EP0537299A1 - Disulfidkonjugate von oligonukleotid-transportagenten - Google Patents

Disulfidkonjugate von oligonukleotid-transportagenten

Info

Publication number
EP0537299A1
EP0537299A1 EP91918074A EP91918074A EP0537299A1 EP 0537299 A1 EP0537299 A1 EP 0537299A1 EP 91918074 A EP91918074 A EP 91918074A EP 91918074 A EP91918074 A EP 91918074A EP 0537299 A1 EP0537299 A1 EP 0537299A1
Authority
EP
European Patent Office
Prior art keywords
oligonucleotide
cell
oligonucleotide conjugate
nucleic acid
conjugate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP91918074A
Other languages
English (en)
French (fr)
Other versions
EP0537299A4 (de
Inventor
John A. Latham
Kuei-Ying Lin
Mark Matteucci
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gilead Sciences Inc
Original Assignee
Gilead Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gilead Sciences Inc filed Critical Gilead Sciences Inc
Publication of EP0537299A4 publication Critical patent/EP0537299A4/de
Publication of EP0537299A1 publication Critical patent/EP0537299A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6841—In situ hybridisation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays

Definitions

  • compositions and - methods for enhancing the delivery of an oligo ⁇ nucleotide into a viable cell or organism comprise oligonucleotide conjugates consisting of an oligonucleotide conjugated via a molecular linker containing at least one j ⁇ disulfide bond, to an agent which facilitates transport across a cell membrane, or across the blood-brain barrier. Also included within the present invention are oligonucleotide conjugates containing a molecular linker having at least one disulfide bond wherein the
  • oligonucleotide 20 directed to methods for inhibiting the expression of a nucleic acid sequence in a cell comprising providing the cell with an oligonucleotide conjugate of the invention.
  • the oligonucleotide can hybridize to the nucleic acid
  • the invention is directed to methods for detecting a nucleic acid sequence in a cell comprising contacting the cell with an oligonucleotide conjugate of the invention, in which the oligonucleotide can hybridize to the nucleic acid
  • the present invention also includes a method for detecting the presence of a nucleic acid sequence of an exogenous infectious agent utilizing oligomer-disulfide conjugates in diagnostic
  • the oligomer-disulfide conjugates utilized in the diagnostic probe includes covalent crosslinking agents, which results in increased sensitivity and reduced background in diagnostic or detection assays.
  • Pharmaceutical compositions and therapeutic methods are also provided.
  • a biotinylated mononucleotide or mononucleo- side linked to an organic basic group via a chemically cleavable bond, e.g. a disulfide linkage, has also recently been disclosed (Herman, U.S. Patent No. ⁇ 4,772,691, issued September 20, 1988). It was suggested that such compositions may be useful in isolating target macromolecules from crude physiological mixtures. Specifically, it was suggested that the biotinylated nucleotides may contact a target on
  • the nucleotide may be cleaved via the cleavable bond to obtain the affinity-macromolecule-target macromolecule complex from which the target macromolecule may be obtained.
  • glutathione a cysteine containing peptide
  • 1-5 mM reduced form
  • target site involves attaching the drug to a carrier capable of transporting the drug from the site of application directly to the site of action (reviewed in
  • Such carriers may be divided into three categories: (1) linear polymers; (2) cells; and (3) three dimensional systems (e.g. liposomes) .
  • Linear polymers are usually covalently linked to the drug via a hydrolyzable bond (reviewed in Hoes and Feijen, 1989, in Drug Carrier Systems, eds. F.H.D. Roerdink and A.M. Kroon, John Wiley & Sons, N.Y., pp. 57-109) .
  • the linkage between the drug and the carrier is cleaved effecting the release of the drug.
  • the carrier is biodegradable.
  • Such carriers include proteins, which are cleaved by 5 proteolytic enzymes inside the cell, polysaccharides which are cleaved by glycosidases or vinyl polymers, which contain hydrolytically labile ester bonds.
  • the success of this approach is dependent on a number of factors which include the conformation of the polymeric 0 carrier and the stability of the drug-carrier bond. There is also the risk of incomplete cleavage of the drug-carrier bond.
  • Another approach involves linking a non-biodegradable polymer to the drug via a hydrolyz- able linkage.
  • Another example involved the conjugation of methotrexate to poly (D-lysine) via a disulfide linkage
  • Cells could potentially be used to deliver a drug to a specific target site.
  • erythro- cytes may be useful in delivering agents to the reticuloendothelial system.
  • cells are limited in both the range of agents which they can carry and 5 target accessibility.
  • the third approach i.e. the use of three dimensional systems such as liposomes and microspheres has the advantage of containing agents within a well protected space.
  • these systems have the disadvantages of being limited in tissue selectivity and their size-imposed inability to cross most normal membrane barriers.
  • Access of drugs to a given target site may also be prevented due to gross anatomical barriers.
  • a barrier is the blood-brain barrier.
  • a chimeric peptides that include a peptide that acts as a neuropharmaceutical agent conjugated, e.g., by disulfide linkage, to a transportable peptide that is capable of crossing the blood-brain barrier at a relatively high rate by receptor-mediated transcytosis (PCT Application Publication No. WO 89/10134, published April 25, 1988).
  • phosphorothioates may in addition to binding to complementary target nucleic acid sequences also direct the inhibition of primer binding to HIV reverse transcriptase (Matsukura et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84:7706- f J- ⁇ J ) • All . cxu ⁇ wc .IUI JCJ. w wn u ⁇ o «-. ⁇ . ⁇ w MCCII COCJ. iwcu for polymerases using polynucleotides , including partially thiolated polycytidylic acid (reviewed in Stein and Cohen, 1988, Cancer Res. 48:2659-2668).
  • Another approach has involved conjugating the oligonucleotide to a molecule that will increase the efficiency of uptake of the oligonucleotide by the cell.
  • conjugates include cholesteryl- conjugated oligonucleotides (Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556) and a poly-
  • Another example includes an oligonucleotide joined through a linking arm to a group that imparts amphophilic character to the final product in order to increase the efficiency of membrane transport (PCT Publication No. WO 88/09810, published December 15, 1988) .
  • Another approach that has been taken involves the use of reactive oligonucleotides, i.e. antisense oligonucleotides linked to reactive agents that are able to modify the target nucleic acid.
  • One such group of reacting agents are intercalating agents which can bind to the duplex by internal insertion between adjacent base pairs or bind to external nucleoside and phosphate elements respectively.
  • inter ⁇ alators that have been attached to oligonucleo ⁇ tides and oligonucleotide analogs include acridine, anthridium, and photoactivatable psoralen (reviewed in zon, 1988, Pharm. Res. 5:539-549).
  • Another such group of reactive groups coupled to oligonucleotides include metal complexes such as EDTA-Fe(II) , o-phenanthroline- Cu(I), or porphyrin-Fe(II) (reviewed in Krol et al. , 1988, BioTechniques 6:958-976) .
  • These compounds can generate hydroxyl radicals in the presence of molecular oxygen and a reducing agent. The resulting radicals can cleave the complementary strand following attack on the target nucleic acid backbone.
  • One problem with using such compounds is since such oligonucleotides are reactive, they may be subject to autodegradation.
  • Pyrimidine oligonucleotides 15 to 18 nucleotides have been shown to bind with sequence specific dependence to homopurine sites in duplex DNA (Moser and Dervan, 1987, Science 238:634-650). These oligonucleotides bind in the major groove, parallel to the purine strand of Watson-Crick double-helical DNA.
  • the binding affinity and specificity of the pyrimidine oligonucleotide for duplex DNA has been shown to be sensitive to pH, organic cosolvent, added cations, and temperature.
  • homopyridine oligonucleotides have been suggested that the sequence specificity of homopyridine oligonucleotides would render such oligonucleotides useful as tools for mapping chromosomes when equipped with DNA cleaving moieties (Moser and Dervan, 1987, Science 238:645-650).
  • Micromolar concentrations of homopyrimidine oligo ⁇ deoxyribonucleotides have also been shown to block recognition of double helical DNA by prokaryotic modifying enzymes and a eukaryotic transcription at a homopurine target site (Maher et al. , 1989, Science 245:725-730).
  • results of a study of 20 base triplets indicate that the triple helix can be extended from homopurine to mixed sequences (Griffin and Dervan, 1989, Science 245:967-971).
  • compositions of the present invention comprise oligonucleotide conjugates.
  • oligo ⁇ nucleotide conjugates consist of an oligonucleotide conjugated, via a molecular linker consisting of at least one disulfide bond, to an agent (termed herein
  • compositions of the present invention also comprise oligonucleotide conjugates containing a molecular linker having at least one disulfide bond wherein the molecular linker confers stability under extracellular conditions but is labile under intracellular conditions.
  • the disulfide linkage of the molecular linker is cleaved during or after transport of the composition into the cell.
  • the oligonucleotide portion of the conjugate consists of at -li-
  • the oligonucleotide portion of the conjugate consists of 6-50 nucleotides, and is capable of hybridizing to at least a portion of a nucleic acid sequence within the target cell.
  • the transport agent may be selected from the group including but not limited to cholesterol, a peptide, a protein, a lipid, a saccharide, a nucleoside or analog thereof, an antibody, and a biocompatible polymer. In a specific embodiment, the transport agent is cholesterol.
  • the invention further provides pharmaceutical compositions comprising an effective amount of the oligonucleotide conjugates of the invention in a pharmaceutically acceptable carrier.
  • compositions of the invention are also provided.
  • the invention is thus directed to therapeutic methods involving increased delivery of a therapeutically effective oligonucleotide into a cell, comprising providing the cell with a composition comprising the oligonucleotide conjugated to a transport agent via a molecular linker containing at least one disulfide linkage.
  • the invention is directed to methods for inhibiting the expression of a nucleic acid sequence in a procaryotic or eucaryotic cell comprising providing the cell with an effective amount of a composition comprising an oligonucleotide conjugate of the invention.
  • the expression of the nucleic acid sequence in the cell is inhibited by hybridization of the oligonucleotide with the nucleic acid sequence in the cell.
  • such composition may inhibit the expression of a nucleic acid in a cell by inhibiting the action of polymerases in the cell.
  • such composition may inhibit the expression of a nucleic acid sequence in a cell by forming a triple helix with a double-stranded nucleic acid sequence in the cell.
  • the compositions can be effective antiviral, antifungal, or antibacterial agents.
  • these compositions may be used to inhibit the expression of cellular genes such as cellular oncogenes.
  • the invention is also directed to methods for detecting a nucleic acid sequence within a procaryotic or eucaryotic cell comprising providing a viable cell with a composition comprising an oligonucleotide conjugate of the invention, in which the oligonuc ⁇ leotide thereof is (a) linked to a detectable label, and (b) is capable of hybridizing to the nucleic acid sequence within the cell.
  • the invention is also directed to methods for detecting a nucleic acid sequence utilizing oligonucleotide-disulfide conjugates in a diagnostic probes comprising an indirect binding assay whereby human body fluids, cell or tissue extracts are screened - ⁇ ⁇ ⁇ - - ⁇ * ⁇ i ⁇ k4 ⁇ TYWT of a pathogen or gene sequence associated with a pathological state whereby an oligonucleotide probe containing a reporter group linked to the oligonucleotide via a disulfide linker can be added to the material containing the target DNA sequence and the reporter group may be released and measured from the hybrid target/probe DNA complex by adding reducing agents.
  • the indirect binding assay can be modified such that the oligonucleotide probe containing a linker group with a free thiol group can be hybridized with DNA bound on to a support membrane.
  • a reporter group containing a free thiol group can then be attached to the free thiol group of the oligonucleotide linker complexed with the target DNA, by formation of a disulfide linkage under oxidizing conditions. If desired, the reporter group target DNA linkage can be subsequently cleaved by exposure to reducing conditions, followed by detection of the reporter group.
  • Oligonucleotides in diagnostic detection assays can be further modified in order to increase sensitivity and reduce background through the incorporation of hybridization-triggered specific crosslinking agents (see e.g., Meyer et al., 1989, J.Am. Chem. Soc. 111:8517-8519; Birg et al., 1990, 10 Nucl. Acids Res. 18:2901-2907; Uhlmann and Peyman, 1990, Chemical Reviews 90(4) :543).
  • Another modification of the above disclosed indirect binding assay involves utilizing probes containing reporter groups and disulfide linkers in 15 combination with nucleic acid analogs that allow sequence specific binding to double stranded DNA bound to a membrane, thereby forming triple helix structures.
  • the indirect binding assay can additionally be modified utilizing double stranded oligonucleotides 20 (containing the binding site sequence recognized by a cognate DNA-binding protein) to bind specifically to and isolate DNA binding proteins. Additionally, the assay can be modified to use commercially available solid support resins derivatized with thiol groups
  • oligonucleotide as defined herein is a DNA or RNA sequence comprising at least 6 nucleotides, with an upper limit of about 50 nucleotides.
  • the oligonucleotide may be single-stranded or double-
  • the oligonucleotide may be modified at the base moiety, sugar moiety, or phosphate backbone.
  • the oligonucleotide may also include other appending groups such as peptides. Portions of the phosphate backbone may be replaced by other moieties.
  • a “peptide” is a fragment of a protein containing at least one amino acid.
  • the peptide may be modified at any reactive site, e.g. amide linkage, and at one or more of the amino acids in the peptide.
  • the peptide may also include other appending groups.
  • oligonucleotide disulfide conjugate as used herein means an oligonucleotide linked to another entity via a disulfide group.
  • reporter group as used herein means a entity capable of being detected.
  • reporter group includes but is not limited to enzymes, fluorescent labels, radioactive labels and biotin avidin labels.
  • FIGURES Figure 1 shows the structure of CHOLESTEROL- TC-R-S-S-R-CAGTGATT.
  • Figure 3 shows an autoradiogram of
  • CHOLESTEROL-TC-R-S-S-R-CAGTGATTTTTTTCTCCAT for 0, 4, and 48 hours with H938 cells.
  • SM represents starting material, and R represents sample reduced in vitro with 10 mM DTT.
  • Figure 4 shows the effect of incubating CHOLESTEROL-TC-R-S-S-R-CAGTGATTTTTTTCTCCAT in RPMI medium + 15% heat inactivated fetal calf serum (FCS) for 0, 30, 60, and 180 minutes.
  • FCS heat inactivated fetal calf serum
  • C represents control, i.e.. compound not incubated in RPMI + 15% heat inactivated FCS.
  • the present invention relates to compositions and methods for enhancing the delivery of an oligonuc ⁇ leotide into a viable cell or organism.
  • the composi- tions of the invention comprise oligonucleotide conjugates. These oligonucleotide conjugates consist of an oligonucleotide conjugated, via a molecular linker consisting of at least one disulfide bond, to an agent (termed herein "transport agent") which facilitates transport across an outer cell membrane, and/or across the blood-barrier.
  • the oligonucleotide conjugates contain a molecular linker having at least one disulfide bond wherein the molecular linker confers stability under extracellular conditions but is labile under intracellular conditions.
  • the disulfide linkage of the molecular linker is cleaved during or after transport of the composition into the cell.
  • the invention further provides pharmaceutical compositions comprising an effective amount of the oligonucleotide conjugates of the invention in a pharmaceutically acceptable carrier.
  • Methods for treatment of various diseases and disorders comprising administering the pharmaceutical compositions of the invention are also provided.
  • the invention is directed to methods for inhibiting the expression of a nucleic acid sequence in a procaryotic or eucaryotic cell comprising providing the cell with an effective amount of a composition comprising an oligonucleotide conjugate of the invention.
  • the invention is also directed to methods for detecting a nucleic acid sequence within a procaryotic or eucaryotic cell comprising providing a viable cell with a composition comprising an oligonucleotide conjugate of the invention, in which the oligonucleotide thereof is (a) linked to a detectable label, and (b) is capable of hybridizing to the nucleic acid sequence within the cell.
  • the invention is also directed to methods for detecting a nucleic acid sequence utilizing oligonucleotide-disulfide conjugates in a diagnostic probes comprising an indirect binding assay whereby human body fluids, cell or tissue extracts are screened for the presence of exogenous target DNA of a pathogenic organism, whereby an oligonucleotide probe containing a reporter group linked to an oligonucleotide via a disulfide linker can be added to the material containing the target DNA sequence, and the reporter group may be released and measured from the hybrid target/probe DNA complex by adding reducing agents.
  • the indirect binding assay can be modified such that the oligonucleotide probe containing a linker group with a free thiol group can be hybridized to DNA or RNA bound to a support membrane.
  • a reporter group containing a free thiol group can then be attached to the free thiol group of the oligonucleotide linker complexed with the target DNA by formation of a disulfide linkage under oxidizing conditions. If desired, the disulfide linkage may be subsequently cleaved and the reporter group detected.
  • Oligonucleotides in diagnostic detection assays can be further modified in order to increase sensitivity and reduce background through the incorporation of hybridization-triggered specific crosslinking agents (see e.g., Meyer et al., 1989, J. Am. Chem. Soc. 111:8517—8519; Berg et al., 1990, Nucl. Acids REs. 18:2901-2907; Uhlmann and Peyman, 1990, Chemical Reviews 90(4):543).
  • Another modification of the above disclosed indirect binding assay involves utilizing probes containing reporter groups and disulfide linkers that also contain nucleotide sequence specific binding to double stranded DNA, thereby forming triple helix structures.
  • an analog includes, but is not limited to, 5-methylcytosine (Mayer et al., 1989, Science 245:725-730).
  • the indirect binding assay can additionally be modified utilizing double stranded oligonucleotides (containing the binding site sequence recognized by a cognate DNA-binding protein) to bind specifically to and isolate DNA binding proteins.
  • a binding assay can be carried out using commercially available solid support resins ⁇ X* ⁇ i» XJ»o& - u ⁇ *o * c ⁇ ** ⁇ to attach to thiol groups on oligonucleotides to form a disulfide linkage. Subsequent binding of the oligonucleotide to target DNA sequences can be used to isolate such target DNA sequences. The bound complex may then be released from the solid support resin by exposure to reducing conditions.
  • the invention provides compositions for facilitating the uptake of an oligonucleotide by a viable cell.
  • the disulfide linkage within the oligonucleotide conjugate can be cleaved via intracellular reduction, freeing the oligonucleotide from the transport agent.
  • the resulting product is a free thiol which under the high intracellular reducing condition- is capable of seeking its target of interest.
  • the molecular linker in the conjugates of the invention preferably comprises a hydrocarbon structure containing, at either or both of its termini or internally, at least one disulfide linkage between the oligonucleotide and the transport agent.
  • the molecular linker may contain heteroatoms, an amino acid or peptide, nucleoside or nucleotide, etc. Alternatively, the molecular linker may consist solely of a disulfide.
  • the molecular linker containing one or more disulfide groups can be introduced at either the 5' or 3• terminus of the oligonucleotide, or internally. In specific embodiments, the molecular linker can be introduced at the 5' position of a pyrimidine, the 8' position of a purine, or the 2' position of a sugar within the oligonucleotide.
  • the molecular linker has the formula:
  • X is 0, S , S , NR l f CH 2 , C (R ! ) 2 , or C;
  • Y is H, Ch 3 , alkyl, aryl or C when
  • X NRi, CH 2 or C fR j ,* and Ri is H, CH 3 , alkyl or aryl .
  • the above described molecular linker has a controllable t% in vivo, facilitating its use as a prodrug/transport component.
  • Utilizing these molecular linkers in the oligonucleotide conjugates of the present invention confers stability to the disulfide bond found in the molecular linker under extracellular conditions but allows for cleavage of the disulfide bond under intracellular conditions. This allows for increased stability of the oligonucleotide conjugate prior to transport into the cell, but provides cleavage of the disulfide bond during or after transport of the composition into the cell.
  • the regulation, in vivo, of the disulfide bond stability is done by varying the groups adjacent to the disulfide bond in the molecular linker. Stability is increased by having election withdrawing groups near the disulfide bond.
  • X is 0 or NH 2
  • Y is CH 2CH 2 or CO
  • R* is H or CH 3 .
  • oligonucleotide conjugates of the present invention provided a t% of >24 hours under extracellular conditions i.e., in a tissue culture medium and a t% of ⁇ 1 hour inside a cell.
  • This increased stability under extracellular conditions as opposed to intracellular conditions is shown by a redox potential that is in the range of about -200mV to about -230mV. This is shown in Example 7.8 of the present application.
  • the oligonucleotide may be conjugated to the transport agent using various procedures known in the art (see for example, Chu and Orgel, 1988, Nucl. Acids
  • the disulfide linkage may be introduced by reacting the oligonucleotide with a bifunctional reagent containing the disulfide linkage so that the oligonucleotide comprises at least one disulfide linkage.
  • reagents include but are not limited to 2-hydroxyethyl disulfide cystamine (Chu and Orgel, 1988, Nucl. Acids
  • oligonucleotide comprising the disulfide linkage is then reacted with the transport agent containing a free thiol group.
  • a bifunctional agent may be reacted with the transport agent and the resulting product may be subsequently reacted with the oligonucleotide containing a free thiol group, forming a oligonucleotide-transport agent conjugate.
  • a bifunctional reagent which uses disulfide as a junction piece and then is capable of cross-reaction with either proteins or DNA (RNA) can be used.
  • the conjugation methods described in the example Section 6, infra, or a modification thereof, can be used.
  • conjugation can be carried out by use of the reagent N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP; Pierce Chemical Co.) (See e.g., Jung et al., 1981, Biochem. Biophys. Res. Commun. 101:599- 606) .
  • SPDP readily modifies free-amino groups via formation of an amide linkage. At the same time, this in a second reaction involving disulfide exchange.
  • Coupling is achieved via disulfide exchange with an entity containing a free thiol via displacement of 2- thiopyridinone.
  • the resulting product contains the two molecules joined via a reducible disulfide linkage.
  • the oligonucleotide portion of the conjugates of the invention may be DNA or RNA, single-stranded or double-stranded.
  • the oligonucleotide is single-stranded DNA.
  • the oligonucleotide portion of the conjugate consists of 6-50 nucleotides, with a size of 8-30 nucleotides most preferred.
  • the oligonucleo- tide portion of the conjugate consists of 6-50 nucleo ⁇ tides, and is capable of hybridizing to at least a portion of a nucleic acid sequence within the target cell.
  • the oligonucleotide may be modified at any position on its structure with substituents generally known in the art.
  • the oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromo- uracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-adenine, 7-methylguanine, 5-methyl-
  • the oligonucleotide comprises at least one modified sugar moiety selected from the group including but not limited to arabinose,
  • the oligonucleo- tide comprises at least one modified phosphate backbone selected from the group consisting of a phosphoro- thioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphos- phonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the oligonucleo ⁇ tide is an ⁇ -anomeric oligonucleotide.
  • oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ⁇ -units, the strands run parallel to each other (Gautier et al, 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide may be conjugated to the transport agent via the molecular linker containing a disulfide linkage at the base moiety, at the sugar moiety, and/or at the phosphate backbone of the oligonucleotide.
  • the transport agents of the invention increase delivery of the oligonucleotides to which they are conjugated to a target cell.
  • the transport agents facilitate transport of the conjugated oligonucleotide across a cell membrane, or across the blood brain barrier in vivo.
  • the transport agent is cleaved from the oligonucleotide after uptake by the target cell, by intracellular reduction of the disulfide linkage.
  • the transport agent can be a molecule known in the art to gain entry into the cell through adsorptive endocytosis
  • the transport agent may be selected from the group including but not limited to cholesterol, a peptide, a protein, a lipid (e.g.
  • a fatty acid containing at least 12 carbon atoms a triglyceride, a phospholipid, a glucocorticoid) , a saccharide (e.g., mannose, glucose, galactose) , an 5 antibody, a nucleoside or nucleoside analog, and a biocompatible polymer (e.g. cellulose, polyethylene glycol, polyvinyl alcohol) .
  • the transport agent is a fatty acid containing 18 carbon atoms.
  • the transport agent is a fatty acid containing 18 carbon atoms.
  • oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R j -oligonucleotide, where R j and R 2 are hydrocarbon chains, and Rj may be identical to R 2 .
  • the oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R j -oligonucleotide, where R j and R 2 are hydrocarbon chains, and Rj may be identical to R 2 .
  • the oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R j -oligonucleotide, where R j and R 2 are hydrocarbon chains, and Rj may be identical to R 2 .
  • the oligonucleotide is a compound having the structure: cholesterol- dinucleotide-R j -S-S-R
  • the conjugates of the invention comprise a transport agent which facilitates passage through the blood-brain barrier. Since the
  • 9 -ft v blood-brain barri.er primarily comprises li.pi.ds, i.n this embodiment, it is preferred that the transport agent be lipophilic.
  • Such transport agents include but are not limited to cholesterol, a hydrophobic peptide, a fatty acid comprising at least 12 carbon atoms, a trigly-
  • the transport agent can be a peptide capable of crossing the blood-brain barrier, such as one of those disclosed in PCT International
  • transport agents may be modified at any position on their structure with substituents generally used in the art.
  • Peptides, 35 proteins, cholesterol, and lipid analogs may be substituted with substituents including but not limited to alkyl, cycloalkyl, aryl, alkaryl, hydroxyalkyl, ester, ether, amide, halo, nitro, cyano, and carboxylic acid.
  • derivatized nucleotides or nucleotide analogs providing for hybridization- 5 triggered cross-linking to other nucleotide sequences may be incorporated into conjugated oligonucleotides of the invention.
  • the present invention relates to methods for inhibiting the expression of a nucleic acid sequence in a procaryotic or eucaryotic plant or animal cell comprising providing a viable cell in culture or in vivo with a composition comprising an effective amount of the oligonucleotide conjugates of the invention.
  • the expression of the nucleic acid sequence in the cell is inhibited by hybridization of 0 . the oligonucleotide with the nucleic acid sequence in the cell.
  • such composition may inhibit the expression of a nucleic acid in a cell by inhibiting the action of polymerases in the cell.
  • such composition may inhibit the expression of a nucleic acid sequence in a cell by forming a triple helix with a double-stranded nucleic acid sequence in the cell.
  • the nucleic acid sequence may be present in a Q procaryotic or eucaryotic cell, a normal or neoplastic cell.
  • the cell is a mammalian cell.
  • the nucleic acid sequence may be endogenous to the cell, or may be found within the cell yet specific to a pathogenic organism.
  • 5 the nucleic acid sequence may be a DNA or RNA sequence.
  • the compositions of the present invention may be useful as therapeutic agents, and for example may be used to inhibit the expression of bacterial or viral or fungal proteins, or of cellular proteins such as oncogenes, as well as T cell receptors, which are postulated to play a role in autoimmune diseases. Alternatively, the compositions may be useful for agricultural purposes.
  • compositions may be used to alter the phenotypic characteristics of a plant, such as the modification of a particular enzymatic activity.
  • the oligonuc ⁇ leotide is cleaved from the transport agent during or after entry into a cell.
  • the expression of a nucleic acid sequence may be inhibited by providing the cell with an effective amount of a composition comprising the oligonucleotide conjugates of the invention, in which the oligonucleotide portion of the conjugate consists of 6-50 nucleotides, with a size of 8-30 nucleotides most preferred, and is capable of hybridizing to at least a portion of the nucleic acid sequence.
  • the oligonucleotide sequence is "antisense" or complementary, and thus capable of hybridizing, to the nucleic acid sequence.
  • the nucleic acid sequence can be contained within a single stranded, double stranded, or multiply stranded nucleic acid. Where the oligonucleo ⁇ tide conjugate binds to the oligonucleotide's comple ⁇ mentary sequence contained on a double stranded nucleic acid, a triple helix can be formed.
  • the oligonucleotide sequence may be complementary to the sequence of the complementary strand of the nucleic acid sequence. In another specific aspect, the oligonucleotide sequence can be complementary to the RNA transcribed off the nucleic acid sequence.
  • the oligonucleotide of the conjugate need not have a 5 sequence complementary to the nucleic acid sequence or to its complementary strand, since, e.g., certain oligonucleotides which are of random sequence or homopolymeric may inhibit the expression of certain non-complementary nucleic acid sequences such as those 0 which are of viral origin (see e.g., Aradi, J. and Ho, Y. K. , 1985, Cancer Biochem. Biophys. 7:349-359; Majumdar, C. , et al., 1989, Biochem. 28(3) :1340-1346) .
  • the expression of a nucleic acid sequence of a pathogenic organism can be ® inhibited.
  • the oligonucleotide portion of the conjugates of the invention comprises a sequence complementary and capable of hybridizing to at least a portion of a DNA or RNA sequence of the pathogenic organism.
  • a variety of diseases and disorders can be treated by administration to a subject of a composition comprising an effective amount of the oligonucleotide conjugates of the invention.
  • a composition comprising an effective amount of the oligonucleotide conjugates of the invention.
  • the disulfide linkage is cleaved and the oligonucleotide is released.
  • Viral diseases and disorders which can be treated by administration of a conjugate of the invention, in which the oligonucleotide inhibits 0 expression of a viral nucleic acid sequence include but are not limited to those caused by hepatitis B virus, cytomegalovirus, herpes simplex virus I or II, human immunodeficiency virus type I or II, influenza virus, respiratory syncytial virus, and human papilloma 5 virus.
  • Malignancies which can be treated by adminis- tration of a conjugate of the invention include but are not limited to lung cancer (e.g., small cell lung carcinoma) , colorectal cancer, prostate cancer, breast cancer, leukemias and lymphomas.
  • the oligonucleotide portion of the conjugate can be complementary to (and capable of hybridizing to) a gene encoding an aberrantly expressed oncogene, or to a gene encoding a growth factor required for maintenance of the malignant state.
  • the compositions may be used to treat a neurological disorder.
  • disorders can also be detected by detecting nucleic acid sequences associated with the presence of such diseases, disorders or malignancies, as provided by the present invention.
  • compositions consisting of an effective amount of the oligonucleotide conjugates of the invention formulated for a variety of modes of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences. Meade Publishing Co., Easton, PA, latest edition.
  • compositions of the invention are formulated in liquid solutions, such as deionized water, water, phosphate- buffered saline, or ethanol, and preferably in physiologically compatible buffers, such as Hank's or Ringer's.
  • physiologically compatible buffers such as Hank's or Ringer's.
  • the compositions may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • Systemic administration can also be by transmucosal or transdermal means, or the compositions may be administered orally.
  • penetrants appropriate to the barrier to be permeated are used in the formula ⁇ tion.
  • penetrants are generally known in the art and include, for example, for transmucosal administra ⁇ tion bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be through nasal sprays, for example, or using suppositories.
  • the compositions are formulated into conventional oral administration forms such as capsules, tablets, and tonics.
  • compositions of the invention are formulated into ointments, salves, gels, or creams, as generally known in the art.
  • the compositions may be formulated in the lumen of vesicles, such as liposomes.
  • an oligonucleotide conjugated at its 5' terminus to a transport agent via a molecular linker containing a disulfide, and which is endcapped at its 3' end with methoxyethylamine to help prevent degradation in vivo is administered intravenously.
  • compositions may be administered to a plant using various procedures known in the art (see Shew aker et al., U.S. Patent No. 4,801,540, issued
  • compositions of the present invention may be introduced into a suitable vector and administered to the plant via electropora- tion, transformation, inoculation, and the like.
  • an effective amount of an oligonucleotide conjugate of the invention in which the oligonucleotide consists of at least 6 nucleotides, is capable of hybridizing to at least a portion of a nucleic acid sequence within a cell, and is detectably labeled, may be used as a detection or diagnostic agent by hybridizing to its complementary nucleic acid sequence within the cell.
  • an effective amount of such an oligonucleotide conjugate may be used to detect a nucleic acid sequence in a viable procaryotic or eucaryotic cell in culture or in vivo
  • the detectable label which is linked to the oligonucleotide may be selected from the group including but not limited to a radioactive group, an enzyme, a fluorescent group, and an antibody.
  • the labelled oligonucleotide hybridizes to its complementary nucleic acid sequence within the cell, and is detected using procedures known in the art.
  • the present invention also includes methods for detecting the presence of a nucleic acid sequence of an exogenous infectious agent or of a selected gene utilizing oligonucleotide-disulfide conjugates as nucleic acid-based diagnostic probes.
  • One such method consists of an indirect assay, whereby human body fluids, tissue or cell extracts are screened for the presence of a target DNA by binding an oligonucleotide bound to a support membrane.
  • An oligonucleotide probe containing a reporter group linked to an oligonucleotide via a disulfide linker can be added to a DNA mixture containing the target DNA sequence.
  • the reporter group which may consist of, but is not limited to, an enzyme such as alkaline phosphatase may be released from the target DNA/oligonucleotide probe by adding a reducing reagent, e.c ., dithiothreitol.
  • a reducing reagent e.c ., dithiothreitol.
  • DNA can then be qualitatively and quantitatively measured by detection of the reporter group, e.g., spectrophotometrically.
  • Another such embodiment of the invention utilizes a diagnostic assay whereby an oligonucleotide probe containing a linker with a free thiol group can be used to hybridize with a target DNA sequence that has previously been immobilized on a solid support membrane. The resulting unbound DNA probe is then washed away and a reporter group containing a free thiol group is attached to the free thiol group of the oligonucleotide linker complex by disulfide bond formation. The presence of target DNA can then be measured by detection of the reporter group.
  • the oligonucleotide, rather than the target DNA can be immobilized on the solid support.
  • nucleotides containing specific hybridization-triggered crosslinking agents can be incorporated within the oligonucleotide probe, in order to amplify sensitivity and reduce background in diagnostic assays.
  • the use of crosslinking agents w ll permit novel diagnostic assay modifications such as a) the use of the crosslinker to increase probe discrimination b) incorporation of a denaturing wash step to reduce background and c) carrying out hybridization and crosslinking at or near the melting temperature of the hybrid DNA will reduce secondary structure in the target DNA and to increase probe specificity.
  • Another specific embodiment of the present invention involves using probes containing disulfide linkers in combination with base analogs such as 5 methycytosine, for use in diagnostic assays that are based on sequence specific binding to double stranded
  • triple helix probes may be conjugated to various reporter groups known in the art to facilitate detection or quantitation of specific regions of double stranded DNA. Probes that form triple helix structures can also incorporate additional modifications such as altered internucleotide linkages that render the oligonucleotide nuclease stable. Such stable oligonucleotides will be useful for assays conducted in the presence of cell or tissue extracts which normally contain nuclease activity.
  • An additional embodiment of the present invention comprises using oligonucleotides with a thiol group for attachment to a solid support derivatized with thiol groups, by formation of a disulfide linkage, in order to bind complementary DNA sequences found in human body fluids, cell or tissue extracts.
  • the solid support is comprised of one of the following: Sulfolink® Coupling Gel Columns, Tresyl Activated Agarose, ImmunoPure® Epoxy-activated Agarose, and TNB Thiol Agarose (Pierce Chemical Company) .
  • Another embodiment of this invention is comprised of double stranded oligonucleotides containing the binding site sequence recognized by a cognate DNA-binding protein, which can be used in the assays described above to bind specifically to a DNA- binding protein from a mixture of proteins isolated from cell or tissue extracts.
  • 2-Dimethoxytrityl-2-hydroxyethyl disulfide hydrogen phosphonate was prepared by reacting 2- dimethoxytrityl-2-hydroxyethyl disulfide with 2-chloro- 4H-1,2,3-benzodioxaphosphorin-4-one.
  • Cholesterol (3.4 g; 8.8 mmole) in 50 ml methylene chloride was added to a 0 ⁇ C methylene chloride solution (100 ml) or 2-chloro-4H-l,2,3- benzodioxaphozphorin-4-one (20 mmole in 20 ml l M methylene chloride) and pyridine (1.6. ml, 20mmole) .
  • the hydrogen phosphonate was incorporated into the 5' position of d-CAGTGATT using standard hydrogen phosphonate chemistry on a Biosearch automated DNA synthesizer using the procedure described by 5 Froehler et al. (1986, Nucl. Acids Res. 14:5399-5407).
  • the dimethoxytrityl group was removed and TC was subsequently added to R-S-S-R-CAGTGATT using standard hydrogen phosphonate chemistry on a Biosearch automated DNA synthesizer as described.
  • TC-R-S-S-R-CAGTGATT was subsequently reacted with the triethylammonium salt of cholesteryl hydrogen-phosphonate triethylammonium salt.
  • the structure of the reaction product is shown in Figure 1.
  • CHOLESTEROL-TC-R-S-S-R-CAGTGATT (I) was labelled at the 3' end by the incorporation of 10 ⁇ Ci ⁇ .- 32 P-UTP (A ⁇ rsham, 3000 Ci/ramol ⁇ ) using 10 U terminal 0 transferase (New England Nuclear) .
  • the reaction mixture was incubated for 1 hour at 37°C using terminal transferase tailing buffer.
  • the reaction mixture was subsequently diluted in 10 mM Tris, 1 mM EDTA, pH 7.5.
  • the oligodeoxyribonucleotide 5'- TTTTTTTCTCCAT-3' was 5' end labelled using ⁇ - 32 P-ATP and T4 polynucleotide kinase.
  • This oligonucleotide contains 0 methoxyethylamine end-caps at the 2-3 • most diester linkages and was prepared via hydrogen-phosphonate chemistry (Froehler, 1986, Tet. Letters 27:5575-5578).
  • the oligodeoxyribonucleotide was phosphorylated at the 5' end by reacting the oligodeoxyribonucleotide with ⁇ -
  • the 32 P-labelled oligonucleotide was eluted from the gel in 10 mM Tris, pH 7.5, l mM EDTA overnight. The sample was desalted and concentrated using a C8 quick sep column (Baker) , eluting the 32 P-labelled oligodeoxyribonucleotide with 30% acetonitrile/water. 35 The solvent was then removed and the product resuspended in 100 ⁇ l of sterile water.
  • CAGTGATTTTTTTTTCTCCAT (4 X 10 6 cpm) which was endcapped at the 3' end with methoxy ethylamine (MEA) phosphor- amidate in 10% heat inactivated fetal calf serum (FCS)-
  • the reaction was stopped by the addition of 5 mM EDTA. 0
  • the cell suspension was pelleted via cent ⁇ fugation in an eppendorf microcentrifuge at 6000 rpm for 5 minutes at 4°C.
  • the cell pellet was washed with 100 ⁇ l PBS and respun in an eppendorf microcentrifuge at 6000 rpm for
  • Tris pH 7.5 containing 15 mM KC1, 2 mM MgC12, 0.1 mM
  • 3'-MEA endcapped internal 3 P-labelled CHOLESTEROL-TC-R-S-S-R-CAGTGATTTTTTTTTCTCCAT was tested 5 for nuclease and reduction stability in RPMI medium supplemented with 15% heat inactivated FCS.
  • 3'-MEA endcapped internal 32 P-labelled CHOLESTEROL-TC-R-S-S-R- CAGTGATTTTTTTTTCTCCAT (4 X 10 5 cpm) was added to 20 ⁇ l of cell medium. Five ⁇ l was removed at 0, 30, 60, and
  • the disulfide linkage is stable to reduction in media containing FCS.
  • the hydrogen phosphonate (2) was incorporated into the 5* position of GC using standard hydrogen phosphonate chemistry on a Biosearch automated DNA synthesizer using the procedure described by Froehler et al. ((1986) Nucleic Acids Res. 14 5399-5407). The dimethoxytritryl group was subsequently removed and oligodeoxynucleotide synthesis continued. Oxidation to the phosphodiester was performed using CC1 4 as previously described.
  • the ligated product was purified via 15% denaturing polyacrylamide gel electrophoresis. Product was visualized via autoradiography and cut out of the gel. The 32 P labeled oligonucleotide was eluted from the gel, desalted and concentrated using C8 reverse phase chromatography.
  • the product was eluted using 30% acetonitrile in water.
  • the cell pellet was washed with 100 uL PBS and respun (6K-5mins) . This procedure was repeated three times. The cell pellet was resuspended in 20 uL of 10 mM Tris pH 7.5 containing 15 mM KC1, 2 mM MgCL2, 0.1 mM EDTA and 0.2% NP-40. The sample was placed on ice for 1 minute followed by 30 seconds of vortexing. This was repeated. This extract was then spun at 3K for 5 mins at 4°C. The supernatent was then removed and diluted into 7M urea loading buffer.
  • the pelleted nuclei were then disrupted in 20 uL of 10 mM Tris pH 7.5 containing 15 mM KC1, 2 mM MgCl 2 , 0.1 mM EDTA and 100 mM NaCl at 65°C for 5 mins. An equal volume of 7M urea loading buffer was then added.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
EP91918074A 1990-03-29 1991-03-29 Disulfidkonjugate von oligonukleotid-transportagenten Withdrawn EP0537299A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50236190A 1990-03-29 1990-03-29
US502361 1990-03-29

Publications (2)

Publication Number Publication Date
EP0537299A4 EP0537299A4 (de) 1993-02-05
EP0537299A1 true EP0537299A1 (de) 1993-04-21

Family

ID=23997461

Family Applications (1)

Application Number Title Priority Date Filing Date
EP91918074A Withdrawn EP0537299A1 (de) 1990-03-29 1991-03-29 Disulfidkonjugate von oligonukleotid-transportagenten

Country Status (5)

Country Link
EP (1) EP0537299A1 (de)
JP (1) JPH05505941A (de)
AU (1) AU7759291A (de)
CA (1) CA2079109A1 (de)
WO (1) WO1991014696A1 (de)

Families Citing this family (112)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US6114513A (en) * 1990-01-11 2000-09-05 Isis Pharmaceuticals, Inc. Thiol-derivatized oligonucleotides
US5578718A (en) * 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US6395492B1 (en) 1990-01-11 2002-05-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5852182A (en) * 1990-01-11 1998-12-22 Isis Pharmaceuticals Inc. Thiol-derivatized oligonucleosides
US6753423B1 (en) 1990-01-11 2004-06-22 Isis Pharmaceuticals, Inc. Compositions and methods for enhanced biostability and altered biodistribution of oligonucleotides in mammals
US6153737A (en) * 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5962219A (en) * 1990-06-11 1999-10-05 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-selex
US5723289A (en) * 1990-06-11 1998-03-03 Nexstar Pharmaceuticals, Inc. Parallel selex
US6147204A (en) * 1990-06-11 2000-11-14 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US6030776A (en) * 1990-06-11 2000-02-29 Nexstar Pharmaceuticals, Inc. Parallel SELEX
US5705337A (en) * 1990-06-11 1998-01-06 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
US6011020A (en) * 1990-06-11 2000-01-04 Nexstar Pharmaceuticals, Inc. Nucleic acid ligand complexes
US6465189B1 (en) 1990-06-11 2002-10-15 Gilead Sciences, Inc. Systematic evolution of ligands by exponential enrichment: blended selex
US6083696A (en) * 1990-06-11 2000-07-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands exponential enrichment: blended selex
US6168778B1 (en) 1990-06-11 2001-01-02 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) Nucleic Acid Ligand Complexes
US6465188B1 (en) 1990-06-11 2002-10-15 Gilead Sciences, Inc. Nucleic acid ligand complexes
US5683867A (en) * 1990-06-11 1997-11-04 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: blended SELEX
US7119184B2 (en) 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
ATE239484T1 (de) * 1991-10-24 2003-05-15 Isis Pharmaceuticals Inc Derivatisierte oligonukleotide mit verbessertem aufnahmevermögen
US6831166B2 (en) 1992-10-23 2004-12-14 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5795870A (en) * 1991-12-13 1998-08-18 Trustees Of Princeton University Compositions and methods for cell transformation
US5693769A (en) * 1991-12-13 1997-12-02 Transcell Technologies, Inc. Glycosylated steroid derivatives for transport across biological membranes and process for making and using same
US5780444A (en) * 1991-12-13 1998-07-14 Trustees Of Princeton University Compositions and methods for cell transformation
US6020482A (en) * 1992-05-25 2000-02-01 Gosselin; Gilles Phosphotriester type biologically active compounds
FR2691463A1 (fr) * 1992-05-25 1993-11-26 Centre Nat Rech Scient Dérivés nucléotidiques, leur préparation et leur application en thérapeutique.
FR2692265B1 (fr) * 1992-05-25 1996-11-08 Centre Nat Rech Scient Composes biologiquement actifs de type phosphotriesters.
US5849905A (en) * 1994-11-23 1998-12-15 Centre National De La Recherche Scientifique Biologically active phosphotriester-type nucleosides and methods for preparing same
US5770725A (en) * 1992-05-25 1998-06-23 Gosselin; Gilles Phosphotriester type biologically active compounds
US5607691A (en) * 1992-06-12 1997-03-04 Affymax Technologies N.V. Compositions and methods for enhanced drug delivery
EP0693939A1 (de) * 1993-04-14 1996-01-31 Roche Diagnostics GmbH Nukleinsäure-transferpeptide und deren verwendung zur einschleusung von nukleinsäuren in eukaryontische zellen
US5955591A (en) * 1993-05-12 1999-09-21 Imbach; Jean-Louis Phosphotriester oligonucleotides, amidites and method of preparation
US5719273A (en) * 1993-06-14 1998-02-17 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modifications methods using nucleophiles and carbon monoxide
US5580972A (en) * 1993-06-14 1996-12-03 Nexstar Pharmaceuticals, Inc. Purine nucleoside modifications by palladium catalyzed methods
US6653458B1 (en) 1993-09-03 2003-11-25 Isis Pharmaceuticals, Inc. Modified oligonucleotides
US5998142A (en) * 1993-09-08 1999-12-07 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-SELEX
KR100361933B1 (ko) 1993-09-08 2003-02-14 라 졸라 파마슈티칼 컴파니 화학적으로정의된비중합성결합가플랫폼분자및그것의콘주게이트
WO1995007092A1 (en) * 1993-09-10 1995-03-16 The University Of Medicine And Dentistry Of New Jersey Blood-brain barrier transporters of neurological agents
DE4437502A1 (de) * 1993-12-02 1995-06-08 Basf Ag Hirudin-Konjugate aus Hirudin und lipophilen Verbindungen
US5830686A (en) * 1994-01-13 1998-11-03 Calydon Tissue-specific enhancer active in prostate
US6057299A (en) * 1994-01-13 2000-05-02 Calydon, Inc. Tissue-specific enhancer active in prostate
DE4421079C1 (de) * 1994-06-16 1995-08-17 Peter Dr Rer Nat Seibel Chimäres Peptid-Nukleinsäure-Fragment, Verfahren zu seiner Herstellung und die Verwendung des Fragments zur zielgerichteten Nukleinsäureeinbringung in Zellorganellen und Zellen
US6048698A (en) * 1994-09-20 2000-04-11 Nexstar Pharmaceuticals, Inc. Parallel SELEX™
US5627185A (en) * 1994-11-23 1997-05-06 Gosselin; Gilles Acyclovir derivatives as antiviral agents
CA2212682A1 (en) 1995-02-10 1996-08-15 Worcester Foundation For Experimental Biology, Inc. Delivery of exogenous compounds
AU5370696A (en) * 1995-03-24 1996-10-16 Board Of Regents, The University Of Texas System Egf-targeted nucleic acid delivery
US5859228A (en) * 1995-05-04 1999-01-12 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US8071737B2 (en) 1995-05-04 2011-12-06 Glead Sciences, Inc. Nucleic acid ligand complexes
US6229002B1 (en) 1995-06-07 2001-05-08 Nexstar Pharmaceuticlas, Inc. Platelet derived growth factor (PDGF) nucleic acid ligand complexes
US5959100A (en) 1996-03-27 1999-09-28 Nexstar Pharmaceuticals, Inc. Pyrimidine nucleosides as therapeutic and diagnostic agents
US5945527A (en) * 1996-05-30 1999-08-31 Nexstar Pharmaceuticals, Inc. Palladium catalyzed nucleoside modification methods using nucleophiles and carbon monoxide
US6838238B1 (en) 1996-10-17 2005-01-04 Invitrogen Corporation Morphatides: novel shape and structure libraries
US6051698A (en) * 1997-06-06 2000-04-18 Janjic; Nebojsa Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US6426335B1 (en) 1997-10-17 2002-07-30 Gilead Sciences, Inc. Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes
US5925628A (en) * 1997-03-31 1999-07-20 Genzyme Corporation Cationic amphiphiles for intracellular delivery of therapeutic molecules
US5912239A (en) * 1997-04-04 1999-06-15 Genzyme Corporation Imidazole-containing cationic amphiphiles for intracellular delivery of therapeutic molecules
US5948925A (en) * 1997-05-06 1999-09-07 Genzyme Corporation Cationic amphiphiles containing linkers derived from neutral or positively charged amino acids
US5952516A (en) * 1997-05-08 1999-09-14 Genzyme Corporation Cationic amphiphiles containing multiplesteroid lipophilic groups
US5942634A (en) * 1997-05-09 1999-08-24 Genzyme Corporation Cationic amphiphiles for cell transfections
AU741546B2 (en) * 1997-07-24 2001-12-06 Perseptive Biosystems, Inc. Conjugates of transporter peptides and nucleic acid analogs, and their use
EP1002103B1 (de) 1997-08-04 2007-10-17 Cell Genesys, Inc. Enhancer des menschlichen glandulären kallikreingens, vektoren die ihn enthalten und methoden für seine verwendung
CN1289371A (zh) 1998-01-30 2001-03-28 阿文蒂斯药物股份有限公司 对还原条件敏感的转染化合物,含有它们的药物组合物及其应用
US6531590B1 (en) * 1998-04-24 2003-03-11 Isis Pharmaceuticals, Inc. Processes for the synthesis of oligonucleotide compounds
US6169078B1 (en) 1998-05-12 2001-01-02 University Of Florida Materials and methods for the intracellular delivery of substances
WO2000012530A1 (en) * 1998-08-26 2000-03-09 Nexstar Pharmaceuticals, Inc. dU SITE-DIRECTED CLEAVAGE OF COVALENT CONJUGATES
US6020483A (en) 1998-09-25 2000-02-01 Nexstar Pharmaceuticals, Inc. Nucleoside modifications by palladium catalyzed methods
AU1750400A (en) * 1998-12-04 2000-06-26 Mosaic Technologies, Inc. Method for the immobilization of oligonucleotides
US6121437A (en) * 1999-03-16 2000-09-19 Isis Pharmaceuticals, Inc. Phosphate and thiophosphate protecting groups
US6822086B1 (en) 1999-08-09 2004-11-23 The General Hospital Corporation Drug-carrier complexes and methods of use thereof
US8106098B2 (en) 1999-08-09 2012-01-31 The General Hospital Corporation Protein conjugates with a water-soluble biocompatible, biodegradable polymer
AU2001238346A1 (en) 2000-02-15 2001-08-27 Genzyme Corporation Modification of biopolymers for improved drug delivery
US6749865B2 (en) 2000-02-15 2004-06-15 Genzyme Corporation Modification of biopolymers for improved drug delivery
CN1434726A (zh) 2000-06-08 2003-08-06 拉卓拉药物公司 包含高分子量聚环氧乙烷的多价平台分子
US6706474B1 (en) 2000-06-27 2004-03-16 Board Of Trustees Of The University Of Illinois Nucleic acid enzyme biosensors for ions
US6559279B1 (en) 2000-09-08 2003-05-06 Isis Pharmaceuticals, Inc. Process for preparing peptide derivatized oligomeric compounds
NZ511705A (en) * 2001-05-14 2004-03-26 Horticulture & Food Res Inst Methods and rapid immunoassay device for detecting progesterone and other steroids
US7109165B2 (en) 2001-05-18 2006-09-19 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20030113714A1 (en) * 2001-09-28 2003-06-19 Belcher Angela M. Biological control of nanoparticles
US20030148380A1 (en) 2001-06-05 2003-08-07 Belcher Angela M. Molecular recognition of materials
AU2002359761A1 (en) 2001-12-18 2003-06-30 Invenux, Inc. Antibiotic compounds
SE0201234D0 (sv) * 2002-04-24 2002-04-24 Avaris Ab Transfer complex with added functionality and methods for its use
US6890719B2 (en) 2002-05-10 2005-05-10 The Board Of Trustess Of The University Of Illinois Fluorescence based biosensor
US20050064508A1 (en) 2003-09-22 2005-03-24 Semzyme Peptide mediated synthesis of metallic and magnetic materials
US8853376B2 (en) 2002-11-21 2014-10-07 Archemix Llc Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US6913890B2 (en) 2002-12-18 2005-07-05 Palo Alto Research Center Incorporated Process for preparing albumin protein conjugated oligonucleotide probes
US7816337B2 (en) 2003-02-18 2010-10-19 Roche Madison Inc. Reversible attachment of a membrane active polymer to a polynucleotide
EP1622572B1 (de) * 2003-04-30 2017-12-20 Sirna Therapeutics, Inc. Konjugate und zusammensetzungen für die zelluläre abgabe
KR101298493B1 (ko) * 2003-09-09 2013-08-21 제론 코포레이션 텔로머라제 억제를 위한 변형 올리고뉴클레오티드
EP1695717A1 (de) * 2005-02-23 2006-08-30 Ludwig-Maximilians-Universität Transport Nano- und Makromolecularer Strukturen ins Zytoplasma und in den Zellkern
US7892734B2 (en) 2005-08-11 2011-02-22 The Board Of Trustees Of The University Of Illinois Aptamer based colorimetric sensor systems
US7799554B2 (en) 2006-03-16 2010-09-21 The Board Of Trustees Of The University Of Illinois Lateral flow devices
JP6125741B2 (ja) * 2006-07-12 2017-05-17 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア 可逆的なホスホトリエステル電荷中和保護基による核酸の形質導入可能な送達
US8415461B2 (en) 2007-01-19 2013-04-09 The Board Of Trustees Of The University Of Illinois Amphiphilic substances and functionalized lipid vesicles including the same
US8785409B2 (en) 2007-01-30 2014-07-22 Geron Corporation Compounds having anti-adhesive effects on cancer cells
US8058415B2 (en) 2007-04-24 2011-11-15 The Board Of Trustees Of The University Of Illinois Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes
WO2009012309A2 (en) 2007-07-16 2009-01-22 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for divalent copper ion detection
US8568690B2 (en) 2007-07-31 2013-10-29 The Board Of Trustees Of The University Of Illinois MRI contrast agents and high-throughput screening by MRI
WO2009045632A2 (en) 2007-08-10 2009-04-09 The Board Of Trustees Of The University Of Illinois Nucleic acid based fluorescent sensor for mercury detection
US8062893B2 (en) 2008-10-10 2011-11-22 The Board Of Trustees Of The University Of Illinois Fluorescent sensor for mercury
BR112012025872B8 (pt) 2010-04-12 2021-05-25 Somalogic Inc primidinas modificadas na posição-5
CN104788523B (zh) 2010-06-22 2017-09-08 欧恩科斯欧公司 用于核酸结合物的具有内涵体溶解剂的优化的体内递送系统
US8815156B2 (en) 2010-07-19 2014-08-26 Andalyze, Inc. Sensor housing and reagent chemistry
EP2527440A1 (de) * 2011-05-27 2012-11-28 Institut Curie Krebsbehandlung durch Kombination von Doppelstrangbruch nachahmenden DNA-Molekülen mit Hyperthermie
IN2015DN01765A (de) 2012-08-20 2015-05-29 Univ California
WO2015069932A1 (en) * 2013-11-06 2015-05-14 Solstice Biologics, Ltd. Polynucleotide constructs having disulfide groups
JOP20200257A1 (ar) 2014-05-01 2017-06-16 Geron Corp تركيبات أوليجو نوكليوتيد وطرق لتحضيرها
ES2879434T3 (es) 2015-07-23 2021-11-22 Inst Curie Uso de una combinación de molécula Dbait e inhibidores de PARP para tratamiento del cáncer
EP3500581A4 (de) 2016-08-17 2021-10-06 Solstice Biologics, Ltd. Polynukleotidkonstrukte
AU2017315670B2 (en) 2016-08-23 2022-03-17 Dicerna Pharmaceuticals, Inc. Compositions comprising reversibly modified oligonucleotides and uses thereof
EP3645546A4 (de) 2017-06-30 2021-12-01 Solstice Biologics, Ltd. Chirale phosphoramidithilfsmittel und verfahren zu ihrer verwendung
EP3674407A4 (de) 2017-08-22 2022-01-12 National University Corporation Nagoya University Modifiziertes polynukleotid

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4471113A (en) * 1982-02-03 1984-09-11 The United States Of America As Represented By The Department Of Energy Prodrugs based on phospholipid-nucleoside conjugates
CA1223831A (en) * 1982-06-23 1987-07-07 Dean Engelhardt Modified nucleotides, methods of preparing and utilizing and compositions containing the same
US4587044A (en) * 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5223263A (en) * 1988-07-07 1993-06-29 Vical, Inc. Liponucleotide-containing liposomes
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
JPS638396A (ja) * 1986-06-30 1988-01-14 Wakunaga Pharmaceut Co Ltd ポリ標識化オリゴヌクレオチド誘導体
US4904582A (en) * 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4837311A (en) * 1987-06-22 1989-06-06 Hoffman-La Roche Inc. Anti-retroviral compounds
WO1989005853A1 (en) * 1987-12-15 1989-06-29 Synthetic Genetics Nucleic acid chelate conjugate as therapeutic and diagnostic agents

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
No further relevant documents have been disclosed. *
See also references of WO9114696A1 *

Also Published As

Publication number Publication date
WO1991014696A1 (en) 1991-10-03
JPH05505941A (ja) 1993-09-02
EP0537299A4 (de) 1993-02-05
CA2079109A1 (en) 1991-09-30
AU7759291A (en) 1991-10-21

Similar Documents

Publication Publication Date Title
EP0537299A1 (de) Disulfidkonjugate von oligonukleotid-transportagenten
US5574142A (en) Peptide linkers for improved oligonucleotide delivery
EP0462145B1 (de) Kovalente konjugate von lipiden und oligonukleotiden
US6444806B1 (en) Conjugates and methods of forming conjugates of oligonucleotides and carbohydrates
CA2071536C (en) Triple helix formation in oligonucleotide therapy
US6235886B1 (en) Methods of synthesis and use
JP2937481B2 (ja) 多薬剤耐性関連タンパク質のオリゴヌクレオチド調整
JP2735813B2 (ja) 標的ポリヌクレオチドにハイブリッド形成するための新規な一工程方法とポリヌクレオチド化合物
US5739309A (en) Enhancement of oligonucleotide inhibition of protein production, cell proliferation and / or multiplication of infectious disease pathogens
WO1994013325A9 (en) Peptide linkers for improved oligonucleotide delivery
JPH06508022A (ja) 生体分子に特異的なアプタマーおよび生産方法
WO1992010590A1 (en) Inhibition of transcription by formation of triple helixes
US20080071069A1 (en) Conjugates and processes for their preparation and their use for transporting molecules across biological membranes
WO1992020698A1 (en) Sequence specific dna binding drugs
US6828434B2 (en) Oligonucleotide and nucleotide amine analogs, methods of synthesis and use
US20070161587A1 (en) Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
EP0579771A1 (de) Einzelsträngige zirkulare oligonukleotide
EP0531436A1 (de) Sequenzspezifische, nichtphotoaktivierte, an den grossen graben doppelsträngiger dna bindende quervernetzende agentien
US5834607A (en) Amines and methods of making and using the same
AU689129B2 (en) Enhancement of oligonucleotide inhibition of protein production, cell proliferation, and/or multiplication of infectious disease pathogens
WO1994006815A9 (en) Oligonucleotide and nucleotide amine analogs, methods of synthesis and use
WO2003025139A2 (en) Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
JP4854913B2 (ja) オリゴヌクレオチド結合体
EP1007735A1 (de) Pharmakologisch wirksame stoffe aus anti-strang-oligonukleotiden
Boiziau et al. Modified oligonucleotides in rabbit reticulocytes: uptake, stability and antisense properties

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19920918

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): DE FR GB

17Q First examination report despatched

Effective date: 19931221

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19970503