DK176253B1 - New type of human immuno-deficiency virus, infections for T4 cells - and derived antigens, immunogens, monoclonal antibodies and nucleic acid sequences, e.g. for diagnosis of AIDS - Google Patents

Abstract

18.3.86, 13.2.86, 6.2.86, 22.1.86-FR-004215, 003881, 001985, 001635, 000911) New HIV-2 (human innunodeficiency virus), or its variants, are infectious for human T4 lymphocytes and have the morphological and immunological characteristics of the viruses deposited as I-502, -532, -642, and -643 (CNCM). Also new are (1) antigens (Ag), forming a single bond in polyacrylamide gel electrophoresis, contg. an epitope recognised by the serum of a carrier of HIV-2 antibodies; (2) immunogens contg. HIV-2 glycoprotein; (3) monoclonal antibdoies (MAb) which specifically recognise (Ag; (4) the hybridomas which produce MAb; and (5) nucleic acid sequences, opt. labelled, derived from at least part of the RNA of HIV-2, or its variants.

Description

in DK 176253 B1

The invention relates to in vitro diagnosis in humans of the possibility of certain forms of AIDS and with respect to certain of these antigens and in vitro detection kits.

5

The isolation and characterization of a first retrovirus, termed LAV, which is considered responsible for the development of AIDS, is discussed in an article by F. Barre-Sinoussi et al. as early as 1983 (Science, vol. 220, nos. 45-99, 10 20, p. 868-871). The use of certain extracts of the tea virus and more particularly of some of its proteins to diagnose the presence of antibodies to the virus is more specifically described in European Patent Application 138,667. Since then, similar strains and 15 certain variants of LAV were isolated . Examples which may be mentioned are those designated HTLV-III and ARV.

To apply the new rules of nomenclature published in Nature in May 1986, retroviruses capable of inducing human inducing the above-mentioned lymphadenopathies and AIDS, commonly referred to as "HIV", are short for the term "human immunodeficiency virus". The subgroup of retroviruses formed by LAV and its variants was initially designated "LAV type I" or "LAV-I". The latter subgroup will hereinafter be referred to as HIV-1, it being understood that the term LAV will still be retained to designate the strain, among strains of retroviruses (in particular LAAV, IDAV-4 and IDAV-2). belonging to the HIV-1 virus group described in the aforementioned European Patent Application No. 138,667, used for comparative experiments described later, namely LAVBRU, filed in the National Collection of Microorganisms (CNCM) (National Collection of Microorganisms) 2 DK 176253 B1 ganism Cultures) at the Pasteur Institute in Paris, France on July 15, 1983 under Nos. 1-232.

The novel retrovirus and related strains of viruses which, like this, are capable of multiplying in human lymphocytes, have been previously designated "LAV type II" or "LAV-II" and are designated in hereinafter "HIV-2", it being understood that the names of certain HIV-2 isolates described below will be followed by three letters referring to the patients from which they are isolated.

The "HIV-2" group can be defined as a group of viruses that exhibit in vitro tropism against human T4 lymphocytes and which have a cytopathogenic effect on these lymphocytes as they proliferate therein, and then either cause general and persistent polyadenopathies or one of the forms of AIDS. HIV-2 retroviruses have been found to be different from HIV-1 type viruses under 20 conditions described in more detail below. Like these latter viruses, they are different from other known human retroviruses (HTLV-I and HTLV-II).

Although there is relatively wide genetic variability in the virus, various HIV-1 strains isolated so far from American, European, African and Haitian antigenic sites have been jointly conserved on their most important proteins ie. core protein p25, the envelope glycoprotein gpl10 and the transmembrane protein gp41-43. These 30 conditions make it possible e.g. for the prototype LAV strain to be used as a strain for antigens to detect antibodies to all HIV-1 group viruses, in all humans carrying them, regardless of their origin.

Their strain has until recently been used to detect anti-HIV-1 antibodies in blood donors and in patients specifically by immunofluorescence and especially by the method referred to as ELISA, "Western Blot" (or immuno-imprint). and "RIPA" is an abbreviation for radioimmunoprecipitation experiments.

However, in a serological study conducted with an HIV-1 lysate on patients originating from West Africa, it has been observed that some of them produced seronegative or very weak positive reactions while showing clinical and immunological evidence of AIDS.

Cultured lymphocytes from one of these patients were the source of a first HIV-2 isolated retrovirus, whose structure 15 in the electron microscope and whose protein profile on SDS gel electrophoresis showed a similarity to the characteristics of HIV-1. However, this new retrovirus HIV-2 had only a minor relationship with HIV-1 in both the antigen homology of its proteins and in the homology of its genetic material.

This new retrovirus or retrovirus with equivalent antigenic and immunological properties may therefore constitute sources of antigens for the diagnosis of infection with this virus and its variants which produce an AIDS form of the type observed in the original cases in African patients or in people who have spent some time in Africa.

This virus was isolated, e.g. from blood taken in the presence of heparin from a 28-year-old heterosexual patient who had never received blood transfusion and who was not a drug addict. Since 1983 he had had almost chronic diarrhea and significant weight loss (17 kg) with occasional fever. Recently, he had had Candida and ser-ratia infections, including an oseophageal candidiasis typical of AIDS.

This patient also exhibited anemia, cutaneous anergy, lymphopenia, and a T4 lymphocyte / T8 lymphocyte ratio of 0.15 with a T4 lymphocyte level of less than 100 pr. mm3 serum.

His lymphocytes, when cultured, did not respond to stimulation with phytohaemagglutinin and concanavalin A. This patient was also diagnosed as suffering from recurrent bacteremia due to S. enteriditis, cryptosporidiosis, infections due to Isopora belli and cerebral toxoplasmosis.

This combination of clinical signs was evidence of "complex symptoms associated with AIDS" or "ARC" (abbreviation for "AIDS-related complex") of the type caused by the HIV-1 virus. also in accordance with the criteria used by the Center for Disease Control (CDC) in Atlanta, USA.

The culture of lymphocytes from these patients and the isolation of the retrovirus were performed according to 25 methods already described for isolation of HIV-1 in the article by Barre-Sinoussi et al. and in European Patent Application No. 84/401 834 - 0 138 667. They are all discussed briefly below. Lymphocytes stimulated for 3 days with phytohaemagglutinin (PHA) were grown in RPMI 1640 culture medium to which 10% fetal calf serum and 105 105 β-mercaptoethanol, interleukin-2 and anti (human interferon a) serum were added.

5 DK 176253 B1

The production of virus was monitored by its reverse transcriptase activity. In the culture supernatant, the maximum viral activity occurred between day 14 and day 22, after which it decreased. The decline and extinction of the cell-5 culture subsequently occurred. As with HIV-1, sections of lymphocytes infected with HIV-2 by electron microscopy showed virions that had reached maturity and viral particles protruding from the surface of the infected cells. The cell lines used to produce the cultures of these isolated viruses may, depending on the case, be HUT, CEM or MOLT type cell lines or any immortalized lymphocyte line containing T4 receptors.

The virus was then propagated in cultures of blood donor lymphocytes, and then in continuous lines of leukemic origin such as HUT 78. It was then characterized by its antigens and its nucleic acid as substantially different from HIV-1. The virus was purified as described in the previously mentioned articles. A first isolate of this virus was deposited with CNCM on December 19, 1985 under No. 1-502. It was then named LAV-II MIR. Another isolate was deposited with CNCM on February 21-25 1986 under number 1-532. This second isolate was given the reference name LAV-II ROD. These isolates will sometimes later simply be referred to as MIR or ROD.

The invention generally relates to any composition 30 for in vitro detection of the species set forth in the preamble of claim 1, and the composition is characterized by that set forth in the characterizing portion of claim 1. The composition can be used to diagnose the presence in a biological fluid serum, especially from humans who have been in contact with HIV-2, of antibodies to at least one of the HIV-2 antigens. The composition may be used for selective diagnosis of the corresponding variety of AIDS, using diagnostic methods such as those used in e.g. are described in the above European patent specification, except that extracts, lysates or purified antigens of HIV-2 are used in place of those of HIV-1. In this connection, the invention more particularly relates to compositions containing at least one of the proteins p12, p16, 10 p26 which are internal proteins, or p36 or gp140. Examples include compositions containing at the same time: p26 and gp 36, p26, p36 and gp 140, pl2, pl6 and p26, pl6, p26 and gp 140, etc.

It is clear that these preparations are merely examples. Specifically, the invention relates to viral extracts or lysates containing this group of proteins and / or glycoproteins or all fractions from which one or more of the aforementioned proteins or glycoproteins are previously separated.

25

The invention also relates to compositions containing a combination of proteins and / or glycoproteins of an HIV-2 with proteins and / or glycoproteins of an HIV-1 such as: 1, either core proteins of HIV-1 and HIV-2, especially p25 from an HIV-1 and p26 from an HIV-2, or alternatively p8 from an HIV-1 and p6 from an HIV-2, or envelope glycoproteins from an HIV-1 and envelope proteins from an HIV-1. HIV-2, especially gp lio from HIV-1 and gp 140 from HIV-2, or alternatively p42 from HIV-1 and p36 or p42-45 from HIV-2, 5 or, of course, mixtures of proteins and / or glycoproteins from a HIV-1 and proteins and / or glycoproteins from an HIV-2.

10 These compositions, when used in diagnosis, make it possible to diagnose AIDS or associated symptoms as they extend over a wider range of the etiologic agents responsible for this. The use of preparations for diagnostic methods containing only proteins and / or glycoproteins of HIV-2 is nevertheless useful for more selective diagnosis of the category of retrovirus responsible for this disease.

The present invention also relates to a method of the kind of in vitro diagnosis set forth in claim 11, characterized by that of the characterizing portion of claim 11. Examples of such compositions are given above.

25

Preferred methods involve e.g. immunoenzymatic reactions of the ELISA or immunofluorescence type. Titrations can be measurements by direct or indirect immunofluorescence, by direct or indirect immuno-enzymatic tests.

Such titrations include, for example: • placing metered amounts of the subject extract or composition in the wells of a microtitration plate; 5 · introduction into these wells of increasing dilutions of serum containing, in principle, the antibodies whose presence is to be revealed in vitro; Incubating the microtitration plate; Careful washing of the microtitration plate with a suitable buffer; Introduction into the wells of a microtitration plate of 15 labeled antibodies specific for human immunoglobulins, labeling with an enzyme selected from those capable of hydrolyzing a substrate in such a way that the latter undergoes a change of its radiation absorption, at least in a special wavelength band, and detection, preferably by comparison with a control, of the degree of hydrolysis of the substrate as an expression of the potential risk or as an actual presence of the disease.

The present invention also relates to kits for the aforementioned diagnosis of the species specified in the preamble of claim 13 which is characterized by the characterizing portion of claim 13.

A kit may comprise an extract or a more heavily purified fraction of the above virus types, this extract or fractions being labeled, for example, radioactive, enzymatic or by immunofluorescence; Anti- (human immunoglobulins) or protein A (advantageously bound on a water-insoluble support element, such as agarose beads); An extract of lymphocytes obtained from a healthy person; • buffers and optionally substrates for visualization of the label.

From the above, it will be understood that the invention relates to the diagnosis of HIV-2 virus or of a variant as a result of the use of the above-described probes by a method using various steps listed below, these steps being arranged so that reveals the characteristic features of HIV-2 virus.

In general, the invention involves any variant of the above viruses or any equivalent virus (e.g., HIV-2-IRMO and HIV-2-EHO deposited in CNCM on December 19, 1986 under Nos. 1-642 and 1-643) containing structural proteins having together immunological properties such as HIV-2 viruses deposited in CNCM under numbers 1-502 or I-532. As regards the definition of the equivalence of these criteria, this should be discussed in more detail below.

The HIV-2 virus or variants thereof in permanent cell lines derived from T4 lymphocytes or lymphocytes containing the T4 phenotype are prepared by a method consisting of culturing these lines previously infected with HIV. 2 viruses, and to recover, especially when the level of reverse transcriptase activity has reached a particular threshold, certain amounts of the virus released into the culture substrate.

A preferred permanent cell line for cultivating HIV-2 is e.g. HUT 78 cell types. A HUT 78 line infected with HIV-2 was deposited in CNCM on February 6, 1986 under number 1-519. Cultivation is carried out e.g. as follows: 15 HUT 7 8 cells (106 / ml) are cultured together with infected normal human lymphocytes (106 / ml). The culture medium is RPMI 1640 with 10% fetal calf serum. After 15-21 days, a cytopathogenic effect is seen in the HUT 78 cells. Reverse transcriptase is examined 1 week after this observation in the supernatant portion of the culture medium. It is then possible to start extracting the virus from the supernatant part.

Another preferred line for cultivation belongs to the 25 lines designated CEM.

Infection and then culture of the infected CEM cells can be performed specifically as described below.

Thirty T4 lymphocytes infected with the HIV-2 virus and uninfected cells of the CEM lineage are cultured together for a period of time necessary for CEM infection. Cultivation is then further continued in a suitable substrate e.g. as described below, and when the reverse transcriptase activity in the infected cells has reached a sufficient level, the virus generated is recovered from the culture substrate.

In particular, simultaneous culture under conditions described below for human T4 lymphocytes infected with a strain of HIV-2 virus originating from a patient hereinafter hereinafter referred to as "ROD" case and CEM in another case.

10

The infected T4 lymphocytes pre-activated with phyto-hemagglutinin were found to have a reverse transcriptase activity of 5,000 cpm / 106 normal T lymphocytes 3 days after the onset of infection. Culture continued until the measured reverse transcriptase activity reached 100,000 cpm in the supernatant portion.

These T4 lymphocytes were then placed in contact with CEM cells (3 x 10 5 infected normal T lymphocytes) and again incubated in the following culture medium: RPMI 20 1640 containing 2.92 mg / ml L-glutamine, 10% decomposed fetal calf serum, 2 µg / ml polybrene, 0.05% anti-inteferon-α serum, 100,000 μg / ml penicillin, 10 μ9 / Γη1 streptomycin and 10,000 μg / ml neomycin.

. 25 The culture medium was changed twice a week.

The measurements of the reverse transcriptase activity in the supernatant were as follows: 30 on day 0 1,000 (background) on day 15 20,000 on day 21 200,000 on day 35 1,000,000 12 DK 176253 B1

A CEM culture infected with HIV-2 virus was deposited in the Collection National de Cultures de Microorganisms (CNCM) at Institut Pasteur under number 1-537 on March 24, 1986.

5

Some individual properties of the antigens and nucleic acids associated with the HIV-2 enlightenment were found from the experiments carried out under the conditions described below. In many cases, they would be better examined by comparing the same type of properties with other types of retroviruses, especially HIV-1 and SIV.

Referring to the drawing, FIG. 1a, 1b and 1c crossed immunoprecipitation assays between sera respectively from patients infected with HIV-1 and HIV-2 and a resus monkey infected with STLV-III on the one hand and with viral extracts of HIV-1 on the other side; FIG. 2a and 2b show comparative results with respect to the electrophoretic migration of the proteins of HIV-1, HIV-2 and STLV-III in SDS-25 polyacrylamide gels, respectively; FIG. 3 shows the results of cross-hybridization between genomic sequences of HIV-1, HIV-2 and STLV-III, on the one hand, and probes containing different subgenome 30 sequences of HIV-1 virus, on the other hand; FIG. 4 is a restriction map of cDNA derived from RNA of HIV-2 ROD; 13 DK 176253 B1 fig. 5 is a restriction map of an E2 fragment of cDNA derived from HIV-2, containing this region corresponding to the 3 'LTR region of HIV-2; 5 FIG. 6 is a nucleotide sequence of a portion of E2, this sequence corresponding to the U3 / R region of HIV-2; FIG. 7 shows: 10 · on the one hand and schematic structural elements of HIV-1 (Fig. 7A) and in line with a region containing HIV-1 3 'LTR, the sequence derived from the E2 region of HIV-2 cDNA and, 15 On the other hand, the common nucleotides present in the sequence originating from the E2 region of HIV-2 and the corresponding sequence of HIV-1, respectively, located at the expense of a number of deletions and insertions (Fig. 7B); 20 FIG. Figure 8 shows schematically the construction of several clones of a phage modified by several insertions derived from HIV-2 cDNA (clones ROD4, ROD27 and ROD35); the sequences originate from R0D4, ROD27 and ROD35 subcloned into a plasmid pUC18, also schematically shown in this drawing, these latter sequences being arranged to correspond to the regions of ROD4, ROD27 and ROD35, respectively, from; FIG. Figure 9 shows the relative intensities of hybridization between 30 14 DK 176253 B1 a / 11 fragments removed from different regions of the complete HIV-1 genome (the fragments are schematically shown below), on the one hand, and HIV-2 cDNA. , found in R0D4, on the other hand, and 5 b / fragments derived from HIV-2 with the same c DNA.

In general, the HIV-2 antigens used in the comparative experiments, the description of which follows, are derived from the 10 HIV-2 MIR strain deposited in CNCM under number 1-502 and the DNA sequences derived from the genome DNA of HIV-2 derived from the strain. HIV-2 ROD deposited under number 1-532 in CNCM.

15 I - Antigens, especially proteins and glycoproteins

The virus originally cultured in HUT 78 was metabolically labeled with [3SS] cysteine and [35S] methionine, the infected cells were incubated in the presence of these radioactive amino acids in 20 culture substrates without the corresponding unlabeled amino acids for 14-16 hours specifically as described in the article with reference number 21 in the literature list found after the description itself, for labeling with [35S] cysteine. The supernatant portion is then cleared and the virus is ultracentrifuged for 1 hour at 100,000 g on a pad of 20% sucrose. The major antigens of the virus were electrophoresed in a polyacrylamide gel (12.5%) under denaturing conditions (SDS), or in a gel consisting of polyacrylamide (10%) + bi-sacrylamide (0.13%) with SDS (0 , 1% final concentration).

The following colored markers were used as molecular weight references: 15 DK 176253 B1 myosin 200 kd phosphorylase B 97.4 kd BSA 68 kd ovalbumin 43 kd 5 α-chymotrypsin 25.7 kd β-lactoglobulin 18.4 kd lysozyme 14.3 kd

Other molecular weight markers were used in other experiments. This is especially true of FIG. 1a, 1b and 1c, referring to other known molecular weight markers (under the letter M of these figures). The antigens can be even more readily separated after immunoprecipitation (RIPA) or by immunoprinting (Western blot) using antibodies present in the patient's serum: their apparent molecular weights determined by their apparent migration are very close to the HIV-1 antigens.

In particular, it should be noted that in the following text, the numbers following the terms "p" and / or "gp" correspond to the approximate molecular weights of the corresponding proteins and / or glycoproteins divided by 1000. For example. p36 has a molecular weight of the order of 36,000. However, it should be understood that these molecular weight values may vary within a range that can reach 5%, 10% or even more depending on the method used to determine these molecular weights.

The repetition of the experiments allowed the apparent molecular weights of the HIV-2 antigens to be determined more accurately. Thus, it was found that the molecular weights of the three core proteins originally assigned to the molecular weights of the order of 13,000, 18,000 and 25,000, respectively, actually had apparent molecular weights closer to the following values of 12,000, 16,000 and 26,000, respectively. These proteins are hereinafter referred to as the abbreviations p12, p16 and p26.

5

The same considerations apply to the existence of protein or glycoprotein bands whose apparent molecular weights were determined at values ranging from 32,000 to 42,000-45,000. Repeating the measurements finally allows a band that corresponds to a molecular weight of exactly 36,000. In the following text this band is denoted by the abbreviation p36. A second band at 42,000-45,000 (p42} is accordingly also determined. One or the other of p36 or p42 is probably a transmembrane glycoprotein of the virus.

A major envelope glycoprotein having a molecular weight of the order of 130-140 kd has been observed: this glycoprotein is hereinafter referred to as gp140.

20

It should be noted that the molecular weights are usually determined with an accuracy of ± 5%, this accuracy may even be slightly lower for high molecular weight antigens as found for gp140 (molecular weight of 140 ± 10%). This group of antigens, (if labeled with [35S] cysteine) is only weakly recognized at all, by patient sera containing anti-HIV-1 antibodies in the detection systems used in the laboratory, or during the use of tests that uses HIV-1 lysates, such as those marketed by Diagnostics Pasteur under the name "ELAVIA". Only the p26 protein was weakly immunoprecipitated with these sera. The envelope protein did not precipitate. The serum of the patient infected with the subject virus (HIV-2) weakly recognizes a p34 protein of HIV-1. Other detection systems used did not recognize other HIV-1 proteins.

In contrast, HIV-2 possesses some proteins that show some immunological similarity to similar structural proteins or glycoproteins secreted under similar conditions from a retrovirus recently isolated from domestic macaq monkeys by the rhesus species, while this immunological relationship tends to be blotted out for other proteins or glycoproteins. This latter retrovirus, believed to be the etiologic agent of AIDS in monkeys, was designated by the researchers who isolated it (literature references 16-18 below) named "STLV-III ^". For convenience, hereinafter it will simply be designated "STLV-IIIAGM" (or, alternatively, the term SIV, an abbreviation for "Abe immuno-deficient virus").

Another retrovirus designated "STLV-IIIAGM" or "SIVAGM" was isolated from wild green monkeys. Unlike the virus found in rhesus monkeys, the presence of "STLV-IIIagh" does not appear to induce an AIDS-type disease in African green monkeys.

25

The immunological kinship between the structural proteins and glycoproteins from HIV-2 on the one hand and STLV - IIImac and STLV - IIIAGM right rovir a on the other hand and as a consequence, however, the kinship between their 30 nucleic acid sequences remains limited.

Trials have allowed for a first distinction between retroviruses capable of infecting humans or monkeys, where the following have been clarified: The HIV-2 virus does not proliferate chronically in lymphocytes from rhesus monkeys, if it has been injected in vivo and under working conditions enabling the development of STLV-IIImac viruses as described by NL Letvin 5 et al., Science (1985), Vol. 230, 71-75.

This inability of HIV-2 to develop in monkeys under natural conditions, on the other hand, allows HIV-2 viruses and STLV-III virus isolates to be biologically differential.

Using the same methods mentioned above, it was found that it was also possible to obtain the following from STLV-III: • a major p27 nuclear protein having a molecular weight of the order of 27 kd, • a major envelope glycoprotein, gp140, 20 • a p32 protein, probably transmembrane not observed in RIPA if the virus is pre-labeled with [35S] cysteine, but which can be seen by immunoassay experiments (Western blot) in the form of broad bands.

The main envelope glycoprotein of HIV-2 has been found to be immunologically closer to the main envelope glycoprotein of STLV-III than to the main envelope glycoprotein 30 of HIV-1.

These findings apply not only to the molecular weights, 130 to 140 kd, for the major glycoproteins of HIV-2 and STLV-III relative to about 110 for the major envelope glycoprotein of HIV-1, but also with regard to the immunological properties , since sera taken from patients infected with HIV-2 and more specifically antibodies raised to HIV-2 gp140 recognize STLV-III gp140 while, in 5 comparative trials, do not recognize the same sera and same antibodies to HIV-2 HIV-1 gp110. However, anti-HIV-2 does not recognize HIV-1 gp110. However, anti-HIV-1 sera that have never reacted with HIV-2 gp140 precipitate a [35S] cysteine-labeled 26 kd protein found in extracts of HIV-2.

The major core protein of HIV-2 appears to have an average molecular weight (approximately 26,000) between the molecular weights of HIV-1 p25 and p27 of STLV-III.

15

These observations stem from trials conducted with viral extracts obtained from HIV-2 isolated from one of the above patients. Similar results have been obtained with viral extracts of HIV-2 isolated from another patient.

20

Cells infected with HIV-1, HIV-2 and STLV-III, respectively, were incubated in a substrate containing 200 µmCi / ml [35S] cysteine in a substrate without unlabeled cysteine for 16 hours. The clarified supernatant portions were centrifuged for 90 25 min at 60,000 g for 90 min. The pellet was lysed in a RIPA buffer (1), immunoprecipitated with various sera and then subjected to electrophoresis on polyacrylamide gel with sodium dodecyl sulfate (SDS-PAGE).

The results are given in Ia, lb and lc.

FIG. 1a shows the observed results of immunoprecipitation between a viral extract of HIV-1 obtained from a CEM Cl.13 cell line and the following sera, respectively: • anti-HIV-1 positive serum (band 1), • serum obtained from the first patient (band 5 2), • serum from a healthy African carrier of anti-HIV-1 antibodies (band 3), 10 serum from a macaq monkey infected with STLV-II1 (band 4), and • serum from the other patient mentioned (band 5).

In FIG. 1b is the observed results of immunoprecipitation between the HIV-2 antigens obtained from the first patient after prior culture with HUT-78 cells, and various sera, more particularly the serum of the first patient (band 1), the anti-HIV-1 -positive 20 serum (band 2), the macaq monkey infected with STLV-III (band 3) and the serum of the above second patient (band 4).

Finally, FIG. lc the observed results for

25 immunoprecipitation between the antigens of an STLV-III

isolate obtained from a macaq monkey with a monkey AIDS. The sera used to which the bands 1-5 refer are the same as those mentioned in connection with FIGS. la.

30 M means the markers myosin (200 kd), galactosidase (130 kd), bovine serum albumin (69 kd), phosphorylase B (93 kd), ovalbumin (46 kd) and carboxylic anhydrase (30 kd).

21 DK 176253 B1

FIG. 2a and 2b show similar results for the electrophoretic migration properties of the proteins from HIV-1, HIV-2 and STLV-III.

FIG. 2a relates to the experiments performed with extracts of virus labeled with [3SS] cysteine after immunoprecipitation on SDS-PAGE. The different bands refer to the following virus extracts: virus obtained from patient 1 and immunoprecipitated with serum derived from the same patient (band 1), 10 extract of the same virus immunoprecipitated with a negative control serum derived from a person not carrying anti-HIV -1 or anti-HIV-2 antibodies (band 2), extract of STLV-III virus immunoprecipitated with a serum derived from a macaq monkey infected with STLV-15 III (band 3), immunoprecipitation observed between extracts of it the same virus and a negative control serum (band 4), and extract of HIV-1 immunoprecipitated with the serum of a European patient infected with AIDS.

FIG. Ib shows results obtained by Western blot (immuno-no imprint) experiments. Cell lysates derived from uninfected or infected HUT-78 cells were subjected to electrophoresis on SDS-PAGE and then electrophoretically transferred to a nitrocellulose filter before reacting with the serum of the above first patient (serum diluted 1/100). The nitrocellulose filter was then washed and the presence of the bound antibodies visualized with 125 I-labeled goat anti-human IgG.

The spots observed in bands 1, 2 and 3 relate to the agglutination experiments between the above serum and the extracts of uninfected HUT-78 cells (band 1), extracts of HUT-78 cells infected with an HIV-2 virus (band 2) and extracts of HUT-78 cells infected with 22 STLV-III (band 3). The numbers appearing in the margin next to the bands correspond to the approximate molecular weights of the most representative viral proteins (molecular weights in kilodaltons).

5 II - Nucleic Acids 1 / RNA from HIV-2 Retrovirus 10 RNA of the virus deposited on a filter as performed by the spot blot method did not hybridize under strong conditions with HIV from HIV-1.

By "strong conditions" is meant the conditions under which the hybridization reaction between RNA from HIV-2 and the selected probe, radiolabelled with 32 P (or otherwise labeled) followed by washing of the sample is carried out. The hybridization, on a membrane, is carried out at 42 ° C in the presence of an aqueous solution especially of 50% formamide 20 · (vol / vol) in 0.1% SDS / 5X SSC for 18 hours. The membrane on which the hybridization reaction is carried out is then washed at 65 ° C in a buffer containing 0.15% SDS and 0.1 X SSC.

25 "Non-vigorous conditions" is understood to mean the conditions under which the hybridization and washing are performed. The hybridization is carried out by contact with the selected probe, labeled with 32 P (or otherwise labeled), namely at 42 ° C in a 5 x SSC buffer, 0.1% SDS containing 30% 30 formamide for 18 hours. Washing of the membrane is performed at 50 ° C with a buffer containing 0.1% SDS and 2 x SSC.

The hybridization experiments were also performed with a hybridization probe consisting of a recombinant plasmid pBT1 up 23 reached by cloning DNA from HIV-1 derived from X'J19 (Cell 1985, vol. 40, p. 9) in the vector pUC18. Under non-potent conditions, only very weak hybridization was observed between the HIV-2 RNA and the cloned DNA 5 derived from HIV-1.

Other probes containing cloned sequences of HIV-1 were used: 10 α / single stranded probes from HIV-1 sub-genome DNA produced from subclones of the HIV-1 genome and introduced into phage M13. The cloned regions are associated with the protease gene or "endonuclease" gene.

Only one probe from the endonulease region of HIV-1 (the nucleotide sequence between base nos. 3760 and 4130) gave weak hybridization under non-potent conditions with HIV-2. The "protease" probe (HIV-1 nucleotide sequence between bases # 1680 and 1804) did not hybridize even under 20 non-potent conditions with HIV-2.

b / A probe pRS3 consisting of the sequence encoding the "envelope" region of HIV-1 (subcloning in pUC18) did not hybridize under non-potent conditions with HIV-2.

The "spot blot" technique is also referred to as "dot blot" (stain transfer).

30 Further hybridization results between genomic RNA from HIV-1, HIV-2 and STLV-III, on the one hand, and probes containing different subgenome sequences of HIV-1 virus, on the other hand, are shown in FIG. Third

24 DK 176253 B1

The supernatant portions of the various culture substrates (in amounts of 0.5 to 1 ml per spot) were centrifuged for 5 minutes at 45,000 rpm. minute; the pellet was resuspended in an NTE buffer containing 0.1% SDS 5 and placed on a nitrocellulose filter. This was pre-dipped in a 2 x SSC substrate (0.3 M NaCl, 0.03 M sodium nitrate). After baking (for 2 hours at 80 ° C), the filters were hybridized with various probes containing genomic sub-fragments of HIV-1 under non-vigorous conditions (30% formamide, 5 x SSC, 40 ° C), washed at 50 ° C. ° C with 2 x SSC solution containing 0.1% SDS and then autoriographed for 48 hours at -70 ° C with a pre-size screen.

Probes 1-4 are single-stranded probes obtained by the prime cut method, as described in (25). Briefly, the single-stranded fragments derived from the M13 virus and containing subgenome HIV-1 insert (30) were ligated to oligomeric fragments (17 nucleotides) derived from 20 M13 (Biolabs). The complementary strand was then synthesized with Klenow enzyme in a TM buffer (10 mM Tris, pH 7.5, 10 mMMgCl 2) in the presence of dATP, dGTP, dTTP and dCTB labeled with 32p at the α position (Amersham, 3000 Ci / mmol ). Then, the DNA was digested with the appropriate restriction enzymes, heat-denatured, and subjected to electrophoresis on a denaturing polyacrylamide gel (containing 6% acrylamide, 8 M urea in a TDE buffer). The gel was then auto-radiographed for 5 minutes. The probe was then cut off and eluted in a 300 mmol NaCl, 0.1% SDS buffer.

Specific activity (SA) of the single-stranded probes was determined at 5 x 108-109 decays per minute / microgram (ppm / µg).

DK 176253 B1

The characteristic sequences present in the various probes were as follows:

Probe 1: Nucleotides 990-1070, Probe 2: Nucleotides 980-1260,

Probe 3: Nucleotides 2170-2240,

Probe 4: Nucleotides 3370-3640.

The numbers of the above nucleotides are those listed under the literature reference (30).

Finally, probe 5 consists of a plasmid pUC18 carrying the EcoR1-Sac1 fragment of the HIV clone in λJ19 (31), which was subjected to nick translation to obtain an SA of approximately 10® dpm / µg.

The relative locations of the subgenome fragments in the probes for the entire HIV-1 genome are indicated schematically in FIG. 3. The different spots correspond to the following:

Stain A: a virus is obtained from a culture of CEM Cl.13 cells infected with HIV-1, Stain B: a virus is obtained from HUT-78 cells infected with STLV-III,

Spot C: and D: isolates obtained respectively from viruses of the aforementioned two African patients,

Spot E: negative control cell extract obtained from uninfected HUT-78 cells, 30 26 DK 176253 B1

Stain F: virus obtained from a Zaire patient suffering from AIDS grown in normal T lymphocytes in the presence of TCGF.

All of the spots were obtained with an amount of virus corresponding to 25,000 ppm reverse transcriptase activity, except spot C: 15,000 ppm.

The following observations were made: 10

The genomic RNAs of the two HIV-2 isolates obtained from purified viral particles did not hybridize with any of the proteins under the strong conditions described above, although the viral particles were isolated and purified from the culture supernatant portions of highly infected cells showing high reverse transcriptase activity.

Under the mild conditions described above, the following observations were made: All the probes hybridized strongly with the genomic RNA obtained from the control HIV-1 preparations and from another isolate obtained from a Zaire patient suffering from AIDS.

Two of the probes obtained (nucleotides 990-1070 and 990-25 1260, both originating from the gag region of HIV-1) hy bridged slightly with the spots from extracts of HIV-2 retroviruses; only one of these two probes (nucleotides 990-1260) also showed poor hybridization with the STLV-III stain (Fig. 3). As for the probe containing a fragment 30 of the pol region (nucleotides 2170-2240), hybridization was observed with STLV-III and, although significantly weaker with RNA of HIV-2. The second probe of the pol region (nucleotides 3370-3640) did not hybridize with any of the HIV-2 and STLV-III spots.

27 DK 176253 B1

Finally, the probe modified by nick translation and containing the entire env gene and LTR (nucleotides 5290-9130) of HIV-2 did not hybridize with either RNA 5 of STLV-III or with RNA of HIV-2.

It should also be noted that another probe that at the 5 'end of the pole reading frame of HIV-1 (corresponding to the protease region) did not hybridize with either RNA of 10 HIV-2 or with RNA of STLV-III.

Thus, it is also apparent from the above that the HIV-2 virus appears to be more distant, from a structural standpoint, from the HIV-1 virus than it is from the STLV-III.

However, HIV-2 is significantly different from STLV-III, as evidenced by the different results obtained with respect to the infectious ability of HIV-2 viruses, which are literally zero in monkeys, relative to the clear infectious properties of STLV. -III viruses in the same monkeys.

The restriction maps and genomic RNA sequences of HIV-2 or of cDNA obtained from these genomic RNAs are available to those skilled in the art, as the strains of HIV-2 deposited in 25 CNCM, after appropriate multiplication, can equip the skilled person with the genetic equipment necessary for the determination of these restriction maps and nucleotide sequences.

The conditions under which the restriction map of the genome of one of the HIV-2 isolates are determined and the conditions under which certain parts of the cDNA derived from these genomes were sequenced are described below.

28 DK 176253 B1

The restriction map of the genome of a retrovirus representative of HIV-2 retroviruses is given in FIG. 4. The restriction map of a substantial fragment of this cDNA is shown in FIG. 5. Finally, part of this last-mentioned fragment has been sequenced.

This sequence and a number of the restriction sites it contains are given in FIG. 6. The cloned whole cDNA - or cloned fragments of this cDNA - can itself be used as specific hybridization probes.

2 / cDNA and fragments of this cDNA are derived from RNA of HIV-2. The conditions under which the cDNA described above was obtained are described below.

The first step in the preparation of this cDNA involved the production of an oligo (dT) serving as a primer 20 or an initiator cDNA strand, by performing an endogenous reaction activated with a detergent, using the reverse transcriptase of HIV-2 on purified virions obtained from the supernatant portions of infected CEM cells. The CEM cell line was a lymphoblastoid CD4 + cell line described by G. E. Goley et al. in Cancer 18: 522-529 (1965), to which reference is hereby made. These CEM cells used were infected with a ROD isolate that was found to produce significant amounts of HIV-2 continuously.

30

Following the synthesis of the second strand (in the presence of nucleotides and a bacterial DNA polymerase), the double-stranded cDNA was introduced into a bacterial phage vector M13 TG130. A phage library of 104 recombinant M13 phages was obtained and subjected to an in situ scan with an HIV-1 probe. This contains a 1.5 kb fragment derived from the 31-end of cDNA derived from RNA of the LAV isolate (shown in Fig. 7A). About 50 positive plaques were revealed, purified and characterized by cross-hybridization of the deposits and sequence assessment of the ends.

This method allowed different clones to be isolated, containing sequences approximately complementary to the 3 'end of the polyadenylated RNA of LTR [short terminal repeat of HIV-1 described by S. Wain Hobson et al. in the Cell 40: 9-17 (1985)] region to which reference is made.

15 The largest of the deposits of the group of the M13 clones in question hybridizing to the 3 'LTR region of HIV-1 is an approximate 2 kb clone designated E2. Like the 3 'LTR region of HIV-1, clone E2 contains an AATAAA signal located approximately 20 nucleotides above a poly (A) terminus, and a 3' LTR region corresponding to the region of HIV-2. After partial sequence assessment, this 3 'LTR region of HIV-2 was found to possess a weak kinship with the homologous region of HIV-1.

FIG. 5 is a restriction map of the fragment of E2 (oblong rectangular area) incorporated into plasmid pSPE2 containing it. It includes part of the R region and the U3 region of HIV-2. The drawing does not show the boundaries of the R and U3 regions.

30

The sequence of a portion of E2 is shown in FIG. 6. The posts for the specific restriction sites are set out herein.

The small degree of kinship between the 3 'LTR regions of HIV-1 and HIV-2 is given in FIG. 7. In fact, only about 50% of the nucleotides of the two LTR sequences can be aligned (approximately 50% sequence homology) at the expense of certain insertions or deletions. In comparison, the sequence homology of the corresponding 5 regions of the various US and African isoids of HIV-1 is greater than 95% without insertion or deletion.

Clone E2 was used as a specific probe for HIV-2, for identification on a hybridization filter of the sequences derived from HIV-2 and present in other clones.

This probe also reveals the genomic RNA of HIV-2 under strong conditions. It also enables detection 15 by the so-called "Southern blot" method on DNA from CEM or similar cells infected with a ROD iso- late or with other HIV-2 isolates. No signal is detected under the same loading conditions in experiments hybridizing this probe with cDNA originating from uninfected cells or from cells infected with HIV-1.

These results confirm the exogenous nature of HIV-2 with respect to HIV-1. An approximately 10 kb species, probably similar to the non-integrated viral DNA, was revealed as a principal component of the non-degraded DNA from cells infected with HIV-2. Another DNA with an approximate size of 6 kb, possibly corresponding to the circular shape of the viral DNA, was also revealed.

The other parts of the HIV-2 genome were also identified. For this purpose, a genome library was constructed in phage xl47.

Subjects XL47.1 are described by W.A.M. Loenen et al. in Gene 10, 249-259 (1980), to which reference is made.

31 DK 176253 B1

The genomic library is built up with fragments obtained by degradation of DNA derived from the CEM cell line infected with HIV-2 ROD after degradation with the enzyme Sau3AI.

Approximately 2 x 10 5 recombinant plaques were searched for with a clone containing the labeled E2 insert from HIV-2 cDNA. Ten recombinant phages were revealed on plaques and purified. The restriction maps of three of these phages, characterized by their ability to "Southern 10 blot" hybridization with E2 deposits under severe conditions as well as with subgenome probes from HIV-1, alleviate mild conditions.

A clone containing a 9.5 kb insert and derived from all 15 of the circular viral DNA containing the complete HIV-2 genome was identified. It was named "XROD 4". The other two clones XR0D27 and XROD35 derived from integrated proviruses carry LTR sequences of the viral coding sequences and adjacent cell DNA sequences. The various sequences are given in FIG. 8th

Fragments of the λ clones were subcloned into plasmid vector pUC18. The fragments originating from XROD4, XROD27 and XROD35 and respective subclones of the above plasmid vector are also seen in FIG. 8. The following subclones were obtained: pROD 27-5, derived from XROD27, contains a 5.2 kb region of the HIV-2 genome and neighboring cell sequences (5 'LTR and 5' coding viral sequence around an EcoRI 30 site); pROD 4.8, derived from XROD4, containing an approximately 5 kb HindIII fragment. This fragment corresponds to the central portion of the HIV-2 genome; 32 DK 176253 B1 pROD 27-5 'and pROD 4.8 contain overlapping HIV-2 deposits; PROD 4.7 contains a 1.8 kb HindIII fragment of XROD4; this fragment is positioned in the 3-way with respect to the subcloned fragment of pROD 4.8 and contains approximately 0.8 kb of coding viral sequences and a portion located between the BamHI and HindIII cloning sites of the left arm of phage λ (XL47.1).

pROD 35 contains all the 3-way HIV-2 coding sequences relative to the EcoRI site, the 3 'LTR end, and approximately 4 kb neighboring nucleotide sequences of cellular origin; pROD 27-5 'and pROD 35 present in E. coli HB 101 were deposited on November 21, 1986 with CNCM under designations 1-626 and 1-633; 20

The complete HIV-2 ROD genome, whose restriction map is indicated in FIG. 4, was rebuilt from pROD 35, pre-linearized with EcoRI and pROD 27-5 '. The EcoRI insert of pROD 27-5 was equated in the corresponding direction in the EcoRI 25 slot of pROD 35.

The degree of kinship between HIV-2 and the other human or aberetroviruses was examined by reciprocal hybridization experiments. The relative homology between the different 30 regions of the HIV-1 and HIV-2 genomes was determined by hybridization experiments of fragments derived from the cloned HIV-1 genome and from the radioactivity label χROD4, respectively.

The relative locations of these fragments (numbers from 1 to 11) relative to the HIV-1 genome are indicated below in FIG. 9th

Even under very mild conditions (Tm 42 ° C), HIV-1 and HIV-2 genomes hybridize only at the level relative to their respective gag genes (spots 1 and 2), reverse transcriptase regions in pole (spot 3) and regions of pole, Q (or sor) genes (spot 5) and F (or 3 'orf) genes and 3' LTR (spot 11). The HIV-1 fragment used to reveal the first cDNA clones of HIV-2 corresponds to the sub-clone from spot 11, which hybridizes relatively well with HIV-2 under mild conditions. A signal emanating from spot 5 is the only one that remains after heavy washing. The envelope gene, tat region and part 15 of pole are found to be highly divergent. These results, as well as the sequence obtained with LTR (Fig. 33), show that HIV-2 is not (in any case for its envelope) a variant of HIV-1.

20 It was observed that HIV-2 is more closely related to SIV [described by M. D. Daniel et al. in Science 228: 1201-1204 (1985)], which is hereby referred to as having HIV-1.

All the SIV proteins, including the envelope protein, are immunoprecipitated by sera from patients infected with HIV-2, whereas the serological cross-reactivity of HIV-1 and HIV-2 is limited to the core proteins. However, SIV and HIV-2 can be distinguished because of the 30 differences mentioned in terms of the molecular weight of their proteins.

Regarding the nucleotide sequences, it should also be noted that HIV-2 is related to SIV.

34 DK 176253 B1

In addition, the characterization of HIV-2 also enables the region of the envelope glycoprotein responsible for binding the virus to the surface of the target 5 cells and subsequent internalization of the virus. The mutual action occurs via the CD4 molecule itself, and it appears that HIV-1 and HIV-2 use the same receptor.

Thus, although there are large differences between the env genes of HIV-1 and 2, the delimited homologous regions of the envelopes of the two forms of HIV can be considered as constituents of binding to a common T4 lymphocyte receptor. These sites are required to form 15 epitopes that carry the immunogenicity of peptides that can be used in humans to elicit a protective immune response to HIV viruses.

Advantageous sequences to generate probes in 20 hybridization reactions with the genetic material of patients carrying viruses or proviruses, specifically for detecting the presence of HIV-2 virus RNA in their lymphocytes, contain a nucleotide sequence resulting from the combination of 5 kb HindIII fragments of 25 ROD4 and E2 cDNA. The tests can be performed by any method, especially by "Northern blot", "Southern blot" and "dot blot" techniques.

Further descriptions of the invention will be apparent from the following 30 examples for identifying certain portions of the retroviral genome and for the preparation of a number of recombinant DNAs containing various portions of a cDNA derived from the retroviral genome of HIV-2.

DK 176253 B1

EXAMPLES

EXAMPLE I

5 DNA probes for use in HIV-2 diagnostic equipment

A cDNA complementary to the genomic RNA obtained from purified virions was prepared as follows: The supernatant portion obtained after 48 hours of culture of CEM cells infected with an HIV-2 ROD isolate of HIV-2 was ultracentrifuged. The centrifuge pellet containing the virus was centrifuged on a sucrose gradient to form a new centrifuge pellet, essentially as described in European Patent Application No. 84 / 401,234-0 138,667 already disclosed.

The purified HIV-2 preparation was used for synthesis of cDNA using an endogenous reaction activated with a detergent.

Briefly, the virion preparation was added to a reaction mixture containing 50 mM Tris-HCl, 5 mM MgCl 2, 10 mM DTT, 0.025% of the detergent marketed under the name 25 "Triton" and 50 μΜ of each of the 4 deoxynucleoside triphosphates and an oligo ( dT) initiator. The reaction was carried out at 37 ° C for 90 minutes.

After extraction with phenol of the proteins present in the first reaction medium, the second cDNA chain was synthesized in the presence of RNAse, E. coli DNA polymerase 1 and the 4 deoxynucleotides for 1 hour at 15 ° C and 1 hour at 22 ° C. Blunt ends were produced on this double-stranded cDNA by the action of the T4 DNA polymerase. All reagents by this method are commercially available (Amersham cDNA kit) and used according to the manufacturer's recommendations.

After (1) ligation of better adapters) containing an EcoRI site (supplied by Pharmacia) to the blunt ends of cDNA in the presence of a T4 DNA ligase (marketed by Biolabs), (2), degrading these linkers with the restriction endonuclease EcoRI, and (3) removing the linker fragments by gel filtration (gel column marketed under the name "Ultrogel") on AcA 34 (LKB-IBF), cDNA is inserted into an M 13 TG 130 vector digested with Eco RI. A cDNA library was obtained after transformation of E. coli strain TGI. Approximately 104 recombinant M13 15 plaques were obtained.

To select in the cDNA library the recombinant M13 clones containing HIV-2 cDNA, the plaque shy hybridization method was used. DNA from the M13 plaques was transferred to nitrocellulose filters and hybridized with sub-genomic HIV-1 probes derived from the VXJ19 "clone of a LAV (or HIV) virus described in the European patent application. This probe contained an insert consisting of a portion of an approximate length of 1500 base pairs (bp) of 25 HIV-1 DNA This insert was bound by 2 Hin-dIII restriction sites, respectively, within the open reading frame of the "env" gene and in the R segment of the 3 'LTR end of HIV This probe contained the 3 'end of the env gene, the entire F gene, the U3 segment, and a portion of the R-30 segment of LTR with an approximate length of 1500 base pairs (bp).

The probe containing 1.5 kg of HindIII insert was labeled with [32 P] -dCTP and -dTTP (32000 Ci x 10 "3 mol) by incubating the probe in the presence of initiators and Klenow DNA polymerase for 1x4 hours at 15 ° C (using an Amersham kit) Hybridization experiments on the library cDNA clones were performed overnight under mild conditions in a solution of a hybridization substrate containing 5 x SSC, 5 x Denhart, 25% formamide, 100 µg / ml denatured salmon sperm DNA and a labeled probe (2 x 107 cpm with a specificity of 109 cpm / Vg) at 37 ° C.

The steps were subjected to three washings after the other in the presence of three solutions, the composition of which is given below:

Wash No. 1: 5 x SSC, 0.1% SDS, at 25 ° C for 4 x 15 min.

Wash 2: 2 x SSC, 0.1% SDS, at 42 ° C for 2 x 30 min.

Wash # 3: 0.1 x SSC, 0.1% SDS, at 65 ° C for 2 x 30 min.

Each wash was followed by autoradiography of the filters.

20

Several positive clones were revealed after wash # 1 and could still be seen after wash # 2. However, all the signals after wash # 3 disappeared, indicating that the positive clones had only weak kinship with the 25 HIV-1 genome, which nevertheless less was sufficient to perform the above selection. The positive clones were further cultured, placed back on plaques, and hybridized with the same probe under conditions similar to Wash No. 1. Most of them were still positive.

The clones were also used to select a total human DNA probe under moderate conditions and by hybridization in 5 x SSC, 5 x Denhart and 40% formamide followed by washing in 1 x SSC, 0.1% SDS at 50 ° C. None of the previously positive clones were revealed and, as a consequence, do not correspond to specific repeat DNA or to cDNA from the ribosomal RNA.

5

The positive M13 recombinant clones were grown in a liquid substrate and characterized as follows: (1) Size of their deposits: 10

An M13 single stranded type of DNA was obtained from each individual clone and synthesis of the second strand was performed with an M13 17-mer initiator sequence and the Klenow enzyme. The deposits were excised using EcoRI (Boehringer) and analyzed by agarose gel electrophoresis. The bulk of the deposits contained from 200 to 600 and 200 bp except for the clone designated E2.1, which had an approximate length of 2 kbp.

(2) Analysis of the nucleotide sequence:

Several clones were partially sequenced using the dideoxy method described by Sanger et al., In Proc. Natl. Acad. Sci. 74: 5463-7 (1977), to which reference is hereby made. Different independent clones contained similar nucleotide sequences except for the poly (A) chains at their 3 'ends, whose length was different. These results show that these cDNA clones originated from the RNA template. Detailed sequence analysis of these cDNA clones, including the 3 'end of the HIV-2 genome. showed a limited relationship with HIV-1.

39 DK 176253 B1 (3) Hybridization with the genomic RNA and DNA of HIV-2: (a) Production of the genomic RNA and HIV-2: 5 An infected supernatant portion was centrifuged (50,000 rpm, 30 minutes). The deposited precipitate was resuspended in 10 mm Tris pH 7.5, 1 mM EDTA, 0.1% SDS. One of the insertion clones, F1l, was labeled and used as a probe for hybridization with the genomic RNA from various viral isolates, according to the "dot blot" method.

The "dot blot" method included the following steps: (i) Placing the sample (HIV-2 lysate) in spots on a nitrocellulose membrane pre-wetted in 20 x SSC (3 M NaCl, 0.3 M sodium citrate) and air-dried, (ii baking the membrane for 2 hours at 80 ° C and (iii) performing the hybridization.

20

The hybridization was carried out under strong conditions (5 x SSC, 5 x Denhart, 50% formamide at 42 ° C). It was followed by washing in 0.1 x SSc, 0.1% SDS at 65 ° C. Under these conditions, the probe was strongly hybridized to the stains derived from two independent isolates of HIV-2, including LAV-III ROD, from which the cloned cDNA originated.

A weak hybridization signal was detected with the stain formed by STLV-III mac [monkey T-lymphotropy virus (also referred to as "SIV"), type III macaque monkey] and no hybridization was detected with HIV-1 isolates.

The "Southern blot" experiments using the clone E2.1 containing the 2 kb insert as a 32P-labeled probe did not reveal any hybridization with DNA from uninfected cells but revealed bands in released cells infected with HIV-2 during severe conditions. HIV-2 exhibited polymorphism at the site of the restriction map equivalent to the restriction map of HIV-5 1. With the complete cellular DNA from infected cells, two types of signal are revealed by the "Southern blot" method: (1) in DNA fractions with molecular weights of about 20 kb and more in the case of integrated forms of the virus, and (2) in fractions of 10 lower molecular weights (9, 10 kb) in the case of the virus not integrated into the genome.

These properties are highly specific to a retrovirus.

Certain experiments performed with STLV-III (SIV-3) from infected cells enabled to demonstrate that the monkey retrovirus is relatively far from HIV-2 (the signal is revealed only under mild conditions). These experiments show that the above probes enable specific detection of HIV-2.

(4) Subcloning the cDNA of HIV-2 into a bacterial plasmid vector

The positive M13 clone, E2.1, was selected and subcloned into a plasmid vector. DNA from the recombinant M13 (TG130) phage E2 was purified in the form of single-stranded DNA (M-13-ROD-E2) containing the 2 kb insert containing the 3 'portion of the HIV-2 genome (obtained from the HIV-2 ROD). This deposit was transferred to a plasmid pSP65 described by Melton, 30 D.A., in 357 Nucleic Acid Res. 12: 035-8056 (1984).

Another chain was built in vitro in the presence of the 17-mer initiator sequence (Amersham), the four nucleotides A, C, T, G and DNA polymerase I (Klenow). EcoRI deposit was excised using EcoRI cleavage and purified on agarose gel and then ligated to pSP65, which had been previously cleaved with EcoRI. The ligation mixture was used to transform E. coli strain 5 DH1, and recombinants were selected based on their ability to resist ampicillin. The identified recombinants were grown on LB substrate (Luria substrate) containing 50 µg / ml ampicillin. These recombinant plasmids were purified and assayed for the presence of the correct interleaved fragment.

One of the clones obtained, designated by reference pSPE2, was deposited in CNCM in Paris, France under registration number 1-595 on September 5, 1986.

15

The inserts originating from cDNA of HIV-2 and present in the above probe contained the nucleotide sequence described above in accordance with a portion of E2.

20

EXAMPLE II

Cloning a cDNA complementary to the DNA complementary to the genomic RNA from HIV-2 vir ions 25 HIV-2 virions were purified from 5 liters of a culture supernatant part from a CEM line infected with a ROD iso- late. A first stranded cDNA was synthesized in contact with sediment purified virus in the presence of an oligo 30 (dT) initiator and using an endogenous reaction activated with a detergent as described by Alizon et al., Nature 312, 757-760 (1984) . The RNA / cDNA hybrids were purified by extraction with a phenol / chloroform mixture and by precipitation with ethanol. The second 42 strand of .cDNA was produced in the presence of DNA polymerase I / RNAse H, as described by Gubier and Hoffman (). Please refer to this article.

The double-stranded cDNA was fitted with blunt ends in the presence of DNA polymease T4 using constituents from a cDNA synthesis equipment marketed by Amersham.

10 EcoRl adapters (linkers) marketed by Pharmacia were attached to the end of the cDNA; the cDNA thus modified, after cleavage in the presence of EcoRl, was introduced into a dephosphorylated phage vector M13tgl3Q, which in turn was cleaved with EcoRl, also marketed by Amersham. A cDNA band was obtained after transformation of E. coli strain TGI. Recombinant plaques (104) were searched for in situ on filters, allowing imprinting by hybridization with the clone J19 containing the 1.5 kb HindIII fragment mentioned above derived from HIV-1.

20

The filters were prehybridized in the presence of a substrate containing 5 x SSC, 5 x Denhart solution, 25% formaldehyde, and denatured salmon sperm DNA (100 µg / ml) at 37 ° C for 4 hours and then hybridized for 16 hours in the same 25 buffer (Tm-42 ° C) in the presence of a further labeled probe (4 x 10 7 cpm) to obtain a final hybridization buffer solution containing 10 s cpm / ml.

Washing was performed with a 5 x SSC, 0.1% SDS solution at 25 ° C for 2 hours (it should be noted that 20 x SSC corresponds to a 3 M NaCl and 0.3 M sodium citrate solution). Plaques that responded positively were purified and the M13 single-stranded DNAs were prepared and their ends sequenced as described by Sanger et al.

43 DK 176253 B1

Hybridization of a DNA from cells infected with HIV-1 and HIV-2 and with RNA from HIV-1, HIV-2 and from SIV virions, respectively, with a probe derived from a cloned 5 cDNA of HIV-2 DNA was extracted from infected CEM cells that continuously produced HIV-1 and HIV-2, respectively. DNA samples of these two retroviruses, cleaved in some cases with 10 20 μg of PstI and not cleaved in other cases, subjected to electrophoresis on 0.8% agarose gel and transferred by the "Southern" method to a nylon membrane. Small-scale infected supernatant moiety taken in an NTE buffer containing 0.1% SDS and with the same reverse transcriptase activity was placed on nitrocellulose previously soaked in a 2 x SSC solution.

A prehybridization was carried out in a solution containing 50% formamide, 5 x SSC, 5 x Denhart and 100 ng / ml denatured salmon sperm DNA for 4 hours at 42 ° C. A hybridization was performed in the same buffer to which 10% dextran sulfate and 106 cpm / ml E2 labeled insert (specific activity 109 cpm / µg) were added for 16 hours at 42 ° C. Two washes were then performed with 0.1 x SSC, 0.1% SDS solution for 25 30 minutes each. After exposure for 16 hours to a magnification screen, the Southern blot was dehybridized in 0.4 N NaOH, neutralized and again hybridized under the same conditions with the HIV-1 probe labeled at 109cpm / µg.

30 44 DK 176253 B1

EXAMPLE III

Cloning in phage λ of the complete DNA from HIV-2 proviru set 5 DNA from CEM cells infected with HIV-2 ROD (Fig. 2, bands a and c) is partially cleaved with Sau3AI. The 9-15 kb fraction was selected on a 5-40% sucrose gradient and ligated to the BamHI arm of the XL47.1 vector. Plaques (2 x 106) 10 obtained after in vitro packaging and application to E. coli strain LA 101 were scanned in situ by hybridization with the insert from the E2 cloned cDNA. About 10 positive clones were purified on plaques and propagated in E. coli C600 recBC. The clones λ ROD 4, ROD 27 and ROD 35 were amplified and their DNA was characterized by recording their restriction maps and by hybridization by the Southern method with the cDNA clone of HIV-2 landing strong conditions and with the gag-pol probes from HIV-1 under mild conditions.

20

FIG. 8 schematically shows the structures of 3 of the recombinantly obtained phages ROD 4, ROD 27 and ROD 35.

The elongated rectangular portions of these diagrams correspond to proviral sequences derived from the DNA of the initially infected CEM cells, the clear portions corresponding to the retroviral sequences, the shaded portions to the portions of cellular DNA, and the black portions to LTRs in the viral sequences.

30

The thin lines denoted by the letters L and R correspond to the arms derived from the XL4 7.1 phage vector used for the cloning.

45 DK 176253 B1

Some of the restriction sites are also listed: these are more specifically the following places: B: BamHI; E: EcoRI; H:

Hind III; K: Kpnl; Ps: PstI; Pv: PvuII; S: Sagl; X: Xbal.

These viral sequences have parts in common with the E2 sequence.

The relative locations of these moieties determined by hybridization with E2 are also indicated in the figures.

ROD 4 is derived from a circular viral DNA. ROD 27 and ROD 10 35 are derived from proviruses integrated into a cellular DNA structure.

Finally, the deposits were subcloned under the above conditions and their relative positions relative to the corresponding ROD 4, ROD 27 and ROD 35 sequences are given in these figures.

More specifically, these are the insertions of the plasmids pROD 21-3 ', pROD 35-3', pROD 4.6, pROD 4.8 and pROD 4.7.

20

FIG. 9 is a plot of the relative intensities of the hybridization spots generated between ROD-4 and the sub-fragments 1-11, respectively, originating from the various parts of the single-stranded DNA derived from an M13 subclone containing a nucleic acid derived from the entire LAV genome. The relative locations of these various fragments relative to the entire LAV genome (determined by sequence assessment) are indicated at the bottom of the drawing. Point 12 corresponds to a control spot 30 generated using a control DNA from phage λ.

The hybridization experiments in the blot transfer (dot blot) method were carried out under the mild conditions of Example II using a probe, of the λ ROD 4 46 recombinant containing the total cDNA from HIV-2. The washings were then performed consecutively under the following conditions: 2 x SSC, 0.1% SDS at 25 ° C (Tm 42 ° C), 1 x SSC, 0.1% SDS at 60 ° C (Tm-20 ° C) and 0.1% x 5 SSC, 0.1% SDS at 60 ° C (Tm-3 ° C).

The indicated spots were obtained after radiographic exposure overnight.

EXAMPLE IV

In vitro diagnostic study for the presence of HIV-2 virus in a biological medium 15 Materials and methods

Patients HIV-2 infected patients were selected from among 20 people who visited Egas Moniz Hospital in Lisbon either for hospitalization or for consultation between September 1985 and September 1986. This committee, all persons of African origin or living in Africa, had a serum test. for antibodies to both HIV-25 1 (immunofluorescence-IFA- and / or ELISA) and HIV-2 (IFA). Only those patients who were serologically infected with HIV-2 were included in the study.

Virus isolation In 12 patients, HIV isolation was attempted as previously described. Briefly, patients' peripheral blood lymphocytes (PBL) were stimulated with PHA, cultured with normal human PHA-stimulated PBL1s, and maintained in the presence of interleukin-2 (IL-2). The cultures were checked for the presence of cytopathic effect (CPE) and for reverse transcriptase (RT) activity in the supernatant moiety.

Immunofluorescence Assay (IFA) IFA slides were prepared as follows: HIV-2-10 infected MOLT-4 cells were washed twice in PBS and placed on IFA glass plates (104 cells / well), air dried and fixed with cold acetone. For testing for IFA, these cells were reacted with 1/10 dilution of the experimental serum for 45 minutes at 37 ° C, washed, dried, and reacted with a fluorescein-conjugated goat anti-human IgG, A, M (l / 100 diluted) for 30 min. minutes at 37 ° C. After washing, the cells were counterstained in 0.006% Evans blue, placed in 90% glycerol, 10% PBS, and examined under fluorescence microscope.

20

ELISA

Some patients' sera were examined for antibodies to HIV-1 using the commercially available serum tests ELAVIA (Pasteur Diagnostics) or Abbott.

Radioimmunoprecipitation (RIPA) test 30 HIV-1 or HIV-2 infected CEM cells were cultured in the presence of 35s cysteine (200 ptCi / ml) for 16 hours. The supernatant portion was collected, viral particles pelleted and lysed in RIPA buffer (Tris-HCL 50 mM, pH 7.5,

NaCl 150 mM, EDTA 1 mM, 1% Triton x 100, sodium deoxy- 0.1%, SDS 0.1%). For each reaction, 50 μΐ of a lysate dilution corresponding to 10s cpm was reacted with 5 μΐ of experimental serum for 18 hours at 4 ° C. Immune complexes were bound to Sepharose Protein A (Pharmacia), washed and eluted by boiling for 2 minutes. Eluted antigens were then analyzed by SDS-polyacrylamide gel electrophoresis and autoradiography.

Pot blot hybridization 10

Viruses isolated from PBL of patients were pelleted and lysed in Tris-HCL 10 mM pH 7.5, NaCl 10 mM, EDTA 1 mM, SDS 0.5%. One microlitre of each lysate corresponding to 50,000 ppm RT activity was placed on nitrocellulose.

Hybridization and washing were performed under vigorous conditions: hybridization in 6 x SSC, 5 x Denhart, 50% formamide for 18 hours at 42 ° C; and wash in 0.1 x SSC, 0.1% SDS at 65 ° C. HIV-1 and HIV-2 probes, 32P labeled for a specific activity of 108 cpm / µg were used. The HIV-1 probe corresponds to 20 complete genome of the LAVBRU isolate, and the HIV-2 probe was derived from a 2 kilobase cDNA clone from the LAV-2ROD iso- lat.

Results 25

Distribution of patients 30 patients with serologic and / or virologic signs of HIV-2 infection were studied. It was 12 men and 18 30 women. The average age was 35, ranging from 11-55 years. All but one patient had lived in West Africa for several years; 26 were born and had lived in Guniea-Bissau and 2 were from the Cape Verde Islands. One patient was an 11-year-old boy from Angola who had lived on 49 DK 176253 B1

Cape Verde for several years. The only European in the study was a 40-year-old Portuguese who had lived for 8 years in Zaire and who refused to live in West Africa.

5 Clinical characteristics

Among the 30 patients, 17 had AIDS according to the CDC criteria. The main symptom of these patients was chronic diarrhea along with in most cases weight-10 loss of more than 10 kg over 1 year. In 10 of the patients, the diarrhea was found to be associated with the presence of a gut opportunistic infection; the 7 cases were the pathogen Isosporabelli alone, one patient had Cryptosporidium alone and 2 had both pathogens.

In 13 cases, no opportunistic intestinal pathogen was found.

Of all 17 AIDS cases, 8 were diagnosed with 8 oseophageal candidiasis. 6 AIDS patients had respiratory symptoms. Pulmonary tuberculosis was diagnosed in 2 and another unidentified mycobacterium was found in one patient. Two patients had pulmonary aspergillosis, one after a tuberculosis. Two other AIDS patients had recurrent seizures of pneumonias without identified pathogens, and one patient had Pneumocystis carinii pneumonia, first diagnosed post-mortem. Four 25 of the 17 AIDS patients had Kaposi's sarcoma: in 3 cases the disease was limited to the skin, and in one patient, post-mortem examination revealed widespread visceral attacks. Central nervous system disorders were found in two AIDS patients: one had cerebral lymphoma and the other 30 had subacute encephalitis of unknown origin.

Four patients were found to have symptoms of the AIDS-related complex (ARC): two exhibited diffuse lymphadenopathy with persistent fever, one had chronic diarrhea with weight loss, and one had recurrent attacks of bronchopneumonia and multiple lymphadenopathies.

Of the other 9 patients, 6 had no symptoms, 5 could be considered related to HIV infection, one had exclusively pulmonary tuberculosis, one had persistent diffuse lymphadenopathy, and one exhibited neurological syphillis. During the 12-month observation period, 7 patients all died of AIDS.

10

Serological examination

Each patient was examined at least once for serum antibody levels against both HIV-1 and HIV-2. All patients' sera were examined by IFA for antibodies to HIV-2, and all were positive. Of these, 21 were also tested for antibodies to HIV-2 by RIPA: all clearly precipitated the high molecular weight glycoprotein of the virus designated gp 140, and 16 20 of these also reacted with the major core protein p26, while only one reacted with the other viral core protein, denoted pl6.

Sera were assayed for the presence of cross-reacting 25 antibodies to HIV-1 using a different assay method. An IFA study was used for 24 sera: 12 were negative, 10 were weakly reactive and 2 were positive. With ELISA examined, 21: 16 were negative and 5 were positive. Finally, 11 sera for antibodies to HIV-1 proteins were examined by RIPA. Three were unable to react with any viral protein, 2 precipitated only the pol gene product p34, and 5 reacted with the major core protein p25. Two sera reacted only weakly with the envelope glycoprotein gp 110 of HIV-1.

51 DK 176253 B1

These two sera, and all sera with positive IFA or ELISA tests for antibodies to HIV-1, showed strong reactivity with gp 140 from HIV-2 by RIPA, indicating infection with HIV-2 rather than with HIV-1. Only 5 patients who did not participate in the study were serologically infected with HIV-1 and not with HIV-2. This patient was a 21 year old woman from Central Africa (Sao Tome Islands) with AIDS.

10 Virus isolation

Isolation of retroviruses from peripheral blood lymphocytes was attempted in 12 patients. HIV was isolated in 11 in accordance with the presence of a typical cytopathic effect and of a peak in the form of particle-associated reverse transcriptase activity in the supernatant parts of the culture.

All 11 isolates were identified as HIV-2 using a dot-blot hybridization technique. Viral spots from 10 isolates were found to hybridize vigorously under strong hybridization conditions and wash with an HIV-2 probe derived from a cloned HIV-2 cDNA, while none hybridized with an HIV-1 probe under the same conditions. An isolate hybridized only weakly with the HIV-2 probe but was unable to hybridize with the HIV-1 probe.

Immunological evaluation 30 13 patients were examined for the number of circulating lymphocytes identified as helper T cells (CD4 +) and for the ratio of helper: supressor T cells. Among these patients, 11 had AIDS: their average ab 52 DK 176253 B1 solute helper T cell count was 243 + 300 / μ1 and their mean helper: supressor ratio was 0.25 + 0.15. One of the patients clinically showing ARC had a helper T lymphocyte count of 240 / μ1 and a ratio of 5 0.18. Another patient with neurological syphillis and no evidence of HIV-related symptoms had a helper T lymphocyte count of 690 / μ1 and a ratio of 0.82.

In this study, HIV-2 infection was detected in 30 10 West African patients who exhibited either AIDS, ARC

or who had no obvious HIV-related symptoms. However, the results suggest that HIV-2 should be considered a major etiologic agent for AIDS in West African patients. The serologic and virological profiles found indicate that HIV-2 infection was not often associated with HIV-1 infection in the patients concerned. Despite important antigenic and genetic differences, HIV-1 and HIV-2 exhibit similar tropism to CD4 + T lymphocytes, similar cytopathic effects, similar morphology, and share common immunoreactive epitopes in some of their constitutive proteins. Since all West African patients with HIV infection in the present study were found to be infected with HIV-2 and none of them with HIV-1, this 25 novel virus HIV-2 must be the main cause of AIDS in West Africa.

The symptoms of HIV-2-related AIDS did not differ from the symptoms of HIV-1-related AIDS in Central Africa: 30 The most common symptom was chronic diarrhea with severe weight loss, mostly due to Isospora belli and / or Crytopsporidium. The frequency of other opportunistic infections such as candidiasis, mycobacteria (including M. tuberculosis) and toxoplasmosis were 53 as for HIV-1-related African AIDS. Pneumocystis carinii pneumonia, a very common complication of AIDS in the United States and Europe, was found only once in this study and no cryp-5 tococcal meningitis was seen.

Nevertheless, the immunological abnormalities found in HIV-2-infected AIDS patients are identical to those found and described in relation to HIV-ΙΟ-ΙΟ related AIDS,

Of the 30 patients who all had serum antibodies reactive with HIV-2 antigens, only 7 had HIV-1 specific antibodies that could be detected using 15 IFA or ELISA. At RIPA, all these 7 patients had antibodies reactive with the other major nuclear proteins. p25 (HIV-1) or p26 (HIV-2), which have strong immunoreactive epitopes in common. 5 patients lacked these antibodies: all 5 had a negative HIV-1 ELISA. IFA 20 was at the borderline of 3 and negative in 2. Although some of these were not completely evaluated, however, 9 patients with serum antibodies to the viral core protein p26 of HIV-2 were found to exhibit a weak reactive or negative HIV-1 deficiency. specific IFA and / or ELISA. These 25 findings point to the importance of including HIV-2 antigens in the HIV serum studies used in Africa, and perhaps in other areas as well.

A retrovirus was isolated from the peripheral lymphocytes in 30 11 patients. In all cases, viral growth was achieved over 2 weeks characterized by the presence of reverse transcriptase activity in the supernatant portion of the culture and cytopathic effect. However, this cytopathic effect seems to vary from one isolate to another: some isolates produced several large syncytia along with vigorous cell lysis, while others exhibited only few syncytias of limited size and effecting reduced viability of the culture.

Five RNAs from all but one isolate were clearly found to hybridize under very powerful conditions with a probe derived from an HIV-2 cDNA clone representing the 3 'end of the genome. No one hybridized with an HIV-1 probe under the same conditions. This shows that the isolates that infect these patients all belong to the same type of virus. Only one isolate hybridized poorly with HIV-1. However, this virus was isolated from a patient with serum antibodies reacting with all the antigens 15 from HIV-2 by RIPA.

The invention generally involves, in addition to HIV-2 virus variants thereof, any equivalent virus that can infect a human and possess immunological properties specific to HIV-2.

The invention generally involves any virus which, in addition to the properties found in connection with HIV-2 viruses deposited in CNCM, also possesses the properties described below.

25

The preferred target of the HIV-2 virus is human Leu 3 cells (or T4 lymphocytes) and "immortalized" cells derived from these T4 lymphocytes, such as cells of the HUT 78 lineage disclosed in the present patent application. In other words, it has specific tropism for these cells It can be grown in permanent lines of HUT, CEM, MOLT or similar type expressing the T4 protein It is not infectious for T8 lymphocytes It is cytotoxic to human T4 55 DK The cytopathogenic nature of HIV-2 viruses with respect to T4 lymphocytes is manifested especially in the presence of multinuclear cells. It exhibits reverse transcriptase activity requiring the presence of Mg2 + ions and has a strong affinity for polyadenylate oligode ( poly (A) -oligo (dT) 12-18) It has a density of about 1.16 in a saccha rose gradient, it has an average diameter of 140 nanometers and a core with an average slide meters of 41 10 nanometers. The lysates of this virus contain a p26 protein that does not cross immunologically with the p24 protein of HTLV-1 virus or HTLV-II virus. Therefore, these p26 proteins have a molecular weight that is slightly higher (about 1000) than the corresponding p25 proteins from HIV-1 15 and slightly lower (again on the order of 1000 lower) than the corresponding p27 proteins from SIV. In addition, the lysates of HIV-2 contain a pi6 protein that is not immunologically recognized by the pI9 protein from HTLV-1 or from HTLV-II in RIPA (Abbreviation for the Radioimmunoprecipitation Trial). In addition, they contain a envelope glycoprotein having a molecular weight of the order of 130,000-140,000 which does not cross immunologically with gp110 from HIV-1 but, on the other hand, crosses immunologically with the gp140 envelope glycoprotein from STLV-III.

These lysates also contain proteins or glycoproteins which can be labeled with (35S) cysteine with molecular weights of the order of 36,000 and 42,000-45,000, respectively. The HIV-2 genome RNA does not hybridize to the HIV-1 genome RNA under strong conditions.

Under mild conditions, it does not hybridize with the nucleotide sequence derived from HIV-1 and containing the env gene and LTR adjacent to it. In particular, it does not hybridize with the nucleotide sequence 5290-9130 of HIV-1, nor with the sequences from the pol region of the HIV-1 genome, especially with the nucleotide sequence 2170-2240. Under mild conditions, it weakly hybridizes with nucleotide sequences from the HIV-1 region, especially the nucleotide sequences of 990-1070 and 990-1260.

5

It should be noted that any retrovirus that is infectious to humans capable of inducing any of the forms of AIDS exhibiting the above essential characteristics and whose genomic RNA is capable of hybridizing under strong conditions with the HIV-2 viral strains deposited in CNCM (or with a cDNA or a cDNA fragment derived from these genomic RNAs) must be considered equivalent to HIV-2.

15

The invention also involves any of the antigens, especially proteins and glycoproteins in purified state, obtainable from HIV-2. Mention of "purified" proteins or glycoproteins means that these proteins or glycoproteins lead to only single bands, respectively, by polyacrylamide gel electrophoresis, especially under the experimental conditions described above. Any suitable method of separation and / or purification to achieve these may be used. Eg. For example, the methods used by R. C. Montelaro et al., J. of Virology, June 1982, pp. 1029-1038 can be used.

The invention generally involves all antigens, especially proteins, glycoproteins or polypeptides derived from an HIV-2 and exhibiting immunological properties similar to those of the antigenic compounds HIV-2. Two antigens are termed "equivalent" in the sense that they are recognized by the same antibodies, especially by antibodies that can be isolated from a serum infected with a HIV-2 patient or as long as they satisfy the conditions of "immunological equivalence" as described above.

5 Equivalent polypeptides, proteins or glycoproteins should include fragments of the above antigens (or peptides built by chemical synthesis) as long as they cause immunological cross-reactions with the antigens from which they originate. In other words, the invention relates to any polypeptide in common with the aforementioned antigens having identical or similar epitopes capable of being recognized by the same antibodies. Associated with this latter type of polypeptides are the expression products of corresponding 15 sequences of DNA compounds encoding the corresponding polypeptide sequences.

The HIV-2 virus has been shown to be useful as a source of antigens for the detection of antibodies in all 20 people who have been in contact with the HIV-2 virus.

It should be noted that generally available technical literature (especially that listed as a bibliography for the purposes of this specification) with regard to HIV-1 and virus designated HTLV-III should be considered as part of the invention, with reference to these, the methods described in these articles being used under similar conditions to isolate HIV-2 viruses or equivalent viruses, and relate to the production from these viruses of their various constituents (especially proteins, glycoproteins, polypeptides and nucleic acids). It is also possible to use what has been described in the technical literature with regard to the use of various components, especially with regard to diagnostic methods for the corresponding forms of LAS or AIDS.

The invention also involves the use of cDNA-5 compounds or their fragments (or recombinants containing them) as probes in the diagnosis of the presence or absence of the presence of HIV-2 virus in serum samples or other biological fluids or tissues obtained from patients suspected of be 10 carriers of HIV-2 virus. Such probes are also preferably labeled (radioactive, enzymatic, fluorescent labeled and the like). Particularly suitable probes for performing the method for diagnosing HIV-2 virus or a variant of HIV-2 may be characterized in that they comprise all or a fraction of the cDNA complementary to the genome of the HIV-2 virus, or alternatively, in particular fragments found in the various clones described above. More specifically, mention should be made of a fraction of cDNA of HIV-2 found in clone E2, more particularly the sequence of the 3 'end (LTR) and / or of the 5' end of the HIV sequence of the above clone E2, or alternatively cDNA containing env region of cDNA from HIV-2 virus.

The probes used in this diagnostic method for HIV-2 viruses and in the diagnostic kits are in no way limited to the probes described above. On the contrary, they include all nucleotide sequences derived from the genome of the HIV-2 virus, of a variant of HIV-2 or of structurally related virus, as long as they allow for antibodies directed against HIV-2 to be revealed in biological fluids in individuals. that can develop one of the forms of AIDS. Of course, the use of nucleotide sequences derived from an HIV-2 that is initially infectious to humans is nevertheless preferred.

59 DK 176253 B1

The detection can be accomplished in all known ways, especially by contacting these probes either with the nucleic acids obtained from cells present in these sera or other biological media, e.g. cerebrospinal fluids, saliva and the like, or with these media as such, as long as their nucleic acids have been made available for hybridization with these probes, this being under conditions which allow hybridization between these probes and these nucleic acids; and by detecting the hybridization produced. The above diagnosis involving hybridization reactions can also be made using mixtures of probes derived from an HIV-1 and an HIV-2, respectively, for all of the 15 times it is unnecessary to differentiate between the type of HIV virus sought.

Usually, the method of diagnosis for the presence or absence of the HIV virus 20 or its variant in serum or other tissue or fluid samples obtained from patients suspected of carrying the HIV-2 virus involves the following steps: 1) preparation of a labeled 2) at least one hybridization step performed under severe conditions, by contacting DNA of cells in the sample of the suspected patient with the labeled probe on a suitable membrane; 3) washing the membrane with a solution which causes retention of these powerful conditions for hybridization; and 4) detection of the presence or absence of the presence of the HIV-2 virus by an immuno-detection method.

In another preferred embodiment of the present process, said hybridization is carried out under mild conditions and washing of the membrane is carried out under conditions suitable for such hybridization.

In particular, the invention involves HIV-2 viruses, which are characterized in that their viral RNA corresponds to a cDNA whose GAG and ENV genes comprise the subsequent nucleotide sequences, respectively.

They arise by sequencing the corresponding regions of cDNA corresponding to the HIV-2 ROD genome. They are consistent with the amino acids they encode.

DK 176253 B1

Received 61 $ 2 FEB. 2007

PVS

CACaODil

HetGlyAlaArgAsnSerVa 1 LeuA rgGlyLysLysAlaAspGlu ATGGGCGCGACAAACTCCGTCTrGAGAGGGAAAAAAGCAGATGAA

^% * * '' · *

LeuGluArglleArgleuArgProG 1 jG lyLysLysLysTyrArg TXA GAAAGAATCACGTTACGGCC C GGCGGAAAGAAAAAGTACAGG.

«* * · * LeuLysHisIleValTrpAlaAlaAs nXy sLeuAspArgPheGly CTAAAACArATTGTGTCGGCACCCAATAAATTGGACAGATTCGGA 100. . -LeuAlaCluSerLeuLeuGluSeTLysGluGlyCysGlnLysIle 10 TTAGCAGA GAGCC TGTT GGAGJ CAAAAGA GGGXTGTCAAAA AATT

* * * · LeuThrValLeuAspProKetValProXhrGlySerGluAsnLeu CTTACAGTTTTACATCCAATGGTACCGACAGGTTCAGAAAATTTA

200. .

LysSerLeiiPheAsnThrValCysVallleTrpCysIleEisAla AAAAGTCTTTTTAATACTGTCTG CGTCATTTGGTGCATACACGCA

15 * * * * G lu GIuLy sValLysAspXhrGluGlyAlaLysGlnlleValArg GAAGAGAAAGTCAAAGATACTGAAGCAGCAAAACAAATAGTGCGG '. . 300

ArgHisLeuValAlaGluThrGlyTarAlaGluLysMetProSer agacatctagtggcagaaacaggaactgcagagaaaatgccaagc * »· ·

Th rSe rArgP roThrA laProSerSerGluLysGlyGl yAs atyr 20 ACAAGIAGACCAACAGCACCAX C ΓΑ GCGAGAAGGGAGG AA ATTAC

. . . 400

ProVa IGlnHisValGlyGlyAsaTyrThrHisIleProLeuSer ccagtgcaacaxgtåggcggcaaciacacccatataccgctgagt • · · '»·

ProArgThrLeuAsnAlaTrpValLysLeuValCluCluLysLys C CCCGAACCCTAAATGCCTGGG ΤΑΑΑΑ TTAGTAGAGGAAAAAAAG 25 · * - ·

PheGlyAlaGluValValProGlyPheGlDAlaLeuSerGluGly

TICGGGGCAGAAGTAGTGCCAGGATTTCACGCACTCTCAGAAGGC

300 I * B #

CysThrProTyrAspIleAsrGlnMetLeuAsnCysValGlyA & p TGCACGCCCTATGATATCAACCAAATGCTTAAXTGTGTGGGCGAC »· -. ·· - · ~ ·.

2q HisGlnAlaAlaHetGlnllelleArgGluIlelleAsnGluGlu

CATCAAGCAGCCATGCAGATAAXCAGGGAGAtXATCAAXGAGGAA Bp 600. B B

AlaAlaGIuTr-pAsp Va lGlnH i. SProIleProGlyProLeuPro "" GCAGCAGAATGGGATGTGCAAC ATCCAATACCAGGCCCCTTACCA

· »B. * * - ♦ · A1 aG1 yGlnLeuArgGluPro A r g G ly SerAs p 11 eAl aG lyXhr GCGGGGCAGCTTAGAGAGCCAAGGGGAXCTGACAXAGCAGGGACA 35. . 700. ...

Thrse rThrValGluGluG lnlieGlnTrplletPheArgProGln acaagcacagtagaagaacagatccagtggatgttiaggccacaa 62 DK 176253 B1

AsnProValProValGlyAsnlleTyrArgArgTrpIleGlnlle

AATCCTGTACCAGTAGCAAACAT C T ATAG A AG AT G GAT CCAGATA. '. . SOO

ClyLeuGlnLysCysValArgHe tTyrAsnProTh.rAsnlleLeu ggattgcagaagtgtgtcaggatgtacaacccga'ccaacatccta c * · · ·

AspIleLysGlnGlyProLysGluProFheGlnSerTyrValAsp

GACATAAAACAGGGACCAAAGGAGCCGTTCCAAAGCTATGTAGAT

900

ArgPheTyrLysSerLeuArgAlaGluGlnThrAspProAlaVal AG ATT C TACAA AAGCT7 GAGGG C A C AACAAACAGAT CCAGCAGTG • · · · ·

LysAsnTrplTe tTbrGlnThrLeuLeuValGlnAsnAlaAenPro 10 AAGAATTGGATGACCCAAACACTGCTAGTACAAAATGCCAACCCA

• * · * ^

AspCysLysLeuValLeuLysGlyLeuGlyMetAsnProThrLea GACTGTAAATTAGTGCTAAAAGGA C TAGGGATG AACCCTACCTTA 1000. . .

GluGluHetLeuThrAlaCysG lnGlyValGlyGlyProGlyGla G AA GAGAT GC TGACCGCCTG TCAG GGGGTAGGTGGGCCAGGCCAG

15 · · · · · *

LysAlaArgLe wulle tAlaGluAlaLeuLysGluVallleClyPro AAAGCTACATTAATGGCAGAGG CC CTGAAAGAGGTCATAGGACCT. 1100. .

AlaProIleProPheAlaAlaAlaGlnG InAr g Ly s Al aPb eLy · GCCCCTATCCCATTCGCAGCAGCC C AGCAGAGAAAGGCATTTAAA •. · * · ·

CysTrpAsnCysGlyLysGluGlyHisSerAIaArgGlaCysArg U TGC TGG AAC TGTGGAAAGGAAGGG CACTCGGC AAGACAATGCCGA

1200

AlaProArgArgGlnClyCysTrpLysCysGlyLysProGlyHis GCACCTAGAAGGCAGGGCTG CTG G AAGTGTGGTAAGCCAGGACAC • »'· * IlelTetThrAsnCysProAspArgGinAl a G lyP ATCATGACAAACTGCCCAGATAG ACAGG CAGGTTTTTTAGGACTG 25. ... 1300

GlyProTrpGlyLysLysProArgAsnPheProValAlaGlnVal GGCCCTTGGGGAAAGAAGCCCCG CAACTTCCCCGTGGCCCAAGTT • * »♦ · ProGlnGlyLeuThrProThrAlaProPro7alAspProAla7a'i C CGCAGGGGCTGACACCAACAG C ACCCCCAGTGG AT CCAGCAGTG • · · · 30 As pLeuLeuG luLysTyrlletGlnGlnGlylysArgGlnArgGlu GATCTACTGGAGAAATATATGCAGCAAGGGAAAAGACAGAGAGAG 1400 * * · · · G InArgG luArgP ro Tyr Ly s G 1 UVA IThrGI u A p PLE uLeuHis cagagagagagaccatacaaggaagtgacagaggacttactgcac ' · · ·

LeuGluG InG lie luTbrProTy rAr g G luPr oP r oThrGluAs p CTCGAGCAGGGGGAGACACCATA CAGGGAGCC ACCAACAGAGGAC 35. 1500

LeuLeuHisLeuAsnSerLeuPheGlyLysAspGla TTGCTGCACCTCAATTCTCTCTTTGGAAAAGACCAG * · · 63 DK 176253 B1

AND VRN

HetMetAsnGlnLeuLeuIleAall AllLeuLeuAiaSerAlaCys ATGAXGAATCAGCTGCTTATTGC CATXTTATTACCTAGTGCTTGC

• · ·, »

LeuValTyrCysXhrGlnTyrV'alThrValPheTyrGlyValPro 5 TTAGTATATTGCACCCAAIAXGX AACTCTTTTCTATGGCGTACCC

•. · · F *

XhrTrpLysAsnAlaThrl1 eP r oLeuFheCysAlaThrArgAsa ACGTGGAAAAATGCAACCATTCCCCTCTTTXGTGCAACCAGAAAT 100.

ArgAspXbrTrpGlyThrlleGlnCysLeuProAspAsnAspAsp AGGGATACTXGGGGAACCATACAGTGCTTGCCTGACAATCATCAT A 0 · * · * ·

TyrGlnGluIleThrLeuAsnValThrGluAlaPbeAspAlaTrp TATCAGGAAATAACTITGAATCTAACAGAGGCTTTTGATGCATGG. 200

AsnAsaThrValTbrGlviG InAll AllGluAspValTrpHisLeu AATAATACAGTAACAGAACAAGCAATAGAAGATGTCTGGCATCTA

• · ft *, c- PheGluXbrSerrieLysProCysValLysLeuXhrProLeuCys ttcgagacatcaataaaaccaxgxgtcaaacxaacacctxxaxgt. . 300

ValAlaMeCLysCysSerSerThrGluSerSerXbrG1yAs nA s a GTA GCAAX GAAATGCAGCAGCACACAGAGCAGC ACAGGGAACAAC

• ft · · ft

ThrThrSerLysSerTh r See rThr Thr TbrTbr XhrPr oXhr As p ACAACCTCAAAGAGCACAAGCACAACCACAACCACACCCACAGAC 20 .... 400

ClnGluGlnGluIleSerGluAspThrProCysAlaArgAlaAsp

CAGGAGCAAGAGATåAGXGAGGATACTCCAXGCGCACGCGCAGAC

«T · · ·

AsnCysSerGlyLeuG1yGluGluGluXhrlleAsnCysGlaPhe AACTGCICAGGATXGGGAGAGGAAGAAACGATCAATXGCCAGXTC

• · · ft 25 A3nMetXhrGlyJ.euGluArgAspLysLysLysGlnXyrAsnGlu AAXATGACAGGAXTAGAAAGAGAXAAGAAAAAACAGXATAATGAA 500.

ThrTrpXyrSeTLysAspValValCysGluXhrAsnAsnSerThr

ACAICGXACXCAAAAGAXGXGGTXTGXGAGACAAATAATAGCACA

ft ft

AsnGlnXbrGlnCysXyrHetAsnEisCysAsnTbrSerVallle AAICAGACCCAGXGIXACAXGAACCAXTGCAACACAXCÅCTCATC. * 600

XhrGluSerCysAspLysSisXyrTrpAspAl allArgPheArg ACåGAAXCAXGXGACAAGCACXATTGGGAXGCXATAAGGTXXAGA%. * · ·

TyrCysAlaProProG lyXy r Al aXeuLe uArgCy s As nAspThr XACTG XGCACC ACCGGGXXAXGCCC XATTAAGATGTAATGAT ACC - 700 35 AsnTyrSerClyPheAlaProAsXCACXXCACXXACCACXACCACXACCACCACCACCACC

TbrCysTbrArgMetMetGluThrG InThrSerThrTrpPheG ly ACATGCACC AGGATGATCGAAA CGCAA ACTTCCA CATGG TTTG GC. . . 800 '.

PheAsnGlyThrArgAlaGluAsnArgThrTyrlleTyrTrpHis tttaatggcactagagcagagaatagaacatatatctattggcat 5. »·.

GlyArgAspAsnArgThrllelleSerLeuAsnLysTyrTyrAso GGCAGAGATAATACAACTATCA TCAGCTTAAACAAATATTATAAT

*. . . 900

LeuSerLeuHisCysLysArgProGlyAsnLysThrValLysGla CTCAGTTTGCATTGTAAGAGGC C AG G G AAT AA G A CAGTGAAACAA

♦ ♦ * * ^ 0 IleMetLeuMetSerGlyBiEValPheBisSerBisTyrGlnPro ATAATGCTTATGTCAGGACAXGTGTTTCACTCCCACTACCAGCCG »« * · lleAsnLysArgProArgGlnAlaTrpCys . -

Tr p Ly s A s pA 1 aM eCGlnGluValLysThrLeuAlaLysBisPro

TGGAAAGACGCCATGCAGGAGG'TGAAGACCCTTGCAAAACATCCC

15 * '• · * · ·

AxgTy r Ar gG lyThr AsnA spThrArgAsnlleSerPbeAlaAla AGGTATAGAGGAACCAATGAC ACAAGGAATArTAGCTTTGCAGCG. 1100; .

Ft-o G1 yLysG lyserAspProG luValAlaTyrHetTrpTlirAsu CCAGG AAAAGGC TC AGACC C A G AAGTAGCATACATGTGGACTAAC •. »» · * 20 CysArgGlyGluPbeLeuTyrCysAsnHetThrTrpPheLeuAsn

IGCAGAGGAGAGTTTCTCTACTCCAACATGACTTGCTTCCTCAAT

1200

TrpIleGluAsnLysThrHisArgAsnTyrAlaProCysHisIle TGCAT ACAGAATAAGACACAC C CCAATTATCCACCGTGCCATATA • · ·. · · LysGlnllell e As nThrTrp H isLysValGlyArgAsnValTyr 25 AAGCAAATAATTAACACATGG CATAAGGTACGGAGAAATGTATAT

. . 1300

LeuProProArgGluClyGluL.euSerCysAsnSerThrValThr TTGCC TCC CAGGGAAGGGGAG C TGTCC TGC AACTCAACAGTAACC

/ · * · »#

SerllelleAlaAsnlleAspTrpG InAsnAs cAsnC lnThrAs n AGCATAATTGCTAACATTGACTGGCAAAACAATAAICAGACAAAC ♦ * · · 30 ...

ClyAepTyrLysLeuValGluIleThrProIleGlyPheAlaPro GGAG ATTATAAATTCGTAGAAATAACACCAATTGGCTT CGCåCC T

35 65 DK 176253 B1

ThrLysGluLysArgTyrSerSerAlaHisGlyArgHisThrArg ACAAAAGAAAAAAGATACTCC TCTGCTCACCGGAGACATACAAGA. 1500.

GlyValPheValLeuGlyPheLeuGlyPheLeuAlaThrAlaGly. CGTGTGTTCGTGCTAGGGTTCTTGCGTTTTCTCGCAACAGCACGT

r · · * * S e r A1 all tGlyAlnArgAlaSerLeuThrValSerAlaGlnSer TCTGCAATGGGCGCTCGAGCGTCCCTGACCGTGTCGGCTCAGTCC. . 1600

ArgTbrLeuLeuAlaGlylleValGlnGlnGlnGlnGlnLeuLeu CGGACTTTACTGGCCGGGATAGTGCACCAACAGCAACAGCTGTTG • · * ·

Αε gValValLysArgGlnGIdG luLeuLeuArgLeuThrPalTrp 10 cacgtggtcaagagacaacaag AACTGTTGCGACTGACCGTCTGG

. . . 1700

GlyThrLysAanLeuGlnAlaArgVaIThrAlalleGluLysTyr CGAACGAAAAACCTCCAGGCAAGAGTCACTGCTATAGAGAAGTAC * - · »»

Le g1nAs pGlnAlaArgLeuA s c S e rX rpG1yCysAlaPheArg CTACAGGACCAGGCGCGGCTAAATTCATGGGGAXGTGCGTTTAGA 15. * ·. 1800

GloValCysHisThrThrVaLProTrpValAsnAspSerLeuAla CAAGTCTGCCACACTACTGTA CC ATGGGTTAAIGATTCCTTÅGCA • *

• «Φ ·%

ArgTyrLeuGluAlaAsLaLe rLy sSerLeuGluGlNaLGlN 20 CGCTACCTGGAGGCAAATATCAGTAAAAGTTTAGAACACGCACAA

1900

IleGlnGlnGluLysAsnHetTyrGluLeuGlnLysLeuAsnSer

ATTCAGCAAGAGAAAAATATGTATGAACTACAAAAATTAAATAGC

»· · M *%

TrpAspIlePbeGlyAsnTrpPheAspLeuXhrSerTrpValLys TGGGATATXTTTGGCAATTGG TTTGAC TTAACCXCCTGGGTCAAG 25. 2000

TyrlleGlnTyrGlyVaiLeullelleValAlaVal'IleAlaLeu IATAITCAAXATGGAGTGCTX AT AAXAGTAGCAGTAAXAGCTXTA • · · · *

Argil eVallleTyrValValGlnlletLeuSerArgLeuArgLys AGAATAGIGATATATGTAGXA C A AATGTTAAGTAGG CTTAGAAAG

2100

CLLytyrArgProValPheSer SerProProGlyTyrlleGlnGln & GCTATA GGCCTGTTTTCTCTT CCCCCCCCGGTTATAXCCAACAG

35 DK 176253 B1 66

IleELsIleKisLysAspArgGlyGlnProAlaAstiGluGluTbr ATCCATAXCCACAAGGACCGGGGACAGCCAGCCAACGAAGAAACA. . . 2200 GluGluAspGlyGlySerAsrxGlyGlyAspArgTyrTrpProTrp GAAGAA GACGG TGGAAGCAAC GG TCCAGACAGATAC TCGCCCTCG

5 · * * · *

ProIleAlaTyrlleKisPheLeuIleArgGlnLeuIleArgLeu CCCATAGCATATATACATTTCCTGATCCCCCAGCTCATTCGCCTC * · * ♦

LeuThrArgLeutyrSerlleCysArgAspLeuLeuSerArgSer TTCACCAGACTATACAGCATCXGCAGGGACTTACTATCCAGGAGC 2300 ....

PheLeuThrLeuGlnLeuIleTyrGlnAsnLeuArgAspT rpLeu 10 TICCTGACC C TCCAACVCAT C TAGCAGAATCTCAGAGACTGG CTG

• · * »

ArgLeuArgThrAlaPheLeuGlnTyrGlyCysGluTrpIleGln AGACTTAGAACAGCCTTCTTGCAATATCGGTGCGAGTCGATCCAA. 2400 GLuAlaPheGlnAlaAlaAlaArgAlaThrArgGluThrLeuAla

GAACCATTCCACGCCGCCGCGAGGGCTACAAGAGAGACTCTTGCG

15 · * * ·

GlyAlaCysArgGlyLeuTrpArgVaH.euGluArgIleGl.yArg

GGCGCGTGCAGGGGCTTGTGGAGGGTATTGGAACGAATCGGGAGG

2500

GlylleLeuAlaValProArgArglleArgGlnGlyAlaGluI1e GGAATACTCGCGGTTCCAAGAAGGATCACACAGGGAGCAGAAATC * · ·. * ·

AlaLeuLeu *** GlyThrAlaValSerAlaGlyArgLeuTyrClu U GCCCTCCTGTGAGGGACGGCAGTATCAGCAGGGAGACTTTATGAA

. . 2600.

TyrserMetGluGIyProSerSerArgLysGlyGluLysPheVal TACTCCATGGAAGGACCCAGCAGCAGAAAGGGAGAAAAATTTGTA * · · *

GlnAlaThrLysTyrGly C AG G C AA C AA AAT AT GG A 25.

30 35 67 DK 176253 B1

Of course, as already indicated above, the invention naturally involves all HIV-2 viruses whose RNA possesses similar properties, especially the GAG and ENV regions, comprising sequences with nucleotide sequence homology of at least 50%, preferably 70%, and preferably 90%, with the corresponding GAG and ENV sequences of HIV-2 ROD.

In particular, the invention involves cDNA fragments encoding p6, p26 and p12, respectively, whose structures 10 are also included in GAGRODN. In particular, it relates to the sequences that extend: from nucleotide 1 to nucleotide 405 (encoding p6); From nucleotide 406 to nucleotide 1155 (coding for p2 6); and from nucleotide 1156 to nucleotide 1566 (coding for 20 µl 2).

In particular, the invention also involves the cDNA fragment encoding gp140 included in the ENVR and extending from nucleotide 1 to nucleotide 2574.

25

The invention also involves nucleotide sequences which differ from the foregoing by nucleotide substitutions, taking advantage of the degeneration of the genetic code as long as the substitutions do not involve a modification of the amino acid sequences encoded by these nucleotide sequences.

In addition, the invention involves proteins or glycoproteins whose amino acid sequences correspond to those indicated on the foregoing pages, as well as equivalent peptides ie. peptides derived from the foregoing pages by addition, substitution or removal of amino acids which do not affect the overall immunological properties of said peptides.

In particular, the invention involves the envelope glycoprotein which exhibits the amino acid sequence encoded by ENVRN.

Any of the aforementioned proteins (p1, p6, or p26) or of the protein exhibiting the structure gp140 or any predetermined portion of these proteins can be prepared by a method comprising introducing the corresponding nucleic acid sequence. in a vector capable of transforming an appropriately selected host cell and enabling expression of the introduced into this vector, that the selected host is transformed by the vector containing the nucleic acid, that the transformed cell host with the modified vector is grown, and extracting and purifying the expressed protein.

Methods disclosed in European patent application no.

85 905513.9 filed October 18, 1985 for the preparation of peptides or proteins consisting of expression products of nucleic acid sequences derived from the genome of HIV-1 are also suitable for the production of said peptides or proteins derived from HIV-2. This European patent application is hereby referred to as a special method.

Below are the molecular weights of HIV-2 proteins relative to the molecular weights of HIV-1.

69 DK 176253 B1

Molecular weight of Molecular weight of HIV-2 proteins HIV-1 proteins kd kd 5 whole gag 58.3 whole gag 55.8 p 16 15 p 18 14.9 p 26 27.6 p 12 15.8 env 98.6 env 97, 4 10 outer env 57.4

Transmembran env 41.2 HIV-2 Mir and HIV-2 ROD are also deposited in the National 15 Collection of Animal Cell Cultures (ECACC) in Salisbury (England) on January 9, 1987 under registration numbers 87 011001 and 87 011002, respectively. .

In addition, plasmids pROD35 and pROD27.5 are deposited in the 20 "National Collection of Industrial Bacteria (NCIB) in

Aberdeen (England) on January 9, 1987 under registration numbers 12 398 and 12 399 respectively.

Reference is made to the 25 literature sites listed in this application.

70 DK 176253 B1

BIBLIOGRAPHY

1. F. Barre-Sinoussi et al., Science 220, 868 (1983).

2. Montagnier et al., Human Cell Leukemia Orlymphoma viruses (Gallo, R.C., Essex, M.E., Gross, L., eds.) Cold Spring Harbor Laboratory, New York, 363 (1984).

3. M. Popovic, M. G. Sarngadharan, E. Read, R. C. Gallo,

Science 224, 497 (1984).

4. J. Levy et al., Science 225, 840 (1984).

5. P. Sonigo et al., Cell 42, 369 (1985).

7. J.W. Curran et al., Science 229, 1352 (1985).

8. A. Ellrodt et al., Lancet, 1383 (1984).

9. P. Piot et al., Lancet ii, 65 (1984).

10. F. Brun-Vezinet et al., Science 226, 453 (1984).

11. N. Clumeck et al., N. Engl. J. Med. 313, 182 (1985).

12. A. B. Rabson and Μ. A. Martin, Cell 40, 477 (1985).

13. S. Benn et al., Science 230, 949 (1985).

30 14. M. Alizon, Manuscript in preparation.

15. F. Brun-Vezinet, unpublished.

71 DK 176253 B1 16. M.D. Daniel et al., Science 228, 1201 (1985).

17. P. J. Kanki et al., Science 228, 1199 (1985).

18. N. L. Letwin et al., Science 230, 71 (1985).

19. A. Gatzar et al., Blood 55, 409 (1980).

20. D. Klatzmann et al., Science 225, 59 (1984).

21. L. Montagnier et al., Virology 144, 283 (1985).

22. J. S. Allan et al., Science 228, 1091 (1985).

15 23. F. CHIVel, manuscript in preparation.

24. F. diMarzo Veronese et al., Science 229, 1402 (1985).

25. V. S. Kalyanaraman et al., Science 218, 571 (1982).

26. I.S.Y. Chen, J. McLaughlin, J.C. Gasson, S.C. Clark and D.W. Golde, Nature 305, 502 (1983).

27. Barin et al., Lancet ii, 1387 (1985).

28. P. J. Kanki, J. Alroy, M. Essex, Science 230, 951 (1985).

29. H. Towbin et al., Proc. Natl. Acad. Sci. USA 76, 4350 (1979).

30. S. Wain-Hobson, P. Sonigo, O. Danos, S. Cole, and M.

Alizon, Cell 40, 9 (1985).

72 M. Alizon et al., Nature 312, 757 (1984).

5

Claims (13)

73 DK 176253 B1 A composition for in vitro detection of the presence in a biological sample of antibodies against a human retrovirus capable of having cytopathogenic effect on human T4 lymphocytes comprising at least one HIV-1 antigen, characterized in that further comprises at least one HIV-2 antigen recognized by the antibodies elicited against the corresponding antigens 10 by any of the HIV-2 retroviruses deposited in CNCM of numbers 1-502, 1-532, 1-642 and 1-643 or in ECACC deposited HIV-2 retroviruses with the numbers 87.011001 and 87.011002 (corresponding to 1-502 and 1-532, respectively) or a variant of one of these HIV-2 retroviruses. 15 Composition according to claim 1, characterized by,. that it comprises a glycoprotein of HIV-2 retroviruses. A composition according to claim 1, characterized in that it comprises an HIV-2 pl2 protein that is immunologically recognized by antibodies raised against the deposited HIV-2 retroviruses and has a molecular weight of the order of 12,000 daltons. A composition according to any one of claims 1 to 3, characterized in that it comprises core proteins from HIV-1 and from HIV-2. Composition according to claim 4, characterized in that it comprises p25 from HIV-1 and p26 from HIV-2. Composition according to claim 4, characterized in that it comprises pI8 from HIV-1 and pI6 from HIV-2. 74 DK 176253 B1 Composition according to claim 1, characterized in that it comprises envelope glycoproteins from HIV-1 and envelope glycoproteins from HIV-2. Composition according to claim 7, characterized in that it comprises gp110 from HIV-1 and gp140 from HIV-2. Composition according to claim 7 or 8, characterized in that it comprises p42 from HIV-1 and p36 from A composition according to claim 1, characterized in that it contains mixtures of antigenic proteins and / or glycoproteins from HIV-1, and / or mixtures 15 of proteins and / or glycoproteins from HIV-2. HIV-2. A method for in vitro detection in a human biological sample, e.g. a serum, from the presence of antibodies that recognize antigens from a human retrovirus capable of cytopathogenic action on the human T4 lymphocytes, and in particular for in vitro diagnosis of a potential or existing LAS or AIDS, caused by a human retrovirus, characterized by contacting the biological sample of the subject to be diagnosed with a mixture of antigens capable of providing a specific immunological reaction with the antibodies against a human HIV-1 retrovirus, or against a human HIV-2 retrovirus capable of having a cytopathogenic effect, which is recognized by the antibodies, is induced against the corresponding antigens of any of the CNCM deposited HIV-2 retroviruses with numbers 1-502, 1-532, 1-642 and 1-643 or in ECACC, HIV-2 retroviruses deposited with numbers 87.011001 and 5 87.011002 (corresponding to 1-502 and 1-532, respectively). , or a variant of one of these HIV-2 retroviruses and that a possible immunologically conjugate formed between at least one of these antigens and the antibodies is detected. Method according to claim 11, characterized in that the biological sample of the person to be diagnosed is contacted with a mixture of antigens from both an HIV-1 and an HIV-2 retrovirus, which antigen from HIV-2 is recognized by the antibodies elicited against the corresponding antigens by any of the HIV-2 retroviruses deposited in CNCM with numbers 1-502, 1-532, 1-642 and 1-643 or HIV-2 retroviruses deposited with ECACC 87.011001 and 87.011002 (corresponding to 1-502 and 1-532, respectively) or a variant of one of these HIV-2 retroviruses, in particular with a composition according to any one of claims 1-8, and demonstrating the possible formation of immunological conjugate between at least one of these antigens and the antibodies. A kit for in vitro detection of the presence of antibodies against a retrovirus that is cytopathogenic for human T4 lymphocytes, especially in a person possibly carrying these antibodies, characterized in that it comprises a mixture of at least one HIV-1 antibody. 30 and at least one HIV-2 antigen, in particular a composition 76 as defined in any one of claims 1-8; means for detecting an immunological conjugate resulting from the immunological reaction between the antigens and antibodies in the biological fluid. 5