1 was suspended in 6M guanidine, 50 mM Tris, pH 7.5, 6 mM DTT (25 ml/10 g cells) using a ground glass homogenizer. The suspension was incubated at room temperature for 15 minutes. The undissolved protein was removed by centrifugation at 20,000 x g for 30 minutes. Final concentration of the IGFBP-1 was 1.0 mg/ml. SDS-PAGE analysis of the pellet and supernatant showed that IGFBP-1 was present in the supernatant only. The denatured and reduced IGFBP-1 was subjected to a three- step refolding procedure.
  • Oxidized glutathione the mixed-disulfide producing reagent (GSSG) , was added to the supernatant to a final concentration of 25 mM, and incubated at room temperature for 15 minutes.
  • GSSG mixed-disulfide producing reagent
  • the solution was then diluted 10 fold gradually with 50 mM tris. pH 9.7 and phenylmethylsulfonylfluoride was added to final concentration of ImM. Final concentration of protein was lOO ⁇ g/ml.
  • the refolding mixture was incubated overnight at 4°C, and then centrifuged at 20,000 x g for 15 minutes. SDS-PAGE analysis of the pellet and supernatant showed that the supernatant was composed of relatively homogeneous IGFBP-1.
  • the refold mixture (15000 ml) prepared from 59Og of E. coli paste containing the correctly refolded IGFBP-1 was concentrated to 1800 ml, dialyzed against 20 mM sodium phosphate, pH 6.0, centrifuged at 10,000 x g for 30 minutes to remove precipitated E. coli proteins and loaded onto an Q-Sepharose (Pharmacia/LKB, Piscataway, NJ) column (5.0 x 60 cm) previously equilibrated with the same buffer. The bound protein was eluted with a 5000 ml linear gradient to 0.5M NaCl at a flow rate of 20 ml/minute. 25 ml fractions were collected.
  • the protein was eluted with a 1500 ml linear gradient to 20 mM HEPES, pH 7.5 at a flow rate of 40 ml/minute. A single broad peak eluted at 5 - 15% ethanol. Aliquots (lO ⁇ l) of each peak fraction were analyzed by RP-4 reverse phase chromatography and SDS-PAGE. Fractions containing pure (95%) correctly refolded IGFBP-1 were pooled, concentrated to 6-8 mg/ml and assayed for bioactivity.
  • EXAMPLE 6 Activity of IGF-l and IGFBP-1 on Mouse 3T3 Fibroblasts A crystal violet dye assay was used to measure cell proliferation. Assays were performed in 96 well gelatin-coated plates. Balb/c 3T3 fibroblasts were plated at 25,000 cells/well in 200 ⁇ l of serum-free DMEM (Dulbecco's modification of Eagle's media, Mediatech, Herndon, VA) containing 0.03 M Glycerol and 0- 1000 ng/ml IGF-l. Cells were incubated for 72 hours at 37°C . At this time, the media was replaced with 150 ⁇ l of 0.2% crystal violet, 10% formaldehyde, 10 mM potassium phosphate pH 7.0.
  • DMEM Disulbecco's modification of Eagle's media, Mediatech, Herndon, VA
  • IGFBP-1 The effect of IGFBP-1 on IGF-1-stimulated proliferation of 3T3 fibroblasts was determined by co-incubating the cells with a set amount of IGF-l and increasing amounts of IGFBP-1.
  • Balb/c 3T3 fibroblasts were plated at 25,000 cells/well in 200 ⁇ l of serum-free DMEM containing 0.03 M glycerol and either 20ng or 50ng/ml IGF-l, and varying amounts of IGFBP-1 (100 ng/ml - 1 x 10 4 ng/ml) . The cells were incubated for an additional 72 hours and processed as described above.
  • Rat osteosarcoma cells (UMR106 cell line, American Type Culture Collection, Accession No CRL-1661, Rockville, Maryland) were plated at 5-6 x 10 4 cells in 0.5 ml of Ham's F12 (Mediatech, Herndon, VA) containing 7% fetal bovine serum, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin and 2 mM L-glutamine per well in 48-well tissue culture plates (Costar, Cambridge, MA) .
  • the cells were washed twice with phosphate buffered saline (PBS) and pre-incubated an additional 24 hours in serum-free Ham's F12 medium containing 100 U/ml penicillin and 100 ⁇ g/ml streptomycin and 2 mM L-glutamine.
  • PBS phosphate buffered saline
  • IGFBP-1 The effect of recombinant IGFBP-1 on the IGF-1-stimulated mitogenesis of rat UMR106 osteosarcoma cells was determined using the assay described above. After the 24 hour pre-incubation with serum-free media, the cells were incubated for an additional 20- 24 hours with 50 ng/ml IGF-l plus different amounts of recombinant IGFBP-1, ranging from 100 ng/ml to 10,000 ng/ml. We found that at a molar ratio of 20:1 (IGFBP-1:IGF-l) , IGFBP-1 reduced the mitogenic activity of IGF-l by 80%.
  • IGF-l is biologically active when tested in vitro using two different types of cells, murine Balb-C 3T3 fibroblasts and UMR106 rat osteosarcoma cells. Furthermore, IGFBP-1 inhibited IGF-l dependent proliferation of these cells demonstrating its ability to bind IGF-l and prevent the binding of IGF-l to cell surface IGF receptors. In both of these assays a molar ratio of 10-20:1 (IGFBP-1:IGF-l) inhibited the biological activity of IGF-l by 80-100%.
  • EXAMPLE 7 DIABETIC (db/db) MOUSE MODEL Homozygous db/db mice are diabetic and exhibit delayed wound-healing compared to normal mice or heterozygous db/+ mice (Tsuboi and Rifkin, Journal of Experimental Medicine, 172:245- 251, 1990) .
  • the following experiments were designed to compare the effects of IGF-l and IGFBP-1 on wound-healing in this model.
  • the IGF-l used in these experiments is met-IGF-1.
  • mice Female db/db mice (approximately 8 weeks of age) were randomly assigned to treatment groups. Each mouse received two 6 mm full-thickness circular wounds on the center of the back using a 6 mm punch biopsy instrument. Growth factors or control solution, phosphate buffered saline (PBS) containing l mg/ml bovine serum albumin (BSA (Sigma Chemical Company, Chicago, IL) were applied to the wounds in 20 ⁇ l. Solutions were applied daily for 5 days. Wounds were left open during this time. Animals were sacrificed on day 8 and histological sections of the wounds prepared at their widest margin. Parameters measured were: (1) percent re-epithelialization; (2) new granulation tissue; and (3) capillary number.
  • PBS phosphate buffered saline
  • BSA bovine serum albumin
  • Re-epithelialization was determined by calculating the ratio of the length of re-epithelialized epidermis versus the original wound width using tracings of the histological sections on a TV monitor at 40 X magnification. Data are expressed as percentages. New granulation tissue was determined from tracing the margins of the granulation tissue in each wound on a TV monitor. Data are expressed as an area (mm 2 ) .
  • Capillary number was determined by counting the number of capillary lumens in whole wound cross sections of the granulation tissue at 100 x magnification.
  • the first experiment was designed to compare increasing amounts of an approximate 1:1 molar ratio of IGF-l:IGFBP-1 to saline controls.
  • the highest dose tested a 1:0.5 molar ratio of the two proteins.
  • the four treatment groups were as follows:
  • mice 3. 10 ⁇ g IGF-l + 40 ⁇ g IGFBP-1 4 mice
  • IGF-l + IGFBP-1 caused a dose-dependent increase in the rate of re-epithelialization and in capillary number (+ 156% and + 140%, respectively, compared to controls, at the highest dose) .
  • This experiment was designed to determine whether the positive effects seen in experiment 1 were due to IGF-l, IGFBP-1, or the combination of IGF-l + IGFBP-1.
  • Ischemic ears were rendered in 28 (56 ears) rabbits.
  • the ears were reproducibly ischemic with a tissue p0 2 measured with a tissue optode of 20-28.
  • a full thickness circumferential incision was made around the base of the rabbit ears, sparing the cartilage, the three major veins and the caudal artery. All of the minor veins, the arterioles, the ventral artery and the central artery were divided and the tissues cut. The skin was sutured by continuous method.
  • the wounds were made in an inverted L-pattern, with the long arm over the ventral artery and the base over the central artery, avoiding the area near the caudal artery.
  • the wounds extended to bare cartilage and the central tissue was removed.
  • Each animal was examined daily for infection, disruption of the wound, or loss or displacement of the wound covering.
  • the wounds were made immediately following the creation of the ischemia. Wound healing was profoundly impaired. This model is a major improvement over previously known wound healing models in reproducing the hypoxic (ischemic) environment that exists in many human chronic wounds.
  • IGF-l and/or IGF-BP1 in varying ratios and varying concentration or control buffer were applied at the time of wounding, and occlusive dressings were applied.
  • Wounds were harvested at day 7 for histologic analysis. Test substances were applied to the wounds once at the time of wounding as described in Example 8. Following administration of the test growth factors, the wounds were covered with an occlusive polyurethane film (TEGADERMTM, 3M Company, Minneapolis, MN) . At day 7, the rabbits were anesthetized. The entire ear was then removed and fixed in 10% buffered neutral formaldehyde overnight or in omnifix for 2.5 hours. The wound was partially excised by taking a through and through rectangular block, including both skin surfaces and the cartilage. The animals were then sacrificed. In the histological analysis, the tissues were dehydrated in graded alcohol and xylene and then embedded in paraffin according to standard procedures.
  • TEGADERMTM occlusive polyurethane film
  • the wounds were bisected and sectioned at 6 ⁇ m to obtain a cross-section near the center of the wound.
  • the section was mounted on poly-L-lysine coated slides and stained with hematoxylin and eosin. The slides were observed under an ordinary light microscope.
  • N-EG new epithelial growth
  • SP new granulation tissue
  • TNG new granulation tissue
  • N-volume volume of new wound healing tissue
  • TNG is a measurement of new granulation tissue growth based on differences in staining in new collagen versus the mature collagen of intact dermis.
  • N-EG is a measurement of the horizontal migration of new epithelial tissue measured from the original wound edge.
  • Tables 8 and 9 provide a summary of the results obtained in the non-ischemic model of Example 8 and the ischemic model described above, respectively. All amounts of proteins indicated in Tables 8 and 9 are in ⁇ g doses.
  • IGF1/BP1(1:1) 1/3.3 440 472 50 114 4.6 E+06 27
  • IGF/BP1(11:1) IGF/BP1(11:1) :
  • IGF/BP1 (5:1) :

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Endocrinology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Epidemiology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Dermatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

L'invention se rapporte à des compositions de cicatrisation de plaies comprenant la protéine de liaison de facteur de croissance du type insuline. Les compositions pharmaceutiques sont formulées de façon à se prêter à une administration non systémique. La présente invention se rapporte à des procédés d'utilisation de ces compositions de cicatrisation.
EP94907292A 1993-01-29 1994-01-25 Composition de cicatrisation de plaies Withdrawn EP0686040A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US1103193A 1993-01-29 1993-01-29
US11031 1993-01-29
PCT/US1994/000799 WO1994016723A2 (fr) 1993-01-29 1994-01-25 Composition de cicatrisation de plaies

Publications (1)

Publication Number Publication Date
EP0686040A1 true EP0686040A1 (fr) 1995-12-13

Family

ID=21748560

Family Applications (1)

Application Number Title Priority Date Filing Date
EP94907292A Withdrawn EP0686040A1 (fr) 1993-01-29 1994-01-25 Composition de cicatrisation de plaies

Country Status (8)

Country Link
EP (1) EP0686040A1 (fr)
JP (1) JPH09500088A (fr)
KR (1) KR960700069A (fr)
AU (1) AU6093794A (fr)
CA (1) CA2154078A1 (fr)
FI (1) FI953615A (fr)
NO (1) NO952987L (fr)
WO (1) WO1994016723A2 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPM678294A0 (en) * 1994-07-13 1994-08-04 Gropep Pty Ltd Use of insulin-like growth factor in combination with insulin
ATE274056T1 (de) * 1995-10-11 2004-09-15 Chiron Corp Kombination pdgf, kgf, igf und igfbp zur wundheilung
US5783556A (en) * 1996-08-13 1998-07-21 Genentech, Inc. Formulated insulin-containing composition
US6420518B1 (en) 1997-04-04 2002-07-16 Genetech, Inc. Insulin-like growth factor agonist molecules
US6121416A (en) 1997-04-04 2000-09-19 Genentech, Inc. Insulin-like growth factor agonist molecules
JP3971108B2 (ja) 1999-01-06 2007-09-05 ジェネンテック・インコーポレーテッド インシュリン様成長因子（ｉｇｆ）ｉ突然変異体
AUPQ585500A0 (en) * 2000-02-25 2000-03-16 Gropep Pty Ltd Treatment for peripheral sensory neuropathy
WO2001087323A2 (fr) 2000-05-16 2001-11-22 Genentech, Inc. Procede de traitement des lesions du cartilage

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3178714B2 (ja) * 1988-07-15 2001-06-25 セントラル・シドニー・エリア・ヘルス・サービス インスリン様成長因子（ｉｇｆ）結合蛋白複合体の酸不安定サブユニット（ａｌｓ）
CA2090702A1 (fr) * 1990-08-28 1992-03-01 Michael C. Kiefer Proteine igfbp-5 possedant une forte affinite pour un facteur de croissance de substances apparentees a l'insuline
US5187151A (en) * 1991-02-12 1993-02-16 Genentech, Inc. Use of binding protein with igf-i as an anabolic growth promoting agent
ES2174852T3 (es) * 1992-08-26 2002-11-16 Celtrix Pharma Metodo para el tratamiento sistemico de estados catabolicos y lesiones sistemicas de tejidos.

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9416723A2 *

Also Published As

Publication number Publication date
JPH09500088A (ja) 1997-01-07
WO1994016723A2 (fr) 1994-08-04
NO952987L (no) 1995-08-30
CA2154078A1 (fr) 1994-08-04
FI953615A0 (fi) 1995-07-28
NO952987D0 (no) 1995-07-27
WO1994016723A3 (fr) 1994-09-15
KR960700069A (ko) 1996-01-19
FI953615A (fi) 1995-07-28
AU6093794A (en) 1994-08-15

Similar Documents

Publication Publication Date Title
Rothe et al. Growth factors: their biology and promise in dermatologic diseases and tissue repair
US5965530A (en) Therapeutic uses of keratinocyte growth factor
AU565347B2 (en) Repair of tissue in animals
AU707340B2 (en) Therapeutic uses of keratinocyte growth factor
JPH0611709B2 (ja) 角膜基質創傷の治療のための組成物
EP0559769B1 (fr) Mitogene de liaison d'heparine presentant une homologie avec le facteur de croissance epidermique (egf)
US5656587A (en) Promotion of cell proliferation by use of transforming growth factor beta (TGF-β)
WO1994012219A2 (fr) Facteur de croissance insulinoide modifie
JP2001526239A (ja) 角質細胞増殖因子−２製剤
US5130300A (en) Method for enhancing growth of mammary parenchyma
WO2002043751A1 (fr) Utilisation d'une composition contenant de l'insuline pour le traitement de plaies
US6767891B2 (en) Peptides with wound healing activity
EP0686040A1 (fr) Composition de cicatrisation de plaies
AU703297B2 (en) Cervical Ripening
WO1993019084A1 (fr) Repliement et purification de facteurs de croissance i ressemblant a l'insuline
AU2003234066A1 (en) Muteins of placental growth factor type 1, preparation method and application thereof
JP3931353B2 (ja) 創傷治癒剤
JPH07316066A (ja) 創傷治癒剤
CN100334114C (zh) 一种新型融合蛋白及其制备
US7807178B2 (en) Muteins of placental growth factor type I, preparation method and application thereof
EP0669134A1 (fr) Remede pour le soin de plaies
JPH0912478A (ja) 新規な皮膚欠損症治療剤
MXPA00006154A (en) Keratinocyte growth factor-2 formulations

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19950824

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 19970819