EP0462231A1 - Activateurs transcriptionnels de biosynthese d'anthocyanine utilises comme marqueurs visuels pour la transformation de plantes - Google Patents

Activateurs transcriptionnels de biosynthese d'anthocyanine utilises comme marqueurs visuels pour la transformation de plantes

Info

Publication number
EP0462231A1
EP0462231A1 EP19900912716 EP90912716A EP0462231A1 EP 0462231 A1 EP0462231 A1 EP 0462231A1 EP 19900912716 EP19900912716 EP 19900912716 EP 90912716 A EP90912716 A EP 90912716A EP 0462231 A1 EP0462231 A1 EP 0462231A1
Authority
EP
European Patent Office
Prior art keywords
cells
expression cassette
plant
expression
dna sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP19900912716
Other languages
German (de)
English (en)
Other versions
EP0462231A4 (en
Inventor
Benjamin A. Bowen
Larry R. Beach
Susan Wessler
Stephen R. Ludwig
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pioneer Hi Bred International Inc
Original Assignee
Pioneer Hi Bred International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi Bred International Inc filed Critical Pioneer Hi Bred International Inc
Publication of EP0462231A1 publication Critical patent/EP0462231A1/fr
Publication of EP0462231A4 publication Critical patent/EP0462231A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis

Definitions

  • This invention relates to the use of anthocyanin pigmentation as a non-phytotoxic marker for transformation of plant cells.
  • the DNA sequence which is being incorporated into the plant cell genome codes for a protein which does not produce an immediately identifiable result.
  • a gene which codes for the insecticidal toxin of Bacillus thuringiensis (BT) does not produce any immediately identifiable change in the characteristics of cells transformed by that gene, unless the cells are destructively analyzed for their content of BT toxin.
  • BT Bacillus thuringiensis
  • Fig. 1 shows a typical dose response curve in maize using the expression cassette of this invention.
  • Fig. 2 shows a plasmid map of pPHI443.
  • Fig. 3 shows the sequence of the Lc cDNA from maize.
  • At least five genes in maize are known to encode enzymes which are, required for the synthesis of anthocyanin pigments.
  • loci including R, B, and Lc, determine the pattern and timing of anthocyanin biosynthesis in the maize plant and seed.
  • the expression of these regulatory genes is complex. For example, more than 50 naturally occurring alleles of R that condition unique patterns of pigmentation have been described.
  • One allele, R-nj has been cloned by tagging with the transposable element Ac.
  • R-nj is approximately 90% homologous with the R genes P, S, Lc and B and has been used to isolate an Lc cDNA clone.
  • the protein encoded by the Lc cDNA has been shown to have features, characteristic of a transcriptional activator. From these, data and previous genetic analyses, it has been determined that all R genes encode functionally equivalent proteins and that developmental specificity of pigmentation is determined by differences in the R promoter regions. Thus, it has now been determined that transcriptional activators of anthocyanin biosynthesis, operatively linked to a suitable promoter in an expression cassette, have widespread utility as non-phytotoxic markers for plant cell transformation. Accordingly, a clone encoding for one of these genes (for example, the Lc gene or a translational equivalent thereof in maize) can be fused to appropriate expression sequences to provide an expression cassette which can be introduced into plant cells by any desired transformation method, such as microprojectile bombardment.
  • any desired transformation method such as microprojectile bombardment.
  • Red cells accumulating anthocyanin can be readily detected in epidermal and sub-epidermal layers of most tissues tested. Since this expression, indicated by accumulation of anthocyanin, can be followed in living tissue, the expression cassettes of this invention, comprising a genomic or cDNA clone ("clone") or translational equivalent thereof coding for a plant transcriptional activator gene for anthocyanin biosynthesis operably linked to plant regulatory sequences which cause expression of the clone in plant cells, provides a useful reporter/marker gene and transformation vector for maize and other plant cells.
  • the ability to follow expression in living tissue by use of a non-toxic marker provides the ability to select cell lineages which can give rise to stably transformed plants. 1/02059
  • this expression cassette can be incorporated into a bacterial transformation vector which causes expression or replication of the expression cassette in living bacterial cells as an intermediate step prior to introduction into plant cells.
  • the present invention also provides bacterial cells containing as a foreign plasmid at least one copy of the foregoing bacterial expression vector.
  • the plant expression cassette preferably includes a strong constitutive promoter sequence at one end to cause the gene to be transcribed at a high frequency, and a poly-A recognition sequence at the other end for proper processing and transport of the messenger RNA.
  • An example of such a preferred (empty) expression cassette into which the cDNA of the Lc gene can be inserted is the pPHl414 plasmid developed by Beach, et al. of Pioneer Hi-Bred International, Inc., Johnston, Iowa.
  • tissue-specific promoters can be employed to monitor transformation in selected tissues of the plant.
  • An example of a tissue-specific promoter is the widely used RuBP carboxylase small subunit promoter.
  • Highly preferred plant expression cassettes will be designed to include one or more structural genes conferring the desired transformation trait, such as insect resistance or increased yield. It is important that the cloned Lc gene have a start codon in the correct reading frame for the structural sequence.
  • the plant expression vectors of this invention can be introduced into plant cells using any convenient technique, including electroporation (in protoplasts), microprojectile bombardment, and microinjection, into cells from monocotyledonous or dicotyledonous plants, in cell or tissue culture, to provide transformed plant cells containing as foreign DNA at least one copy of the DNA sequence of the plant expression cassette.
  • the monocotyledonous species will be selected from maize, sorghum, triticale, wheat and rice, and ' the dicotyledonous species will be selected from soybean, alfalfa, tobacco, canola and tomato.
  • protoplasts can be regenerated and cell or tissue cultures can be regenerated to form whole fertile plants which carry and express the desired marker gene.
  • a highly preferred embodiment of the present invention is a transformed maize plant, the cells of which contain as foreign DNA at least one copy of the DNA sequence of an expression cassette of this invention.
  • this invention provides transformation methods which use anthocyanin as a non-phytotoxic marker, comprising the steps of: a) culturing cells or tissues from a selected target plant; b) introducing into the cells the cell or tissue culture at least one copy of an expression cassette comprising a sequence coding for a plant transcriptional activator for anthocyanin biosynthesis, operably linked to plant regulatory sequences which cause the expression of the sequence in the cells, and c) identifying transformed cells by their anthocyanin pigmentation.
  • the sequence can be a genomic or cDNA clone, or a sequence which is translationally equivalent to a genomic or cDNA clone for the transcriptional activator.
  • translationally equivalent is meant that the DNA sequence in proper reading frame forms codons which translate to an amino acid sequence which is functionally equivalent to the amino acid sequence of the transcriptional activator produced by the genomic or cDNA clone, or is complementary (using normal C-G and A-T pairing) to a DNA sequence which in proper reading frame forms codons which translate to an amino acid sequence which is functionally equivalent to the amino acid sequence of the transcriptional activator produced by the genomic or cDNA cxone.
  • Translation tables which show codon equivalences are found in most textbooks of molecular biology.
  • this marker gene which uses pigmentation to provide visual evidence of transformation in plant cells, readily lends itself to use in combination with any of a variety of cell sorters which are capable of sorting cells on the basis of color, since accumulation of anthocyanin imparts a distinctive red or purple color to transformed cells.
  • this invention also provides a method as described above, in which transformed cells are additionally separated from non- transformed cells by a cell sorter which sorts on the basis of color.
  • the plant vectors provided herein can be incorporated into Agrobacteriu tumefaciens, which can then be used to ⁇ transfer the vector into susceptible plant cells, primarily from dicotyledonous species.
  • this invention provides a method for transformation of Agrobacterium tumefaciens- susceptible dicotyledonous plants in which the expression cassette is introduced into the cells by infecting the cells with an Agrobacterium tumefaciens, a plasmid of which has been modified to include the expression cassette provided herein. Since the marker expression cassette provided by this invention causes " accumulation of a naturally occurring pigment, no enzyme assay or substrate is needed to determine activity of the gene.
  • the expression cassettes of this invention because they employ transcriptional activator sequences for anthocyanin biosynthesis, have many potential applications in studying the molecular genetics and developmental biology of plants such as maize.
  • domains of the R protein thought to be important for DNA binding and transcriptional activation can be altered by site-directed mutagenesis of the Lc cDNA coding sequence in pPHI443.
  • the sequence of maize Lc cDNA is shown in Figure 2. By reintroducing mutant constructs into maize tissues of the appropriate genotype, the contribution of these domains to R function can be addressed.
  • the Lc cDNA can also be used as a reporter gene for the analysis of promoters and other cis-acting control regions in maize.
  • the library was screened with the 3.7 kb Hindlll genomic Lc clone using standard methods, as described in Maniatis, T., Fritsch, F., and Sambrook, J., (1982) Molecular Cloning; A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor ⁇ ' ew York). Of 3 x 10 5 recombinant oheqe screened with the 3.7 kb Hindlll fragment, one phage contained a 2.5 kb insert. The 6 kb Malawi genomic fragment was isolated by ligating 5 to 7 kb Hindlll genomic fragments into the Spel site of lambda Zap (Stratagene) , packaged and plated. Of 2 x 10 5 recombinant phage screened with the 3' end of the cDNA (position 880-1772), twelve phage contained the 6 kb Hindlll fragment.
  • Genomic and cDNA inserts were subcloned into pUCll9. Overlapping subclones and unidirectional deletion clones were isolated and sequenced by the dideoxy method of Sanger et al., Proc. Natl. Acad. Sci . USA, l ⁇ , 5463-5467 (1977).
  • the start of transcription was determined by primer extension using the method of Dunsmuir et al., Plant Molecular Biology Manual (Kluwer Academic Publishers, Hingham, Massachussetts) Chapter Cl, pp. 1-17.
  • Five ug of poly(A) + RNA and 0.1 pmol (7.5 x 10 5 cpm) of the 32 P-labelled oligonucleotide 5' CGTGAACCGGCGGACGAGGG 3' were hybridized at 55°C for 3 hrs.
  • the primer was extended for 45 min at 37°C with AMV reverse transcriptase.
  • RNase protection experiments were performed according to Promega Biotech.
  • RNA 1.5 x 10 5 cpm was added to 5 ug poly(A) + RNA isolated from female spikelets and hybridized overnight at 45°C.
  • the unhybridized RNA was digested for 1 hr at 30°C with 40 ug/mL RNase A and 8 U/mL RNase T .
  • the primer- extended and RNase protection products were each separated on an 8% acrylaraide sequencing gel.
  • the cDNA clone was sub ⁇ cloned into pGEM-7Z (Promega). This plasmid (p266) was linearized with Xhol and i vitro transcribed with SP6 polymerase according to the manufacturer (Promega). The RNA was in vitro translated for 60 min in the presence of [ 35 S]-methionine using the rabbit reticulocyte lysate system (Promega). The protein products were separated on a 10% Laemmli gel. The sequence of the cDNA clone was identical to sequences found in the two genomic fragments confirming that the cDNA was derived from Lc.
  • the transcription unit was found to span approximately 7 kb with introns at positions 228-229, 387-388, 648-649, 745-746, 760-761, 817-818, 1566-1567, and 1996-1997. All introns contained the consensus splice junction sequence (5' GT— — AG 3'). Primer extension was used to determine the start of transcription. A 20-base oligonucleotide was hybridized to poly(A) + RNA isolated from plants with and without Lc and extended with reverse transcriptase. Two major bands were observed which were used to define nucleotide positions 1 and 3. An RNase protection experiment confirmed this as the start of transcription. The 5' end of the Lc cDNA starts 20 bp from the transcription start site.
  • the cDNA sequence contains a 610 amino acid open reading frame beginning with an AUG at nucleotide position 236 and ending with a stop codon at nucleotide position 2066.
  • the plasmid pPHl443 is a pUCl ⁇ plasmid containing an enhanced 35S promoter spanning nucleotides - 421 to +2 of Cauliflower Mosaic Virus with the region from - 421 to - 90 duplicated in tandem, a 79 bp Hindlll Sa l fragment from pJHlOl spanning the 5' leader sequence of Tobacco Mosaic Virus, a 579 bp fragment spanning the first intron from maize Adhl-S, a 2415 bp Xbal fragment spanning the Lc cDNA, and a 281 bp fragment spanning the polyadenylation site from the nopaline synthase gene in pTiT37.
  • control plasmid pPHl459 contained identical expression signals, but an 1870 bp fragment from pRAJ275 spanning the beta-D-glucuronidase (GUS) coding sequence which was inserted in place of the Lc cDNA.
  • GUS beta-D-glucuronidase
  • EXAMPLE 2 PLANT CELL TRANS ORMATI N Mature dry seed of W22 Al A2 Bzl Bz2 Cl C2 r-g:Stadler B-b pi was obtained from Pioneer Hi-Bred International, Johnston, Iowa. Kernels were surface sterilized for 20 min in 20% Clorox/0.1% Tween-20, washed three times in sterile distilled water and allowed to imbibe for 14-18 hrs in distilled water at room temperature. After removing the pericarp, embryos were dissected out and germinated on MS medium solidified with 0.5% Gel-Rite. The remainder of the kernel was split into halves which were placed with the exposed aleurone layer upper most on MS plates containing 0.25 M sorbitol.
  • Tissues were usually incubated at 30°C with an 18 hr/6 hr light-dark regimen. Half-kernels were bombarded the following day, whereas germinated seedlings were bombarded 36-48 hrs after plating. In most experiments, 5 ug each of pF ⁇ l459 and/or pPHl443 DNA was precipitated onto 4.375 mg of gold particles (Engelhard A1570 Flakeless) essentially as described in the patent application of Tomes, U.S. Serial No. 351,075, the disclosures of which are hereby incorporated herein by reference. Approximately 10 7 particles in a total volume of 1 uL were delivered using a particle gun as described by Sanford, et al.
  • Anthocyanin accumulation was first detectable at 14-18 hrs after bombardment in aleurone cells and some epidermal cells (e.g., scutellar node). In other tissues (e.g., epidermal cells of root, leaf, coleoptile, tassel, etc.), pigmentation often took 36-48 hrs to develop. In most cells, the red color was stable for several weeks following bombardment. Tissues were stained for GUS within 48 hrs following bombardment essentially as described by Jefferson et al., (1987) EMBO J. , 6, 3901-3907, except that the staining solution contained 1% DMSO.
  • R locus gene expression in plant tissues is conditioned by the Pi locus.
  • anthocyanin biosynthesis is light-dependent in all tissues except for the aleurone layer.
  • Pigmentation in the aleurone layer requires Cl, which is functionally equivalent to Pi.
  • Cl Pi and Cl pi aleurones and seedling tissues which had been incubated in either the light or the dark were bombarded with pPHl443
  • aleurone pigmentation resulting from the introduction of pPHl443 was independent of either Pi or light
  • seedling pigmentation required one or the other of these factors.
  • This characteristic provides the ability to distinguish between stably and transiently transformed cells by incubating the cells in the dark for several days post- bombardment and then returning them to growth in the light. Only cells which have been stably transformed will then become pigmented.
  • pigmentation was seen in the epidermal layer of the coleoptile, mesocotyl, scutellar node, coleorhiza and both primary and adventitious roots.
  • pigmentation was frequently observed in the trichomes and marginal hairs of young leaves and tassel glumes, as well as in epidermal and sub-epidermal cells. Red cells were also seen at lower frequency in the inner and outer layers of immature pericarp, immature tassels and anther locules and both culm and husk tissues. Surprisingly, pigmented cells were never observed in either immature or mature endosperm.
  • Cell-autonomous expression can be visualized in almost all tissues of the plant without having to disturb the integrity of the plant. This is extremely useful for developmental studies of maize and other plants and for obtaining stably transformed plants.
  • By introducing the gene into meristematic cells pigmented sectors of tissues can be followed during subsequent development. Stably transformed sectors which give rise to germ line tissues can yield transformed plants in the following generation.
  • This invention also provides materials and methods for the creation of new ornamental plants in which selected cells or tissues, or all cells or tissues, produce and accumulate anthocyanin pigmentation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention se rapporte à des activateurs transcriptionnels de biosynthèse d'anthocyanine, qui sont liés fonctionnellement à un promoteur approprié dans une cassette d'expression et qui ont un eutilité étendue comme marqueurs non phytotoxiques pour la transformation de cellules végétales. Un clone codant pour l'un de ces gènes (tels que le gène Lc ou un équivalent translationnel de ce gène dans le maïs) peut être amené à fusionner avec des séquences d'expression appropriées, pour former une cassette d'expression pouvant être introduite dans des cellules végétales par n'importe quel procédé de transformation désiré. La présente invention permet également d'obtenir des substances et des procédés de production de nouvelles plantes ornementales ayant une pigmentation par l'anthocyanine.
EP19900912716 1989-08-01 1990-07-31 Transcriptional activators of anthocyanin biosynthesis as visual markers for plant transformation Withdrawn EP0462231A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US38773989A 1989-08-01 1989-08-01
US387739 1989-08-01

Publications (2)

Publication Number Publication Date
EP0462231A1 true EP0462231A1 (fr) 1991-12-27
EP0462231A4 EP0462231A4 (en) 1992-05-13

Family

ID=23531192

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19900912716 Withdrawn EP0462231A4 (en) 1989-08-01 1990-07-31 Transcriptional activators of anthocyanin biosynthesis as visual markers for plant transformation

Country Status (3)

Country Link
EP (1) EP0462231A4 (fr)
AU (1) AU6287390A (fr)
WO (1) WO1991002059A1 (fr)

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6403865B1 (en) 1990-08-24 2002-06-11 Syngenta Investment Corp. Method of producing transgenic maize using direct transformation of commercially important genotypes
UA48104C2 (uk) 1991-10-04 2002-08-15 Новартіс Аг Фрагмент днк, який містить послідовність,що кодує інсектицидний протеїн, оптимізовану для кукурудзи,фрагмент днк, який забезпечує направлену бажану для серцевини стебла експресію зв'язаного з нею структурного гена в рослині, фрагмент днк, який забезпечує специфічну для пилку експресію зв`язаного з нею структурного гена в рослині, рекомбінантна молекула днк, спосіб одержання оптимізованої для кукурудзи кодуючої послідовності інсектицидного протеїну, спосіб захисту рослин кукурудзи щонайменше від однієї комахи-шкідника
AU671272B2 (en) * 1992-01-09 1996-08-22 John Innes Foundation Regulation of plant genes
EP0764212A1 (fr) * 1994-06-06 1997-03-26 Plant Genetic Systems, N.V. Utilisation de genes de l'anthocyanine pour la conservation de plantes males steriles
US6008437A (en) * 1995-06-06 1999-12-28 Plant Genetic Systems Use of anthocyanin genes to maintain male sterile plants
AU5377896A (en) * 1995-10-16 1997-05-07 Seminis Vegetable Seeds, Inc. A method for visually selecting transgenic plant cells or tissues by carotenoid pigmentation
CA2261577A1 (fr) * 1996-08-09 1998-02-19 Calgene, Inc. Procedes de fabrication de composes carotenoides et d'huiles speciales a partir de graines de plantes
US6429356B1 (en) 1996-08-09 2002-08-06 Calgene Llc Methods for producing carotenoid compounds, and specialty oils in plant seeds
GB9706381D0 (en) * 1997-03-27 1997-05-14 Cambridge Advanced Tech Improvements relating to the specificity of gene expression
GB9801598D0 (en) 1998-01-26 1998-03-25 Unilever Plc Methods and compositions for modulating flavonoid content
US6653530B1 (en) 1998-02-13 2003-11-25 Calgene Llc Methods for producing carotenoid compounds, tocopherol compounds, and specialty oils in plant seeds
US6307123B1 (en) 1998-05-18 2001-10-23 Dekalb Genetics Corporation Methods and compositions for transgene identification
ATE358723T1 (de) 1999-04-15 2007-04-15 Calgene Llc Nukleinsäuresequenzen für proteine die an der isoprenoid-synthese beteiligt sind
US6872815B1 (en) 2000-10-14 2005-03-29 Calgene Llc Nucleic acid sequences to proteins involved in tocopherol synthesis
US6841717B2 (en) 2000-08-07 2005-01-11 Monsanto Technology, L.L.C. Methyl-D-erythritol phosphate pathway genes
AU2002218088A1 (en) 2000-11-17 2002-05-27 Agriculture And Agrifood Canada Regulation of flavonoid expression in alfalfa using maize regulatory genes
EP1392106B1 (fr) 2001-05-09 2008-12-31 Monsanto Technology LLC Genes tyra et utilisations associees
US7161061B2 (en) 2001-05-09 2007-01-09 Monsanto Technology Llc Metabolite transporters
AU2002329759A1 (en) 2001-08-17 2003-03-03 Monsanto Technology Llc Methyltransferase genes and uses thereof
WO2003034812A2 (fr) 2001-10-25 2003-05-01 Monsanto Technology Llc Methyltransferases aromatiques et utilisations associees
CA2478957C (fr) 2002-03-19 2013-07-02 Monsanto Technology, Llc Acides nucleiques et polypeptides se rapportant a l'enzyme homogentisate prenyl transferase ("hpt"), et utilisations correspondantes
BR0313270A (pt) 2002-08-05 2005-08-02 Monsanto Technology Llc Genes relacionados com a biosìntese de tocoferol e usos dos mesmos
BR112013004691A2 (pt) 2010-08-30 2017-11-21 Dow Agrosciences Llc construto de dna de ativação gênica marcada de milho, população marcada de plantas de milho, método para geração da mesma e método para gerar uma planta de milho marcada
US11034969B2 (en) * 2017-12-22 2021-06-15 Altria Client Services Llc Plant comprising recombinant polynucleotides encoding a pigment regulatory transcription factor with a tissue-preferred promoter

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4300310A (en) * 1980-07-28 1981-11-17 The Board Of Regents Of The University Of Nebraska Identification and sorting of plant heterokaryons
US4649109A (en) * 1984-02-16 1987-03-10 Brandeis University Methods for isolating mutant microorganisms from parental populations
US4771002A (en) * 1984-02-24 1988-09-13 Lubrizol Genetics, Inc. Transcription in plants and bacteria
US4833080A (en) * 1985-12-12 1989-05-23 President And Fellows Of Harvard College Regulation of eucaryotic gene expression

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9102059A1 *

Also Published As

Publication number Publication date
WO1991002059A1 (fr) 1991-02-21
EP0462231A4 (en) 1992-05-13
AU6287390A (en) 1991-03-11

Similar Documents

Publication Publication Date Title
EP0462231A1 (fr) Activateurs transcriptionnels de biosynthese d'anthocyanine utilises comme marqueurs visuels pour la transformation de plantes
US5034323A (en) Genetic engineering of novel plant phenotypes
Kobayashi et al. Myb-related genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis
EP0471056B1 (fr) Biosynthese de carotenoides dans des hotes transformes par genie genetique
Goldsbrough et al. Lc as a non‐destructive visual reporter and transposition excision marker gone for tomato
US5955361A (en) P gene promoter constructs for floral-tissue preferred gene expression
JPH08507923A (ja) Ｄｎａ、ｄｎａ構築物、細胞及びそれから誘導された植物
WO1998022593A9 (fr) Constructions promotrices du gene p pour expression preferentielle d'un gene de tissu floral
CA2626304C (fr) Cereales a dormance modifiee
US6787687B1 (en) Rin gene compositions and methods for use thereof
EP0859850B1 (fr) Promoteur de la glutathione s-transferase vegetale
HU222268B1 (hu) Hímsteril és megváltozott virágszínű transzgenikus növények és az előállításukra alkalmas DNS-konstrukciók
AU671272B2 (en) Regulation of plant genes
WO1994010831A1 (fr) Induction du nanisme et d'une floraison precoce a l'aide des proteines abondantes d'embryogenese tardive (aet) du groupe 3
US6762347B1 (en) NOR gene compositions and methods for use thereof
US6177614B1 (en) Control of floral induction in plants and uses therefor
JPH11504202A (ja) 植物における花の誘導の制御およびその使用法
WO2001014561A1 (fr) Compositions de gene nor et leurs procedes d'utilisation
CN115747233B (zh) 一种调控草莓叶色的FaPDS基因及其应用
AU741854B2 (en) Control of floral induction in plants and uses therefor
WO2001004315A2 (fr) Compositions de genes rin et leurs procedes d'utilisation
AU8150801A (en) Control of floral induction in plants and uses therefor
MXPA97006959A (en) Control of floral induction in plants, and supply of my
MXPA99000235A (en) Plan plastic division genes

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LI LU NL SE

17P Request for examination filed

Effective date: 19911021

A4 Supplementary search report drawn up and despatched

Effective date: 19920324

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB IT LI LU NL SE

17Q First examination report despatched

Effective date: 19940323

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 19950619