EP0241546A4 - Verfahren zur herstellung heterologer proteine. - Google Patents

Verfahren zur herstellung heterologer proteine.

Info

Publication number
EP0241546A4
EP0241546A4 EP19860906613 EP86906613A EP0241546A4 EP 0241546 A4 EP0241546 A4 EP 0241546A4 EP 19860906613 EP19860906613 EP 19860906613 EP 86906613 A EP86906613 A EP 86906613A EP 0241546 A4 EP0241546 A4 EP 0241546A4
Authority
EP
European Patent Office
Prior art keywords
protein
flagellin
gene
sequence
nucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP19860906613
Other languages
English (en)
French (fr)
Other versions
EP0241546A1 (de
Inventor
Mark L Stahl
Vallie Edward R La
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetics Institute LLC
Original Assignee
Genetics Institute LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetics Institute LLC filed Critical Genetics Institute LLC
Publication of EP0241546A1 publication Critical patent/EP0241546A1/de
Publication of EP0241546A4 publication Critical patent/EP0241546A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/62—Insulins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/036—Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones

Definitions

  • This invention relates to a novel method for producing a heterologous protein in a bacterial host cell such that the protein is exported from the host cell into the extracellular medium.
  • protease degradation of secreted proteins is to utilize mutant strains deficient in protease production. Mutations have been isolated in both the alkaline and neutral protease structural genes by recombinant methods (Stahl and Ferrari, 1984; Yang et al., 1984; Kawamura and Doi, 1984). Other protease deficient mutations isolated, to date, are pleitropic and also block the formation of mature endospores (Michel and Millet, 1970).
  • the method of this invention results in the transport of protein out of a flagellated bacterium and does so during the logarithmic growth phase and in the presence of a repressive substance such as-glucose. Products thus secreted are likely to be spared the problem of degradation by some proteases. Combining this secretion method with protease deficient mutants may improve product stability even more.
  • This method harnesses the export system normally used by the host cell in exporting the protein flagellin.
  • Flagellin which is the monomeric protein component of the flagellar filament, is a major extracellular protein product in many bacteria. Specifically, it is the predominant extracellular protein in logarithmic and early stationary phase of growth when Bacillus is grown- in minimal salts and glucose. The mechanism by which flagellin is exported is unknown. It does not seem to be exported by using a signal sequence which is cleaved from the amino-terminus of the protein (Silhavy et al., 1983). The amino-terminus of purified flagellin from Caulobacter crescentus. for example, has a sequence which corresponds to the putative translation start of its cloned structural gene (Gill and Aggbian, 1982,1983).
  • the amino-terminus of purified flagellin from Salmonella tvphimurium begins with alanine which corresponds to the second amino acid following the translation start ⁇ f its cloned structural gene (Joys and Rankis, 1972; Zieg and Simon, 1980). It is therefore unlikely that a processed leader sequence mediates transport of flagellin in bacteria such as Bacillus. Salmonella or Caulobacter.
  • Flagellin and several other proteins seem to exit the cell through the central core of the flagellum (lino, 1977; Silverman and Simon, 1977). These proteins can be as large as about 60 Kd so the physical size of the organelle core does not seem to limit this system unduly.
  • the mechanism of secretion and the structural necessities of proteins to be exported by this system are not known, but much information about this system and the related system in £_ £__!_ has been collected and reviewed by lino (1977) and Silverman and Simon (1977).
  • One notable feature of the system is its efficiency. It suffices to note that a flagellated £. co ⁇ cell has some 60,000 flagellin molecules (Komeda, 1982), thus a culture containing 1 x 10 9 cells per ml exports approximately 5 mg per liter of flagellin.
  • flagellar assembly is that the structure is assembled from the ceil membrane outward and the new components are derived from proteins that are transported through the core of the organelle and are assembled on the tip of the growing organelle.
  • the flagellin structural gene is one of the last flagellar genes to be transcribed and translated during the synthesis of the flagellar organelle.
  • a strain deleted for the flagellin gene should have an intact basal body and hook structure but would lack the filament.
  • a mutation of interest to this invention is the ci ⁇ mutation, which has a phenotype of constitutive flagellar synthesis when this strain is grown in the presence of glucose (Silverman and Simon, 1977). £. cQJl strains carrying this particular mutation also produce five-fold more flagellin than wild-type strains.
  • the present invention we have isolated and determined the sequence of the E- subtilis hag gene; deleted, in certain embodiments, part or all of this gene from the genome of the host cell; identified essential .elements of the sequence involved in transport of the protein to the outside of the cell; inserted into the host cell a heterologous gene encoding a desired protein at some site within the genome of the bacterium or within a flagellin gene locus of the host cell genome or as an extrachromosomal plasmid and expressed and exported fusion proteins containing the desired protein fused to that portion of flagellin essential for export. Methods and materials for the execution of this strategy are disclosed in detail hereinafter.
  • This invention concerns a method for producing a heterologous protein in a bacterial host cell such that the protein is exported from the host cell into the culture medium.
  • the method involves culturing in a bacterial culture medium a genetically engineered bacterial strain containing a fusion DNA sequence comprising a first nucleotide sequence encoding at least an N-terminal portion of a flagellin protein and a second nucleotide sequence encoding the heterologous protein.
  • the first nucleotide sequence is linked via its 3' terminus to the 5' terminus of the second nucleotide sequence, and the fusion DNA sequence is itself operatively linked to an expression control sequence.
  • the two linked nucleotide sequences making up the fusion DNA sequence are linked to each other "in frame" such that the coding region of the entire fusion DNA sequence is translated to produce the encoded protein.
  • the first and second nucleotide sequences are linked by means of a linking nucleotide sequence encoding a selectively cleavable polypeptide.
  • the resulting exported fusion protein may be selectively cleaved by chemical or enzymatic methods to produce the heterologous protein encoded for by the second nucleotide sequence of the fusion DNA sequence.
  • the heterologous protein may then be separately recovered from any polypeptide fragment of flagellin or other protei ⁇ aceous material.
  • Figure 1 depicts restriction maps of clones p4A and p8A and the extent of nucleotide sequencing of clone p4A.
  • Table i depicts the available nucleotide sequence data for clone p4A.
  • Table 2 depicts the nucleotide and amino acid sequence of the ⁇ 5M proinsulin gene and corresponding protein.
  • Table 3 depicts the nucleotide sequence of the £. __ ⁇ _Ii flagellin gene.
  • the invention relates to a method for producing a heterologous protein in a bacterium of a flagellate species such that the heterologous protein is exported by the bacterium into the bacterial growth medium.
  • the method involves culturing in a suitable bacterial growth medium a bacterial strain containing as part of its genetic material a "fusion" DNA sequence which includes a nucleotide sequence encoding at least a portion of the N-terminus of a flagellin protein linked to a heterologous gene, i.e., a gene encoding a protein other than flagellin.
  • the fusion DNA sequence is operatively linked to an expression control sequence, preferably that of the flagellin gene of the host bacterium, and contains a translational terminating signal 3' to the heterologous gene component.
  • Suitable host cells may be selected from a wide range of flagellate bacterial species including for example Escherichia coli. Caulobacter crescentus and Bacillus subtilis.
  • the host cell must contain a known or identifiable nucleotide sequence encoding a flagellin protein. It should be noted that bacteria in which flagellin-encoding DNA has not been identified heretofore may also be useful in the practice of this invention.
  • the appropriate nucleotide sequence may be identified and characterized by using conventional techniques to recover and appropriately purify a suitable amount of flagellin from the bacteria for protein sequencing, determine the amino acid sequence of a portion of the flagellin, prepare oiigonucleotide probes corresponding to the amino acid sequence so determined, screen a DNA library derived from the bacteria for the presence of a nucleotide sequence capable of hybridizing to the probe(s) and determine the nucleotide sequence of the DNA so identified and/or its location in the bacterial genome.
  • the flagellin gene of E- subtilis may be routinely obtained from the B. subtilis genome as a 2.5 Kb PstI fragment by purely conventional means using an oligonucleotide probe complementary to part or all of the sequence depicted in Table 1.
  • the flagellin gene of E- subtilis may be routinely obtained from the B. subtilis genome as a 2.5 Kb PstI fragment by purely conventional means using an oligonucleotide probe complementary to part or
  • E. coli flagellin gene may be obtained from the E. coli
  • the wild-type host cell must contain at least one flagellum and preferably, as in the case B. subtilis or E. coli. a plurality of flagella.
  • the host cell is an increased flagellin and motility (ifm) strain of B . subtilis.
  • Strains carrying ifm mutations produce and export significantly more flagellin than wild-type host cells and may be conveniently obtained by iteratively selecting from cultured colonies those cells which migrate furthest away from the spot of inoculation on a semisolid medium referred to as "motility agar".
  • An ifm strain of B. subtilis, for example has been so obtained which produces and exports about twenty times as much flagellin as does the wild-type B. subtilis.
  • the genetically engineered ifm strain produced and exported about twenty times as much heterologous protein as a similarly treated wild-type strain.
  • the DNA sequence encoding the N-terminal portion of flagellin e.g. a portion of the hag gene of B. subtilis. is operatively linked to an. expression control sequence, including for example, a promoter, a ribosome binding site and a translation start codon.
  • an expression control sequence including for example, a promoter, a ribosome binding site and a translation start codon.
  • the expression control sequence used is the host cell's expression control
  • ' fMet Arg lie Asn His Asn lie Ala Ala 143 TGCCTTAACAACATATTCAGGGAGGAACAAAACA ATG AGA ATT AAC CAC AAT ATT GCA GCG
  • Glu Lys Leu Ser Ser Gly Leu Arg lie Asn Arg Ala Gly Asp Asp Ala Ala Gly 258 GAG AAA CTT TCT TCA GGT CTT CGC ATC AAC CGT GCG GGA GAT GAC GCA GCA GGT
  • Glu Thr His Ala lie Leu Gin Arg Val Arg Glu Leu Val Val Gin Ala Gly Asn 420 GAA ACT CAT GCG ATC CTT CAA CGT GTT CGT GAG CTA GTT GTT CAA GCT GGA AAC
  • the preferred expression control sequence is the expression control sequence of the ' hag gene.
  • the heterologous protein which is produced and exported will usually be a fusion protein comprising at least a portion of the flagellin protein linked to the protein encoded for by the heterologous gene.
  • the fusion DNA sequence contains a full-length flagellin-encoding nucleotide sequence linked via its 3'terminus to the 5' terminus of the heterologous gene.
  • the flagellin- encoding sequence is truncated at its 3 ' terminus.
  • the fusion DNA sequence contains nucleotides 1-633 of the flagellin-encoding gene linked via nucleotide 633 to the 5' terminus of the heterologous sequence.
  • a shorter portion of the flagellin gene is used which contains nucleotides 1-432.
  • Other embodiments may contain deletions of various lengths within the 432-912 nucleotide region of'the flagellin gene. Sequences containing further deletion of nucleotides 5' to nucleotide - 432 are also expected to be useful in the practice of this " invention although the exact length of the remaining flagellin sequence which permits or optimizes export of the fusion protein has not yet been precisely determined.
  • the desired flagellin-encoding sequence may be only about 75, 50, 25 or 10 codons in length. Even shortier flagellin-encoding sequences may be useful in this invention, and it is possible that the 5 1 untranslated region alone of the flagellin gene, with no flagellin-encoding nucleotide sequence, will permit export of the heterologous protein in certain cases.
  • heterologous as the term is used herein is meant a protein or DNA sequence other than a flagellin protein or a DNA sequence encoding a flagellin
  • the fusion DNA sequence contains an additional nucleotide sequence which links the flagellin gene portion and the heterologous gene.
  • the linking sequence encodes a polypeptide which is selectably cleavable or digestable by conventional chemical or enzymatic methods.
  • the fusion protein of this embodiment will thus contain an engineered cleavage site at which it may be selectably cleaved. Cleavage of the fusion protein yields the "mature" protein which is encoded by the heterologous gene. The mature protein may in turn be obtained in purified form, free from any polypeptide fragment of flagellin to which it was previously linked.
  • the engineered host cells produce and export the heterologous. protein during a growth phase when protease secretion is at a minimum.
  • a growth phase when protease secretion is at a minimum.
  • the engineered host cells produce and export the heterologous protein in the presence of a substance which tends to further reduce the level of exported proteases e.g. glucose, in -the case of B. subtilis.
  • heterologous DNA a wide variety of heterologous proteins may be produced by this method including, for example, proteins useful for human or veterinary therapy or diagnostic applications, such as hormones, cytoxins, growth or inhibitory factors, etc., fu ctional enzymes, and modified natural or wholly synthetic proteins.
  • One approach for producing a genetically engineered bacterium of this invention involves deleting a portion or all of the flagellin gene from the chromosome of the host bacterium and inserting into the flagellin deletion locus or into another chromosomal locus, a plasmid-borned heterologous gene via a single recombination event.
  • the replacement of the host flagellin gene with a deleted version constructed in vitro is performed by established methods (Stahl and Ferarri, 1984, Yang et al . , 1984;
  • an "integrable plasmid” or an "integration vector” in B. subtilis is well documented (Ferrari et al . , 1983) .
  • This particular integration vector is comprised of a selectable antibiotic resistance gene and a plasmid origin that allows extrachromosal replication in 32. coli . but not in B. subtilis.
  • this vector must include a sequence which is homologous to a sequence within the host genome; this may be- a portion of the flagellin gene that has not been deleted from the host genome, or the sequence could be a portion or all of another host gene.
  • the plasmid also includes a heterologous gene fused to a.
  • the resulting chromosomal structure contains the plasmid flanked by directly duplicated copies of the homologous
  • SUBSTITUTE SHEET 14 sequence As long as antibiotic selection is maintained, the plasmid-derived sequences are replicated- and stably inherited as part of the bacterial genome. In some cases, perhaps depending on which antibiotic resistance gene is placed on this plasmid, the integrated plasmid can be
  • amplified or the number of integrated plasmid copies can be increased, by growth of the strain carrying the integrated plasmid in higher levels of the antibiotic used to select for the initial integration (Gutterson and
  • heterologous protein may be accomplished by transforming, with or without amplification, the plasmid into a host strain carrying the ifm mutation.
  • a second approach involves stably inserting a plasmid into a flagellin deletion strain, preferably one that contains the ifm mutation, wherein the plasmid contains a fusion DNA sequence as previously described and in addition, a functional origin that allows extrachromosomal replication in B. subtilis.
  • the plasmid must also contain a selectable gene, such as an antibiotic resistance gene, which can be used to select for the inheritance of the plasmid by transformation and to insure maintenance of the plasmid during culture growth.
  • a selectable gene such as an antibiotic resistance gene
  • the plasmid pUBllO which is a Staphylococcus aureus plasmid that is often used in B. subtilis molecular biological applications, is a potentially useful high copy number plasmid (Gryczan, et al., 1978). This particular plasmid has a copy number of approximately 40 per cell.
  • Another plasmid, pE194, may be useful as a low copy plasmid in B. subtilis (Gryczan and Dubnau, 1978) . When this plasmid is 15 transformed into B. subtilis it maintains a copy number of approximately 5-10 per cell.
  • a third approach for producing a genetically engineered bacterium of this invention is to integrate a plasmid, which is comprised of a heterologous gene fused to the 3 ' end of a portion of the flagellin gene that lacks the transcription and translation control sequence and in addition may lack a portion of the gene encoding the N- terminal region of the gene, into a B. subtilis host containing an intact flagellin gene and preferably the ifm mutation.
  • This integrable plasmid also contains a selectable antibiotic resistance gene and a plasmid origin that allows extrachromosomal replication in E. coli, but not in B. subtilis. When transformed into B. subtilis, selection is for the inheritance of the antibiotic resistance gene and integration into the chromosome is mediated by .
  • the heterologous gene is fused to the transcription and translation regulatory sequences and all or part of the encoding sequences of the host flagellin gene.
  • the fusion junction between flagellin and the heterologous gene must be a codon that is 3 ' of those flagellin sequences required for export. If so, the integration of this plasmid generates one copy of a completely functional gene that codes for the expression and export of a heterologous protein.
  • the integration also generated two truncated and nonfunctional genes, a flagellin gene that lacks transcription and translation control sequences and may or may not contain sequences encoding for a portion of the N-terminus, and a flagellin-heterologous gene fusion that lacks the same sequences.
  • a flagellin gene that lacks transcription and translation control sequences and may or may not contain sequences encoding for a portion of the N-terminus
  • a flagellin-heterologous gene fusion that lacks the same sequences.
  • SUBSTITUTE SHEET 16 into B. subtilis interrupts the host flagellin gene and at the same time introduces the desired gene fusion between flagellin and the heterologous gene at a copy number of one per chromosome.
  • E. coli was transformed by the procedure of Dagert and Ehrlich (1979), with selection on . L agar plates containing 15 ⁇ g/ml neomycin, 15 ⁇ g/ml chloramphenicol, or 50 ⁇ g/ml ampicillin. B.
  • subtilis strains were transformed by the procedure of Anagnostopoulos and Spizizen (1961), with selection on L agar plates containing 5 ⁇ g/ml neomycin or 5 ⁇ g/ml chloramphenicol. Auxotrophic markers were selected on minimal glucose plates supplemented with the appropriate amino acids at 50 ⁇ g/ml (Spizizen, 1958).
  • B. subtilis G1B1 was constructed by transforming E_ subtilis 168 trpC2 with E_ subtilis W23 DNA and selecting for Trp + transformants. An ifm mutation was selected in this strain by repeated selection for hypermotility on motility agar by the method of Grant and Simon (1969).
  • the plasmids pBR322, pJH101 , pUC18, pUC19, and pUB110 have all been described previously (Bolivar et al., 1977; Yanisch-Perron et al., 1985; Ferrari et al., 1983; Gryczan et al., 1978).
  • the plasmid pALl ⁇ 5M contains the human proinsulin gene that has been specifically mutagenized to encode a proinsulin that can be processed in vitro to insulin by enzymatic and chemical means (U. S. Serial No. 646,573 and International Application No. PCT/US 85/01673; see figure 3).
  • Plasmid DNA was prepared from f ______ transformants by the alkaline lysis method of Birnboim and Doly
  • B. subtilis chromosomal DNA was prepared by the method of Marmur (1961 ). The separation of restriction fragments on polyacrylamide and agarose gels and the electroelution of DNA fragments were performed as previously described (Lawn et al., 1981). All plasmid constructions were made with DNA fragments purified by electroelution from gels. Restriction fragments were ligated into appropriate sites of M13 phage vectors mp18 or mp19 (Vieira and Messing, 1982; Yanisch-Perron et al., 1985) in preparation for sequence determination by dideoxy methods (Sanger et al., 1977).
  • DNA restriction fragments were prepared as probes by labeling [alpha- 3 P] CTP by nick-translation (Rigby et al., 1971 ).
  • Synthetic oligonucleotides were synthesized by the phosphotriester method (Crea and Horn, 1980), and end labeled with [gamma- 32 P] ATP and T4 polynucleotide kinase (Richardson, 1971).
  • Hybridization conditions for the labeled oligonucleotide pools were at 37 C in a solution of 1 X Denhardt solution, 0.1 mM ATP, 1 mM NaCI, 0.5 % Nonidet® P-40-, (a nonionic detergent; Sigma), 200 ng/ml soluble type XI bakers yeast RNA (Sigma), 90 18
  • PMSF me thylsulfonyl fluoride
  • EDTA EDTA
  • E_ subtilis 168 flagellin was purified by the method of Martinez (1963). Once isolated, the material was separated from minor contaminants on a preparative SDS-polyacrylamide gel and the band containing flagellin was cut out, lyophilized and used as an antigen in rabbits for the production of flagellin specific antibodies. This protocol resulted in the production of highly specific antibodies for the detection of flagellin and flagellin-heterologous fusion proteins by western blot analysis.
  • E_ subtilis GIBI and _ subtilis GIB1 ifm were grown in expression medium plus L- 3 ⁇ S-methionine to mid-logarithmic phase of growth. Samples from the culture were processed as described in the methods section to compare the levels of flagellin produced in the two strains. There was approximately 10-fold more flagellin exported in the strain carrying the ifm mutation. The western blot with a ⁇ tiflagellin antibody confirmed that this protein is flagellin.
  • the 17-mer oligonucleotide probe pool for the cloning, by hybridization, of the hag gene of B. subtilis GIB1 was designed and based on the published amino acid sequence of flagellin (Delange et al., 1976). Two pools of 12 17-mer oligonucleotides completely covered the degeneracy of amino acids 170-174 and, in addition, the first two bases of the glycine codon at amino acid 175 of the sequence (Asn-lle-Glu-Asp-Met-Gly).
  • sequences of the oligonucleotides in pool number 1 are ⁇ '-A-A-T/C-A-T-T/C/A-G-A-A/ G-G-A-T-A-T-G-G-G-3 * and pool number 2 are 5'-A-A-T/C- A-T-T/C/A-G- A- A/G-G-A-C-A-T-G-G-G-3 * .
  • a genomic library was prepared in pUC18 using DNA from E_ - subtilis GIB1.
  • the vector was digested with Eall and the first two bases complementary to the 5' overlapped ends were filled in using the Klenow fragment of DNA polymerase I and dTTP and dCTP.
  • the bacterial DNA was partially digested with £__il3A and sized on a preparative agarose gel. DNA fragments ranging in size from 2-5 Kb were cut put and electroeluted from the gel and then treated with the Klenow fragment and dGTP and dATP to 21
  • the EL ⁇ ___ii - subtilis shuttle vector, pBE3 contains the pUC18 polylinker (147 bp EcoRI - Pvull restriction fragment), the pBR322 origin of replication (1166 bp P____U.II - Ahalll restriction fragment), and the neomycin nucleotidyl tra ⁇ sferase gene and origin of replication from pUB110 (3,529 bp Pvull - EcoRI restriction fragment).
  • the integration vector, plEVI is a derivative of pJH101 that replicates autonomously in E. coli. but when transformed into B. subtilis. must integrate into the chromosomal flagellin locus.
  • the plasmid contains the chloramphenicol acetyl transferase (CAT) gene and origin of replication from pJH101 (3,224 bp £stl - Aval restriction fragment), part of the pUC18 polylinker (200 bp Pvull - Xbal restriction fragment) and a 400 bp Hindi 11 - £tl restriction fragment from the E. subtilis chromosome just 5' of the Jbag, promoter region (see Fig. 1). The 5' overlaps of the Aval. Xbal.
  • Hindlll ends were filled in by the Klenow fragment of DNA pol I with all four dNTPs before ligation.
  • the order of these restriction fragments in a clockwise direction on a circular map is _____IJ--origin-CAT gene--Aval/Pvull-polylinker--Xbal/Hindlll--40Q bp chromosome fragme ⁇ t-Pstl.
  • plEV1fla304Pl ⁇ C Construction of plEV1fla304Pl ⁇ C.
  • the plasmid plEV1fla304Pl ⁇ C is a derivative of plasmids, pBE3, pALI ⁇ 5M, p4A, and plEVI which contains the pBR322 origin of replication, the CAT gene which confers functional resistance to chloramphenicol in both £, coli and E. subtilis. and a sequence which encodes amino acids 144 - 304 of flagellin (see Table i) , four junction amino acids (Gly-Met-Gln-Ala), and the ⁇ 5M proinsulin gene (see Table 2) .
  • the latter encoding sequence does not contain regulatory sequences for the initiation of transcription and translation.
  • subtilis GIB1 ifm. it integrates via a single recombination event between the homologous plasmid-bome and chromosomal flagellin sequences apd results in the reconstitution of a functional gene which encodes a fusion protein containing 1 - 304 amino acids of flagellin, the 4 junction amino acids, and the ⁇ 5M proinsulin sequence.
  • This gene includes the host transcription and translation start
  • This plasmid was constructed as follows. The 4750 bp Hindlll - Pvull restriction fragment from pBE3, (the first three bases of the Hindlll 5' overlap were filled in by the Klenow fragment with dATP, dGTP, and dCTP), was ligated to the 470 bp f&hl - Ndel restriction fragment from pALI ⁇ 5M, (the 3' overlap of the Sphl site was chewed back by the Klenow fragment and the first base of the Ndel 5' overlap was filled in by the Klenow fragment with dTTP), to construct pFPH .
  • the Ahalll end of the fragment from p4A was treated with "slow" bal-31 exonuclease before ligatidn, and the proper pFPIfla304 construction was screened by colony hybridization with an oligonucleotide (5'-T-T-A-T-T-A-C-G-T-G-G-C-A-T-G-C-A-A-A-3 * ) that spans the correct ligation juntion. The sequences of the hybridization positives were determined to confirm the proper construction.
  • the 1621 bp BamHl - Boil restriction fragment from pFPIfla304 (the Bail 5' overlap was filled in with the Klenow fragment and all four dNTPs), was ligated to the 3827 bp BamHl - EcoRI restriction fragment from plEVI (the EcoRI 5' overlap was filled in with the Klenow fragment and all four dNTPs) to construct the plasmid plEV1fla304PI.
  • the plasmid plEV1fla304Pl ⁇ C was constructed by digesting plEV1fla304PI with CJal, purifying the 4500 bp fragment and religati ⁇ g the same fragment.
  • flagellin-proinsulin fusion protein was identified as a band that bound antiflagellin antibody and migrated at the expected molecular weight when compared to the migration of flagellin. The appearance of this band in the supernatant fraction of the culture aliquot confirms that a significant amount of flagellin-proinsulin fusion protein was exported into the medium.
  • Flagellin in B. subtilis G1B1 ifm is exported at levels up to 10 - 20 % of the total cell protein during logarithmic stage of growth, in the presence of glucose, where the secretion of extracellular proteases is minimized.
  • the flagellin export pathway has been utilized to export heterologous fusion proteins into the culture medium.
  • a recombinant flagellin - proinsulin fusion protein was exported via the flagellin export pathway.
  • This same experimental approach was successfully used to export another flagellin - heterologous fusion protein, namely flagellin - TEM ⁇ -lactamase fusions.
  • This particular ⁇ -lactamase is from the plasmid pUC18 (Yanisch-Perron et al., 1985), and confers ampicillin resistance to various gram negative bacteria including £. coli.
  • Flagellin - ⁇ -lactamase gene fusions were expressed in Bacillus which resulted in the accumulation of flagellin - ⁇ -lactamase fusion protein in the culture medium.
  • This fusion protein has ⁇ -lactamase activity and also cross reacts with antiflagellin and anti ⁇ -lactamase antibodies.
  • strains carrying the flagellin - ⁇ -lactamase gene fusions were resistant to ampicillin.
  • the flagellin - proinsulin fusion protein contains a methionine residue at the junction between the flagellin amino acid residues and the proinsulin residues thus the latter could be cleaved from flagellin with cyanogen bromide. Active and properly folded insulin may thus be obtained by combined treatment of the fusion protein with cyanogen bromide and a
  • the strategy for the export of a variety of homologous or heterologous proteins via the flagellin pathway is to fuse the coding sequence for that protein "X" to a portion or all of the flagellin coding sequence, and at the junction, introduce a specific cleavage site so that the desired sequence may be removed by chemical or enzymatic means.
  • cyanogen bromide which cleaves on the carboxy side of methionine residues
  • formic acid may be used to cleave between aspartic acid and proline residues (Nilsson et al., 1985).
  • proteases which also may be useful for site specific cleavages. Two examples are porcine enteropeptidase, which cleaves on the carboxy side of the sequence (Asp) 4 -Lys ( Maroux et al., 1971), and factor X a , which cleaves on the
  • a nucleotide sequence that encodes for either of the specific recognition sites for these or other specific proteases may be placed, by conventional recombinant methods, at the junction of flagellin - protein "X" encoding sequences.
  • the use of specific proteases to cleave fusion proteins exported via the flagellin pathway would result in the release of protein "X" without an f-Met or Met residue at the N-terminus.
  • flagellin can be purified easily and is highly antigenic, consequently fusion proteins may be purified by affinity chromatography with flagellin antibody, then processed by the appropriate chemical or enzymatic means.
  • fusion proteins would require specific processing to a mature, active form by specific chemical or enzymatic means as described above.
  • these types of proteins include insulin, colony stimulating factors, human growth hormone, or other pharmaceuticals destined for human use.
  • Other proteins for example, enzymes such as proteases, amyiases or proteins such as animal growth hormones, may be active and suitable for use as flagellin fusion proteins. In cases such as these the specific chemical or enzymatic processing step required for removal of the flagellin encoding sequences would be unnecessary.
  • the export of homologous or heterologous proteins via the flagellin export pathway may be further improved by modifications in host cell development, vectors, and promoter vector combinations. At least two general catagories of host cell mutations may further increase the final yield of flagellin - protein "X" fusion protein obtained in this process.
  • host mutations that decrease protease activity may be used. Most protease activity can be minimized simply by growing the culture in the presence of excess glucose, but further improvements may be obtained by isolating mutations in regulatory genes, such as spoQ mutations, which are pleitropic and result in decreased expression of some proteases (Michel and Millet, 1970; Hoch, 1976).
  • Recombinant methods may be used to isolate in vitro - derived mutations in other protease structural genes as has been accomplished with the alkaline and neutral protease genes (Stahl and Ferrari, 1984; Yang et al., 1984; Kawamura and Doi, 1984).
  • the host flagellin gene may be inactivated to provide for more efficient export of flagellin fusion proteins.
  • the integration event generated an active flagellin - proinsulin gene fusion, and simultaneously, inactivated the resident flagellin gene.
  • the inactivation of the host flagellin gene can also be accomplished by replacing the gene with an in vitro - derived deletion mutation (Stahl and Ferrari, 1984; Yang et al., 1984; Kawamura ' and Doi, 1984). This would increase the flexibility of using alternate vector - promoter combinations which may ultimately increase the yield of the desired product.
  • the regulatory sequences for the initiation of transcription and translation of flagellin - gene "X" gene fusions in these examples may be those from the flagellin gene or.may be from another gene where transcription and translation is constitutive; or these sequences may be from a gene that is regulated and thus could be controlled.
  • the latter type of regulatory sequence may be used where it is desired to prevent gene expression until the culture density is high, at which point transcription and translation may then be initiated to yield product accumulation in the culture medium. Expression of genes encoding 29
  • heterologous or homologous proteins controlled by any one of the above regulatory sequences may be on low-copy vectors such as integrable plasmids '(Ferrari et al., 1983) or plasmids such as pE194 that replicate extrachromosomally (Gryczan and Dubnau, 1978) or high-copy vectors such as pUB110 (Gryczan et al., 1978) and pBE3 which replicate extrachromosomally.
  • An integration vector may be inserted into any gene in the chromosome.
  • a particularly attractive insertion site is a gene that - is dispensible for normal growth, such as the neutral protease structural gene (Yang et al., 1984). This gene may be cloned and a portion of the coding sequence could be used as the homologous sequence on an integrable plasmid that is required for integration by recombination.
  • Genes or portions thereof for other proteins of the flagellum may be used in place of the flagellin gene to achieve production and export of the heterologous protein.
  • the protein may be recovered, purified and sequenced, in whole or part, and the gene encoding the protein identified by hybridization with oligonucleotide probes, for example. Identification and use of such genes in accordance with this invention may be accomplished in analagous fashion to the methods disclosed herein for flagellin-related embodiments.
  • flagellin gene can be easily cloned as described previously in this document and flagellin - heterologous gene fusions can be expressed as a part of low or high copy plasmid vectors or as sequences integrated into the chromosome.
  • a mutation, cj ⁇ has been isolated which when introduced into a strain results in a five-fold overproduction of flagellin and renders the strain constitutively motile (Silverman and
  • flagellin - heterologous fusion protein Five-fold more flagellin - heterologous fusion protein may be produced if the appropriate vector containing the gene fusion is introduced into this mutant strain.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP19860906613 1985-10-11 1986-10-10 Verfahren zur herstellung heterologer proteine. Withdrawn EP0241546A4 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US78674985A 1985-10-11 1985-10-11
US786749 1985-10-11

Publications (2)

Publication Number Publication Date
EP0241546A1 EP0241546A1 (de) 1987-10-21
EP0241546A4 true EP0241546A4 (de) 1988-11-02

Family

ID=25139491

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19860906613 Withdrawn EP0241546A4 (de) 1985-10-11 1986-10-10 Verfahren zur herstellung heterologer proteine.

Country Status (3)

Country Link
EP (1) EP0241546A4 (de)
JP (1) JPS63501053A (de)
WO (1) WO1987002385A1 (de)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4886748A (en) * 1986-03-11 1989-12-12 Shionogi & Co., Ltd. DNA encoding flagellin and vector having the same
US6130082A (en) * 1988-05-05 2000-10-10 American Cyanamid Company Recombinant flagellin vaccines
ATE121782T1 (de) * 1988-05-05 1995-05-15 Praxis Biolog Inc Rekombinante vakzine von flagellin.
EP1836221B1 (de) 2004-12-02 2011-08-03 Csir Grampositive bakterienzellen enthaltend ein unterbrochenes flagellingen, fusionsproteine auf flagellinbasis und deren verwendung zum entfernen von metallionen aus einer flüssigkeit
US10849938B2 (en) 2017-09-13 2020-12-01 ZBiotics Company Gene expression system for probiotic microorganisms
US10975377B2 (en) * 2018-01-30 2021-04-13 Jiangnan University Method for regulating expression of protein of interest in bacillus subtilis

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4338397A (en) * 1980-04-11 1982-07-06 President And Fellows Of Harvard College Mature protein synthesis
EP0124374A1 (de) * 1983-04-28 1984-11-07 Genex Corporation Herstellung von Protein A
WO1984004756A1 (en) * 1983-05-24 1984-12-06 Celltech Ltd Polypeptide and protein products, and processes for their production and use
EP0157235A1 (de) * 1984-03-22 1985-10-09 Bayer Ag Verfahren zur Herstellung von Proteinen
EP0237045A2 (de) * 1986-03-11 1987-09-16 Shionogi & Co., Ltd. Für Flagellin kodierende DNS und dieses enthaltender Vektor

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4338397A (en) * 1980-04-11 1982-07-06 President And Fellows Of Harvard College Mature protein synthesis
EP0124374A1 (de) * 1983-04-28 1984-11-07 Genex Corporation Herstellung von Protein A
WO1984004756A1 (en) * 1983-05-24 1984-12-06 Celltech Ltd Polypeptide and protein products, and processes for their production and use
EP0157235A1 (de) * 1984-03-22 1985-10-09 Bayer Ag Verfahren zur Herstellung von Proteinen
EP0237045A2 (de) * 1986-03-11 1987-09-16 Shionogi & Co., Ltd. Für Flagellin kodierende DNS und dieses enthaltender Vektor

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF BACTERIOLOGY, vol. 139, no. 3, September 1979, pages 721-729; Y. KOMEDA et al.: "Regulation of expression of the flagellin gene (hag) in Escherichia coli K-12: Analysis of hag-lac gene fusions" *
JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 254, no. 3, 10th February 1976, pages 705-711, US; R.J. DELANGE et al.: "Amino acid sequence of flagellin of Bacillus subtilis 168" *
PROC. NATL. ACAD. SCI. USA, vol. 79, November 1982, pages 6847-6851; M. MILHAUSEN et al.: "Cloning of developmentally regulated flagellin genes from Caulobacter crescentus via immunoprecipitation of polyribosomes" *
See also references of WO8702385A1 *

Also Published As

Publication number Publication date
WO1987002385A1 (en) 1987-04-23
EP0241546A1 (de) 1987-10-21
JPS63501053A (ja) 1988-04-21

Similar Documents

Publication Publication Date Title
US4801536A (en) Method for producing heterologous proteins
Nilsson et al. Efficient secretion and purification of human insulin-like growth factor I with a gene fusion vector in Staphylococci
US4897348A (en) Recombinant materials and methods for producing human connective tissue-activating peptide-III and analogs thereof
JP2521413B2 (ja) シグナル配列をコ―ドしているｄｎａと直接結合しているヒト成長ホルモンをコ―ドしているｄｎａ
EP0234888B1 (de) Verfahren zur Herstellung von menschlichem Epidermalwachstumsfaktor und dessen Analogen
US4994379A (en) Modified signal peptides
EP0138948B1 (de) DNS- Sequenzen für Signal-Peptide
EP0196864A2 (de) Behandlung und Sekretion von rekombinanten Proteinen mittels alkalischer Phosphatase, dazu verwendbare DNA-Sequenzen und mittels dieser Sequenzen transformierte Zellen
HU205386B (en) Process for expressing cloned lysostaphin gene and for producing dna fragment containing the gene, expression vector and transformed host cell
Wong et al. Use of the Bacillus subtilis subtilisin signal peptide for efficient secretion of TEM beta-lactamase during growth
US5087564A (en) Release of recombinant peptides from polypeptides using V8 endopeptidase
AU595805B2 (en) Releasing desired peptides from fusion polypeptides using endopeptidases
Vasantha et al. Secretion of a heterologous protein from Bacillus subtilis with the aid of protease signal sequences
AU661054B2 (en) Biosynthetic process for the preparation of chemical compounds
WO1987002385A1 (en) Method for producing heterologous proteins
EP0133756A2 (de) Vektor für die Expression von Polypeptiden
JP3154720B2 (ja) 誘導性発現ベクター
EP0225860B1 (de) Verfahren zur Ausscheidung von Genprodukten in das Wachstumsmedium von gram-negativen Bakterien
EP0063494B1 (de) Verfahren zum Produzieren von Protein aus einem Mikroorganismus, Mikroorganismen zur Verwendung in solchem Verfahren und ihre Erzeugung, Vektoren zur Verwendung in dieser Erzeugung und Protein produziert durch diesen Mikroorganismus und von diesen Mikroorganismen abgeleitete transformierte Kulturen
KR940010862B1 (ko) 유용한 메탈로프로테이나제 억제제 씨퀀스 재조합 벡터계의 제조를 위한 dna 재조합 방법
WANG et al. Construction of a Bacillus subtilis mutant-deficient in three extracellular proteases
US5171673A (en) Expression of heterologous dna using the bacillus coagulans amylase gene
US5843709A (en) Biosynthetic process for the preparation of chemical compounds
WO1985001067A1 (en) Recombinant materials and methods for producing human connective tissue-activating peptide-iii and analogs thereof
JPS63102684A (ja) 遺伝子およびその利用方法

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LI LU NL SE

17P Request for examination filed

Effective date: 19871014

A4 Supplementary search report drawn up and despatched

Effective date: 19881102

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

17Q First examination report despatched

Effective date: 19901105

18W Application withdrawn

Withdrawal date: 19901030

RIN1 Information on inventor provided before grant (corrected)

Inventor name: STAHL, MARK, L.

Inventor name: LA VALLIE, EDWARD, R.