EP0466780A1 - Megakaryozyten-wachstumssteigernde wirkung - Google Patents

Megakaryozyten-wachstumssteigernde wirkung

Info

Publication number
EP0466780A1
EP0466780A1 EP90906033A EP90906033A EP0466780A1 EP 0466780 A1 EP0466780 A1 EP 0466780A1 EP 90906033 A EP90906033 A EP 90906033A EP 90906033 A EP90906033 A EP 90906033A EP 0466780 A1 EP0466780 A1 EP 0466780A1
Authority
EP
European Patent Office
Prior art keywords
mgpa
csf
cells
megakaryocyte
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP90906033A
Other languages
English (en)
French (fr)
Other versions
EP0466780A4 (en
Inventor
Barbara Winslow Grant
Kenneth G. Mann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Vermont
Genetics Institute LLC
University of Vermont and State Agricultural College
Original Assignee
University of Vermont
Genetics Institute LLC
University of Vermont and State Agricultural College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Vermont, Genetics Institute LLC, University of Vermont and State Agricultural College filed Critical University of Vermont
Publication of EP0466780A1 publication Critical patent/EP0466780A1/de
Publication of EP0466780A4 publication Critical patent/EP0466780A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel protein factor which stimulates the growth of megakaryocytes and augments the differentiation or maturation of megakaryocytes. Also provided are processes for obtaining the factor in homogeneous form and producing it by recombinant genetic engineering techniques.
  • Megakaryocytes are the hematopoietic cells, largely found in the bone marrow, but also in peripheral blood and perhaps other tissues as well, whi,ch produce platelets (also known as thrombocytes) and subsequently release them into circulation. Megakaryocytes, like all
  • hematopoietic cells of the human hematopoietic system ultimately derive from a primitive pluripotent marrow stem cell after passing through a complex pathway comprising many cellular divisions and considerable differentiation and maturation.
  • Mature megakaryocytes ultimately undergo subdivisions and release the cytoplasmic fragments which are circulating platelets.
  • the platelets derived from these megakaryocytic cells are critical for initiating blood clot formation at the site of injury. Platelets also release growth factors at the site of clot formation that speed the process of wound healing and may serve other functions.
  • Clinical experience has shown that control mechanisms exist to maintain effective platelet numbers in humans, but that at times these specific controls are either inadequate or ineffective and lead to depressed levels of platelets (thrombocytopenia) or thro bocytosis despite normal numbers of red blood cells and white blood cells.
  • the inability to form clots is the most immediate and serious consequence of a low platelet count, a potentially fatal complication of many therapies for cancer. Such cancer patients are generally treated for this problem with platelet transfusions.
  • platelets for such procedures are obtained by plateletphoresis from normal donors.
  • platelets for transfusion have a relatively short shelf-life and also expose the patients to considerable risk of exposure to dangerous viruses, such as the human immunodeficiency virus (HIV) or the various hepatitis viruses.
  • HIV human immunodeficiency virus
  • Megakaryocyte colony-stimulating factors eg- CSFs
  • CFU-M megakaryocytic progenitors
  • TPO thrombopoietin
  • megakaryocyte stimulating activity megakaryocyte stimulating activity
  • megakaryocyte potentiating activity thrombopoietin-like activity. It is unclear whether thrombopoietic factors are structurally identical or related to any of the in vitro defined megakaryocyte stimulating activities.
  • IL-3 supports human megakaryocyte colony formation and, at least in monkeys, also frequently elicits an elevation in platelet count.
  • IL-3 influences hematopoietic cell development in all of the hematopoietic lineages and can be distinguished from specific regulators of megakaryocytopoiesis and platelet formation which interact selectively with cells of the megakaryocytic lineage.
  • IL-6 has TPO-like or megakaryocyte potentiating activity in human in vitro assays [see, e.g., E. Bruno and R. Hoffman, Exp. He atol.. .12:1038-4 (1989)]. In most of these assays human IL-6 has shown no TPO-like activity [M. Teramura et al, EXP. Hematol.. 12:1011-1016 (1989) and M. W. Long et al, J. Clin. Invest.. 81:1779-1786 (1988)]. R. Hoffman et al, J. Clin. Invest. , 75:1174-
  • HEK-derived activity can increase isotopic incorporation into platelets when given parenterally in mice, and increase the production of platelet factor 4-like proteins in rodent megakaryocyte lineage cells. This activity is heat stable, and maintains activity after treatment with endoglycosidases, and binds to wheat germ lectin. Finally, activities have been described from urine that promote megakaryocyte growth in rodents in vivo and in marrow culture.
  • Kawakita has partially purified an activity from urine that varies with patient platelet count, and under dissociating conditions has a molecular weight of 45,000.
  • the activity of this on human megakaryocyte progenitors has not been tested, nor has it been shown to be specific for the megakaryocyte hematopoietic lineage.
  • M. Kawakita et al Br. J. Haem. , 62 . :715-722 (1986); M. Kawakita et al, Blood. 61:556-560 (1983) ; see, also, S. Kuriya et al, Exp. Cell Biol.. 5_5:257-264 (1987) ; K. Enomoto et al, Brit. J. Haem.
  • the present invention provides a novel proteinaceous megakaryocyte growth promoting activity factor ("MGPA") which is substantially free from other human proteins.
  • This protein may be purified from cell sources producing the factor naturally or upon induction with other factors. It may also be produced by recombinant genetic engineering techniques. MGPA may also be synthesized by chemical techniques, or a combination of the above-listed techniques.
  • the MGPA of the present invention has been found to be specific to the megakaryocyte lineage, augmenting maturation and/or proliferation of megakaryocytes in # the assay of Example 1 below.
  • Active MGPA has an apparent molecular weight of approximately 45 kd as determined by gel filtration chromatography and sodium dodecyl sulfate polyacrylamide gel electrophoresis. MGPA is further characterized in that it does not bind wheat germ lectin. The factor does bind to a cation exchange resin (e.g. ,
  • MGPA Pharmacia Mono S column
  • MGPA is further characterized by its ability to act in an additive or synergistic manner with GMCSF and IL3 to promote megakaryocyte growth in liquid bone marrow culture systems.
  • Still a further aspect of the present invention is a process for isolating and purifying the MGPA composition of the present invention or a fragment thereof from human urine.
  • This purification process provided by the present invention involves the following steps. The first two steps are ammonium sulfate precipitation, followed by cation exchange column chromatography on sulphopropyl Sephadex at pH5.4 in 25mM ammonium acetate buffer. This step is followed by subjecting the MGPA-containing fractions to filtration through a polyethyleneimine anion exchange membrane in 50mM ammonium bicarbonate buffer at pH 7.4. The MGPA- containing filtrate is then subjected to reverse phase high performance liquid chromatography (HPLC) on a C3 column with 0.05% trifluoroacetic acid (TFA) and acetonitrile as the mobile phase solvent.
  • HPLC reverse phase high performance liquid chromatography
  • a further aspect of the present invention is homogeneous MGPA purified from urine or produced via recombinant or synthetic techniques which is characterized by a specific activity in the radioimmunoassay of greater than 1 X 10 6 units/mg.
  • Another aspect of the present invention is a DNA sequence that encodes the expression of a human MGPA protein.
  • This DNA sequence may include an isolated DNA sequence that encodes the expression of a human MGPA protein as / described above.
  • the DNA sequence may also include 5 ' and 3 ' human non-coding sequences flanking the MGPA coding sequence.
  • the DNA sequence may also encode an amino terminal signal peptide.
  • a recombinant DNA molecule comprising vector DNA and a DNA sequence encoding human MGPA.
  • the DNA molecule provides the MGPA DNA in operative association with a regulatory sequence capable of directing the replication and expression of MGPA in a selected host cell.
  • Host cells transformed with such DNA molecules for use in expressing recombinant MGPA protein are also provided by the present invention.
  • the DNA molecules and transformed cells of the invention are employed in another aspect, a novel process for producing recombinant human MGPA protein, or peptide fragments thereof.
  • a cell line transformed with a DNA sequence encoding expression of MGPA protein or a fragment thereof (or a recombinant DNA molecule as described above) in operative association with a suitable regulatory or expression control sequence capable of controlling expression of the protein is cultured under appropriate conditions permitting expression of the recombinant DNA.
  • This claimed process may employ a number of known cells as host cells for expression of the protein.
  • Presently preferred cell lines for producing MGPA are mammalian cell lines and bacterial cells.
  • the expressed MGPA protein is then harvested from the host cell, cell lysate or culture medium by suitable conventional means.
  • the conditioned medium may be processed through the same purification steps or modifications thereof as used to isolate the MGPA from urine.
  • MGPA protein As still a further aspect of the present invention, there is provided recombinant MGPA protein.
  • This protein is substantially free from other human proteinaceous materials and comprising a DNA sequence encoding one or more of the peptide fragments or sequences described herein.
  • the MGPA protein of this invention is also characterized by containing one or more of the physical, biochemical, pharmacological or biological activities described herein.
  • compositions containing a therapeutically effective amount of homogeneous or recombinant MGPA or an effective amount of one or more active peptide fragments thereof. These pharmaceutical compositions may be employed in methods for treating disease states or disorders " characterized by a deficiency or defect of platelets.
  • the MGPA composition of the present invention or pharmaceutically effective fragments thereof may be employed in the treatment of aplastic anemias, e.g. , to augment production of platelets in patients having impaired platelet production (such as AIDS patients or patients undergoing cancer chemotherapy) .
  • the MGPA may be used to treat blood disorders such as thrombocytopenia.
  • MGPA may be used as an adjunctive therapy for bone marrow transplant patients.
  • a further aspect of the invention is a method for treating these and other pathological states resulting from a deficiency of platelets by administering to a patient a therapeutically effective amount of MGPA or one or more peptide fragments thereof in a suitable pharmaceutical carrier.
  • These therapeutic methods may include administering simultaneously or sequentially with MGPA or one or more peptide fragments thereof an effective amount of at least one other meg-CSF or TPO-like factor, a cytokine, hematopoietin, interleukin, growth factor, or antibody.
  • Still another aspect of the present invention are- antibodies directed against human MGPA or a fragment thereof.
  • the invention claims cell lines capable of secreting such antibodies and methods for their production and use in diagnostic or therapeutic procedures.
  • Other aspects and advantages of the present invention will be apparent upon consideration of the following detailed description of preferred embodiments thereof.
  • the novel human megakaryocyte growth promoting activi-ty factor, MGPA is a homogeneous protein or proteinaceous composition substantially free of association with other human proteinaceous materials.
  • This protein can be produced via recombinant techniques to enable large quantity production of pure, active MGPA useful for therapeutic applications. Alternatively this protein may be obtained as a homogeneous protein purified from human urine or from a mammalian cell line secreting or expressing it. Further MGPA or active fragments thereof may be chemically synthesized.
  • composition of the present invention has an apparent molecular weight of approximately 45 kd as determined by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under either non-reducing or reducing conditions.
  • composition of the present invention has an apparent molecular weight of approximately 40-50 kd on gel filtration chromatography.
  • composition of the present invention has a specific activity in the megakaryocyte growth promoting assay of Example 1 of greater than approximately 1X10 6 units/mg protein.
  • the MGPA composition of the present invention is capable of binding a cation exchange column under acidic conditions of pH 5.4.
  • the MGPA composition of the present invention is not capable of binding to Wheat Germ lectin.
  • the MGPA composition of the present invention does not bind to an anion exchange resin at neutral pH.
  • the MGPA composition of the present invention is found consistently in the 30-50% ammonium sulfate precipitate of thrombocytic patient urine. (8) The MGPA composition of the present invention cannot be detected in normal human plasma with the current assays.
  • the biological activity of the MGPA composition of the present invention is demonstrated by its ability to stimulate the growth and development of megakaryocytes in the radioimmunological megakaryocyte growth promoting assay of Example 1.
  • This in vitro assay for regulatory activities stimulated by low platelet counts detects cell-bound GPIIb/IIIa, a megakaryocyte lineage specific glycoprotein which is expressed on small morphologically unrecognizable megakaryocyte precursors as well as recognizable megakaryocytes and platelets.
  • the assay enables quantitative assessment of in vitro megakaryocytopoiesis [B. W. Grant et al, Blood, 69:1334- 1339 (1987) ] . This assay is described in detail in Example 1 below.
  • MGPA was originally detected in the citrated plasma of human patients with aplastic anemia. Unfractionated plasma from these patients demonstrate an enhanced support of megakaryocyte growth in vitro.
  • Plasmas from other thrombocytopenic patients have been shown to contain MGPA.
  • Human MGPA was initially purified from this human plasma by a sequence of purification steps and techniques specifically described in Example 2 below. However, this factor may also be purified from thrombocytopenic patient urine.
  • MGPA Osteosarco a cells explanted from a tumor and passaged in culture
  • HS10 elaborate MGPA.
  • MGPA has not been detected in conditioned media when HS10 cells are grown in the presence of serum. When grown without serum, these cells produce an activity very similar to the plasma MGPA with an unfractionated conditioned medium having 100 to 200 units MGPA per A 280 unit. This activity co-purifies with the plasma MGPA on an ACA34 gel filtration column. Because HS10 is not a transformed cell line, it grows slowly, dies off, and secretes very little MGPA (serum free conditioned media has about 1/10 of a unit per milliliter) . These cells may be transformed to produce MGPA consistently.
  • osteosarcoma cell lines may be detected with similar MGPA production.
  • MGPA similar to that found in plasma has also been detected in conditioned media from human umbilical vein endothelial (HUV) cells.
  • Conditioned media from these cells (supplied by Dr. Faller, Dana-Farber and Dr. Shorer, University of Minnesota) have been found to promote megakaryocyte growth in the radioimmunoassay of Example 1.
  • This material co-purifies with plasma MGPA by gel filtration, and supports megakaryocyte growth in phytohemagglutinin-leukocyte conditioned medium (PHALCM) , IL3 or GM-CSF in a dose dependent way similar to the plasma and urinary MGPA. This activity is not inhibited by anti GM-CSF.
  • PHALCM phytohemagglutinin-leukocyte conditioned medium
  • IL3 phytohemagglutinin-leukocyte conditioned medium
  • the purification techniques employed in obtaining MGPA from human urine comprises the following steps which are outlined in detail in Example 3. These steps include subjecting the unconcentrated urine to ammonium sulfate precipitation; binding the 80% ammonium sulfate fraction to a cation exchange chromatographic column (sulfopropyl Sephadex) in 25 mM ammonium acetate, pH 5.4 and eluting the bound protein in a gradient of NaCl; passing the 0.15M NaCl eluate containing MGPA through an anion exchange membrane (polyethyleneimine) in ammonium bicarbonate buffer, pH 7.4; and finally applying the filtrate through a cycle of reverse phase HPLC using H 2 0/TFA/acetonitrile as the solvent.
  • a cation exchange chromatographic column sulfopropyl Sephadex
  • Fractionation techniques that have not been useful include hydroxyapatite, heparin sepharose and wheat germ agglutinin using two different lectin bead preparations [Sigma] .
  • Homogeneous MGPA may be obtained by applying the above purification procedures, which are described in detail in Example 3, to human thrombocytopenic urine or other sources of human MGPA e.g., cell or tissue sources. Procedures for culturing a cell (or tissue) source which may be found to produce MGPA are known to those of skill in the art.
  • MGPA of this invention differs from other TPO- like factors of the prior art. For example, MGPA differs from TSF [MacDonald, supra1 and megCSA [Hoffman, supra1 in apparent molecular weight, in the % ammonium sulfate that precipitates it from plasma, in its behavior on ion exchange columns, and in its lack of binding to wheat germ lectin.
  • MGPA or one or more peptide fragments thereof may also be produced via recombinant techniques.
  • the purified MGPA material is reduced and digested with trypsin. Tryptic fragments are isolated and sequenced by conventional techniques. Oligonucleotide probes are synthesized using the genetic code to predict all possible sequences that encode the amino acid sequences of the tryptic fragments. Several sequences are generated as probes.
  • the MGPA cDNA is identified by using these probes to screen a human genomic library.
  • the mRNA from a cell source of MGPA can be used to make a cDNA library which can be screened with the probes to identify the cDNA encoding the MGPA polypeptide.
  • a cDNA clone is obtained.
  • the obtained cDNA sequences may be employed as probes to rescreen the library and hybridize to the full length MGPA sequence.
  • the human CDNA for MGPA can also be obtained by subcloning a full length human genomic clone into an expression vector, transfecting it into COS cells, preparing a cDNA library from these transfected COS cells and screening by hybridization for MGPA cDNA. Once the entire cDNA is identified, it or any portion of it that encodes an active fragment of MGPA, can be introduced into any one of a variety of expression vectors to make an expression system for MGPA or one or more fragments thereof.
  • DNA sequences encoding the MGPA polypeptide are obtained.
  • the present invention also encompasses these DNA sequences, free of association with DNA sequences encoding other proteins, and coding on expression for MGPA polypeptides.
  • These DNA sequences include those sequences encoding all or a fragment of MGPA and those sequences which hybridize under stringent hybridization conditions [see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual) , Cold Spring Harbor Laboratory (1982) , pages 387 to 389] to the DNA sequences.
  • An example of one such stringent hybridization condition is hybridization in 4XSSC at 65°C, followed by a washing in 0.1XSSC at 65°C for an hour.
  • an exemplary stringent hybridization condition is in 50% formamide, 4XSSC at 42°C
  • DNA sequences which hybridize to the sequences for MGPA under relaxed hybridization conditions and which code on expression for MGPA peptides having MGPA biological properties also encode novel MGPA polypeptides.
  • non-stringent hybridi ⁇ zation conditions are 4XSSC at 50°C or hybridization with 30-40% formamide at 42°C.
  • a DNA sequence which shares regions of significant homology, e.g., sites of glycosylation or disulfide linkages, with the sequences of MGPA and encodes a protein having one or more MGPA biological properties clearly encodes a MGPA polypeptide even if such a DNA sequence would not stringently hybridize to the MGPA sequences.
  • DNA sequences encoding the peptide sequences of MGPA are also included in the present invention, as well as analogs or derivatives thereof.
  • DNA sequences which code for MGPA polypeptides but which differ in codon sequence due to the degeneracies of the genetic code or variations in the DNA sequence of MGPA which are caused by point mutations or by induced modifications to enhance the activity, half-life or production of the polypeptides encoded thereby are also encompassed in the invention.
  • MGPA polypeptides may also be produced by known conventional chemical synthesis. Methods for constructing the polypeptides of the present invention by synthetic means are known to those of skill in the art.
  • the synthetically-constructed MGPA polypeptide sequences by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with MGPA polypeptides may possess MGPA biological properties in common therewith. Thus, they may be employed as biologically active or immunological substitutes for natural, purified MGPA polypeptides in therapeutic and immunological processes.
  • Modifications in the peptides or DNA sequences encoding MGPA can be made by one skilled in the art using known techniques. Modifications of interest in the MGPA sequences may include the replacement, insertion or deletion of a selected amino acid residue in the coding sequences. Mutagenic techniques for such replacement, insertion or deletion are well known to one skilled in the art. [See, e.g., United States patent 4,518,584.] Specific mutations of the sequences of the
  • MGPA polypeptide may involve modifications of a glycosylation site, if any.
  • the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at any asparagine- linked glycosylation recognition site or at any site of the molecule that is modified by addition of O-linked carbohydrate.
  • An asparagine-linked glycosylation recognition site comprises a tripeptide sequence which is specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either Asp-X-Thr or Asp-X-Ser, where X can be any amino acid.
  • One such modification may be the attachment of polyethylene glycol (PEG) onto existing lysine residues in the MGPA sequence or the insertion of one or more lysine residues or other amino acid residues that can react with PEG or PEG derivatives into the sequence by conventional techniques to enable the attachment of PEG moieties.
  • PEG polyethylene glycol
  • the present invention also provides a method for producing MGPA polypeptides or active fragments thereof.
  • One method of the present invention involves introducing the cDNA encoding a MGPA polypeptide into an expression vector to make an expression system for MGPA.
  • a selected host cell is transformed with the vector and cultured.
  • the method of this present invention therefore comprises culturing a suitable cell or cell line, which has been transformed with a DNA sequence coding on expression for a MGPA polypeptide under the control of known regulatory sequences. Regulatory sequences include promoter fragments, terminator fragments and other suitable sequences which direct the expression of the protein in an appropriate host cell.
  • the expressed factor is then recovered, isolated and purified from the culture medium (or from the cell, if expressed intracellularly) by appropriate means known to one of skill in the art.
  • Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO) or 3T3 cells.
  • CHO Chinese hamster ovary cells
  • the selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature. 293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol. , 5(7) :1750-1759 (1985) or Howley et al, U. S. Patent
  • suitable mammalian cell lines are the monkey COS-1 cell line, and the CV-1 cell line.
  • Further exemplary mammalian host cells include particularly primate cell lines and rodent cell lines, including transformed cell lines. Normal diploid cells, cell strains derived from in vitro culture of primary tissue, as well as primary explants, are also suitable.
  • Candidate cells may be genotypically deficient in the selection gene, or may contain a dominantly acting selection gene.
  • Other suitable mammalian cell lines include but are not limited to, HeLa, mouse L-929 cells, 3T3 lines derived from Swiss, Balb-c or NIH mice, BHK or HaK hamster cell lines.
  • E . coli e.g., HB101, MC1061 and strains used in the following examples
  • Various strains of Bj_ subtilis. Pseudomonas, other bacilli and the like may also be employed in this method.
  • yeast cells Many strains of yeast cells known to those skilled in the art are also available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Engineering. 8.:277-298 (Plenum Press 1986) and references cited therein.
  • the present invention also provides recombinant molecules or vectors for use in the method of expression of novel MGPA polypeptides.
  • These vectors contain the MGPA DNA sequences and which alone or in combination with other sequences code for MGPA polypeptides of the invention or active fragments thereof.
  • vectors incorporating modified sequences as described above are also embodiments of the present invention and useful in the production of MGPA polypeptides.
  • the vector employed in the method also contains selected regulatory sequences in operative association with the DNA coding sequences of the invention and capable of directing the replication and expression thereof in selected host cells.
  • pXM which is particularly desirable for expression in COS cells [Y. C. Yang et al, Cell. 47: 3-10 (1986)].
  • Another vector which is desirable for expression in mammalian cells, e.g., CHO cells, and is described in the examples is pEMC2Bl.
  • Mammalian cell expression vectors described herein may be synthesized by techniques well known to those skilled in this art.
  • the components of the vectors may be obtained from natural sources or synthesized by known procedures. See, Kaufman et al, J. Mol. Biol. , 159:511- 521 (1982) ; and Kaufman, Proc. Natl. Acad. Sci. , USA, 82 . .689-693 (1985).
  • the vector DNA may include all or part of the bovine papilloma virus genome [Lusky et al, Cell, .36:391-401 (1984)] and be carried in cell lines such as C127 mouse cells as a stable episomal element. The transformation of these vectors into appropriate host cells can result in expression of the MGPA polypeptides.
  • MGPA or active fragments thereof, purified to homogeneity from cell sources or produced recombinantly or synthetically, may be used in a pharmaceutical preparation or formulation to stimulate platelet recovery in patients suffering from thrombocytopenias associated with marrow hypoplasia, e.g., aplastic anemia following chemotherapy or bone marrow transplantation.
  • Other platelet disorders for which treatment with MGPA may be useful include diseases of increased platelet consumption and production, such as, disseminated intravascular coagulation, immune thrombocytopenia, and thrombotic thrombocytopenia.
  • MGPA may be useful in treating myeloproliferative thrombocytotic diseases, and thrombocytosis in inflammatory conditions and in iron deficiency.
  • MGPA MGPA
  • MGPA may be employed to stimulate the "shedding" of new "undamaged" platelets in such patients.
  • Therapeutic treatment of such platelet disorders or deficiencies with these MGPA polypeptide compositions may avoid undesirable side effects caused by treatment with presently available serum-derived factors or transfusions of human platelets. It may also be possible to employ one or more peptide fragments of MGPA in such pharmaceutical formulations.
  • polypeptides of the present invention may also be employed, alone or in combination with other cytokines, hematopoietins, interleukins, growth factors or antibodies in the treatment of the above-identified conditions.
  • compositions for treating the conditions referred to above comprise a therapeutically effective amount of the MGPA polypeptide or a therapeutically effective fragment thereof in admixture with a pharmaceutically acceptable carrier.
  • This composition can be systematically administered parenterally. Alternatively, the composition may be administered intravenously. If desirable, the composition may be administered subcutaneously.
  • the therapeutic composition for use in this invention is in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • the preparation of such pharmaceutically acceptable protein solutions having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
  • the dosage regimen involved in a method for treating the above-described conditions will be determined by the attending physician considering various factors which modify the action of drugs, e.g. the condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors.
  • the daily regimen should be in the range of 1-1000 micrograms of MGPA protein or fragment thereof or 50 to 5000 units of protein pe * r kilogram of body weight.
  • compositions and polypeptides of the present invention may also be employed, alone or in combination with other cytokines, hematopoietins, interleukins, growth factors or antibodies in the treatment of disease states characterized by other symptoms as well as platelet deficiencies. It is anticipated that this molecule, will prove useful in treating some forms of thrombocytopenia in combination with general stimulators of hematopoiesis, such as IL-3 or GM-CSF.
  • Other megakaryocytic stimulatory factors e.g., meg-CSF, or other molecules with TPO-like activity may also be employed with MGPA.
  • Additional exemplary cytokines or hematopoietins for such co-administration include G-CSF, CSF-1, IL-1, IL-4, M-CSF, IL-7, or erythropoietin.
  • the dosage recited above would be adjusted to compensate for such additional components in the therapeutic composition. Progress of the treated patient can be monitored by conventional methods.
  • Such antibodies may include both monoclonal and polyclonal antibodies, as well as chimeric antibodies or "recombinant" antibodies generated by known techniques.
  • the antibodies of the present invention may be utilized for in vivo and in vitro diagnostic purposes, such as by associating the antibodies with detectable labels or label systems. Alternatively these antibodies may be employed for in vivo and in vitro therapeutic purposes, such as by association with certain toxic or therapeutic compounds or moieties known to those of skill in this art.
  • GPIIb/IIIA allows quantitative assessment of in vitro megakaryocytopoiesis. This system uses a radioimmunoassay to measure the generation of megakaryocytes in cultures of normal human bone marrow and is reproducible and reliable as a screen for megakaryocyte growth.
  • Non-adherent mononuclear bone marrow cells are cultured for two weeks in Iscove's modified Dulbecco ⁇ ⁇ medium, fetal calf serum or other serum or plasma, and other growth factors. Aliquots of cultured cells are washed free of culture media, and exposed to 125 I-HP11D, a murine monoclonal antibody specific to the GPIIb/IIIA complex [see, Grant et al, in "Megakaryocyte Development and Function", eds, Allen R. Liss, pp. 117-121 (1986)]. The binding of iodinated antibody is specific to megakaryocytes, and when free antibody is washed away from the cell pellet, radioactivity bound in the pellet is a quantitative measure of the number of megakaryocytes present.
  • the quantitative nature of the assay has been demonstrated by correlation with the numbers of morphologically identifiable megakaryocytes in cytospin preparations from individual wells of the MGPA assay.
  • This assay detects small, morphologically difficult-to- recognize megakaryocytes as well as larger, more mature megakaryocytes.
  • This assay cannot distinguish between increases in numbers of cells, increases in size of cells, or increases in the density of GPIIb/IIIA on the cell surface. Therefore, the megakaryocyte morphology and the number and variety of other cells in wells of interest are further evaluated using cytocentrifuge preparations.
  • This assay correlates well with human megakaryocyte colony assays for response to class I myeloid growth factors (IL-3 and GM CSF) , and human aplastic plasma.
  • IL-3 and GM CSF class I myeloid growth factors
  • GM CSF myeloid growth factors
  • Optimal growth and maximum signal occurs with 3-4 X 10 5 cells per well and an incubation period of 12-14 days.
  • a useful test to confirm or rule out the specificity of individual megakaryocyte growth promoting activities is quantitation of the percent megakaryocytes among cultured cells by immunoalkaline phosphatase stain of GPIIb/IIa expressing cells.
  • This assay system has readily adapted to the screening of fractionated material for MGPA. For example, after isolation procedures, as described in Example 3, fractions are tested for protein content by absorbtion at A 280 , dialyzed against ammonium bicarbonate buffer (50 mM) , lyophilized, resuspended in Iscove ⁇ medium with 5% fetal calf serum, and filtered through 0.2 micron filters. Each fraction is tested at 3-6 dose levels (dilutions) with two different normal bone marrows with the MGPA assay followed by cytospin analysis and other tests on the marrows, as indicated.
  • routine screening of a fraction for MGPA is performed using human marrow cultured in 30% fetal calf serum in the presence of synergizing Class I growth factors, usually 5% Phytohemagglutinin-Leukocyte Conditioned Medium (PHALCM) or 10 units of recombinant IL-3 [Genetics Institute, Inc., Cambridge, MA] added to support the early stem cells and maximize expression of megakaryocyte specific stimulating activities.
  • PHALCM Phytohemagglutinin-Leukocyte Conditioned Medium
  • IL-3 Geneetics Institute, Inc., Cambridge, MA
  • one unit of MGPA is defined as the amount of MGPA required to stimulate megakaryocyte growth to twice that of the background (the fetal calf serum plus PHALCM control) in this assay.
  • the number of units in a sample equals the difference between the CPM bound at the end of culture in the sample well minus the CPM bound in the fetal calf serum plus PHALCM control, divided by the CPM bound in that same control.
  • the calculation of the number of units in a given fraction is done by averaging the calculated unitage from wells representing the linear part of the dose response curve from two independent experiments using two different marrow samples.
  • the screening assay system is optimized to detect factors that complete the megakaryocyte developmental program promoted by Class I hemopoietins.
  • Plasma MGPA was purified through step 3 above 600 times relative to whole aplastic plasma.
  • the apparent MW as determined by the gel filtration and SDS PAGE steps was found to be approximately 40-50 kd.
  • plasma from four patients with aplastic anemia, four patients with immune thrombocytopenia, three patients with chemotherapy induced thrombocytopenia, two patients with thrombotic thrombocytopenic purpura and one patient with megakaryocytic thrombocytopenia were tested for MGPA.
  • MGPA is purified from fresh patient urine using the following sequential fractionation steps: ammonium sulfate precipitation, sulfopropyl sephadex (SPC-50) cation exchange chromatography, polyethyleneimine (PEI) anion exchange membrane filtration, and reverse phase high performance liquid chromatography (HPLC) .
  • SPC-50 sulfopropyl sephadex
  • PEI polyethyleneimine anion exchange membrane filtration
  • HPLC reverse phase high performance liquid chromatography
  • MGPA activity in the 80% protein precipitate has approximately 40 units per mg protein.
  • the level of MGPA present in thrombocytopenic urine is increased by greater than 5-12 fold.
  • the second purification step is the use of cation exchange column chromatography.
  • the MGPA- containing ammonium sulfate fraction is dialyzed into 25 mM ammonium acetate pH 5.4 and then applied to a sulfopropyl sephadex (SPC-50) ion exchange column equilibrated in the same buffer.
  • Bound protein is eluted in a gradient of NaCl from 0-1M.
  • MGPA elutes at approximately 150 mM NaCl resulting in approximately a 60-fold enrichment of MGPA specific activity.
  • Further purification of the MGPA is achieved by the third step in which the 150 mM eluate from the SPC-50 column is subjected to anion exchange filtration.
  • MGPA-containing protein is dialyzed into 50 mM ammonium bicarbonate pH 7.4 and passed through a polyethyleneimine (PEI) anion exchange membrane equilibrated in the same buffer. MGPA activity is collected in the flow-through fraction. This step enriches MGPA specific activity by approximately 10- fold.
  • the fourth step in the purification is achieved using reverse phase high performance liquid chromatography (HPLC) on a C3 column.
  • HPLC high performance liquid chromatography
  • the PEI membrane filtrate which contains MGPA is dialyzed into 0.05% TFA and loaded onto a C3 column equilibrated in 0.05% TFA. Bound protein is eluted in a gradient of acetonitrile in 0.05% TFA.
  • MGPA elutes between 62 and 70% acetonitrile. At this point in the purification MGPA has a specific activity of greater than 1X10 6 units per mg protein. Based on SDS polyacrylamide gel electrophoresis (SDS- PAGE), the major protein band at 45,000 under reducing conditions contains the MGPA activity when it is excised from the gel and eluted into a suitable buffer for assay.
  • SDS- PAGE SDS polyacrylamide gel electrophoresis
  • the purified MGPA obtained from the HPLC step may be suitable for protein sequencing directly or it may be subjected to SDS PAGE prior to protein sequencing to remove minor contaminants which may be present after the fourth step.
  • Example 1 a Units are defined as in Example 1.
  • Urinary MGPA is markedly increased in thrombocytopenic patients.
  • unfractionated urinary proteins where a mixture of enhancing and inhibitory factors are observed to be present, greater than 5-15 fold more activity in patient urine is observed than in normal human urine.
  • the activity measured in the assay of Example 1 is a physiologic regulator of megakaryocyte production that is con ⁇ titutively produced and measurable in normal urine, but markedly induced and thus measurable in the plasma as well as the urine of thrombocytopenic patient ⁇ .
  • the following assays were performed using .the purified MGPA from plasma or urine as described. After the first few stages of purification, the biological characteristics of plasma MGPA and urinary MGPA are identical. The recombinant version of the molecule is expected to exhibit the'same biological properties in these same assays or other assays.
  • the Clas ⁇ I hemopoietins IL3 and GM-CSF maintain viability and support proliferation of undifferentiated myeloid precursor cells and promote megakaryocyte growth in the assay system of Example 1.
  • MGPA is not IL-3 or GM-CSF
  • PHALCM was also employed as a crude source of these activities to provide maximal Class I activity to the cells to be assayed.
  • IL3 nor GMCSF increase megakaryocyte growth in liquid culture over that of other myeloid cells.
  • Megakaryocyte growth supported by MGPA is not neutralized by antibodies to IL-3 [Genetics Institute] if the culture is supplemented with GM-CSF to support stem cell growth.
  • megakaryocyte growth supported by MGPA is not neutralized by antibodies to GM-CSF if IL-3 is supplied.
  • a combination of these antisera reverses all megakaryocyte growth stimulated by PHALCM.
  • Human bone marrow grown in the presence of IL3 and GMCSF produced similar amounts of megakaryocytes in the presence or absence of antiserum against GMCSF. When human marrow was grown in methylcellulose, very few granulocyte/ macrophage colonies are stimulated above FCS control with 3 units/ml of partially purified MGPA.
  • MGPA adds to the effect of PHALCM in the marrow cultures.
  • On day 14 of culture very little dose dependent megakaryocyte growth is seen in cultures supplemented with FCS and HPLC-purified MGPA as the only ex ⁇ genou ⁇ growth factor ⁇ .
  • MGPA i ⁇ ob ⁇ erved in the pre ⁇ ence of PHALCM, IL-3 , and GM-CSF.
  • Each of these sources of clas ⁇ I hemopoietin ⁇ appears to support the same or very similar groups of MGPA responsive cells, as the response curves are quite similar from most marrows.
  • MGPA will produce an additive or synergistic effect with either IL3 and/or GM-CSF in therapeutic applications.
  • the megakaryocytes supported by MGPA in culture are consistently more mature and somewhat larger in size than those grown in control wells (FCS with PHA- LCM) suggestive of a maturational effect.
  • Marrow supported by FCS and PHA-LCM has produced recognizable megakaryocytes ranging in stage from I to II/III to IV.
  • a cytospin from the same marrow grown under identical conditions except that HPLC-purified MGPA was added show that not only are more megakaryocytes recognizable per field, but they tend to be more mature and have far denser cytoplasm. No increase is seen in the number of other myeloid cells.
  • MGPA is stable to boiling, to guanidine hydrochloride treatment, to O-glycanase treatment; to dige ⁇ tion with tryp ⁇ in; and to multiple cycles of lyophilization or freeze thawing.
  • Example 5 Amino Acid Seguence and Cloning of MGPA Pure MGPA is ⁇ equenced using conventional microsequencing technique ⁇ suitable for studies of picomolar amounts of protein. Amino terminal sequence is complemented with sequence ⁇ of peptides derived by peptida ⁇ e or cyanogen bromide digestion, separated by reverse phase HPLC or SDS gel electrophore ⁇ is and electroelution. The amino acid sequence of MGPA is screened for uniqueness using the PIR data banks.
  • the degree of glyco ⁇ ylation is assessed by amino acid/amino sugar determination and by molecular weight shift on SDS gel of iodinated MGPA after digestion by a panel of glycosidases including neuraminidase, sialida ⁇ e, F-endoglycosidase, and G- endoglyco ⁇ ida ⁇ e.
  • probes consisting of pools of oligonucleotides or unique oligonucleotides are designed from the tryptic sequences according to the method of R. Lathe, J. Mol. Biol.. 183 . (1):1-12 (1985).
  • the oligonucleotide probes are synthesized on an automated DNA synthe ⁇ izer.
  • Becau ⁇ e the genetic code is degenerate (more than one codon can code for the same amino acid) a mixture of oligonucleotides are ⁇ ynthe ⁇ ized that contain all po ⁇ ible nucleotide ⁇ equence ⁇ encoding the amino acid sequence of the selected tryptic fragment or portion thereof. It may be po ⁇ ible in ⁇ ome cases to reduce the number of oligonucleotides in the probe mixture based on codon usage because some codons are rarely used in eukaryotic genes, and because of the relative infrequency of the dinucleotide CpG in eukaryotic coding sequences [see J. J. Toole et al, Nature, 312:342-347 (1984)].
  • the regions of the amino acid sequences used for probe design are chosen by avoiding highly degenerate codons where possible.
  • the oligonucleotides are synthesized on an automated DNA synthe ⁇ izer and the probe ⁇ are then radioactively labelled with polynucleotide kina ⁇ e and 32 P-ATP.
  • cDNA i ⁇ then synthesized from polyadenylated RNA from a human cell line, e.g., one of the above mentioned cell source ⁇ of MGPA u ⁇ ing either conventional cloning technology or polymera ⁇ e chain reaction technology.
  • the cDNA library may be cloned into lambda ZAP [Stratagene Cloning Systems, La Jolla, CA] or other suitable vectors using e ⁇ tabli ⁇ hed techniques (see Toole et al cited above) .
  • Recombinants from thi ⁇ library are plated and duplicate nitrocellulose replicas made of the plates.
  • the oligonucleotides are kinased with 32 P gamma ATP and hybridized to the replica ⁇ at a temperature predicted from the length and base composition of the probes [See, J. Singer-Sam et al, Proc. Nat'l. Acad. Sci. USA. 0:802-806 (1983) and S. V.
  • a complete or partial cDNA sequence is obtained by this method.
  • Thi ⁇ sequence may be used optionally as a probe to rescreen the library to obtain full length cDNAs. It i ⁇ also possible that partial cDNAs may yield an active MGPA fragment.
  • the MGPA gene may be i ⁇ olated from a human genomic library (available from Stratagene) in ⁇ Zap u ⁇ ing the oligonucleotide hybridization probe ⁇ described above.
  • the genomic MGPA clone is expre ⁇ sed directly in mammalian cells or used to isolate a cDNA. In the latter case, the MGPA gene is used as a hybridization probe to identify a source of MGPA in RNA.
  • the MGPA gene is expressed transiently in COS1 cells to generate an MGPA mRNA that can be used to generate a cDNA.
  • Example 6 Expression of Recombinant Human MGPA
  • the cDNA encoding it is transferred into an appropriate expression vector, of which numerous types are known in the art for human, insect, yeast, fungal and bacterial expression, by standard molecular biology techniques.
  • an appropriate expression vector of which numerous types are known in the art for human, insect, yeast, fungal and bacterial expression, by standard molecular biology techniques.
  • One such vector for mammalian cells is pXM [Y.
  • This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the adenovirus tripartite leader ⁇ equence, a ⁇ mall hybrid intervening ⁇ equence, an SV40 polyadenylation signal and the adenovirus VA I gene, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells [See, e.g., Kaufman, Proc. Natl. Acad. Sci. USA. 2:689-693 (1985)].
  • the pXM vector is linearized with the endonuclease enzyme Xhol and subsequently ligated in equi olar amount separately to the cDNA encoding MGPA that has been previously modified by addition of synthetic oligonucleotides that generate Xho I complementary ends to generate constructs for expression.
  • pEMC2Bl Another vector for mammalian expression is pEMC2Bl.
  • This vector may be derived from pMT2pc which has been deposited with the American Type Culture Collection (ATCC) , Rockville, MD (USA) under Acce ⁇ ion Number ATCC 40348.
  • ATCC American Type Culture Collection
  • P ⁇ tl The DNA is linearized by digestion of the plasmid with P ⁇ tl.
  • the DNA is then blunted using T 4 DNA polymerase.
  • TGCAGGCGAGCCTGAATTCCTCGA 3 is then ligated into the DNA, recreating the PstI ⁇ ite at the 5" end and adding an EcoRI ⁇ ite and Xhol ⁇ ite before the ATG of the DHFR cDNA.
  • Thi ⁇ pla ⁇ mid i ⁇ called pMT21.
  • pMT21 i ⁇ cut with EcoRI and Xhol which cleave ⁇ the plasmid at two adjacent cloning sites.
  • a pair of oligonucleotides 68 nucleotides in length are ⁇ ynthesized to duplicate the EMCV sequence up to the ATG.
  • the ATG is changed to an ATT, and a C i ⁇ added, creating a Xhol ⁇ ite at the 3 1 end.
  • a Taq ⁇ l ⁇ ite i ⁇ ⁇ ituated at the 5' end.
  • the ⁇ equence ⁇ of the oligonucleotides are: 5 ' CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT GAAAAACACGATTGC 3' and its complementary strand.
  • This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, DHFR and 3-lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.
  • the EMC2B1 vector is linearized with the endonuclease enzyme EcoRI and sub ⁇ equently ligated in equimolar amount ⁇ eparately to the cDNA encoding MGPA that has been previously modified by addition of synthetic oligonucleotides that generate EcoRI complementary ends to generate constructs for expression. These constructs can be expres ⁇ ed in various hosts with appropriate vectors.
  • the vector is then introduced into appropriate host cells by conventional genetic engineering techniques.
  • the tran ⁇ formed cells are cultured and the expressed MGPA is recovered and purified from the culture medium using standard techniques.
  • a. Mammalian Cell Expre ⁇ ion To obtain expression of the MGPA protein, the pXM construct containing the cDNA is mixed and transfected into COS cell ⁇ , for example.
  • the conditioned medium from the tran ⁇ fected COS cells contains MGPA biological activity as measured in the megakaryocyte growth promoting assay of Example 1.
  • the mammalian cell expression vectors described herein may be synthesized by techniques well known to those skilled in this art.
  • One skilled in the art can also construct other mammalian expression vectors comparable to the pXM vector by, e.g., inserting the DNA sequence of the MGPA from the plasmid with appropriate enzymes and employing well-known recombinant genetic engineering techniques and other known vectors, such as pJL3 and pJL4 [Gough et al., EMBO J.. 4 . :645-653 (1985)] and pMT2 (starting with pMT2-VWF, ATCC #67122; see PCT application PCT/US87/00033) .
  • Mammalian host cell ⁇ other than COS cell ⁇ may also be employed in MGPA expre ⁇ ion.
  • CHO cell ⁇ may be employed a ⁇ a mammalian ho ⁇ t cell of choice.
  • stable transformants are then screened for expression of the product by standard immunological, biological or enzymatic assay ⁇ , such as those described above in Examples 1 and 4.
  • the presence of the DNA and RNA encoding the MGPA polypeptides may be detected by standard procedures such as Southern and Northern blotting.
  • Transient expression of the DNA encoding the polypeptides during the several days after introduction of the expression vector DNA into suitable host cells is measured without selection by bioactivity or immunologic assay of the proteins in the culture medium, b.
  • Bacterial Expression Systems Similarly, one skilled in the art could manipulate the sequence ⁇ encoding the MGPA polypeptide by eliminating any human regulatory sequences flanking the coding sequence ⁇ and inserting bacterial regulatory sequence ⁇ to create bacterial vector ⁇ for intracellular or extracellular expre ⁇ ion of the MGPA polypeptide of the invention by bacterial cell ⁇ .
  • the DNA encoding the polypeptide ⁇ may be further modified to contain different codons to optimize bacterial expression as i ⁇ known in the art.
  • sequences encoding the mature MGPA are operatively linked in-frame to nucleotide sequences encoding a secretory leader polypeptide permitting bacterial expression, secretion and processing of the mature MGPA polypeptides, also by method ⁇ known in the art.
  • the MGPA may be expressed as a cytoplasmic protein in E. coli.
  • yeast vectors are constructed employing yeast regulatory sequences to expres ⁇ cDNA encoding the precursor, in yeast cells to yield secreted extracellular active MGPA.
  • the polypeptide may be expressed intracellularly in yeast, the polypeptide isolated and refolded to yield active MGPA. [See, e.g., procedures de ⁇ cribed in published PCT application WO 86/00639 and European patent application EP 123,289. ]
  • One method for producing high levels of the MGPA polypeptide of the invention from mammalian cell ⁇ involves the construction of cells containing multiple copies of the cDNA encoding the MGPA.
  • the cDNA is co-tran ⁇ fected with an a plifiable marker, e.g., the DHFR gene for which cells containing increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, ⁇ . Mol. Biol.. (1982) supra.
  • an a plifiable marker e.g., the DHFR gene for which cells containing increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, ⁇ . Mol. Biol.. (1982) supra.
  • MTX methotrexate
  • the pXM vector or the pEMC2Bl vector containing the MGPA gene in operative a ⁇ sociation with other plasmid sequences enabling expression thereof is introduced into DHFR-deficient CHO cells, DUKX-BII, along with a DHFR expression plasmid such as pAdD26SVpA3 [Kaufman, Proc. Natl. Acad. Sci. USA. £2:689-693 (1985)] by either calcium phosphate coprecipitation or protoplast fusion, followed by tran ⁇ fection.
  • the MGPA gene and marker gene may be on a ⁇ ingle plasmid or on two plasmids for transfection.
  • DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum. Transformants are checked for expre ⁇ sion of MGPA by bioassay, immunoassay or RNA blotting and positive pools are subsequently selected for amplification by growth in increasing concentrations of MTX (sequential step ⁇ in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al. , Mol. Cell Biol. , 5_:1750 (19830 - The amplified lines are cloned, and MGPA expres ⁇ ion i ⁇ monitored by the MGPA a ⁇ say of Example I. MGPA expres ⁇ ion i ⁇ expected to increase with increasing levels of MTX resistance.
  • the resulting cell lines can be further amplified by appropriate drug selection, resulting cell lines recloned and the level of expre ⁇ ion assessed using the MGPA assay described in Example I.
  • the MGPA expressing CHO cell lines can be adapted to growth in serum-free medium.
  • Homogeneous MGPA can be isolated from conditioned medium from the cell line using method ⁇ familiar in the art, including techniques such as lectin-affinity chromatography, reverse phase HPLC, FPLC and the like.
  • MGPA and synthesized peptides from its sequence will be used to produce polyclonal antisera in rabbits and monoclonal antibodies in mice using conventional methods to generate antibodies to detect and quantitate MGPA in clinical samples, and to screen for antibodies that block MGPA for therapeutic use.
  • Mice and rabbits are immunized with pure urinary MGPA or with individual peptide sequence ⁇ 12-20 amino acid ⁇ in length. Serum from the animals is collected weekly and tested for reactivity by Western blotting to whole MGPA. Wells with immunoreactivity on Western blot are expanded and subcloned.
  • a series of antibodies to MGPA is useful in detecting and blocking MGPA, and determining its receptor binding site. Both polyclonal antisera and a series of monoclonals against MGPA peptides are useful in establishing the immunologic identity of plasma and urinary MGPA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Fodder In General (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP19900906033 1989-04-03 1990-04-02 Megakaryocyte growth promoting activity Withdrawn EP0466780A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US33265189A 1989-04-03 1989-04-03
US332651 1989-04-03

Publications (2)

Publication Number Publication Date
EP0466780A1 true EP0466780A1 (de) 1992-01-22
EP0466780A4 EP0466780A4 (en) 1992-08-26

Family

ID=23299216

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19900906033 Withdrawn EP0466780A4 (en) 1989-04-03 1990-04-02 Megakaryocyte growth promoting activity

Country Status (5)

Country Link
EP (1) EP0466780A4 (de)
JP (1) JPH04506513A (de)
AU (1) AU641645B2 (de)
CA (1) CA2050584A1 (de)
WO (1) WO1990012108A1 (de)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6433142B1 (en) 1989-08-08 2002-08-13 Genetics Institute, Llc Megakaryocyte stimulating factors
AU8868891A (en) * 1990-10-12 1992-05-20 Amgen, Inc. Megakaryocyte maturation factors
WO1992021755A1 (en) * 1991-05-31 1992-12-10 Genentech, Inc. Treatment of hiv-associated immune thrombocytopenic purpura
EP0591420A1 (de) * 1991-06-28 1994-04-13 New England Deaconess Hospital Eine differenzierte megakaryozyten-zellinie, die neue megakaryozyten-differenzierungsfaktoren produziert
US5250732A (en) * 1991-07-18 1993-10-05 Genentech, Inc. Ketamine analogues for treatment of thrombocytopenia
CN1107891A (zh) * 1994-03-04 1995-09-06 上海贝特生物技术有限公司 人促巨核细胞生成素及其分离纯化和基因克隆方法及应用
US5795569A (en) * 1994-03-31 1998-08-18 Amgen Inc. Mono-pegylated proteins that stimulate megakaryocyte growth and differentiation
KR100203824B1 (ko) * 1994-03-31 1999-06-15 스티븐 엠. 오드리 거핵구 성장 및 분화를 자극하기 위한 조성물 및방법
TW497972B (en) * 1995-06-08 2002-08-11 Kirin Brewery Stable thrombopoietin (TPO)-containing lyophilized compositions
RU2482870C1 (ru) * 2012-02-27 2013-05-27 Федеральное государственное бюджетное учреждение "Российский онкологический научный центр имени Н.Н. Блохина" Российской академии медицинских наук (ФГБУ "РОНЦ им. Н.Н. Блохина" РАМН) Средство, индуцирующее дифференцировку стволовых кроветворных клеток в тромбоциты

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991002001A1 (en) * 1989-08-08 1991-02-21 Genetics Institute, Inc. A megakaryocytopoietic factor

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4695542A (en) * 1983-10-04 1987-09-22 Dnax Research Institute Of Molecular And Cellular Biology, Inc. cDNA clones coding for polypeptides exhibiting multi-lineage cellular growth factor activity

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991002001A1 (en) * 1989-08-08 1991-02-21 Genetics Institute, Inc. A megakaryocytopoietic factor

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
EXPERIMENTAL HEMATOLOGY vol. 13, no. 11, December 1985, NEW YORK, USA pages 1164 - 1172; MAZUR, E.M. ET AL.: 'Human megakaryocyte colony stimulating factor in sera from aplastic dogs : partial purification, characterization and determination of hematopoietic cell lineage specificty.' *
EXPERIMENTAL HEMATOLOGY vol. 14, no. 6, 1986, NEW YORK, USA page 490; SHIMIZU, T. ET AL.: 'Purification of human megakaryocyte colony stimulating factor.' *
EXPERIMENTAL HEMATOLOGY vol. 15, no. 5, 1987, NEW YORK, USA page 492; SHIMIZU, T.: 'Purification of human sialylated megakaryocyte colony stimulating factor.' *
See also references of WO9012108A1 *
THE JOURNAL OF CLINICAL INVESTIGATION vol. 75, no. 4, April 1985, THE AMERICAN SOCIETY FOR CLIN. INV. pages 1174 - 1182; HOFFMAN, R. ET AL.: 'Purification and partial characterization of a megakaryocyte colony-stimulating factor from human plasma.' *

Also Published As

Publication number Publication date
EP0466780A4 (en) 1992-08-26
WO1990012108A1 (en) 1990-10-18
AU641645B2 (en) 1993-09-30
CA2050584A1 (en) 1990-10-04
AU5405890A (en) 1990-11-05
JPH04506513A (ja) 1992-11-12

Similar Documents

Publication Publication Date Title
US5260417A (en) Megakaryocyte growth promoting activity protein
US5326558A (en) Megakaryocytopoietic factor
AU638430B2 (en) Natural killer stimulatory factor
US5648467A (en) Natural killer cell stimulatory factor
US5734037A (en) DNA encoding the human cytokine, interleukin-9
US4877729A (en) Recombinant DNA encoding novel family of primate hematopoietic growth factors
KR970003518B1 (ko) 신규 영장류 조혈성장인자족(family)
US20070104680A1 (en) Antibodies to natural killer stimulatory factor
AU641645B2 (en) Megakaryocyte growth promoting activity
EP0804480B1 (de) Gereinigte thrombopoietin und verfahren zur herstellung davon
AU640686B2 (en) A megakaryocytopoietic factor
KR970004941B1 (ko) 신규 영장류 조혈 성장 인자족(family) 발현용 벡터 및 형질전환체

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19911001

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LI LU NL SE

A4 Supplementary search report drawn up and despatched

Effective date: 19920707

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB IT LI LU NL SE

17Q First examination report despatched

Effective date: 19940415

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19940826