EP0636182A1 - Antibodies for treatment and prevention of respiratory syncytial virus infection - Google Patents

Antibodies for treatment and prevention of respiratory syncytial virus infection

Info

Publication number
EP0636182A1
EP0636182A1 EP93908006A EP93908006A EP0636182A1 EP 0636182 A1 EP0636182 A1 EP 0636182A1 EP 93908006 A EP93908006 A EP 93908006A EP 93908006 A EP93908006 A EP 93908006A EP 0636182 A1 EP0636182 A1 EP 0636182A1
Authority
EP
European Patent Office
Prior art keywords
antibody
seq
rsv
ser
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP93908006A
Other languages
German (de)
English (en)
French (fr)
Inventor
Geraldine Taylor
Edward James Stott
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SCOTGEN Ltd
Original Assignee
SCOTGEN Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SCOTGEN Ltd filed Critical SCOTGEN Ltd
Publication of EP0636182A1 publication Critical patent/EP0636182A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/42—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum viral
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1027—Paramyxoviridae, e.g. respiratory syncytial virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18511—Pneumovirus, e.g. human respiratory syncytial virus
    • C12N2760/18522—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • Respiratory syncytial virus is a pneumovirus of the family Paramyxoviridae and is the major cause of severe lower respiratory tract infections in children and calves during the first year of life [Kim et al . , Amer. J. EpidemJQl. .21:216-225 (1973); Stott et al . , . Hygiene. Little:257-270 (1980); Mclntosh and Chanock, in B. N. Fields et al .
  • RSV Respiratory syncytial virus
  • anti-RSV antibodies for treatment of RSV in murine and bovine species
  • the treatment of non-murine or non-bovine species is potentially limited by the immune response of these species to the foreign murine or bovine antibodies.
  • immune responses in humans against murine antibodies have been shown to both immunoglobulin constant and variable regions.
  • the present invention provides a variety of anti-RSV antibodies, functional fragments thereof including CDRs.
  • antibodies and fragments are useful in the construction of fusion proteins, particularly chimeric and humanized antibodies, which are characterized by the binding specificity and/or neutralizing activity of an anti-RSV monoclonal antibody (mAb) .
  • mAb monoclonal antibody
  • a novel humanized antibody containing bovine antibody variable sequences in association with human immunoglobulin framework and constant regions are also disclosed.
  • Fig. 1 is a graph illustrating the isolation of recombinant LF1/1298, which contains the RSV Long strain F glycoprotein cDNA with a single transversion C to A at nucleotide 1298, cloned in the polylinker of pGEM4. This recombinant permits expression of the F protein in selected host cells.
  • Fig. 2 is a diagram of the F glycoprotein primary structure denoting the hydrophobic regions (
  • the locations of the trypsin fragments recognized by different mAbs are shown below the diagram.
  • Figs. 3A and 3B compare partial B4 and B13/B14 antibody variable light (VL) chain amino acid sequences [SEQ ID ⁇ OS:
  • the B4 sequence is reported above the B13/B14 sequence to more readily illustrate comparison between the sequences.
  • the symbol "-" represents a gap in the sequence introduced to improve the alignment between the sequences.
  • the CDRs are boxed.
  • the underlined sequences correspond to the sequences of the polymerase chain reaction (PCR) oligonucleotide primers used in amplifying these antibody sequences.
  • Figs. 4A and 4B compare partial B4 and B13/B14 antibody variable heavy (VH) chain amino acid sequences [SEQ ID NOS: 3 and 4] with the B4 sequence reported above the B13/B14 sequence.
  • the symbol "-", CDRs and PCR oligonucleotide primers sequences are defined and illustrated as in Figs. 3A and 3B.
  • Fig. 5 is a bar diagram showing the competitive binding of 10 anti-F bovine mAbs, labelled with 125 I, to the A2 strain of RSV in the presence of increasing amounts of unlabelled antibodies.
  • Neg represents the ability of the mAb to neutralize the RSV in a plaque neutralization assay.
  • FI refers to the ability of the antibody to inhibit fusion of multinucleated giant cells in an assay.
  • Protection refers to whether the mAb was able to protect mice against RSV infection in an in vivo assay. Symbols: less than 10% ( ⁇ ) , 11 to 80% (cross-hatched box) , or greater than 80% (D) remaining bound at the highest amount of competing antibody tested.
  • Fig. 6 is a bar diagram showing the competitive binding of anti-F murine mAbs. "Neut”, “FI”, “Protection” and the symbols are defined as in Fig. 5.
  • Fig. 7 is a bar diagram showing the binding of anti-F mAbs to the RSV A2 strain and antibody-escape mutant RSVs.
  • the antibodies were tested in an ELISA using the purified viruses indicated at the top of the figure to coat microtitre plates. Symbols: less than 20% ( ⁇ ) , 20 to 80% (cross-hatched box) , greater than 80% (D) of the absorbance values obtained with the A2 strain.
  • Fig. 8 is a bar diagram showing the binding of anti-F mAbs to RSV Long strain and antibody-escape mutant RSVs. The antibodies were tested as described in Fig. 7. Symbols: less than 25% (open box) , 25 to 50% (cross-hatched box) , greater than 50% ( ⁇ ) of the absorbance values obtained with the Long strain.
  • Fig. 9 is a series of 8 bar diagrams showing the binding of mAb B4 to synthetic octomeric peptides, bound to polyethylene pins, where each amino acid in the sequence corresponding to amino acid #266 through 273 of the RSV F protein [SEQ ID NO: 19] has been replaced in turn with other amino acids (indicated on the abscissa) . The sequence of amino acids beneath each bar diagram shows which amino acid has been replaced (indicated by a box around the letter) .
  • Fig. 10 is a predicted humanized VH region sequence
  • bovine mAb B4 is the donor antibody [SEQ ID NO: 5] .
  • CDRs are boxed.
  • Underlined residues in the framework regions are murine residues which have been retained.
  • Fig. 11 is a predicted humanized constant heavy region sequence B4HuVK for use in constructing an altered antibody, wherein B4 is the donor antibody [SEQ ID NO: 6] .
  • CDRs are boxed.
  • Figs. 12A and 12B provide a contiguous predicted humanized VH region sequence B13/B14HuVH [SEQ ID NO: 7] for use in constructing an altered antibody, wherein B13/B14 is the donor antibody.
  • CDRs are boxed and retained murine residues are underlined.
  • Fig. 13 is a predicted humanized constant heavy region sequence B13/B14HuVK [SEQ ID NO: 8] wherein B13/B14 is the donor antibody.
  • CDRs are boxed.
  • FIGS. 14A and 14B provide a contiguous DNA sequence and corresponding amino acid sequence [SEQ ID NOS: 9 and 10] for the VH region of RSV19. CDRs are boxed. Underlined sequences correspond to the primers used. Figs. 15A and 15B provide a contiguous DNA sequence and corresponding amino acid sequence of the RSV19 VL region
  • Fig. 16 shows the plasmid pHuRSV19VH comprising a human Ig VH region framework and CDRs from murine RSV19.
  • Fig. 17 shows the plasmid pHuRSV19VK comprising a human
  • Ig VL framework and CDRs derived from RSV19 Ig VL framework and CDRs derived from RSV19.
  • Fig. 18 shows the derived Ig variable region amino acid sequences encoded by murine RSV19VH [SEQ ID NO: 13] .
  • Fig. 19 shows the derived Ig variable region amino acid sequences encoded by pHuRSV19VH [SEQ ID NO: 14] .
  • Fig. 20 shows the derived Ig variable region amino acid sequences encoded by pHuRSVl9VHFNS [SEQ ID NO: 15] .
  • Fig. 21 shows the derived Ig variable region amino acid sequences encoded by pHuRSVl9VHNIK [SEQ ID NO: 16].
  • Fig. 22 shows the derived Ig variable region amino acid sequences encoded by pHuRSV19VK [SEQ ID NO: 17] .
  • Fig. 23 is the DNA and amino acid encoding the HuVL framework 4, [SEQ ID NOS: 20 and 21] showing the potential splice site.
  • the underlined bases were changed to provide the genuine Jl gene sequence [SEQ ID NO: 22] .
  • first fusion partner refers to a nucleic acid sequence encoding an amino acid sequence, which can be all or part of a heavy chain variable region, light chain variable region, CDR, functional fragment or analog thereof, having the antigen binding specificity of a selected antibody, preferably an anti-RSV antibody.
  • second fusion partner refers to another nucleotide sequence encoding a protein or peptide to which the first fusion partner is fused in frame or by means of an optional conventional linker sequence. Such second fusion partners may be heterologous to the first fusion partner.
  • a second fusion partner may include a nucleic acid sequence encoding a second antibody region of interest, e.g., an appropriate human constant region or framework region.
  • fusion molecule refers to the product of a first fusion partner operatively linked to a second fusion partner.
  • "Operative linkage" of the fusion partners is defined as an association which permits expression of the antigen specificity of the anti-RSV sequence (the first fusion partner) from the donor antibody as well as the desired characteristics of the second fusion partner.
  • a nucleic acid sequence encoding an amino acid linker may be optionally used, or linkage may be via fusion in frame to the second fusion partner.
  • fusion protein refers to the result of the expression of a fusion molecule. Such fusion proteins may be altered antibodies, e.g., chimeric antibodies, humanized antibodies, or any of the antibody regions identified herein fused to immunoglobulin or non-immunoglobulin proteins and the like.
  • donor antibody refers to an antibody (polyclonal, monoclonal, or recombinant) which contributes the nucleic acid sequences of its naturally- occurring or modified variable light and/or heavy chains, CDRs thereof or other functional fragments or analogs thereof to a first fusion partner, so as to provide the fusion molecule and resulting expressed fusion protein with the antigenic specificity or neutralizing activity characteristic of the donor antibody.
  • An example of a donor antibody suitable for use in this invention is bovine mAb B4 or B13/14.
  • acceptor antibody refers to an antibody (polyclonal, monoclonal, or recombinant) heterologous to the donor antibody, but homologous to the patient (human or animal) to be treated, which contributes all or a substantial portion of the nucleic acid sequences encoding its variable heavy and/or light chain framework regions and/or its heavy and/or light chain constant regions to a second fusion partner.
  • a human antibody is an acceptor antibody.
  • CDRs are defined as the complementarity determining region amino acid sequences of an antibody which are the hypervariable regions of immunoglobulin heavy and light chains which provide the majority of contact residues for the binding of the antibody to the antigen or epitope.
  • CDRs of interest in this invention are derived from donor antibody variable heavy and light chain sequences, and include functional fragments and analogs of the naturally occurring CDRs, which fragments and analogs also share or retain the same antigen binding specificity and/or neutralizing ability as the donor antibody from which they were derived. See, e.g., the CDRs indicated by boxes in Figs. 3A, 3B, 4A, 4B, and 10 through 13.
  • mAb B13/B14 may be characterized by a certain level of antigen affinity, and a CDR encoded by a nucleic acid sequence of B13/B14 in an appropriate structural environment may have a lower affinity, it is expected that CDRs of B13/B14 in such environments will nevertheless recognize the same epitope(s) as B13/B14.
  • a “functional fragment” is a partial CDR sequence or partial heavy or light chain variable sequence which retains the same antigen binding specificity and/or neutralizing ability as the antibody from which the fragment was derived.
  • an “analog” is an amino acid or peptide sequence modified by replacement of at least one amino acid, modification or chemical substitution of an amino acid, which modification permits the amino acid sequence to retain the biological characteristics, e.g., antigen specificity, of the unmodified sequence.
  • An "allelic variation or modification” is an alteration in the nucleic acid sequence encoding the amino acid or peptide sequences of the invention. Such variations or modifications may be due to degeneracies in the genetic code or may be deliberately engineered to provide desired characteristics. These variations or modifications may or may not result in alterations in any encoded amino acid sequence.
  • an "altered antibody” describes a type of fusion protein, i.e., a synthetic antibody (e.g., a chimeric or humanized antibody) in which a portion of the light and/or heavy chain variable domains of a selected acceptor antibody are replaced by analogous parts of CDRs from one or more donor mAbs which have specificity for the selected epitope.
  • a synthetic antibody e.g., a chimeric or humanized antibody
  • CDRs e.g., a chimeric or humanized antibody
  • These altered antibodies may also be characterized by minimal alteration of the nucleic acid sequences encoding the acceptor mAb light and/or heavy variable domain framework regions in order to retain donor mAb binding specificity.
  • These antibodies can comprise immunoglobulin (Ig) constant regions and variable framework regions from the acceptor mAb, and one or more CDRs from the anti-RSV donor antibodies described herein.
  • a “chimeric antibody” refers to a type of altered antibody which contains naturally-occurring variable region light chain and heavy chains (both CDR and framework regions) derived from a non-human donor antibody in association with light and heavy chain constant regions derived from a human acceptor antibody.
  • a “humanized antibody” refers to an altered antibody having its CDRs and/or other portions of its light and/or heavy variable domain framework regions derived from a non- human donor immunoglobulin, the remaining immunoglobulin- derived parts of the molecule being derived from one or more human immunoglobulins.
  • Such antibodies can also include altered antibodies characterized by a humanized heavy chain associated with a donor or acceptor unmodified light chain or a chimeric light chain, or vice versa.
  • effector agents refers to non-protein carrier molecules to which the fusion proteins, and/or natural or synthetic light or heavy chain of the donor antibody or other fragments of the donor antibody may be associated by conventional means.
  • non-protein carriers can include conventional carriers used in the diagnostic field, e.g., polystyrene or other plastic beads, or other non-protein substances useful in the medical field and safe for administration to humans and animals.
  • Other effector agents may include a macrocycle, for chelating a heavy metal atom, or a toxin, such as ricin. Such effector agents are useful to increase the half-life of the anti-RSV derived amino acid sequences.
  • a non-human species may be employed to generate a desirable immunoglobulin upon presentment with the respiratory syncytial virus (RSV) F protein or a peptide epitope therefrom.
  • RSV respiratory syncytial virus
  • Conventional hybridoma techniques are employed to provide a hybridoma cell line secreting a non-human mAb to the RSV peptide.
  • FI neutralizing, fusion-inhibiting
  • mAbs highly protective bovine and murine anti-RSV monoclonal antibodies
  • bovine antibodies capable of binding to the F protein, B13 and B14, and other suitable bovine mAbs designated herein as B4, B7 through BIO, and murine mAbs, designated herein as 16 through 21, are described in detail in Examples 1 and 2, and in Figs. 5 and 6.
  • B13 and B14 anti-RSV antibodies are characterized by the ability to neutralize RSV in a plaque reduction neutralization test. Both B13 and B14 are potent in fusion inhibition assays and are protective in mice. Competition studies, together with studies of antibody- escape mutants, binding to F protein fragments and synthetic peptides suggest that the epitope recognized by mAbs B13 and B14 may be similar to, but not identical to, the epitope recognized by mAb RSV19 (also known as mAb 19 or RSMU19) , the IgG 2a murine mAb specific for F protein amino acid 417- 438 of and described in Example 11 below and in PCT patent application No. PCT/GB91/01554.
  • B13 and B14 have been determined to be substantially identical are referred to as a single mAb called B13/B14 in certain instances. Where the mAbs were tested separately, reference is made to mAb B13 or B14.
  • bovine mAb B4 a previously disclosed anti-RSV mAb, B4 is effective in protecting calves against infection with bovine RSV, as well as protecting mice against infection with human RSV.
  • B4 is also potent in fusion inhibition and virus neutralization assays (Examples 16 and 17) .
  • These three bovine mAbs B4, B13, and B1 have been identified as desirable antibodies which may be altered for pharmaceutical or prophylactic use.
  • this invention is not limited to the use of these three mAbs or their hypervariable sequences.
  • These mAbs illustrate the products and methods of this invention; wherever in the following description the donor mAb is identified as B4, B13 or B14, it should be understood that any other appropriate anti-RSV neutralizing antibodies and corresponding anti-RSV CDRs may be substituted therefor.
  • anti-RSV antibodies may be developed by screening an antibody library including hybridoma products or libraries derived from any species immunoglobulin repertoires in a conventional competition assay, such as described in the examples below, with one or more bovine antibodies or RSV epitopes described herein. Particularly desirable for screening for additional antibodies are the neutralizing and protective mAbs, B4 and B13/B14.
  • the invention may provide an antibody, other than B4 or B13/14, which is capable of binding to the RSV peptide spanning amino acid #266 through #273, ITNDQKKL, of the F protein [SEQ ID NO: 19] or other relevant RSV epitopes.
  • This antibody may be a mAb or an altered antibody, an analog of such antibodies, a Fab fragment thereof, or an F(ab') 2 fragment thereof.
  • Such other mAbs generated against a desired RSV epitope a'nd produced by conventional techniques include without limitation, genes encoding murine mAbs, human mAbs, and combinatorial antibodies.
  • These anti-RSV antibodies may be useful in pharmaceutical and therapeutic compositions for treating RSV in humans and other animals.
  • anti-RSV antibodies described above may be useful as donors of desirable functional fragments, including the antibody light and heavy chain variable sequences and CDR peptides.
  • the present invention also includes the use of Fab fragments or F(ab*) 2 fragments derived from mAbs directed against an epitope of RSV as agents protective in vivo against RSV infection and disease.
  • a Fab fragment is the amino terminal half of the heavy chain and one light chain
  • an F(ab') 2 fragment is the fragment formed by two Fab fragments bound by disulfide bonds.
  • MAb B13/14 or other suitable RSV binding antibodies provide a source of these fragments, which can be obtained by conventional means, e.g., cleavage of the mAb with the appropriate proteolytic enzymes, papain and/or pepsin.
  • the above-described mAbs recognize certain protective epitopes on the fusion (F) protein of RSV which are recognized by a natural host of RSV.
  • the nucleotide sequence of the F mRNA and the predicted protein sequence of the F protein [SEQ ID NO: 19] have been previously reported in Collins et al . , Proc. Nat.'1. A ⁇ ari. Sr._ . TTS ⁇ r 11:7683-7687 (1984) .
  • the amino acid numbering referred to herein is identical to the numbering in this latter reference.
  • the inventors identified an eight amino acid sequence spanning amino acids 266 through 273 of the F protein [SEQ ID NO:
  • epitopes of interest include epitopes at around amino acid #429 which are recognized by neutralizing antibodies, B13 and B14.
  • Examples 7 and 8 synthesis of peptides with sequences containing the amino acids changed in the escape mutants and the assessment of the reactivity of these peptides with the mAbs.
  • Sequence analysis of the F protein [SEQ ID NO: 19] of the antibody-escape mutants permits identification of the amino acid residues important in the binding of the highly protective mAbs. Similarly, information on the binding of the protective mAbs to synthetic peptides permits the location of the epitopes that they recognize.
  • bovine mAbs recognized epitopes similar ' to those recognized by the murine mAbs, and one of the protective antigenic areas (site B; site II of
  • Fig. 8 is recognized both by cattle, which are a natural host for RSV, and mice.
  • the epitope(s) recognized by the protective bovine mAbs B13 and B14 do not appear to be identical to any recognized by murine mAbs.
  • B13 and B14 bind to a region of the F protein around amino acid 429.
  • mAb B13/B14 does not recognize the peptides spanning F protein amino acids #417-438, #417-432, and #422-438 all of SEQ ID NO: 19, which are recognized by mAb RSV19.
  • a second antigenic site is not recognized by mAb RSV19.
  • the RSV epitope recognized by B4 is reproduced by the RSV F peptide at the amino acid sequence spanning #255-275 of SEQ ID NO: 19.
  • the inventors have determined using the Geysen pepscan technique, that B4 recognizes an epitope spanning amino acid 266 to 273 of the F protein [SEQ ID NO: 19] .
  • Altered antibodies directed against functional fragments or analogs of this epitope may be designed to elicit enhanced binding with the same antibody.
  • mAbs which are directed against this epitope have been shown to protect mice and/or bovines from in vivo RSV infection.
  • epitopes of these antibodies are useful in the screening and development of additional anti-RSV antibodies as described above. Knowledge of these epitopes enables one of skill in the art to define synthetic peptides and identify naturally-occurring peptides which would be suitable as vaccines against RSV and to produce mAbs useful in the treatment, therapeutic and/or prophylactic, of RSV infection in humans or other animals. IV.
  • the mAbs B4 and B13/14 or other anti-RSV murine, human and bovine, antibodies described herein may donate desirable nucleic acid sequences encoding variable heavy and/or light chain amino acid sequences and CDRs, functional fragments, and analogs thereof useful in the development of the first fusion partners, fusion molecules and resulting expressed fusion proteins according to this invention, including chimeric and humanized antibodies.
  • the present invention provides isolated naturally- occurring or synthetic variable light chain and variable heavy chain sequences derived from the anti-RSV antibodies, which are characterized by the antigen binding specificity of the donor antibody.
  • Exemplary nucleotide sequences of interest include the heavy and light chain variable chain sequences of the mAbs B4, B13 and B14, as described below in the examples. Based on this variable region sequence data, B13 and B14 appear to be substantially identical.
  • the naturally occurring variable light chain of B13/14 is characterized by the amino acid sequence of Figs. 3A and 3B [SEQ ID NO: 2] labelled B13/B14VL.
  • the naturally- occurring variable heavy chain of B13/14 is characterized by the amino acid sequence illustrated in Figs. 4A and 4B [SEQ ID NO: 4] labelled B13VH. These heavy and light chains are described in Example 18.
  • the amino acid sequences of the B4VL and VH chains are reported in Figs. 4A and 4B [SEQ ID NO: 4] and 3A and 3B [SEQ ID NO: 2], respectively, with the putative CDR peptides boxed.
  • the CDR3 peptides are unusually long, having 25 and 21 amino acids, respectively, in contrast to the vast majority of human and rodent CDR3s which have less than 20 amino acids.
  • nucleic acid sequences encoding the variable heavy and/or light chains, CDRs or functional fragments thereof. are used in unmodified form or are synthesized to introduce desirable modifications. These sequences may optionally contain restriction sites to facilitate their insertion or ligation to a second fusion partner, e.g., a suitable nucleic acid sequence encoding a suitable antibody framework region or the second fusion partners defined above.
  • VH and VL chain amino acid sequences and CDR sequences (e.g., Figs. 3A, 3B, 4A, 4B, and 10 through 13) and functional fragments and analogs thereof which share the antigen specificity of the donor antibody.
  • these isolated or synthetic nucleic acid sequences, or fragments thereof are first fusion partners, which, when operatively combined with a second fusion partner, can be used to produce the fusion molecules and the expressed fusion proteins, including altered antibodies of this invention.
  • These nucleotide sequences are also useful for mutagenic insertion of specific changes within the nucleic acid sequences encoding the CDRs or framework regions, and for incorporation of the resulting modified or nucleic acid sequence into a vector for expression.
  • a fusion molecule may contain as a first fusion partner a nucleotide sequence from an anti-RSV donor mAb, fragment or analog which sequence encodes an amino acid sequence for the naturally occurring or synthetic VH or VL chain sequences, a functional fragment or an analog thereof.
  • the first fusion partner is operatively linked to a second fusion partner, the resulting fusion molecule and expressed fusion protein is characterized by desirable therapeutic or prophylactic characteristics.
  • the fusion molecule upon expression, can produce a fusion protein which is an altered antibody, a chimeric, humanized or partially humanized antibody. Altered antibodies directed against functional fragments or analogs of RSV may be designed to elicit enhanced binding in comparison to the donor antibody.
  • An exemplary fusion molecule may contain a synthetic VH and/or VL chain nucleotide sequence from the donor mAb encoding a peptide or protein having the antigen specificity of mAb B4 or B13/14. Still another desirable fusion molecule may contain a nucleotide sequence encoding the amino acid sequence containing at least one, and preferably all of the CDRs of the VH and/or VL chains of the bovine mAbs B4 or B13/14 or a functional fragment or analog thereof.
  • the second fusion partners with which the anti-RSV sequences first fusion partners are associated in the fusion molecule are defined in detail above.
  • the resulting fusion molecule may express both anti-RSV antigen specificity and the characteristic of the second fusion partner.
  • Typical characteristics of second fusion partners can be, e.g., a functional characteristic such as secretion from a recombinant host, or a therapeutic characteristic if the fusion partner is itself a therapeutic protein, or additional antigenic characteristics, if the second fusion partner has its own antigen specificity.
  • the second fusion partner is derived from another antibody, e.g., any isotype or class of immunoglobulin framework or constant region (preferably human) , or the like
  • the resulting fusion molecule of this invention provides, upon expression, an altered antibody.
  • a fusion molecule which on expression produces an altered antibody can comprise a nucleotide sequence encoding a complete antibody molecule, having full length heavy and light chains, or any fragment thereof, such as the Fab or F(ab') 2 fragment, a light chain or heavy chain dimer, or any minimal recombinant fragment thereof such as an F v or a single-chain antibody (SCA) or any other molecule with the same specificity as the donor mAb.
  • SCA single-chain antibody
  • a fusion molecule which on expression produces an altered antibody may contain a nucleic acid sequence encoding an amino acid sequence having the antigen specificity of an anti-RSV antibody directed against the F protein amino acid sequence spanning amino acid #266 through #273 of SEQ ID NO: 19, ITNDQKKL and analogs thereof, operatively linked to a selected second fusion partner.
  • Analogs of that epitope include those identified in the examples, such as SEQ ID NO: 56 when amino acid #266 is replaced with Ala, Cys, Asp, Glu, Phe, Gly, His, Leu, Pro, Gin, Arg, Ser, Thr, Val, Trp, and Tyr; or SEQ ID NO: 57 when amino acid #269 is replaced with Glu, Phe, lie, Leu, Met, Arg, Ser, Thr, Val, Trp, and Tyr; or SEQ ID NO: 58 when amino acid #271 is replaced with Asp, Glu, Phe, lie, Leu, Met, Arg, Ser, Thr, Val, Trp, Tyr and Gin; or SEQ ID NO: 59 when amino acid #273 is replaced with Ala, Cys, Asp and Glu.
  • the source of the nucleic acid sequences is mAb B4.
  • Another fusion molecule which on expression produces an altered antibody may contain a nucleic acid sequence encoding the variable heavy chain sequence of Figs. 4A and 4B, a functional fragment or analog thereof, the variable light chain sequence of Figs. 3A and 3B, a functional fragment or analog thereof, or one or more B4 CDR peptides.
  • Another exemplary fusion molecule may contain a nucleic acid sequence encoding an amino acid sequence having the antigen specificity of the anti-RSV antibody B13/B14, operatively linked to a selected second fusion partner.
  • the nucleic acid sequence may encode the VH chain sequence of Figs. 4A and 4B [SEQ ID NO: 4], a functional fragment or analog thereof, the VL chain sequence of Figs.
  • 3A and 3B [SEQ ID NO: 2], a functional fragment or analog thereof, or one ' or more B13/B14 CDR peptides.
  • the antibody contains at least fragments of the VH and/or VL domains of an acceptor mAb which have been replaced by analogous parts of the variable light and/or heavy chains from one or more donor monoclonal antibodies.
  • These altered antibodies can comprise immunoglobulin (Ig) constant regions and variable framework regions from one source, e.g., the acceptor antibody, and one or more CDRs from the donor antibody, e.g., the anti-RSV antibodies described herein.
  • An altered antibody may be further modified by changes in variable domain amino acids without necessarily affecting the specificity of the donor antibody. It is anticipated that heavy and light chain amino acids (e.g., as many as 25% thereof) may be substituted by other amino acids either in the variable domain frameworks or CDRs or both. Such altered antibodies may or may not also include minimal alteration of the acceptor mAb VH and/or VL domain framework region in order to retain donor mAb binding specificity.
  • these altered antibodies may also be characterized by minimal alteration, e.g., deletions, substitutions, or additions, of the acceptor mAb VL and/or VH domain framework region at the nucleic acid or amino acid levels may be made in order to retain donor antibody antigen binding specificity.
  • Such altered antibodies are designed to employ one or both of the VH or VL chains of a selected anti-RSV mAb (optionally modified as described) or one or more of the above identified heavy and/or light chain CDR amino acid and encoding nucleic acid sequences.
  • an altered antibody may be produced by expression of a fusion molecule containing a synthetic nucleic acid sequence encoding three CDRs of the VL chain region of the selected anti-RSV antibody or a functional fragment thereof in place of at least a part of the nucleic acid sequence encoding the
  • a suitable acceptor antibody for supplying nucleic acid sequences as second fusion partners, may be a human (or other animal) antibody selected from a conventional database, e.g., the Kabat database, Los Alamos database, and
  • the acceptor antibody is selected from human IgG subtypes, such as IgGi or IgG 2 , although other Ig types may also be employed, e.g., IgM and IgA.
  • a human antibody characterized by a homology to the framework regions of the donor antibody (on an amino acid basis) may be suitable to provide a heavy chain constant region and/or a heavy chain variable framework region for the insertion of the donor
  • acceptor antibody capable of donating light chain constant or variable framework regions may be selected in a similar manner. It should be noted that the acceptor antibody heavy and light chains are not required to originate from the same acceptor antibody.
  • the acceptor antibody need not contribute only human immunoglobulin nucleotide sequences to the desired fusion molecule, and resulting expressed fusion protein.
  • a fusion molecule may be constructed in which a DNA sequence encoding part of a human immunoglobulin chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule.
  • a bovine or another species' immunoglobulin may be used, e.g., to create a 'bovinized' or other species' altered antibody.
  • a particularly desirable fusion protein is a humanized antibody.
  • humanized antibody refers to a molecule having its CDR regions and/or other portions of its VL and/or VH domain framework regions derived from an immunoglobulin from a non- human species, the remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin.
  • these humanized antibodies one, two or preferably three CDRs from the anti-RSV antibody VH and/or VL regions are inserted into the framework regions of a selected human antibody, replacing the native CDRs of that latter antibody.
  • the variable domains in both human heavy and light chains have been altered by one or more CDR replacements.
  • Such altered antibodies according to this invention include a humanized antibody containing the framework regions of a human IgG subtype into which are inserted one or more of the CDR regions of a bovine antibody.
  • Such a humanized antibody can contain the VH CDR peptides of the bovine mAb inserted into the heavy chain framework region of a human antibody and in association with the bovine light chain, or a bovine/human chimeric light chain.
  • a humanized antibody is described in Example 20.
  • such an altered antibody may be associated with a desired human light chain.
  • a chimeric antibody can contain the human heavy chain constant regions (preferably IgG) fused to the anti-RSV antibody, preferably bovine mAb, Fab regions.
  • An exemplary chimeric antibody is described in Example 19.
  • the altered antibody preferably has the structure of a natural antibody or a fragment thereof and possesses the combination of properties required for effective prevention and treatment of a desired condition in animals or man depending on the antigenicity supplied by the donor antibody.
  • the altered humanized antibody thus preferably has the structure of a natural human antibody or a fragment thereof, and possesses the combination of properties required for effective therapeutic use.
  • Such "humanized" antibodies are effective in the prevention and treatment of RSV infection in an appropriate animal model for RSV infection in humans, and recognize a large variety of human clinical isolates of RSV.
  • nucleic acids encoding the bovine mAbs B4, B13 and B14 provide desirable RSV epitope specific donor sequences (first fusion partners) for the construction of a fusion molecule, which upon expression produces a humanized antibody according to this invention which can elicit a minimal immune response in humans. See, for example, the variable heavy and light chain sequences of Figs. 4A, 4B,
  • a fusion protein which is a chimeric antibody, as defined above, differs from the humanized antibodies by providing the entire non-human donor antibody heavy chain and light chain variable regions, including framework regions in association with human (or other heterologous animal, where desired) IgG constant regions for both chains.
  • chimeric antibodies which retain additional non-human sequence in comparison to humanized antibodies of this invention, may also prove likely to elicit some desirable immune response in the human.
  • a preferred altered antibody is one directed against respiratory syncytial virus (RSV) , preferably one specific for the fusion (F) protein of RSV.
  • RSV respiratory syncytial virus
  • F fusion protein of RSV.
  • a particularly preferred antibody of this kind has all or a portion of the variable domain amino acid sequences of B4 or B13/B14 reported in
  • Figs. 3A, 3B, 4A and 4B in its light and heavy chains, respectively.
  • Figs. 10 through 13 illustrate predicted amino acid regions suitable for use in a "humanized" antibody and are described in the Brief Description of the
  • an altered antibody of this invention may be characterized by the presence of one or more of the CDR peptides identified in the above figures.
  • an altered antibody may contain a the
  • the resulting humanized antibody is characterized by the antigen binding specificity of mAb B4.
  • Still another preferred altered antibody may contain a
  • the altered antibody is thus characterized by the antigen binding specificity of mAb
  • variable sequences such as the B4 CDR peptides, including:
  • SYSVS amino acids 31-35 of SEQ ID NO: 3 ;
  • DASNGGII YNPALKS amino acids 50-65 of SEQ ID NO: 3 ;
  • CSVGDSGSYACTXaaGXaaRKGEYVDA wherein Xaa is any or no amino acid (amino acids 100-122 of SEQ ID NO: 3); SGSS(S or D)NIG(R or I) (W or F) (G or A)V(N or G) (amino acids 22-34 of SEQ ID NO: 1) ;
  • YESSRPS amino acids 50-56 of SEQ ID NO: 1 ;
  • ATGDYNIA amino acids 89-96 of SEQ ID NO: 1 ;
  • ATGDYNIAV amino acids 89-97 of SEQ ID NO: 1 ; or the B13/B14 CDR peptides, including
  • GNTKRPS amino acids 50-56 of SEQ ID NO: 2 ;
  • VCGESKSATPV amino acids 89-99 of SEQ ID NO: 2
  • DHNVG amino acids 31-35 of SEQ ID NO: 4 ;
  • VIYKEGDKDYNPALKS (amino acids 50-65 of SEQ ID NO: 4) ; LGCYPVEGVGYDCTYGLQHTTFXaaDA, wherein Xaa is any amino acid (amino acids 98-122 of SEQ ID NO: 4), may be used in place of the larger variable region sequences of the figures.
  • Such altered antibodies can be effective in prevention and treatment of respiratory syncytial virus (RSV) infection in animals and man.
  • RSV respiratory syncytial virus
  • Another species of therapeutic, diagnostic or pharmaceutical protein of this invention is provided by the proteins or peptides encoded by the first fusion partner which are associated with above-described effector agents.
  • Such a protein provides an anti-RSV amino acid sequence of the invention associated with a non- protein carrier molecule.
  • Another example contains a desired anti-RSV sequence of the invention to which is attached an non-protein reporter molecule.
  • the entire fusion proteins described above may be associated with an effector agent.
  • the procedure of recombinant DNA technology may be used to produce a protein of the invention in which the F c fragment or CH3 domain of a complete anti-RSV antibody molecule has been replaced by an enzyme or toxin molecule.
  • Another example of a protein of this invention contains an anti-RSV amino acid sequence of the invention with a macrocycle, for chelating a heavy metal atom, or a toxin, such as ricin, attached to it by a covalent bridging structure.
  • fusion or linkage between the anti-RSV antibody nucleotide sequences sequences and the second fusion partner in the fusion molecule or association of the peptides encoded by the first fusion partner and an effector agent may be by way of any suitable conventional means.
  • Such conventional means can include conventional covalent or ionic bonds, protein fusions, or hetero-bifunctional cross- linkers, e.g., carbodiimide, glutaraldehyde, and the like.
  • conventional chemical linking agents may be used to fuse or join to the anti-RSV amino acid sequences.
  • the fusion proteins and altered antibodies of the invention will be produced by recombinant DNA technology using genetic engineering techniques.
  • the same or similar techniques may also be employed to generate other embodiments of this invention, e.g., to construct the chimeric or humanized antibodies, the synthetic light and heavy chains, the CDRs, and the nucleic acid sequences encoding them, as above mentioned.
  • a hybridoma producing the anti-RSV antibody e.g., the bovine mAb B4
  • the cDNA of its heavy and light chain variable regions obtained by techniques known to one of skill in the art, e.g., the techniques described in Sambrook et al., Molecular r.lonin ⁇ (A Laboratory Manual ) f 2nd edition, Cold Spring Harbor Laboratory (1989) .
  • the variable regions of the mAb B4 are obtained using PCR primers, and the CDRs identified using a known computer database, e.g, Kabat, for comparison to other antibodies.
  • Homologous framework regions of a heavy chain variable region from a human antibody are identified using the same databases, e.g., "Kabat, and a human (or other desired animal) antibody having homology to the anti-RSV donor antibody is selected as the acceptor antibody.
  • the sequences of synthetic VH regions containing the CDRs within the human antibody frameworks are defined in writing with optional nucleotide replacements in the framework regions for restriction sites. This plotted sequence is then synthesized by overlapping oligonucleotides, amplified by polymerase chain reaction (PCR) , and corrected for errors.
  • a suitable light chain variable framework region may be designed in a similar manner or selected from the donor or acceptor antibodies. As stated above, the source of the light chain is not a limiting factor of this invention.
  • CDRs of the anti-RSV mAbs and their encoding nucleic acid sequences are employed in the construction of fusion proteins and altered antibodies, preferably humanized antibodies, of this invention, by the following process.
  • a DNA sequence is obtained which encodes the non-human donor antibody (e.g., B4, B13/B14) VH or VL chain regions.
  • the non-human donor antibody e.g., B4, B13/B14
  • VH or VL chain regions encodes the non-human donor antibody (e.g., B4, B13/B14) VH or VL chain regions.
  • a donor antibody at least the CDRs and those minimal portions of the acceptor mAb light and/or heavy variable domain framework region required in order to retain donor mAb binding specificity as well as the remaining immunoglobulin-derived parts of the antibody chain are derived from a human immunoglobulin.
  • a first conventional expression vector is produced by placing these sequences in operative association with conventional regulatory control sequences capable of controlling the replication and expression thereof in a host cell.
  • a second expression vector is produced having a DNA sequence which encodes the complementary antibody light or heavy chain, wherein at least the CDRs (and those minimal portions of the acceptor monoclonal antibody light and/or heavy variable domain framework region required in order to retain donor monoclonal antibody binding specificity) of the variable domain are derived from a non-human immunoglobulin.
  • this second vector expression vector is identical to the first except in so far as the coding sequences and selectable markers are concerned so to ensure as far as possible that each polypeptide chain is equally expressed.
  • a single vector of the invention may be used, the vector including the sequence encoding both light chain and heavy chain-derived polypeptides.
  • the DNA in the coding sequences for the light and heavy chains may comprise cDNA or genomic DNA or both.
  • a selected host cell is co-transfected by conventional techniques with both the first and second vectors to create the transfected host cell of the invention comprising both the recombinant or synthetic light and heavy chains.
  • the transfected cell is then cultured by conventional techniques to produce the altered or humanized antibody of the invention.
  • the humanized antibody which includes the association of both the recombinant heavy chain and/or light chain is screened from culture by appropriate assay, such as an ELISA assay. Similar conventional techniques may be employed to construct other fusion molecules of this invention.
  • the invention also includes a recombinant plasmid containing a fusion molecule, which upon expression produces an altered antibody of the invention.
  • Such a vector is prepared by conventional techniques and suitably comprises the above described DNA sequences encoding the altered antibody and a suitable promoter operatively linked thereto.
  • the invention includes a recombinant plasmid containing the coding sequence of a mAb generated against the F protein
  • Suitable vectors for the cloning and subcloning steps employed in the methods and construction of the compositions of this invention may be selected by one of skill in the art.
  • any vector which is capable of replicating readily, has an abundance of cloning sites and marker genes, and is easily manipulated may be used for cloning.
  • the selection of the cloning vector is not a limiting factor in this invention.
  • the vectors employed for expression of the altered antibodies according to this invention may be selected by one of skill in the art from any conventional vector.
  • the expression vectors also contain selected regulatory sequences which are in operative association with the DNA coding sequences of the immunoglobulin regions and capable of directing the replication and expression of heterologous DNA sequences in selected host cells, such as
  • CMV promoters contain the above described DNA sequences which code for the altered antibody or fusion protein.
  • the vectors may incorporate the selected immunoglobulin sequences modified by the insertion of desirable restriction sites for ready manipulation.
  • the expression vectors may also be characterized by marker genes suitable for amplifying expression of the heterologous DNA sequences, e.g., the mammalian dihydrofolate reductase gene (DHFR) or neomycin resistance gene (neo R ) .
  • marker genes suitable for amplifying expression of the heterologous DNA sequences e.g., the mammalian dihydrofolate reductase gene (DHFR) or neomycin resistance gene (neo R ) .
  • Other preferable vector sequences include a poly A signal sequence, such as from bovine growth hormone (BGH) and the betaglobin promoter sequence (betaglupro) .
  • replicons e.g. replicons, selection genes, enhancers, promoters, and the like
  • selection genes e.g. replicons, selection genes, enhancers, promoters, and the like
  • Other appropriate expression vectors of which numerous types are known in the art for mammalian, bacterial, insect, yeast, and fungal expression may also be selected for this purpose.
  • Such a vector is transfected into a mammalian cell or other suitable cell lines via conventional techniques.
  • the present invention also encompasses a cell-line transfected with these described recombinant plasmids.
  • the host cell used to express the altered antibody or molecule is preferably a eukaryotic cell, most preferably a mammalian cell, such as a CHO cell or a myeloid cell.
  • Other primate cells may be used as host cells, including human cells which enable the molecule to be modified with human glycosylation patterns.
  • suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production and purification are known in the art. See, e.g., Sambrook et al . , cited above.
  • Bacterial cells may prove useful as host cells suitable for the expression of the recombinant mAbs of the present invention.
  • any recombinant mAb produced in a bacterial cell would have to be screened for retention of antigen binding ability.
  • Streptomyces other bacilli and the like may also be employed in this method.
  • strains of yeast cells known to those skilled in the art are also available as host cells, as well as insect cells and viral expression systems. See, e.g.
  • the vectors of the invention may be constructed, transfection methods required to produce the host cells of the invention, and culture methods necessary to produce the fusion protein or altered antibody of the invention from such host cell are all conventional.
  • the fusion proteins or altered antibodies of the invention may be purified from the cell culture contents according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like. Such techniques are within the skill of the art and do not limit this invention.
  • a method of expression of the humanized antibodies may utilize expression in a transgenic animal.
  • a method of expression of the humanized antibodies of the invention may be by expression in the milk of a female transgenic animal, such as described in U.S.
  • a DNA sequence for a selected humanized antibody of the invention may be operatively linked in an expression system to a milk-specific protein promoter, or any promoter sequence specifically activated in mammary tissue, through a DNA sequence coding for a signal peptide that permits secretion (and maturation, if necessary) of the desired protein in the mammary tissue.
  • Suitable promoters and signal peptides may be readily selected by one of skill in the art.
  • the expression system is transgenically introduced into a host genome using standard transgenic techniques, for example by microinjection into the pronuclei of fertilized mammalian eggs. See, e.g. B. Hogan et al, "Manipulating The
  • one or more copies of the construct or system are incorporated into the genome of the transgenic mammal.
  • the presence of the expression system permits the female of the mammalian species to produce and secrete the recombinant humanized antibody into its milk. This system allows for high level production of the humanized antibodies of the invention.
  • This latter method of expression may be particularly suitable for a humanized antibody containing bovine CDRs, and especially suitable for the oral administration of this antibody to bovines as well as human infants.
  • Other transgenic systems may also be employed.
  • the altered antibody is then examined for in vitro activity by use of an appropriate assay.
  • an appropriate assay Presently, conventional enzyme linked immunosorbent assay (ELISA) formats are employed to assess qualitative and quantitative binding of the altered antibody to the RSV epitope (see Example 3) .
  • ELISA enzyme linked immunosorbent assay
  • Other assays may also be used to verify efficacy prior to subsequent human clinical studies performed to evaluate the persistence of the altered antibody in the body despite the usual clearance mechanisms.
  • Example 11 below demonstrates the method of constructing the altered humanized antibodies derived from the murine monoclonal antibody RSV19, such as HuRSV19VH/VK and HuRSV19VHFNS/HuRSV19VK which are described in copending PCT patent application No. PCT/GB91/01554.
  • RSV19 monoclonal antibody
  • HuRSV19VH/VK HuRSV19VHFNS/HuRSV19VK
  • Such altered antibodies can effectively prevent and eradicate infection.
  • humanized antibodies are the antibodies B4, B13 and B14 described herein. Such antibodies are useful in treating, therapeutically or prophylactically, a human against human RSV infection. Such antibodies may also be useful as diagnostic agents. VII. Therapeutic/Prophylactic Uses of the Invention
  • This invention also relates to a method of treating, therapeutically or prophylactically, human RSV infection in a human in need thereof which comprises administering an effective, human RSV infection-treating dose of antibodies including one or more of the mAbs described herein, or fragments thereof, or an altered antibody as described herein, or another fusion protein, to such human.
  • This invention also relates to a method of treating, therapeutically or prophylactically, bovine or other species' RSV infection in a bovine or other animal in need thereof which comprises administering an effective, RSV infection-treating dose of antibodies or molecules including one or more of the mAbs described herein, or fragments thereof, or an altered antibody as described herein, to such animal.
  • fusion proteins, antibodies, altered antibodies or fragments thereof of this invention may also be used in conjunction with other antibodies, particularly human monoclonal antibodies reactive with other markers (epitopes) responsible for the disease against which the altered antibody of the invention is directed.
  • monoclonal antibodies reactive with other markers (epitopes) responsible for the disease in a selected animal against which the antibody of the invention is directed may also be employed in veterinary compositions.
  • fusion proteins or fragments thereof described by this invention may also be used as separately administered compositions given in conjunction with chemotherapeutic or immunosuppressive agents.
  • chemotherapeutic or immunosuppressive agents The appropriate combination of agents to utilized can readily be determined by one of skill in the art using conventional techniques.
  • the altered antibody HuRSV19VHFNS/HuRSV19VK described in Example 11, or a similarly altered 34, B13 or B14 antibody may be given in conjunction with the antiviral agent ribavirin in order to facilitate the treatment of RSV infection in a human.
  • One pharmaceutical composition of the present invention comprises the use of the antibodies of the subject invention in immunotoxins, i.e., molecules which are characterized by two components and are particularly useful for killing selected cells in vitro or in vivo.
  • immunotoxins i.e., molecules which are characterized by two components and are particularly useful for killing selected cells in vitro or in vivo.
  • One component is a cytotoxic agent which is usually fatal to a cell when attached or absorbed.
  • the second component known as the
  • delivery vehicle provides a means for delivering the toxic agent to a particular cell type, such as cells comprising a carcinoma.
  • the two components are commonly chemically bonded together by any of a variety of well-known chemical procedures.
  • the linkage may be by way of heterobifunctional cross-linkers, e.g., carbodiimide, glutaraldehyde, and the like. Production of various immunotoxins is well-known in the art.
  • cytotoxic agents are suitable for use in immunotoxins, and may include, among others, radionuclides, chemotherapeutic drugs such as methotrexate, and cytotoxic proteins such as ribosomal inhibiting proteins (e.g., ricin) .
  • the delivery component of the immunotoxin may include one or more of the humanized immunoglobulins or bovine immunoglobulins of the present invention. Intact immunoglobulins or their binding fragments, such as Fab, are preferably used. Typically, the antibodies in the immunotoxins will be of the human IgM or IgG isotype, but other mammalian constant regions may be utilized if desired.
  • the mode of administration of the therapeutic agent of the invention may be any suitable route which delivers the agent to the host.
  • the fusion proteins, antibodies, altered antibodies, and fragments thereof, and pharmaceutical compositions of the invention are particularly useful for parenteral administration, i.e., subcutaneously, intramuscularly or intravenously.
  • the compositions for parenteral administration will commonly comprise a solution of the altered antibody of the invention or a cocktail thereof dissolved in an acceptable carrier, preferably an aqueous carrier.
  • an acceptable carrier preferably an aqueous carrier.
  • aqueous carriers may be employed, e.g., water, buffered water, 0.4% saline, 0.3% glycine, and the like. These solutions are sterile and generally free of particulate matter. These solutions may be sterilized by conventional, well known sterilization techniques.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, etc.
  • concentration of the antibody of the invention in such pharmaceutical formulation can vary widely, i.e., from less than about 0.5%, usually at or at least about 1% to as much as 15 or 20% by weight and will be selected primarily based on fluid volumes, viscosities, etc., according to the particular mode of administration selected.
  • a pharmaceutical composition of the invention for intramuscular injection could be prepared to contain 1 mL sterile buffered water, and 50 mg of an altered antibody of the invention.
  • a pharmaceutical composition of the invention for intravenous infusion could be made up to contain 250 ml of sterile Ringer's solution, and 150 mg of an altered antibody of the invention.
  • Actual methods for preparing parenterally administrable compositions are well known or will be apparent to those skilled in the art and are described in more detail in, for example. Remington's Pharmaceutical Scienc r 15th ed., Mack Publishing Company,
  • one dose of approximately 1 mg/kg to approximately 20 mg/kg of a molecule or an antibody of this invention should be administered parenterally, preferably i.v. (intravenously) or i.m. (intramuscularly) ; or one dose of approximately 20 ug/kg to approximately 2 mg/kg of such antibody should be administered i.n. (intranasally) .
  • such dose should be repeated every six (6) weeks starting at the beginning of the RSV season (October- November) until the end of the RSV season (March-April) .
  • one dose of approximately 5 mg/kg to approximately 100 mg/kg of an antibody of this invention should be administered i.v. or i.m. or one dose of approximately 0.5 mg/kg to approximately 10 mg/kg of such antibody should be administered i.n.
  • one dose of approximately 2 mg/kg to approximately 20 mg/kg of an antibody of this invention should be administered parenterally., preferably i.v. or i.m.; or approximately 200 ug/kg to approximately 2 mg/kg of such antibody should be administered i.n.
  • Such dose may, if necessary, be repeated at appropriate time intervals until the RSV infection has been eradicated.
  • the dose of B4 required to protect calves when administered by the i.t. route was 300 ⁇ g/kg body weight. This is 300 to 1000-fold less than the amount of human IgG, containing high titres of RSV- neutralizing antibody, required to reduce RSV infection in cotton-rats and owl monkeys, passively immunized by the i.t. route [Hemming and Prince, Reviews of Infectious Diseases. 12:S470-S475 (1990)]. It has been shown that about 10-fold less antibody is required to reduce virus shedding when given by the topical route when compared with intravenous administration [Prince & Hemming, (1990) ] .
  • compositions of the invention may also be administered by inhalation.
  • inhalation is meant intranasal and oral inhalation administration.
  • Appropriate dosage forms for such administration such as an aerosol formulation or a metered dose inhaler, may be prepared by conventional techniques.
  • a composition for administration by inhalation for an aerosol container with a capacity of 15-20 ml: Mix 10 mg of an • antibody of this invention with 0.2-0.2% of a lubricating agent, such as polysorbate 85 or oleic acid, and disperse such mixture in a propellant, such as freon, preferably in a combination of (1,2 dichlorotetrafluoroethane) and difluorochloromethane and put into an appropriate aerosol container adapted for either intranasal or oral inhalation administration.
  • a propellant such as freon
  • a composition for administration by inhalation for an aerosol container with a capacity of 15-20 ml: Dissolve 10 mg of an antibody of this invention in ethanol (6-8 ml), add 0.1-0.2% of a lubricating agent, such as polysorbate 85 or oleic acid; and disperse such in a propellant, such as freon, preferably a combination of (1.2 dichlorotetrafluoroethane) and difluorochloromethane, and put into an appropriate aerosol container adapted for either intranasal or oral inhalation administration.
  • a lubricating agent such as polysorbate 85 or oleic acid
  • a propellant such as freon
  • the antibodies, altered antibodies or fragments thereof described herein can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective with conventional immune globulins and art-known lyophilization and reconstitution techniques can be employed.
  • compositions of the invention can be administered for prophylactic and/or therapeutic treatments.
  • compositions are administered to a patient already suffering from a disease, in an amount sufficient to cure or at least partially arrest the disease and its complications.
  • compositions containing the present antibodies or a cocktail thereof are administered to a patient not already in a disease state to enhance the patient's resistance.
  • Single or multiple administrations of the pharmaceutical compositions can be carried out with dose levels and pattern being selected by the treating physician.
  • the pharmaceutical composition of the invention should provide a quantity of the altered antibodies of the invention sufficient to effectively treat the patient.
  • fusion proteins, antibodies, variable sequences, CDR peptides and epitopes of this invention may be used for the design and synthesis of either peptide or non-peptide compounds (mimetics) which would be useful in the same therapy as the antibody. See, e.g., Saragovi et al . , Science, 2__2.:792-795 (1991).
  • Murine monoclonal antibodies 1 to 14 were described in Taylor et al . , (1984) cited above and incorporated herein by reference. Several of these antibodies were produced by immunizing BALB/c mice with bovine RSV, strain 127. The bovine RSV, strain 127 was isolated at Compton in 1973 from a calf with respiratory disease. Others of these antibodies were produced with cells persistently infected with the Long strain of human RSV [Fernie et al . , Proc. Son. Exp. Biol. Medic. , l ⁇ 2:83-86 (1981)].
  • Murine monoclonal antibodies 16 to 21 were produced from BALB/c mice inoculated intranasally (i.n.) on two occasions, three weeks apart, with 1X10 4 pfu of the human RSV strain A2, grown in Hep-2 cells. Human RSV, strain A2, subtype A was isolated from a child in Australia [Lewis et al . , P>H . , ⁇ . Ans r. . 11: 932-933 ( 1961) ] .
  • mice were inoculated intraperitoneally (i.p.) with 2X10 7 pfu of the bovine 127 strain.
  • the immune splenocytes were fused with NS-1 myeloma cells
  • the resulting hybridomas were screened for antibody to RSV by radioimmunoassay and immunofluorescence, cloned twice on soft agar and cloned cells inoculated into BALB/c mice to produce ascitic fluid as described in Taylor et al . , cited above.
  • Bovine monoclonal antibodies Bl to B6 were produced as described in Kennedy et al . , J. Gen. Virol. , 69:3023-3032 (1988), incorporated herein by reference.
  • bovine mAbs B7 to B10, B13 and B14 were produced from bovine lymphocytes obtained from the same calf, but the lymphocytes were stored in liquid nitrogen and fused with NS1 cells at later dates.
  • the resulting heterohybridomas were screened for bovine antibody to RSV by ELISA and in some cases also by the fusion inhibition assay [essentially as described in Kennedy et al . (1988), cited above], but adapted to microtitre plates.
  • the antibody AK13A2 raised against the Long F protein was a generous gift of Dr. P. Coppe, Centre d' economies rurale, Marloie, Belgium.
  • the mAbs 1BC11 (a negative control antibody) , 47F and 49F have been described by Garcia-Barreno et al . , J. Virol . . £1:925-932 (1989).
  • the specificities of the mAbs for F protein viral polypeptides were determined by radioimmune precipitation of ( 35 S)-methionine or ( 3 H)-glucosamine labelled RSV infected cell lysates performed as described by Kennedy et al . , ___. Gen. Virol.. 11:3023-3032 (1988). The specificity was confirmed by Western blots (immunoblotting) of non-reduced and reduced RSV-infected cell lysates performed as described by Taketa et al . , Electrophor.. 1:492-497 (1985).
  • the antigens used in immunoblotting were either Hep-2 cells infected with the human RSV A2 strain or calf kidney (CK) cells infected with the bovine RSV strain 127. Uninfected Hep-2 or CK cells were used as control antigens. Only mAbs Bl, B4, B5 [Kennedy et al . , cited above] and mAbs RSV19, B13 and B14 reacted with F protein denatured by boiling in dithiothreitol. Whereas mAbs Bl, B4 and B5 recognized 46K and 22K fragments of denatured FI protein in Western blotting, mAbs RSV19, B13 and B14 only recognized 46K fragments.
  • a "+" indication means that the mAb inhibited the formation of multinucleated giant cells.
  • mice The ability of mAbs to protect against RSV infection was studied in BALB/c mice as follows. 100 ⁇ l of ascitic fluid containing the mAbs was injected intra-peritoneally into groups of five mice. One day later, the mice were inoculated i.n. with 10 4 pfu of the A2 RSV strain. On day 5 of the infection, the mice were killed and their lungs assayed for RSV on secondary CK monolayers, according to the procedure described in Taylor et al . , Infect. Immun. r
  • a "-" indication means that the mAb did not protect the immunized mice against RSV infection.
  • a “+” or “+_-+” indication means that the mAb did protect the animals to a lesser or greater degree, respectively.
  • the eight mAbs that were effective in the fusion inhibition assay i.e., murine mAbs 11, 13, RSV19 and
  • bovine mAbs B4, B5, B13, and B14 were highly effective in preventing RSV infection in BALB/c mice when administered i.p. 24 hours prior to i.n. challenge with the
  • Example 3 - Enzyme Linked I munosorhent Assay RSV antigens to be tested in the ELISA were each prepared from Hep-2 cells, 3 to 4 days after infection. Cells were scraped into medium, spun at 500 g for 5 minutes, resuspended in distilled water and treated with 0.5% (w/v) NP40 detergent to yield a cell lysate. Control antigen was made in a similar way using uninfected Hep-2 cells.
  • the ELISA was performed as follows: Microtitre plates were coated with RSV or control antigen, diluted in distilled water, overnight at 37°C, incubated with blocking buffer consisting of 5% normal pig serum in PBS and 0.05% Tween 20 for 1 hour at room temperature and washed 5x with PBS/Tween. Serial 3-fold dilutions of mAb were added to the wells and the plates incubated for 1 hour at room temperature. After washing 5x with PBS/Tween, HRP- conjugated rabbit anti-bovine IgG (Sigma) diluted 1:4000 or HRP-conjugated goat anti-mouse IgG (Kpl, Maryland, USA) diluted 1:2000, was added to each well.
  • Example 4 Purification of the F glycoprotein and trypsin treatment The F protein was purified by immunoaffinity chromatography from extracts of Hep-2 cells infected with the Long strain [See, Walsh et al . , . Gen. Virol.. 66:409- 415 (1985); and Garcia-Barreno et al . , (1989), cited above].
  • FIG. 2 shows the F glycoprotein primary structure denoting the hydrophobic regions, the site of proteolytic processing, the potential sites for N- glycosylation, the cysteine residues and the amino acid residues which are changed in the neutralization escape mutants (see Table 3A-3C below) .
  • the locations of the trypsin fragments recognized by different mAbs are shown below Fig. 2.
  • the region on the F protein recognized by mAbs B13 and B14 were identified by examining their binding to F protein fragments, expressed in E. coli.
  • Recombinant C protein (rC, F 37 _ s24 ) of SEQ ID NO: 19 and recombinant D protein (rD, F 371 _ 550 ) of SEQ ID NO: 19 were used as antigens in ELISA as described in Example 3.
  • These peptide sequences of the F protein were fused to an influenza non-structural protein fragment containing amino acids 1 - 81 of the influenza nonstructural protein 1 (NS-1) at their amino termini, inserted into an expression plasmid and expressed in E. coli .
  • the production of these fusion peptides involved conventional procedures.
  • the epitope specificity of the 16 murine and 12 bovine mAbs to the F protein were analyzed by a competitive binding assay using purified and labelled mAbs.
  • these competitive binding assays identified twelve antigenic sites on the F protein, many of which overlapped extensively.
  • Three epitopic sites were recognized by both the neutralizing mAbs and the highly protective FI mAbs, e.g., B4, B5, B13 and B14.
  • These findings are similar to those of others who have identified three antigenic sites on the F protein involved in neutralization using murine mAbs, two of which are involved in FI activity [Walsh et al . , J. Gen. Virol .. 11:505-513 (1986) and Beeler et al . , .7. Virol.. £1:2941-2950 (1989)].
  • virus neutralization can occur by a mechanism independent of preventing the fusion of the virus with the cell membrane, e.g. steric hindrance of virus attachment
  • the IgG from ascitic fluid containing either murine or bovine mAbs was purified on either Protein A- sepharose or Protein G-sepharose Fast-Flow [Pharmacia LKB] .
  • the ascitic fluids were mixed with equal volumes of 0.1M phosphate buffer (pH 8) , and passed through a Protein A- sepharose column with the same buffer.
  • Bound antibodies were eluted with 0.1 M citrate buffer (pH 6.0 to 3.5). Fractions eluted with low pH buffers were collected in IM
  • IgG from tissue culture supernatants was purified on Protein G-sepharose Fast-Flow and eluted with 0.1M glycine as described above. Purified IgG was dialyzed against PBS and labelled with 125 I using chloramine T or coupled to biotin.
  • mAbs B13 and B14 a dilution of biotinylated mAbs, determined to give 90% of maximum binding to RSV- infected cell lysate, was allowed to bind to RSV antigen in the presence of increasing amounts of unlabelled antibody.
  • An unlabelled mAb to the nucleoprotein (N) was used as a control. The results of this assay are illustrated in Figs.
  • the binding of bovine mAbs Bl and B7 were not inhibited by any of the murine mAbs and, indeed, B7 appeared to recognize a distinct epitope.
  • the epitopes recognized by 2 highly protective bovine mAbs B4 and B5 were similar to each other and to 2 of the highly protective murine mAbs, 11 and 13.
  • the binding of the protective bovine mAbs B13 and B14 was inhibited to various degrees by protective murine mAbs, RSV19 and 20, and the protective bovine mAbs B4 and B5.
  • the competition profiles of mAbs B13 and B14 were different from those antibodies mapping to sites B and C, suggesting that they recognize a different site on the F protein.
  • the murine and bovine mAbs recognized 12 antigenic areas, most of which overlapped extensively.
  • the highly protective, fusion-inhibiting (FI) neutralizing mAbs mapped to 2 or possibly 3 sites (areas B, C and L in Fig. 5) on the F protein.
  • the pattern of reactivity of antibody-escape mutants with the mAbs confirmed the mapping of the protective epitopes deduced from competitive binding assays.
  • two regions of the F primary structure were identified where the epitopes recognized by neutralizing mAbs were located.
  • the first region mapped within the trypsin resistant amino terminal third of the large FI subunit.
  • This region contained the overlapping epitopes recognized by mAbs 47F, 49F, 7C2, AK13A2, 11 and B4, included in antigenic area II (Fig. 8) and area B (Figs. 5 and 7) .
  • Antigenic areas II and B are identical.
  • Most amino acid changes found in mutants selected with these antibodies were clustered around amino acids 262-272 of SEQ ID NO: 19. Since these antibodies reacted in Western blots with proteolytic fragments of the FI subunit, it was originally thought that they recognized "linear" epitopes determined by sequences of consecutive amino acids.
  • the change at 216 is distantly located from the peptide 255-
  • the neutralization of RSV by the mAbs used to select the escape mutants is theorized to be related to their capacity to inhibit the membrane fusion of the F glycoprotein [Garcia-Barreno et al . (1989), cited above;
  • mutants altered in the fusogenic activity of the influenza virus hemagglutinin [Daniels et al . , Cell, 40:431- 439 (1985) ] have been mapped outside the fusion peptide of the HA2 subunit.
  • the escape mutants were developed and evaluated as follows.
  • the wild type and neutralization escape mutant viruses were grown in Hep-2 cells and purified from culture supernatants as previously described [Garcia-Barreno et al. ,
  • the Long and A2 strains of human RSV were plaque purified before being used to select viruses which escaped neutralization (mAb resistant mutants) by mAbs 47F, AK13A2, 7C2, 11, B4, B5, 19 or 20, and other mAbs directed against the F glycoprotein as described herein. These were selected in two different ways:
  • Antibody escape mutant viruses of the RSV A2 strain which are refractory to neutralization by one of the highly protective mAbs, 11, B4, B5, RSV19 and 20, were produced using plaque reduction techniques.
  • mAbs RSV19 For mAbs RSV19,
  • confluent monolayers of primary CK cells were infected with the A2 strain at a multiplicity of infection (MOD of 0.2. Starting 24 hours after infection and continuing for 3 to 5 days, the culture medium was replaced daily with fresh medium containing 10% mAb. Virus was harvested when a cytopathic effect (CPE) was apparent.
  • MOD multiplicity of infection
  • Virus prepared in this way was mixed with an equal volume of the mAb under test for 1 hour at room temperature and inoculated onto CK monolayers in 35 mm multi-well plates
  • Mutant viruses were plaque picked again and inoculated into tubes containing coverslips of calf testes cells or Hep-2 cells. After 4 to 6 days incubation, the coverslips were removed and stained with the mAb under test followed by FITC-labelled rabbit anti-mouse
  • each escape mutant was used as antigen in the ELISA described in Example 3 to test its reactivity with a panel of anti-F mAbs (Figs. 7 and 8) .
  • Mutant viruses selected for resistance to mAb 11 lost the capacity to bind not only mAb 11 but also mAbs 13, B4, and B5, and had reduced binding to mAb 7C2, when compared with the parent A2 strain of RSV (Fig. 7) .
  • All mutant viruses selected for resistance to either B4 or B5 lost the capacity to bind not only B4 or B5 but also 11 and 13.
  • some mutants selected with B4 e.g. C4947/5) still bound to B5 but at a greatly reduced level when compared with the A2 strain.
  • mutants selected for resistance to mAb As seen for mutants selected for resistance to mAb
  • B4 and B5 mutants showed either the same, reduced or no binding to mAb BIO when compared with the parent A2 strain.
  • escape mutants of the Long strain were isolated as previously described [Garcia-Barreno et al . (1989), cited above] . Briefly, virus stocks were enriched in mutant viruses by 4-5 consecutive passages in the presence of the selecting antibody, 47F, 7C2 or AK13A2.
  • viruses were plaque purified in antibody containing agar plates. Several viral plaques were isolated, and their resistance to antibody neutralization was confirmed. A single plaque originated from each aliquot of the virus stock was chosen for further analysis.
  • AK13A2 were included in antigenic area II previously described by Garcia-Barreno et al . (1989), cited above, based solely on their reactivity with antibody-escape mutants.
  • the epitopes recognized by mAbs RSV19 and 20 were included in antigenic area IV by the same criteria (Fig. 8) .
  • the mutations selected in the escape viruses affected only epitopes from the antigenic area which included the selective antibody. For instance, mutant 4/4 did not react with any of the antibodies grouped in area II, whereas other mutants selected with the same antibody (11/3, 4, 5 and 7) reacted with mAbs 7C2 and B4 but not with 47F, 49F or AK13A2.
  • the mutants selected with mAbs 19 or 20 did not bind the antibodies grouped in the antigenic area IV, except mAb 52F. However, in all cases the mutant viruses retained the binding of mAbs from other antigenic areas.
  • the epitopes included in antigenic area II could be distinguished by at least one of the following criteria: i) the reactivity of mAbs with escape mutants, ii) the competition of mAbs for virus binding and iii) the inhibition of virus binding by an anti-Id antiserum. Only the epitopes 47F and 49F could not be distinguished by the above criteria, but they differ in both neutralizing capacity and susceptibility to denaturing agents.
  • Example 8 Location of amino acid changes selected in neutralization escape mutants
  • the F protein mRNAs obtained from cells infected with the different viruses were sequenced as follows. Hep-2 cells were infected with the different viruses and harvested 30-40 hours post-infection, when cytopathic effect was evident by the formation of syncytia. Total RNA was isolated by the isothiocyanate-CsCl method [Chirgwin et al . , Biochem., 11:5294-5299 (1979)] and poly A+ RNA was selected by oligo dT-cellulose chromatography. These mRNA preparations were used for sequencing by the dideoxy method [Sanger et al . , Proc. Na '1. Acad. Sci... USA.
  • SEQ ID NO: 28 F1707 5'-CTCAGTTGATCCTTGCTTAG.
  • the F mRNA of viruses selected with mAbs AK13A2, AK13A2, 7C2 and B4 were sequenced between nucleotides 420 and 920, which encode the trypsin resistant fragments recognized by those antibodies (Fig. 2) .
  • the F mRNA of viruses selected with mAb 11 were sequenced only between nucleotides 893 and 906.
  • the F mRNAs of viruses selected with mAbs 19 and 20 were sequenced between nucleotides 1100 and 1680, which encode the region of the tentatively located 26 kDa trypsin resistant fragment recognized by those antibodies.
  • Table 3 illustrates sequence changes selected in different neutralization escape mutants, including two previously reported mutants selected with mAb 47F [Lopez et al . , (1990), cited above]. Only nucleotide (mRNA sense) and amino acid changes at the indicated positions, as compared to the Long and A2 strain sequences, are shown. ND means not done.
  • viruses selected with mAb AK13A2 (11/3, 4, 5 and 7) has a single transversion (A to U) at nucleotide 797 which changed Asn-262 to Tyr. This change eliminated the binding sites for antibodies 47F, 49F and AK13A2 (see also Fig. 8) and it is identical to the change observed in mutant 4 selected with mAb 47F.
  • a fifth virus selected with mAb AK13A2 (4/4) had, in addition, a transition (A to G) at nucleotide 659 which Asn-216 to Asp. This second amino acid change led to the loss of all the epitopes- from antigenic area II (Fig. 8) .
  • the last mutant selected with mAb AK13A2 (4') had a single transition A to G at nucleotide 827, leading to the replacement of Lys-272 by Glu and the loss of all the epitopes from area II.
  • mutants selected with mAb 7C2, except mutant 4 contained single nucleotide changes (A to G or A to C) at positions 827 or 828 which changed Lys-272 to Glu or Thr, respectively. These changes eliminated the reactivity with all the mAbs from antigenic area II. Mutant 4 had two nucleotide substitutions at position 583 (C to A) and 786 (U to C) which changed amino acids 190 (Ser to Arg) and 258 (Leu to Ser) . The last mutant had only lost the binding site for mAb 7C2 but retained its reactivity with all the other anti-F antibodies (Fig. 8) .
  • the two mutants selected with mAb B4 had a single nucleotide transversion at position 828 (A to C) which changed Lys-272 to Thr.
  • all the amino acid changes selected with mAbs from antigenic area II were clustered in a small segment of the F protein, between amino acids 262 and 272, except the changes at amino acids 258, 216 and 190 which were detected only in viruses with two amino acid substitutions.
  • Example 9 Reactivity of antibodies with synthetic peptides Since the antibodies used to select the escape mutants reacted in Western blot with trypsin fragments of the FI subunit, whether or not synthetic peptides could reproduce the epitopes recognized by these antibodies was determined.
  • the peptides shown in Table 4 were synthesized in an Applied Biosystem 430 instrument, using the solid phase technology and t-Boc chemistry [Merrifield, Science, 212:341-347 (1986)]. The peptides were cleaved off the resin with trifluoromethyl sulfonic acid and purified from protecting groups and scavengers by Sephadex G-25 chromatography. The amino acid sequence of each peptide was confirmed by automated Edman degradation in an Applied Biosystem 477 protein sequencer.
  • the first site contains several overlapping epitopes located within the trypsin resistant amino terminal third of the FI subunit, clustered around amino acids 262-
  • Overlapping peptides corresponding to amino acids 255 to 275 of the F protein [SEQ ID NO: 19] were synthesized in duplicate as a series of octamers overlapping by seven amino acids and offset by one amino acid, bound to polyethylene pins using F-Moc chemistry following the method of Geyson et al, J. Immunol. Meth., 112:259-274 (1987) .
  • the software package, polyethylene pins and amino acids used to produce the peptides were obtained from Cambridge Research Biochemicals, Cheshire, England.
  • the pins to which the peptides are bound were incubated with blocking buffer in 96 well microtitre plates (PBS containing 0.05% Tween 20 and 2% Marvel) on a rotary shaker. After one hour incubation at room temperature, the pins were incubated with mAb B4, and diluted 1:600 in blocking buffer at 4°C with shaking. After being washed 10 times for 5 minutes in PBS containing 0.05% Tween 20 (PBS/Tw) , the pins were incubated with horseradish peroxidase (HRP)-rabbit anti-bovine IgG [Sigma], diluted 1:4000 in blocking buffer.
  • HRP horseradish peroxidase
  • the pins were washed ten times for 5 minutes and incubated, in the dark with agitation, in microtiter plates containing 150 ⁇ l/well of 50 mg of azino-di-3-ethyl-benzthiazodisulpho-nate [Sigma] dissolved in 100 ml of substrate buffer (0.1M disodium hydrogen orthophosphate; 0.08M citric acid) containing 0.3 ⁇ 1/ml of 120 volume hydrogen peroxide. When sufficient color had developed, the O.D. was read at 405 nm- on a Titertek Multiscan MCC 340 plate reader.
  • MAb B4 recognized a single peptide extending from amino acid #266-273 of SEQ ID NO: 19 and having the sequence I T N D Q K K L bound to the pins.
  • the binding of B4 to this octomer was studied further using peptides, bound to pins, which represented the above sequence, but where every amino acid in this sequence was replaced in turn with each of the 20 naturally occurring amino acids.
  • Duplicate peptides were synthesized as described above and the binding of mAb B4 to the peptides was determined by ELISA and is shown in Fig. 9.
  • B4 bound to all peptides where amino acid 266-Ile was replaced in turn with all other amino acids, indicating that amino acid 266- He was not essential for the binding of B4 to the peptide 266-273 of SEQ ID NO: 19.
  • replacement of amino acids 270-Glu and 273-Lys did not affect the binding of B4 to a significant extent.
  • substitution of amino acids 268-Asn, 269-Asp and 272-Lys resulted in the total loss of binding of B4, indicating that these amino acids are essential for the binding of B4 to peptide 266-273 of SEQ ID NO: 19.
  • RSV19 is specific for the fusion (F) protein of RSV.
  • the RSV19 hybridoma cell line was obtained from Dr. Geraldine Taylor. Methodology for the isolation of hybridoma cell lines secreting monoclonal antibodies specific for RSV is described by Taylor et al . , Immunology, 12:137-142 (1984) .
  • cytoplasmic RNA was prepared by the method of Favaloro et al . , (1980) cited above from the RSV19 hybridoma cell line, and cDNA was synthesized using Ig variable region primers as follows.
  • Ig variable region primers for the Ig heavy chain variable region, RSV19VH (see Figs. 15A, 15B and 19), the primer [SEQ ID NO: 33] VH1FOR
  • VH1FOR or VKIFOR 250 ⁇ M each of dATP, dCTP, dGTP and dTTP,
  • VH and VK cDNAs were then amplified using PCR.
  • the primers used were: VH1FOR; VKIFOR; VH1BACK
  • DNA/primer mixtures consisted of 5 ⁇ l RNA/cDNA hybrid, and 0.5 ⁇ M VH1FOR and
  • VH1BACK primers For PCR amplifications of VK, DNA/primer mixtures consisted of 5 ⁇ l RNA/cDNA hybrid, and 0.5 ⁇ M VKIFOR and VKIBACK primers. To these mixtures was added 200 ⁇ M each of dATP, dCTP, dGTP and dTTP, lOmM Tris-HCl pH 8.3,
  • amplified VH DNA was purified on a low melting point agarose gel and by
  • VH DNA was either directly ligated into the Smal site of M13 mp 18/19 or, following digestion with PstI, into the
  • Amplified VK was similarly gel purified and cloned by the following alternatives: (1) PvuII digest into M13mpl9 (Smal site) ; (2) PvuII and Bglll digest into M13mpl8/19 (Smal-BamHI site) ; (3) PvuII and Bglll digest into M13tgl31 (EcoRV-BglH site) ; (4) Bglll digest into M13tgl31 (Smal-Bglll site) .
  • the resultant collections of overlapping clones were sequenced by the dideoxy method [Sanger et al . , cited above] using Sequenase [United States
  • the murine RSV19 CDRs were transferred to human frameworks by site directed mutagenesis.
  • the primers used were:
  • the DNA templates for mutagenesis comprised human framework regions derived from the crystallographically solved proteins, NEW [Saul, et al . , J. Biol.,Chem., 53:585- 597 (1978)] with a substitution of amino acid 27 from serine to phenylalanine [See, Riechmann et al . , loc.cit.1 and REI [Epp et al . , Eur J. Bio ⁇ hsm. ...:..1_-...4 (1974)] for VH and VK domains, respectively.
  • M13 based templates comprising human frameworks with irrelevant CDRs were prepared as described by Riechmann et al . , Nature, 332 (1988).
  • Oligonucleotide site directed mutagenesis of the human VH and VK genes was based on the method of Nakamaye et al . , Nucl. Acid Res., 14:9679-9698 (1986). To 5 ⁇ g of VH or VK single-stranded DNA in M13 was added a two-fold molar excess of each of the three VH or VK phosphorylated oligonucleotides encoding the three mouse CDR (complementarity determining region) sequences. Primers were annealed to the template by heating to 70°C and slowly cooled to 37°C.
  • T4DNA ligase [Life Technologies, Paisley, UK]; 0.5 mM of each of the following nucleoside triphosphates (dATP, dGTP, dTTP and 2'-deoxycytidine 5'-0-) 1-thiotriphosphate) (thiodCTP) ; 60mM Tris-HCl (pH 8.0); 6mM MgCl 2 ; 5mM DTT [Sigma, Poole, UK]; and lOmM ATP in a reaction volume of 50 ⁇ l. This mixture was incubated at 16°C for 15 hours.
  • the DNA was then ethanol precipitated and digested with 5 units Neil [Life Technologies, Paisley, UK] which nicks the parental strand but leaves the newly synthesized strand containing thiodCTP intact.
  • the parental strand was then removed by digesting for 30 minutes with 100 units exonuclease III [Pharmacia,
  • Single-stranded DNA was prepared from individual plaques and sequenced by the method of Messing, Methods in Enzymology. 111:20-78 (1983) . If only single or double mutants were obtained, then these were subjected to further rounds of mutagenesis (utilizing the methodology described above) by using the appropriate oligonucleotides until the triple CDR mutants were obtained.
  • the CDR replaced VH and VK genes were cloned in expression vectors (by the method of Maniatis et al . ) to yield the plasmids pHuRSV19VH and pHuRSV19VK.
  • the plasmids are shown in Figs. 16 and 17, respectively.
  • the CDR replaced VH gene together with the Ig heavy chain promoter, appropriate splice sites and signal peptide sequences were excised from M13 by digestion with Hindlll and BamHI, and cloned into an expression vector containing the murine Ig heavy chain enhancer, the SV40 promoter, the gpt gene for selection in mammalian cells and genes for replication and selection in E. coli .
  • the variable region amino acid sequence is shown in Fig. 19.
  • a human IgGl constant region was then added as a BamHI fragment.
  • pHuRSV19VK plasmid The construction of the pHuRSV19VK plasmid was essentially the same except that the gpt gene was replaced by the hygromycin resistance gene and a human kappa chain constant region was added (see Figs. 17 and 22).
  • lO ⁇ g of pHuRSV19VH and 20 ⁇ g of pHuRSV19VK were digested with Pvul utilizing conventional techniques. The DNAs were mixed together, ethanol precipitated and dissolved in 25 ⁇ l water.
  • Approximately 10 7 YB2/0 cells [American Type Culture Collection, Rockville, Maryland, USA] were grown to semi- confluency, harvested by centrifugation and resuspended in 0.5ml DMEM [Gibco, Paisley, UK] together with the digested DNA in a cuvette. After 5 minutes on ice, the cells were given a single pulse of 170V at 960uF (Gene-Pulser, Bio-Rad- Richmond, California, USA) and left in ice for a further 20 minute. The cells were then put into 20 ml DMEM plus 10% foetal calf serum and allowed to recover for 48 hours.
  • the cells were distributed into a 24-well plate and selective medium applied (DMEM, 10% foetal calf serum, 0.8 ⁇ g/ml mycophenolic acid, and 250 ⁇ g/ml xanthine) . After 3-4 days, the medium and dead cells were removed and replaced with fresh selective medium. Transfected clones were visible with the naked eye 10-12 days later.
  • DMEM 10% foetal calf serum, 0.8 ⁇ g/ml mycophenolic acid, and 250 ⁇ g/ml xanthine
  • the presence of human antibody in the medium of wells containing transfected clones was measured by conventional ELISA techniques. Micro-titre plates were coated overnight at 4°C with goat anti-human IgG (gamma chain specific) antibodies [Sera-Lab-Ltd., Crawley Down, UK] at 1 ⁇ g per well. After washing with PBST (phosphate buffered saline containing 0.02% Tween 20x (pH7.5)), lOO ⁇ l of culture medium from the wells containing transfectants was added to each microtitre well for 1 hour at 37°C.
  • PBST phosphate buffered saline containing 0.02% Tween 20x (pH7.5)
  • HuRSV19VH/VK also called RSH200
  • HuRSV19VH/VK secreted from cell lines cotransfected with pHuRSV19VH and pHuRSV19VK
  • Antigen consisted of calf kidney (CK) cells infected with RSV A2 strain [Lewis et al . , Med. J. Austral a, 41:932-933 (1961)] and treated with 0.5% (v/v) NP40 detergent to yield a cell lysate.
  • Microtitre plate wells were coated with either infected or control cell lysate. Antigen coated plates were blocked with PBST for 1 hour at 37°C, washed with PBST, and thereafter humanized antibody was applied (i.e., HuRSV19VH/VK) . After 1 hour at 37°C, the wells were emptied, washed with PBST and 200 ng goat anti-human IgG antibodies [Sera Lab-Ltd., Crawley Down, UK] added per well.
  • This humanized antibody HuRSV19VH/VK (RSHZ00) , generated by the straight replacement of the RSV19 heavy and light chain CDRs into the human heavy chain framework regions (variable and constant regions REI and kappa, respectively) bound to whole RSV preparations, although with an affinity less than the donor murine RSV19 antibody.
  • High affinity antibodies specific for RSV were developed by a method designed to achieve minimal variable region framework modifications giving rise to high affinity binding.
  • the method involves the following order of steps of alteration and testing:
  • amino acid 94 comprises Arg in the framework of the primary antibody but not in the framework of the altered antibody, then an alternative heavy chain gene comprising
  • Arg 94 in the altered antibody is produced.
  • the altered antibody framework comprises an Arg residue at position 94 but the primary antibody does not, then an alternative heavy chain gene comprising the original amino acid at position 94 is produced.
  • alternative plasmids produced on this basis are tested for production of high affinity altered antibodies.
  • Framework amino acids within 4 residues of the CDRs as defined according to Kabat are compared in the primary antibody and altered CDR- replacement antibody. Where differences are present, then for each region (e.g., upstream of VHCDRl) the specific amino acids of that region are substituted for those in the corresponding region of the altered antibody to provide a small number of altered genes. Alternative plasmids produced on this basis are then tested for production of high affinity antibodies.
  • the method is exemplified by the production of a high affinity altered antibody derivative of HuRSV19VH/VK specific for RSV.
  • Comparison of VH gene sequences between RSV19VH and pHuRSV19VH indicates that 3 out of 4 amino acid differences occur between amino acids 91 to 94 of the F protein of SEQ ID NO: 19, which defines a framework sequence adjacent to heavy chain CDR3.
  • plasmid pHuRSVl9VHFNS (Fig. 20) was produced by inserting the RSV1 heavy chain CDRs and the four amino acid framework sequence amino acids 91 to 94 into the human framework described in the preceding example.
  • oligonucleotide site directed mutagenesis the following oligonucleotide was used for mutagenesis of the HuRSV19VH gene in Ml3:
  • the cell line cotransfected with pHuRSVl9VHFNS and pHuRSV19VK (Fig. 22) produced a second humanized antibody
  • HuRSV19VHFNS/HuRSV19VK (abbreviated hereafter as RSHZ19) .
  • This antibody was tested in an ELISA assay for analysis of binding to RSV antigen prepared from detergent-extracted, virus-infected cells.
  • the substitution of VH residues 91 to 94 in HuRSV19VH/VK with VH residues from mouse RSV19VH partially restored antigen binding levels.
  • Additional analysis of HuFNS binding properties was performed using an ELISA assay in which intact Type A RSV (Long strain) was used as the antigen. The data from such additional analysis show that there is little if any difference between the ability of the murine mAb RSV19 and the humanized RSHZ19 antibodies to bind to intact, non-denatured RSV. This additional analysis also showed detectable binding of HuRSV19VH/VK to intact virus, although of a much lower magnitude than was seen with either RSV19 or RSHZ19.
  • fluorescein-conjugated rabbit anti-mouse IgG [Nordic Laboratories-Tilburg, The Netherlands] or fluorescein-conjugated goat anti-human IgGl
  • a suspension of MA104 cells was infected with RSV at an m.o.i. (multiplicity of infection) of 0.01 PFU (plaque forming units) per cell. After 1 hour at 37°C, 2 ml of cells at lOVml were distributed to glass coverslips in tubes. After a further 24 hours at 37°C, the culture medium was replaced by medium containing dilutions of humanized antibody, RSHZ19. Twenty-four hours later, coverslip cultures were fixed in methanol for 10 minutes and stained with May Grunwald stain [BDH Chemicals Ltd., Poole, UK].
  • the effect of increasing concentrations of RSHZ19 in inhibiting the frequency of giant cells demonstrates the biological activity of the humanized antibody RSHZ19 in inhibiting Type A RSV induced cell fusion. Additional studies showed that the fusion inhibition titres for RSV19 versus RSHZ19 were comparable, providing additional evidence that affinity for the native viral antigen was fully restored in the humanized RSHZ19.
  • the humanized antibody RSHZ19 has also been shown, using methodology analogous to that utilized above for showing inhibition of Type A RSV induced cell fusion, to exhibit a dose dependent inhibition of Type B RSV (strain 8/60) induced giant cell fusion.
  • mice were challenged intranasally with 10 4 PFU of the A2 strain of human RSV [Taylor et al . , Infect. Immun. , 41:649-655 (1984)]. Groups of mice were administered with 25 ⁇ g of humanized antibody either one day prior to virus infection or 4 days following infection. Administration of antibody was either by the intranasal
  • RSHZ19 was also shown to be active in vivo when administered prophylactically to mice challenged with Type B
  • HuRSV19VH/VK was also shown to be active in vivo when administered prophylactically to mice challenged with Type B
  • mice Five female BALB/c mice (weighing approximately 20g) were inoculated i.p. with 50 ⁇ g RSHZ19 (CHO) and another 5 were inoculated intravenously (i.v.) with 50 ⁇ g RSHZ19 (CHO) . Mice were bled from the tail 2 hours, 1, 4, 7, 14,
  • strain A2-infected or uninfected Hep-2 cells, followed by dilutions of mouse sera and HRP-anti human IgG.
  • mice inoculated i.v. developed antibody to
  • mice inoculated i.p. had no detectable antibody to RSHZ19.
  • mice log 10 ELISA Inoculated titre* _ i.v. 2.5 + 0.2 i.p. ⁇ -5
  • Biotinylated RSHZ19 recognized RSV in all the nasopharyngeal aspirates studied.
  • the intensity of fluorescence in samples stained with biotinylated RSHZ19 was less than in those stained with IMAGENTM RSV; however, the numbers of stained cells appeared to be similar in both samples.
  • Lung washings were obtained at post-mortem by filling the lungs with 800 ml of PBS. Lung washings were centrifuged at 1300 g and the cell pellet resuspended in 5 ml of medium. All samples were assayed for RSV on secondary
  • Calves were also treated i.t. with 15 mg B13 or 15 mg Bl 24 hours prior to challenge with bovine RSV (BRSV) .
  • MAb Bl is an anti-F antibody that is non-neutralizing, non- protective in mice but fixes complement (Kennedy et al, (1988)) .
  • p 0.07
  • Cytoplasmic RNA was prepared by the method of Favaloro et al . , Meth. Enzy ol . . 11:718-749 (1980) from B4, B13 and B14 hybridoma cell lines.
  • the primers
  • BCGIFOR 5*TTGAATTCAGACTTTCGGGGCTGTGGTGGAGG 3' [SEQ ID NO: 29], which is based on sequence complementary to the 5' end of bovine ⁇ -1 and -2 constant region genes
  • BCLIFOR 5'CCGAATTCGACCGAGGGTGGGGACTTGGGCTG 3' [SEQ ID NO: 30], which is complementary to the 5' end of the bovine lambda constant region gene, were used in the synthesis of Ig heavy (VH) and light (VL) chain variable region cDNAs, respectively.
  • cDNA synthesis reactions consisted of 20 ⁇ g RNA, 0.4 ⁇ M BCGIFOR or BCLIFOR, 250 ⁇ M each of dATP, dCTP, dGTP and dTTP, 50mM Tris-HCl pH 7.5, 75mM KC1, lOmM DTT, 3mM MgCl 2 and 27 units RNase inhibitor [Pharmacia, Milton Keynes, United Kingdom] in a total volume of 50 ⁇ l. Samples were heated at 70°C for 10 minutes and slowly cooled to 42°C over a period of 30 minutes. Then, lOO ⁇ MMLV reverse transcriptase [Life Technologies, Paisley, United Kingdom] was added and incubation at 42°C continued for 1 hour.
  • VH and VK cDNAs were then amplified using the polymerase chain reaction (PCR) as described by Saiki et al . , Science. 211:487-491 (1988).
  • PCR polymerase chain reaction
  • the primers used were BCGIFOR, BCLIFOR, [SEQ ID NO: 31]
  • VH1BACK 5'AGGT(S) (M) (R)CTGCAG(S)AGTC(W)GG 3'
  • VL2BACK 5'TTGACGCTCAGTCTGTGGTGAC(K)CAG(S) (M)GCCCTC 3'
  • VH1BACK is described by Orlandi et al . , Proc. Nat'1. Acad. Sci.. USA. 11:3833-3937 (1989) .
  • the sequence of VL2BACK was based on nucleotide sequences listed for the 5' end of human lambda variable regions [Kabat et al . , (1987), cited above] .
  • DNA/primer mixtures consisted of 5 ⁇ l RNA/cDNA hybrid and 0.5 ⁇ M BCGIFOR and VHIBACK primers.
  • DNA/primer mixtures consisted of 5 ⁇ l RNA/cDNA hybrid and 0.5 ⁇ M BCLIFOR and VL2BACK primers.
  • VH DNA was cloned as Pstl-EcoRI fragments into similarly-digested M13mpl8/19 [Pharmacia-Milton Keynes, UK] .
  • VL DNA was cloned as Sstl-EcoRI fragments into M13mpl8/19 digested with the same enzymes. Representative clones were sequenced by the dideoxy method [Sanger et al . , Proc. Nat'1.
  • amino acid sequences obtained by translation of the variable region gene inserts were aligned with known VH and VL sequences to allow identification of the CDRs.
  • VL and VH amino acid sequences of B4 and the apparently substantially identical B13 and B14 antibodies are reported in Figs. 3A and 3B (VL) , and 4A and 4B (VH) .
  • the B4 sequences are reported above the B13/B14 sequences to demonstrate the ho ologies therebetween.
  • the B4VH gene was amplified from an M13 clone
  • Example 18 by PCR with oligonucleotides VH1BACK (described in Example 18) and VH1FOR (5' TGAGGAGACGGTGACCGTGGTCCCT
  • the PCR mixture consisted of 0.5 ⁇ l M13 phage supernatant 0.5 uM each of the above primers, 250 uM each of dATP, dCTP, dGTP and dTTP, 10 mM KCl, 20 mM Tris-HCl pH 8.8, 10 mM (NH 4 ) 2 S0 4 ,
  • M13VHPCR1 (Orlandi et la, 1989, cited above) .
  • the integrity of a chosen clone was confirmed by nucleotide sequencing.
  • the B4VH was cloned into an expression vector as described in Example 11 except that the human IgGl constant region was already present in the vector.
  • the plasmid was termed ⁇ SVgptB4BoVHHuIgGl.
  • the vector M13VKPCR1 (Orlandi et al, 1989, cited above) was first modified to allow it to accept a lambda, rather than kappa, chain variable region. This was achieved by mutating the 5' end of the existing VK gene using the oligonucleotide
  • M13VKPCR1 was grown in E. coli RZ1032 (dut ' ung " ) to give single-stranded template DNA containing uracil in place of thymine.
  • 0.5 ug DNA was mixed with 1 pmol each of the three phosphorylated oligonucleotides above and 1 pmol of an oligonucleotide VKPCRFOR (5' GCGGGCCTCTTCGCTATTACGC 3') [SEQ ID NO: 47] which anneals to the M13 template downstream of the insert DNA.
  • the oligonucleotides were annealed to the template in 20 ul of 50 mM Tris-HCl pH 7.5, 25 mM MgCl 2 , 63 mM NaCI by heating to 80°C for 5 minutes and cooling slowly to room temperature.
  • dATP, dCTP, dGTP and dTTP were added to a 250 ⁇ M final concentration, DTT to 7 mM, ATP to 1 mM with 0.5 unit T7 DNA polymerase (USB) and 0.5 unit T4 DNA ligase (BRL) in the same buffer.
  • the 30 ⁇ l reaction was incubated at room temperature for one hour and the DNA ethanol precipitated.
  • the DNA was dissolved in 50 ⁇ l of 60 mM Tris.HCl, pH 8.0, 1 mM EDTA, 1 mM DTT, 0.1 mg/ml BSA containing 1 unit uracil DNA glycosylase and incubated at 37°C for one hour before NaOH was added to 0.2 M and incubation continued at room temperature for 5 minutes.
  • the DNA was ethanol precipitated, dissolved in 20 ⁇ l TE and the insert fragment amplified by PCR.
  • the reaction mixture contained 2 ⁇ l mutant DNA, 0.5 ⁇ M each VKPCRFOR and VKPCRBACK (5 1
  • CTGTCTCAGGGCCAGGCGGTGA 3*) [SEQ ID NO: 48], 250 ⁇ M each of dATP, dCTP, dGTP and dTTP, 10 mM Tris.HCl pH 8.3, 50 mM KCl,
  • the product DNA was cloned into M13mpl9 as a Hindlll-
  • Hpal and Ncol restriction sites were introduced at the ends of the B4VL by amplifying the DNA from an Ml3 clone
  • the expression vectors were co-transfected into YB2/0 myeloma cells, transfectomas secreting antibody identified and a chimeric antibody B4BoVH/BoVL purified as described in Example 11.
  • the chimeric antibody was compared to the B4 bovine antibody for binding to RSV-infected cell lysate in an ELISA.
  • the method was essentially as described in Example 11 except that RSV-infected and uninfected Hep2 cell lysates were used.
  • the reporter antibodies were goat anti- human IgG antibodies, HRPO-conjugated (Sera-Lab Ltd, Crawley Down, UK) and rabbit anti-bovine IgG antibodies, HRPO- conjugated (Sigma, Poole, UK), used as 1 in 1000 dilutions.
  • bovine and chimeric (BoVH/BoVL) B4 antibodies bound to the infected cell lysate whereas an irrelevant humanized antibody did not. None of the antibodies reacted against the control lysate. It is not possible to draw a direct comparison between the bovine and chimaeric antibodies from this experiment as different reporter antibodies were used. In a separate experiment comparing the conjugates, about 2.5 fold more bovine antibody than human antibody was required to obtain the same OD reading. Thus the bovine and chimeric antibodies are approximately equivalent in binding.
  • B4 Humanized Heavy Chain The B4VH was humanized by transferring the bovine CDRs onto human NEWM VH frameworks (Saul et al, 1978, cited above) using site-directed mutagenesis. The following bovine framework residues (numbering as Kabat et al, (1987) , cited above) were incorporated into the humanized VH alongside the CDRs (see Figure 10) .
  • Lys94 - the amino acid at this position can affect the conformation of CDR3 by formation of a salt bridge (Chothia and Lesk (1987) , cited above) .
  • the template DNA was M13mpl9-based and contained a VH gene comprising NEWM frameworks and irrelevant CDRs, similar to that described by Riechmann et al . , Nature, 332:323-327 (1988) .
  • the mutagenesis was carried out as described above for the construction of M13VLPCR1.
  • the oligonucleotides employed were:
  • VHCDR1 5' CTGTCTCACCCAGCTTACAGAATAGCTGCTCAATGAGAAG
  • VHCDR2 5' CATTGTCACTCTGGATTTCAGGGCTGGGTTATAATATATGATT
  • VHCDR3 5' CAAGGACCCTTGGCCCCAGGCGTCGACATACTCGCCCTTGC
  • pSVgptB4HuVHHuIgGl was co-transfeeted with the chimeric light chain vector, pSVhygB4BoVLHuVK as described in Example
  • the resulting partially humanized antibody B4HuVH/BoVL therefore contains a humanized B4 heavy chain (B4HuVH) with a B4 light chain chimeric B4BoVLHuVK.
  • B4HuVH humanized B4 heavy chain
  • B4 light chain chimeric B4BoVLHuVK.
  • Cells secreting B4HuVH/BoVL antibody were expanded and antibody purified from 400ml conditioned medium.
  • the B4HuVH/BoVL antibody was compared to the chimeric antibody B4BoVH/BoVL in binding to RSV strain A2-infected cell lysate in an ELISA. This allowed assessment of the relative binding abilities of the chimeric and humanized heavy chains.
  • the humanized heavy chain HuVH binds to RSV-infected cell lysate, but is 2-3 fold deficient in binding relative to the chimeric heavy chain BoVH. Additional murine residues were included to attempt to increase binding.
  • the HuVH gene was mutated to encode the following changes: T at position 73, N at position 76 and F at position 78 to NSV. These residues are part of a ⁇ -turn which forms a fourth loop at the antigen binding surface.
  • a HuVHNSV/BoVL antibody was produced and tested for binding to a lysate of cells infected with the Snook strain of RSV by ELISA. Inclusion of the RSV residues gave no advantage over the original HuVH.
  • a humanized version of the B4 light chain B4HuVL was constructed by site-directed mutagenesis of the bovine B4VL frameworks to give frameworks of the human KOL lambda variable region (see Figure 11) .
  • Cells were selected for the presence of the gpt gene which is found on the heavy chain expression vector.
  • Initial results using BoVL and HuVL probes show bands of approximately the same size for all three species of light chain.
  • Two more humanized light chain constructs - a human REI kappa framework-based version of the light chain and a CDR- grafted light chain with frameworks of the human KIM46L lambda chain, may be made using the actual nucleotide sequence of the KIM46L VL gene (Cairns et al, J. Immunol..
  • bovine variable region sequences in the databases meant that it was difficult to design primers for PCR amplification and thus to isolate DNA for the initial cloning and sequencing.
  • Example 21 Effect of RSH7.19 and RSBV04 administered therapeut cally to RSV infected mice
  • Groups of five mice were inoculated intranasally with approximately 10 5 PFU of the A2 strain of RSV and were treated on day 4 of infection with different amounts of
  • RSBV04 administered intraperitoneally either alone or with
  • RSHZ19 0.5 mg/kg RSHZ19, as shown in Table 10 below. Mice were killed five days after RSV challenge, and the level of virus in the lungs determined on CK cells. The results are shown in Table 10 and indicated that the effect of combined therapy with RSHZ19 and RSBV04 is additive rather than synergistic.
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE protein
  • FEATURE protein
  • MOLECULE TYPE DNA (genomic)
  • CAG AAA CCA GGC CAG TCT CCA AAG CTC CTG ATC TAC AGA GTT 168 Gin Lys Pro Gly Gin Ser Pro Lys Leu Leu He Tyr Arg Val 45 50 ' 55

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Communicable Diseases (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pulmonology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
EP93908006A 1992-04-06 1993-04-06 Antibodies for treatment and prevention of respiratory syncytial virus infection Withdrawn EP0636182A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB9207479 1992-04-06
GB929207479A GB9207479D0 (en) 1992-04-06 1992-04-06 Novel antibodies for treatment and prevention of respiratory syncytial virus infection in animals and man
PCT/GB1993/000725 WO1993020210A1 (en) 1992-04-06 1993-04-06 Antibodies for treatment and prevention of respiratory syncytial virus infection

Publications (1)

Publication Number Publication Date
EP0636182A1 true EP0636182A1 (en) 1995-02-01

Family

ID=10713521

Family Applications (1)

Application Number Title Priority Date Filing Date
EP93908006A Withdrawn EP0636182A1 (en) 1992-04-06 1993-04-06 Antibodies for treatment and prevention of respiratory syncytial virus infection

Country Status (9)

Country Link
EP (1) EP0636182A1 (ko)
JP (1) JPH07508401A (ko)
KR (1) KR950701386A (ko)
AU (1) AU679440B2 (ko)
CA (1) CA2133662A1 (ko)
GB (1) GB9207479D0 (ko)
NZ (1) NZ251405A (ko)
WO (1) WO1993020210A1 (ko)
ZA (1) ZA932445B (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9963500B2 (en) 2015-10-29 2018-05-08 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5824307A (en) 1991-12-23 1998-10-20 Medimmune, Inc. Human-murine chimeric antibodies against respiratory syncytial virus
US6258529B1 (en) * 1994-12-01 2001-07-10 Oravax, Inc. PCR amplification of rearranged genomic variable regions of immunoglobulin genes
US5811524A (en) * 1995-06-07 1998-09-22 Idec Pharmaceuticals Corporation Neutralizing high affinity human monoclonal antibodies specific to RSV F-protein and methods for their manufacture and therapeutic use thereof
US7175847B1 (en) 1995-06-07 2007-02-13 Biogen Idec Inc. Treating intestinal inflammation with anti-CD80 antibodies that do not inhibit CD80 binding to CTLA-4
US7153508B2 (en) 1995-06-07 2006-12-26 Biogen Idec Inc. Treatment of B cell lymphoma using anti-CD80 antibodies that do not inhibit the binding of CD80 to CTLA-4
WO1997010846A1 (en) 1995-09-18 1997-03-27 Intracel Corporation Neutralizing monoclonal antibodies to respiratory syncytial virus
FR2758331B1 (fr) * 1997-01-14 1999-03-05 Univ Bourgogne Nouveaux moyens pour le diagnostic, la prevention et le traitement vis-a-vis de contaminations ou d'infections par des virus a tropisme muqueux
US6160099A (en) * 1998-11-24 2000-12-12 Jonak; Zdenka Ludmila Anti-human αv β3 and αv β5 antibodies
AU2001259379B2 (en) * 2000-05-03 2006-08-03 Medimmune, Llc Combination therapy of respiratory diseases using antibodies
AU2001263443A1 (en) * 2000-05-25 2001-12-03 Med Immune, Inc. F-protein epitope-based vaccine for respiratory syncytial virus infection
US7132100B2 (en) 2002-06-14 2006-11-07 Medimmune, Inc. Stabilized liquid anti-RSV antibody formulations
TW200636064A (en) * 2004-10-28 2006-10-16 Centocor Inc Anti-respiratory syncytial virus antibodies, antigens and uses thereof
EP1997830A1 (en) 2007-06-01 2008-12-03 AIMM Therapeutics B.V. RSV specific binding molecules and means for producing them
US8568726B2 (en) 2009-10-06 2013-10-29 Medimmune Limited RSV specific binding molecule
DK2614082T3 (en) 2010-09-09 2018-11-26 Pfizer 4-1BB BINDING MOLECULES
US9364414B2 (en) 2011-02-01 2016-06-14 Isp Investments Inc. Method to protect skin from ultraviolet radiation using novel peptides involved in the improvement of microparasol organization in keratinocytes
FR2970968A1 (fr) * 2011-02-01 2012-08-03 Isp Investments Inc Nouveaux peptides intervenant dans la voie de signalisation scf c-kit et compositions les comprenant
US10774132B2 (en) * 2012-01-09 2020-09-15 The Scripps Research Instittue Ultralong complementarity determining regions and uses thereof
CA2862979A1 (en) * 2012-01-09 2013-07-18 The Scripps Research Institute Humanized antibodies with ultralong cdr3s
EP2943512A4 (en) 2013-01-11 2016-06-01 California Inst Biomedical Res FUSION BOVINE ANTIBODIES
WO2015010100A2 (en) * 2013-07-18 2015-01-22 Fabrus, Inc. Humanized antibodies with ultralong complementarity determining regions
CA3111336A1 (en) * 2018-09-03 2020-03-12 Pontificia Universidad Catolica De Chile Specific monoclonal antibody against the n antigen of human respiratory syncytial virus (hrsv) useful for treating infection, detection thereof and diagnosis
AU2021399453A1 (en) * 2020-12-18 2023-07-27 Zhuhai Trinomab Pharmaceutical Co., Ltd. Respiratory syncytial virus-specific binding molecule

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989005823A1 (en) * 1987-12-23 1989-06-29 The Upjohn Company Chimeric glycoproteins containing immunogenic segments of the glycoproteins of human respiratory syncytial virus
EP0539522B1 (en) * 1990-07-19 1998-12-30 THE UNITED STATES OF AMERICA as represented by the Secretary United States Department of Commerce Improved immunotherapeutic method of preventing or treating viral respiratory tract disease
GB9019812D0 (en) * 1990-09-11 1990-10-24 Scotgen Ltd Novel antibodies for treatment and prevention of infection in animals and man
DK0671927T3 (da) * 1992-09-16 2003-04-22 Us Gov Health & Human Serv Neutraliserende humane monoklonale antistoffer mod respiratorisk syncytialvirus
AU3660893A (en) * 1993-01-29 1994-08-15 Med Immune, Inc. Human-murine chimeric antibodies against respiratory syncytial virus

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9320210A1 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9963500B2 (en) 2015-10-29 2018-05-08 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US10072072B2 (en) 2015-10-29 2018-09-11 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US10323079B2 (en) 2015-10-29 2019-06-18 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US10358480B2 (en) 2015-10-29 2019-07-23 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US11008380B2 (en) 2015-10-29 2021-05-18 Merck Sharp & Dohme Corp. Antibody neutralizing human respiratory syncytial virus
US11566065B2 (en) 2015-10-29 2023-01-31 Merck Sharp & Dohme Llc Antibody neutralizing human respiratory syncytial virus
US11981726B2 (en) 2015-10-29 2024-05-14 Merck Sharp & Dohme Llc Antibody neutralizing human respiratory syncytial virus

Also Published As

Publication number Publication date
ZA932445B (en) 1995-01-05
NZ251405A (en) 1997-09-22
AU679440B2 (en) 1997-07-03
AU3900093A (en) 1993-11-08
GB9207479D0 (en) 1992-05-20
CA2133662A1 (en) 1993-10-14
WO1993020210A1 (en) 1993-10-14
KR950701386A (ko) 1995-03-23
JPH07508401A (ja) 1995-09-21

Similar Documents

Publication Publication Date Title
AU679440B2 (en) Antibodies for treatment and prevention of respiratory syncytial virus infection
AU654827B2 (en) Novel antibodies for treatment and prevention of infection in animals and man
WO1993020210A9 (en) Antibodies for treatment and prevention of respiratory syncytial virus infection
CA2197684C (en) Human-murine chimeric antibodies against respiratory syncytial virus
US5955364A (en) Neutralizing high affinity human monoclonal antibodies specific to RSV F-protein and methods for their manufacture and therapeutic use thereof
FI108991B (fi) Menetelmä ihmisen monoklonaalisen vasta-aineen tuottamiseksi
Maeda et al. Construction of reshaped human antibodies with HIV-neutralizing activity
KR101671452B1 (ko) 항ｒｓｖ ｇ 단백질 항체
US6569430B1 (en) Antibodies to the antigen Campath-1
EP1265928B1 (en) Ultra high affinity rsv neutralizing antibodies
US20070020279A1 (en) Human-murine chimeric antibodies against respiratory syncytial virus
NZ256232A (en) Fusion molecule with one partner having the antigenic specificity of an anti-plasmodium antibody, antibodies thereof, plasmids and cell lines therefor, and pharmaceutical compositions
US5607847A (en) Recombinant human anti-human immunodeficiency virus antibody
JP2001510329A (ja) ヒトモノクローナル抗体
EP1079856B1 (en) Humanized antibodies that recognize verotoxin ii and cell line producing same
JPH05276988A (ja) 新規抗ｈｉｖ抗体
NZ250415A (en) Monoclonal antibody directed against rsv epitope 417-438, its use and production
CA2087528A1 (en) Chimeric hiv-1-neutralizing immunoglobulins

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19941025

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 19980112

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19980923

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1013665

Country of ref document: HK