AU601397B2 - Retrovirus of the hiv-2 type susceptible of inducing aids, and its antigenic and nucleic constituents - Google Patents

Description

AU-AI-68911/ 8 7 ORGANISATION NIONDIALE DE LA PROPRIETEfN'tELLECTUELLE P C T 11ue u a ternationalM

O

_"?.AfNDE INTERNATIONALE PUBLIEE EN VER6 UAI{I/ E INMA TIERE DE BREVETS (PCT) (SI) Classification Internationale des brevets 4 (11) 4NumA-io dc publication iternationale: WO 87/ 04459 C12N 7/00, A61K 39/21 GO IN 33/569, C07K 15/06 Al C12N 5/00, 15/00, C12Q 1/70 (43) Date de publication Initernationale: 30 juillet 1987 (30,07,87) S C12P 21/02 1) (21) Nurnkro de la demnande internationale: (22) Date de d6p~t International; (31) Numiros des demandes prioritaires: PCT/FR87/00025 22janvier 1987 (22.01,87) 86/00910 86/00935 86/0011 86/01985 835,228 86/03881 86/042 15 916,080 933,184 Brevet on demande principal(e) (63) Apparent6(e) par continualaon us DWpos~e le 013,477 (CIP) I6janvier 1987 (60.7 (32) Dates de priorit6* 22 janyier 1986 (22,01,86) 22 janvler 1986 (22,01,86) 6 l'~vrier 1986 (06.02.86) 13 r~vrier 1986 (13,02,86) 3 mars 1986 (03,03,86) 18 mars 1986 (18,03,86) 24 mars 1986 (24,03,86) 6 octobre 1986 (06,10,86) 21 novembre 1986 (21.11,86) y

A;

4r#.

(33) Pays de priortte" SEP 1987

F~IAUSTRALIAN

I 14 AUG 1987

AETOFFICE

(71) DWposant (pour toils les 4tats d~slgn~s sailf US): INSTITUT PASTEUR [FR/FRII 25.1,8, rue du Or, Roux, F-75724 Paris C~dex 15 (FR4*).

(72) Inventeurs; et Inventeurs/D~p62!!ns (U5 :eulement) MONTAGNIER, Luc 21, rue de Malabry, F-92350 Le Plessis Robinson CHAMARET, Solange jVR/FR]; 324, rue Lecourbe, F-75015 Paris GUETARD, Denise [FR/FR]; 4B, rue Anselme Payen, F-75015 Paris ALIZON, Marc [FR/ FRI; 71, rue du Cardinal Lemoine, F. 75005 Paris (FR), CLAVEL, Fran ois 83, rue de I'Ass.omption, F- 75016 Paris GUYADER, Mireille [FR/FR]; 2, square Roca maziaoa rt., F-75016 Paris SONIGO, Pierre [FR/ FR]; 23, rue Gutenberg, F-75015 Paris BRUN-VEZI- NET, Franqoise [FR/FR]; 24, boulevard Saint-Germain, Fm 75005 Paris REY, Marianne 10, rue du Temple, F- 75004 Paris ROUZIOVX, Christine [FR/FR]; 21, rue de Dantzig, F175015 Paris KATLAMA, Christine [FR/FR]: 8, rue de jarente, F,75004 Paris (FR).

(74) Nlandataire: S.C. ERNEST GUTMANN YVES PLASSE- RAUD;, 67, boulevard Haussmann, F-75008 Paris (FR).

(81) Etats dtisignist AU, CF (brevet, GAPI), CG (brevet GAPI), CM 1 (brevet OAPI), DK, GA (brevet GAP!), JP, KR,ML(bel QAPI), MVR (brevet QAPI), SN (br ,vet GAPI), TD) (brevr GAP!), TG (brevet GAP!), US, PublI~e 4vec rapport le rec/iwrce Iternationale, elvant /'expiration du Ml prvu~ pour ta olodijkation des revendications, sera republi~e si de telles inodlftations sont reviles, (54)Titie: RETROVIRUS OF THE HIV-2 TYPE SUSCEPTIBLE OF INDUCING AIDS, AND ITS ANTIGENIC AND NUCLEIC CONSTITUENTI (54)Titre, RE'iROVIRUS DU TYPE HIV-2 SIJSCEPTIBIE DE PROVOQUER L.E SIDA, ET SES CONSTITUANTS ANTI(JENIQUES ET NUCLEIQUES (57) Abstract tNew variety or' retroviruses, designated by HIV-2, or which samples have beert deposited at ECACC under the num4 bers 87,01,1001 and 87,01,1002 and at, NCIB under the numbers 12.398 and 12,399, The invention also eutsto the antl* gens susceptible or' being obtained from said virus, In particular from the proteins p12,, p 16, p26 and gp 140. These differ" ent antigens are applicable to the diagnosis of the disease, particularly by contact with a serum ol'the patient, on whom the diagnosis Is to be carried out, it. also relates to immunogenic compositions containing mote particularly the, glycoproteint rp14O. FInaliy, It relates to nucleotidic sequences uleable particularly as hybridiz tion probes derived from the RNA of HIV-2 4 (57) Abr~g6 Nouvelle vark6 de r~trovlrus, d6nomm~s H[V-2, dont des chantillons on( t d~pog~s A VIECACC sous les ntum ros 87.011001 et 87001,1002 et, A la NCIB sous Ies nUm~ros 12..30 et 12,399. Ct~e concerne aussi les iantlg~ncs susceptibles d'~tre obtenus k~ pariir de ae virus, en particulier des prot~nes p12, p16, p26 at gpl4O. Ces dlff~rents antig~nes sont appl& cables au dlagno.sic de la mahadie, notamnment par mi'sc en contact avec un 86rum du malade chezlequel le diagnostic doit Wte effectU6, Mlie, concerne des comro,-,ons immunog~nes con-4enant pius particull~rement la giycoprot~ine sp 140. iille concerne enflq des s~quencos nucl~otidiquc utllsables notarnment e" tanit que sondes d'hybridation, d~riv~es 4~ IAP'N dle H-IV-2,

,I

New retrovirus c.apable of causing AIDS, means and methods for detecting it in vitro The invention relates to a new class of viruses having the capacity to cause lymphadenopathies, which are then capable of being replaced by acquired immune deficiency syndrome (AIDS) in man, The invention also relates to antigens capabl'e of being recognized by antibodies induced in man by this new class of virus. It also relates to the antibodies induced by antigens obtained from these viruses.

S: This invention relates, furthermore, to cloned 15 DNA sequences possessing sequence analogy or complementarity with the genomic RNA of the abovementioned virus, -g e It also relates to the methods for preparing these cloned DNA sequences, The invention also relates to polypeptides containing amino acid sequences encoded by the cloned DNA sequences.

In addition, the invention relates to applications of these antigens to the in vitro diagnosis in man of potentials for certain forms of AIDS and, in respect of some of these antigens, to the production of immunogenic compositions and vaccinating compositions against this retrovirus, The invention likewised relates to the applications of the abovementioned antibodies for the same purposes and, for some of them, to their application to the production <if acitve principles of drugs against these gorms of human AIDS, Finally, the invention relates to the application of the cloned DNA sequences, and of polypeptides obtained from these sequences, as probes it diaonostic kits.

The isolation and charactediat ion of a first 1 ';aa'4'

Y,

I

2 retrovirus., known as LAV, whose responsibility in the developement of AIDS had been recognized, formed the subject of a description in a paper by F. BARRE-SINOUSSI al.. already in 1983 (Science, vol. 220, N' 45-99, p. 868-871), Application of some extracts of this virus, and more especially of some of its proteins, to the diagnosis of the presence of antibodies against the virus was described more especially in European Patent Application n' 138.667. Since then, other similar strains and variants of LAV have been' isolated, Examples which may be xecalled are those kcnown by the names H-TLV-ITI and. ARV, To apply the new rules of nomenclature published in Nature in May 1986, the retroviruses capable .0..of inducing in man the abovementioned lyrphadenopathies and AIDS will be jl1ven the overall designation "I an abbreviation of the term "Human Immunodeficiency Virus" The subgroup of retroviruses forred by LAV and its vaziants was initially 'designated by the terms I'LAV type 20 folio or "LAy-I" The latter subgroup will. be designated 8*6:01 hereinafter HIV-1# it. being understood thatt the term LAV of will, still be retained to denote that strain, among the strains of retrovirus (in partirtilar LAAV, ID)AV-4 and IDAV-2) belonging to the H-IV-1 virus class which are described in the abovementioned i8uropean Patent Application 138,667, which was used in the comparative experiments described l~ater. na~iely LAV 8 which was

BRQ

deposited with the Collectiot~ Nationale des Cult~utes do Micro-organismes (CNCM) (National rollec"I.ie-)i of Mico organitsm Culti~ies) of the Institut Pstteur do a Fram~e, on 15th July 1983 londr n' The new retrovirus whioh 4 rm jtire, Q the present patent a~the Virup re rel~ated to it, and whl(h 4le, like I i iP I**L"C in human lymphocytes, formerly known as. "LAV type II" or "LAV-IT", are henceforward known as "HIV-2", it being understood that the designations of certain HIV-2 isolates described later will be followed by three letters which refer to the patients from whom they were isolated.

The "HIV-2" group can be defined as a group of viruses having in vitro a tropism for human T4 lymphocytes; and which have a cytopathogenic effect with respect to these lymphocytes when they multiply therein, and then either cause generalized and persistent polyadenopathies or one of the forms of AIDS. The HIV-2 retroviruses have proved to be different from the HIV-1 type viruses under the conditions mentioned later. Like these latter viruses, they are different from the other human retroviruses which are already known (HTLV-I and

SHTLV-II).

Although there is fairly wide genetic variability in the virus, the different HIV-1 strains isolated to date from American, European, Haitian and .a *4 African patients have antigenic sites in common conserved on their principal proteins, i.e. core protein I envelope glycoprotein gp110 and transipembrane protein gp41-43. This relationship makes it possible, for example, for the prototype LAV strain to be used as a strain of antigens for detecting antibodies against all HIV-1 class viruses, in all people who carry them, regrdless of their origin. This strain is hence currently used for detecting anti-HIV-1 antibodies in blood donors and patients, in particular by immunofluorescence and in parlicular by the technique known as ELISA, "Western Blot" (or immuno-imprinting) and "RIPA", an abbreviation for Radioimmunoprecipitation Assay.

However, in a se ological study peformed with 3 an HIV-1 lysate on paierto Who originated from West l i 4 Africa, it was observed that some of them gave seronegative or very weakly positive reactions, whereas they showed clinical and immunological signs of AIDS.

The cultured lymphocytes of one of these patients were the source of a first HIV-2 retrovirus isolated, whose structure in electron microscopy and whose proteine profile in SDS gel electrophoresis show a resemblance to those of HIV-1. However, this new retrovirus HIV-2 possesses overall only a slight relationship to HIV-1, from the standpoint both of the antigenic homology of its proteins and of the homology of its gene- Stic material, This new retrovirus, or retroviruses having equivalent antigenic Lnd immunological properties, can hence constitute sources of antigens for the diagnosis of infection by this virus and the variants which induce an AIDS form of the type which had been observed in the initial instances in African ,patients or in people who had Spent time in Africa.

20 Typically, this virus was isolated from the blood, drawn in the presence of heparin, from a 28-yearold heterosexual patient who had never bean transfused and who was not a drug addict, Since 1983, he had had substantial chronic diarrhoea, and substantial weight loss (17 kg) with intermittent fever. More recently, he had had Candida and Serratia infections, including an oesophageal candidiasis typical of AIDS, This patient also had anaemia, cutaneous anergy, Lymphopenia and a T4 lymphocyte/T8 lymphocyte ratio of 0.15, with a T4 lymphocyte level of les: than 100 per mm 3 of serum, His lymphocytes in culture did not respond to stimulation with phytohanaeaggluitinin and concanaval in A. This patient was also diagnosed as suffering from recurrent bacteriaemia due to a, enteriditis, cryptosporidioses, infections due to Isospora belli a-'d cerebral toxoplasmoses.

1 c. I r~-u C This combination of signs was evidence of "complex symptoms linked with AIDS" or "ARC" (abbreviation for "AIDS-Related Complex"), of the type caused by HIV-1 virus. These various observations were also in conformity with the criteria applied by the Center of Disease Control (CDC) of Atlanta, USA.

The culturiny of the lymphocytes from these patients and the isolation of the retrovirus were performed according to the technique already described for the isolation of HIV-1 in the paper by BARRE-SINOUSSI et al, and European Patent Application n' 84/401.834 0.138.667. They are recalled briefly below. Lymphocytes stimulated for 3 days with phytohaemagglutinin (PHA) were cultured in RPMI 1640 culture medium to which 15 -5 5of foetal calf serum and 10 M p-mecaptoethanol, interleukin-2 and anti-(human interferon a) serum are added, The production of yirus was followed by its reverse transcriptase activity, In the culture supernatant, the peak viral activity appeared at between day 14 and day 22, and then decreased. The decline and death of the cell culture followed, As with HIV-1, sections of lymphocytes infected with HIV-2 showed, in electron microscopy, virions which had reached maturity, and viral particles budding at the surface of the infected cells, The cell lines used for producing the cultures of these isolated viruses can be, depending on the case, cell lines of the HUT, CE4 or MOLT type, or any immortalized lymphocyte Line bearing T4 receptors.

The virus was then propagated in cultures of lymphocytes trom blood donors, and then in continuous lines of leukaemic origin, such as HUT 78. It was then characterized by its antigens and its nucleic acid as being substantially different from HIV-1. The virus was purified as described in the prior documents already 6 mentioned, A first isolate of this virus was deposited with the CNCM1 on 19th December 1985 under n' 1-502. It was subsequently designated by the name LAV-II MIR. A second isolate was deposited with the CNCM on 21st February 1986 under n' 1-352. This second isolate .has the reference name WAV-II ROD. These isolates will sometimes be referred to later simply as MIR or ROD.

In a general manner, the invention relates to any variant of the above viruses, or any equivalent vi- Srus (fo example, such as HIV-2-IRMO and HIV-2-EHO, deposited with the CNCM on 19th December 1986 under n's 1-642 and 1-643, respectively), containing structural proteins which have the same immunological propeties as S* those of the HIV-2 viruses deposited with the CNCM under Sn's 1-502 or 1-532. The definitions of criteria of equivalence will be returned to later.

The invention also relates to a method for producing the HIV-2 virus or variants of the latter in permanent cell lines derived from T4 lymphocytes, or 20 lymphocytes bearing the T4 phenotype, this method consistig in culturing these lines which have been infected beforehand with HIV-2 virus and, in particular when the level of reverse transcriptase activity has reached a specified threshold, in recovering the amounts Sof virus released into the culture medium.

S A preferred permanent line for the purpose of culturing HIV-2 is, for example, of the HUT 78 cell type. An HUT 78 line infected with HIV-2 was deposited on 6th February 1986 with the CNCM under n" 1-519. Cula.k Sturing is, for example, carried out as follows The HUT 78 cells (10 /mi) are co-cultured Aith infected normal human lymphocyte (10 6 The culture medium is RPMI 1640 with 10 foetal calf serum. After to 21 days, a cytopathogenic effect is observed in the HUT 78 cells. The reverse transcriptase is assayed one iA

P:

rf~; 7 week after this observation, in the culture supernatant.

It is then possible to begin to recover the virus from this supernatant.

Another preferred line for culturing belongs to the lines known under the designation CEM.

The infection and then the culturing of the infected CEM cells can be carried out, in particular, as follows.

T4 lymphocytes infected beforehand with HIV-2 virus and uninfected cells of the CEM line are co-cultured for the time required for infection of the CEM, The culture conditions are then, moreover, continued in a suitable medium, for example that described below, and 5 when the reverse transcriptase activity of the infected 1 5 cells has reached a sufficient level the virus produced is recovered from the culture medium, In particular, co-culturing was carried out, under the conditions specified below, of human T4 lymphocytes which had been infected five days beforehand o with a strain of HIV-2 virus originating from a patient <hereinafter designated "ROD", on the one hand, and CEM, on the other hand.

se The infected T4 lymphocytes, activated beforehand with phytohaemagglutiini, proved to possess a reverse transcriptase activity of 5,000 cpm/10 normal T lymphocytes three days after the beginning of the infection, Culturing was continued until the measured reverse transcriptase activity reached 100.000 cpm in the supernatant. These T4 lymphocytes were then placed Sin contact with CEM cells (3 x 106 infected normal T lymphocytes) and reincubated in the following culture medium RPMI 1640 containing 2.92 mg/ml of L-glutamine, of decomplemented foetal calf serum, 2 ug/ml of Polybrene, 0,05% of anti-interferon-alpha serum, 100.000 ug/ml of penicillin, 10 ug/ml of streptomycin and 10.000 ug/ml of neomycin.

4

U'NT

Y

i 8 The culture medium is changed twice weekly.

The measurements of reverse transcriptase activity measured in the supernatant were as follows day 0 1.000 (background) on day 15 20.000 on day 21 :200.000 on day 35 1.000.000 A CEM culture infected with HIV-2 virus was 1 deposited with the Collection Nationale de Cultures de Micro-organismes (CNCM) of the Institut Pasteur under n' 1-537 on 24th March 1986.

A few characteristics of the antigens and nucleic acids involved in the structure of HIV-2 emerge 5 from the experiments carried out under the conditions 15 *described below, They will, in many cases, be better assessed by comparison with the same type of characteristics relating to other types of.retrovirus, in particular HIV-1 and SIV.

In that which follows, reference will be made to the drawings, in which Figures la, lb and ic relate to crossed immuno-precipitation experiments between sera, respectively, of patients affected with HIV-1 and HIV-2, and of rhesus monkeys infected with STLV-III, on the one hand, and viral extracts of HIV-1, on the other hand Figures 2a and 2b show comparative results for the electrophoretic mobilities of the proteins of HIV-1, tIV-2 and STLV-III respectively, in SDS-polyacrylamide gels Figure 3 shows the results of crossed hybridization between genomic sequences of HIV-1, HIV-2 and STLV-III on the one hand, and probes containing different subgenomic sequences of the HIV-1 virus, on the other hatd 9 Figure 4 is a restriction map of the cDNA derived from the RNA of HIV-2 ROD Figure 5 is a restriction map of an E2 fragment of the cDNA derived from HIV-2, this fragment containing a region corresponding to the 3' LTR region of HIV-2 Figure 6 is a nucleotide sequence of a portion of E2, this sequence corresponding to the U3/R region of H1IV-2 Figure 7 shows on the one hand, and schematically, structural elements of HIV-1 (Figure 7A) and, aligned with a region containing the HIV-1 3' LTR, the sequence derived from the E2 region of the HIV-2 cDNA, and on the other hand, the common nucleotides present, respectively, in the sequence derived from the E2 region of HIV-2 and in the corresponding sequence of HIV-1, placed in alignment at the cost of a number of deletions and insertions (fig. 7B); Figure 8 shows schematically the structures of several clones of a phage modified by several inserts originating from the cDNA derived from HIV-2 (clones ROD4, ROD27 and ROD35) sequences derived, in their turn, from ROD4, ROD27 and ROD35, subcloned in a plasmid pUC18, have also been shown schemetically in this figure, these latter sequences being placed to correspond with the regions of ROD4, ROD27 and ROD35 from which they respectively originate Figure 9 shows the relative intensities of hybridization between a/ eleven fragments removed from different regions of the complete HIV-1 genome (the fragments being shown schematically at the bottom of the figure), on the one hand, and the HIV-2 cDNA, present in ROD4, on the other hand, and (1 4 b/ fragments originating from HIV-2 with the same cDNA.

Generelly, the HIV-2 antigens used in the comparative tests, the description of which follows, originate from the HIV-2 MIR strain deposited with the CNCM under n' 1-502, and the DNA sequences derived from the genomic DNA of HIV-2 originate from the strain HIV-2 ROD deposited with the CNCM under n' 1-352.

I ANTIGENS, IN PARTICULAR PROTEINS AND

GLYCOPROTEINS

The virus initially cultured in HUT 78 was la- 35 35 belled metabolically with S]systeine and S]methionine, the infected cells being incubated in the presence of these radioactive amino acids in culture medium de- S void of the corresponding unlabelled amino acid, for a period of 14 to 16 hours, especially according to the technique described in the paper designated as reference (21) in the bibliography presented at the end of the 35 description, as regards the labelling with S]cystei- 20 2 The supernatant is then clarified and the virus then ultracentrifuged for one hour at 100.000 g on a cushion of 20% sucrose. The principal antigens of the virus separated by electrophoresis in a polyacrylamide gel under denaturing conditions (SDS), or in a gel composed of poly-acrylamide bisacrylamide with SDS final concentration). The following coloured markers are used as molecular weight references myosin 200 kd phosphorylase B 97.4 kd BSA 68 kd ovalbumin 43 kd a-chymotrypsin 25.7 kd 8-lactoglobulin 18.4 kd lysozyme 14.3 kd C C i i 11 Other molecular weight markers were used in other experiments. This applies, in particular, to Figures la, ib and Ic, which refer to other known molecular weight markers (under the letter M in these figures). The antigens are still more readily distinguished after immuno-precipitation (RIPA) or by ji.mmunoimprinting (Wastern blot), using the antibodies present in the patient's se, their apparent molecular 1 weights, determined by their apparent migrations, are very close to those of the HIV-1 antigens.

*i It is generally specified that, in the text which follows, the numbers which follow the designations and/or "gp" correspond to the approximate molecular weights of the corresponding proteins and/or glycopro- 15 teins, divided by 1000. For example, p36 has a molecular weight of the order of 36.000, It is, however, understood that these molecular weight values can vary within a range which can reach 10% or even more, depending Son the techniques used for the determination of these 20 moleculax weights.

Repetition of the experiments enabled the apparent molecular weights of the HIV-2 antigens to be determined more accurately. Thus, it was found that the Smolecular weights of the three core proteins, which had initially been assigned molecular weights of the order O* g*.0g of 13.000, 18,000 and 25.000, respectively, in fact had 0S apparent molecular weights closer to the following values 12,000, 16,000 and 26,000, respectively. These proteins are hereinafter designated by the abbreviations p12, p16 and p26.

The same considerations apply to the existence of protein or glycoprotein bands whose apparent molecular weights were assessed at values Which could range from 32.000 to 42.000-45.000. Repetition of the measurements finally enabled a band corresponding to an -j

I^

1 1 mm Im I m m I m 12 apparent molecular weight of 36.000 to be precisely defined. In the text which follows, this band is designated by the abbreviation p36. Another band at 42.000- 45.000 (p42) is consistently observed also. One or other of p36 or p42 probably constitutes a transmembrane glycoprotein of the virus.

A major envelope glycoprotein having a molecular weight of the order of 130-140 kd is consistently observed this glycoprotein is designated hereinafter by the term gp140.

It is appropriate to note that, in general, the molecular weights are assessed with an accuracy of t this accuracy even being capable of becoming a little lower for antigens of high molecular weight, as was fournd for gp140 (molecular weight of 140 t This group of antigens (when they are labelled with S]cysteine is only faintly recognized, if at all, by sera of patients containing anti-HIV-1 antibodies in the detection systems used in the laboratory or by the use of tests employing HIV-1 lysates, such as those marketed by DIAGNOSTICS PASTEUR under the name "ELAVIA" Only the p26 protein was weakly immunoprecipitated by such sera, The envelope protein was not precipitated, The serum of the patient infected with the new virus (HIV-2) faintly recognizes a p34 protein of HIV-1, In the detection system used, the other HIV-1 proteins were not recognized, In contrast, HIV-2 possesses some proteins which show some immunological relationsh. with comparable structural proteins or glycoproteins, separated under similar conditions from a retrovirus recently isolated from captive mLacaques of the rhesus species, whereas this immunological relationship tends to become obliterated for lbthe, proteins or glycoproteins. This latter retrovirus, which is presumed to be the aetiological agent of AIDS in monkeys, was designated by the 13 investigators who isolated it [bibliographic references (16-18) below] by the name "STLV-III For convenienmac ce of reference, it will be designated in the text which follows simply by the term "STLV-III" (or alternatively *by the term SIV, an abbreviation for "Simian Immunodeficiency Virus"), Another retrovirus, designated "STLV-III

AGM

or SIVAGM), has been isolated in wild green monkeys.

However, in contrast to the, virus present in rhesus monkeys, the presence of "STLV-IIIAGM does not appear to induce an AIDS-type disease in African green monkeys.

Nevertheless, the immunological relationship of the structural proteins and glycoproteins of HIV-2 on the one hand and the STLV-III and STLV-III M retro- 15 mac AGM viruses on the other hand, and consequently the relationship of their nucleic acid sequences, remains limited. Experiments have enabled a first distinction to be established between the retroviruses capable of in- S. 20 fecting man or monkeys the following emerges lips The HIV-2 virus does not multiply in chronic S| fashion in the lyphocytos of rhesus monkeys when it has been injected in vivo and under working conditions Which permit the development of the STLV-III virus, as have mac been described by N. L, Letvin et al,, Science (1985), S vol. 230, 71-75.

This apparent inability of HtV-2 to develop in monkeys under natural conditions enables the HIV-2 virus, on the one had, and the STLV-III virus isolates, 3 on the other hand, to be differentiated biologically, Employing the same techniques as those recorded above, it was found that it was also possible to obtain the following from STLV-II a principal p27 core protein, having a molecular weight of the order of 27 kilodaltons, a major envelope glycoprotein, gp140, kSI 14 4 p 32 protein, probably transmembrane,' which is not observed j,n RIPA when the virus has been labelled beforehand with C 3 S]cysteine, but which can be observed immuno-imprinting experiments (Western bloats) in the form of broad bands.

The major envelope glycoprotein o~f HIV-2 has proved to be immunologically closer to the major envelope glycoprotein Qf STLV-IIX than to the major envelope glyco-protein of HIV-1, These findings appl not only in respect of the rnol,ecular weights, 130-140 kilodaltons for the major glycopxotein5 of H-IV-2 and STLV-III compared with approximately 110 f or the major envelope glycoprotein of HIV- 1, but also in respect of the immunological properties, *since sera drawn from. patients infected with HIV-2, and more especially antibodies f~ormned against the HIV-2 gpl4Qt recognize the STLV-III gp140 whereas, in comparable experiments, the same sera and the same antibodi 'es to HIV-2 do not recognize the HIV-1 gp1.10. However, anti-hiv-2 do not recognize the HIV-1 gpllO, However, ti-HIV-1 sera which have never reacted with the HIV-2 gpl4Os precipitate a C 3 Sj]cysteine- labelled 26kd protein present in extracts of tiIV-2.

I'h- major core protein of HIV-2 appears to ag* so. have an average molecular weight (approximately 26,00Q) intermediate between that of the !IIV-1 p25 and the p27 of STLV-Ill These. observations are derived from expe-riments carried out with viral extracts obtained from HV-2 isolated from one, of the abovementioned patients, similar results have been obtained with viral eKtracts of HIV-2 isolated from the second patient,.

Cells infected, resp~ectively, with HIV-1, HIV-2 and STLV-111 were incubated in a medium contaiing 200 p Ci/mi Of I 3S]cysteine in a medium free from unlabelled cysteine for 16 hours. The clarified supernatants were centrifuged at 60.000 g for 90 minutos. The pellets lysed in an RIPA buffer immunoprecipicated with different sera and then subjected to electrophoresis on polyacrylamide gel, charged with sodium dodec-yl sblphate The, results observed are illustrated by figula, lb and 1c, Figure la shows the observed results of imtnuna-precipitati"on between a viral, extract of HIV-1 obtaiied from a CEM C1,13 cell line and the following sera, respectively': -anti -H.r'1 -lps itive serum (band 1), *serum obtained from the first patient mentio- So* ned above (band 2), e srq m of a healthy Afrlican carrier of anti- H.IV-1 antibodies (band 3)1 off* 000"- serum obtained f rom a macacQue infec,ed with STLVIII (band 4) and -serum of thie second patient mentioned abo~ve (band In Figure ib, t:here are recorded the observed results of immunoprecipitation between the HIV-2 ant4.- $*too* 25 n obvained from the first patient, after prior coltu- *6 a re With HUT-!8 cell,., And different sera( more especiaLlly the senum cf the abovementioned first patient (band the an.ti-HIV-1-psitive serum (band the serum of, the macaque infected with STLV-III (band 3) and the serum Qt the abovementlioned socond p~uient (band 4), Finally, Figure 1c illustrates the o bserved resul ts o f immunoprtecipitation betzween the antigens of An STLV-1IXI isolate pbtained from a macqqUe having 4.

simian AIDS The sera used, to which -the bandis 1 to refer, are the same as those recorded above in relation to Figure la,

I

16 I M refers to the markers myosin (200 kd), galactosidasc. (130 kd), bovine serum albumin (69 kd), phosphorylase B (92}cd), ovalbumin (46kd) and carbonic anhydrase (30 kd).

Figures 2a and 2b show comparative results for the electrophoretic mobilities of the proteins of HIV-1, HIIV-2 and STLV-1EI.

Figure 2a relates t~o the experiments carried out with extracts of virus labelled with 3 Sjysteine, immunoprecipitation on ISDS-PA(3E. The different **bands relate to the following virus extracts zvirus obtained from patient 1 and immunoprecipitated by the serum originating from the same patient (band 1), es extract of the same virus immunoprecipitated with a egative control serum originating from a person not carrying anti-HIIV-l or anti-HIV-2 antibodies (band2), extract of STLV-III virus imiunoprecipitated with a serum originating from a macaque infected with STLV-I1.t (band immunoprecipitatxon. observed between extracts of te samevirusand a negative control serum (band4) and extract of I-IV-1 immUnoprecipitated with the serum *.of a European, patient infected with AIDS, Figure lb shows the results obtained in Wetrnbo (immuno-imprinting) experimonts, Cell lysates originating from uninf ectec or infected HUT-7$ cells were subjected to electrophoresis on SDS-PAGEt and then transferred electrophoretically to a nitrocellulose fi1ter before being reacted with the serum of the abovemention d. first. patient (serum diluted 1/100), The ni,filter was then washed and the detectiori of the hound antibodies v1i ,alized with, 2 I-labelled goat atiti-hUman 1GO.

The spot$ observed in,' bands 1, 2 and 3 relate( espectively, to the agglutination experiments botween 354 17 te'abovementioned serum and extracts of unirifPec1,t1d HUT- 78 cel~ls (band. extracts of HUT-78 cells infected with an EiIV-2 virus (band 2) and extracts of HUT-78 cells infected with STLV-III (band, 3) The numbers which appear in the margins beside each of the bands correspond to the approximate molecular weights of the most representative viral, proteins (molecular weights in kilodaltons).

11 NUCLEIC ACIDS The RNAs of the HiV-2 retrovirus The RNA of. the virus, deposited on a filter accc,-ding to. the "spot blot" technique, did not hybridize, urndet~ stringent conditions, with the DNA of H-IV-1.

By "5tringent conditions", there are understood* the cond~itions under which the hybridization reaction between the RNA of the HIV-2 and the chosen probe, radio-active,y. labelled with 32pl(or labelled in a different manner) Xollowed by ~the washing of2 the probe, 2 0* are carried out, The hybridization, on a membrane, is *carried out at 42*C in the presence of an Aqueous solution particularly of 50% forM.AMide (volumie/volume) in 0,1% SDS/5X $SC for 18 hours. The membrane on which the hybridization reaction has been carried out is then washed at W5C in a buffer containing 0.15% of SOS and f 011 X SSC.

.By itnon-stringent Qc~nditions", ther, are understood, tL conditions under which the hybr3.'ization reaction and the washing are carried out The h ybridiis cartied out by bringing into cuntaczt with the chosen probe, labelled with 321 (or otherwise labelled), name:ly at 42'c in a 5 X SSC buffer, 0.1% SDS; containing of tormamide for 18 hours, The washing of the memnbranie is carried out at 50'C with a buffer containilig 350.1% of SOS and R X SSQ.

Hybridization experiments were also carried vector pUC18. Under non-stringent conditions, only very out with a hybridization probe consis(ing of a recombinant plasmid pBT1 obtained by cloning the DNA of HIV-1 originating from AJ19 (Cell 1985, vol. 40, p. 9) in the vector pUC18. Under non-stringent conditions, only very .weak hybridization was observed between the RNA of HIV-2 and the cloned DNA derived from HIV-1.

Other probes containing cloned sequences of HIV-1 were used 0 a/ single-stranded probes of subgenomic DNA of HIV-1, produced from subclones of the HIV-1 genome and inserted in phage M13. The cloned regions related to the protease gene or the kendonuclease" gene.

Only one probe of the endonuclease region of 5 HIV-1 (nucleotide sequence between bases n's. 3760 and 4130) gave a weak hybridization under non-stringent conditions with HIV-2. The "protease" probe (HIV-1 nucleotide sequence between bases n's.'1680 and 1804) did not hybridize even under non-stringent conditions with to&* 20 HIV-2.

2O s .e b/ A probe pRS3, consisting of the sequence coding for tha "envelope" region of HIV-1 (subcloning in pUC18) did not giva hybridization under non-stringent conditions with HIV-2, The "spot blot" technique is also known as 25 "dot biot" (transfer by spots).

0* Further results of hybridization betwefrn gr nomic RNAs of HIV-1, HIV-2 and STLV-III, on the one hand, and probes containing different subgenomic sequences of the HIV-1 virus, on the other hand, appear in Figure 3.

The supernatants of the different culture media (in the proportion of 0.5 to 1'ml for each spot) were centrifuged for 5 minutes at 45,000 revolutions per minute the pellets were resuspended in an NTE buffer containing 0.11 of SDS and deposited on a nitrocellulose 19 f ilter. The latter was, pre-soaked in a 2 x SSC medium (0.3 M NaCl, 0.03 M sodium citrate). After baking (for 2 hours at 80*C), the filters were hybridized with various contr.aining gcnomic sub-f ragments of HIV- 1, under non-stringent conditions (30% formamide, 5 X SSC, washed at 50'C with a 2 X SSC solution containing 0.1% of SDS and then autoradiographed for 48 hours at with enhancing screenrs.

The probes 1-4 are 5ingle-stranded probes obtained by the "prime cut' method, as described in Briefly, the single-stranded fragments originating from *the M13 virus and bearing 5ubgenomic HIV-1 inserts were ligated to oligomeric fragments (17 nucleotides) originating from M113 (BIOLABS). The complementary strand *,was then synthesized with Kienow enzyme in a TM buffer mM Tris, pH 7.5, 10 mMMgc~l) inte tence of 32 dATP, dGTP, dTTP and dCTB, Idbelled with P at the alpha-position (Amersham, 300Q C i/ mmo1), The DNA was sees. 2 then, digested with the appropriLate restriction enzymes, .6.;..heat denatured and subjected to electrophoresis on a denaturing polyacrylaniide gel (containing 6% of acrylamide, 8 M ure4 in a TDE buffer). The gel was the-_n autoradiographed 2'or 5 minutes. The probLe was tl24n cut out and eluted in a 300 mM NaCi., 0,1% SDS buffer, Specific too$ 2511 o 0 activities (SA) of these single-stranded probes were estim~ated at 5 x 108 10~ disintegrations per minute/miCrogram (dprn/ug), The characteristic :sequence,- present in the dif f egnt probes werc as followst 3iProbe 1 znUcleotides 990-1070, Probe 2 nucleotides 980-1260, Probe 3 tnucleotides 2170-2240 Probe 4 1,nucleotides 3370-3640, The numbering of the above nualeotides are those, envisag~ld in the paper under reference

TFA

ILastly, the probe 5 consists of a plasmid pUC18 bearing the EcoR1-Sac fragment of the HIV clone in AJ19 which was subjected to nick translation to obtain an SA of approximately 108 dpm/pg.

The relative arrangements of the subgenomic fragments present in the probes with respect to the whole HIV-1 genome are shown schematically in Figure 3.

The different spots correspond, respectively, as follows: spot A a virus is obtained from a culture of CEM C1.13 cells infected with HIV-1, spot.B a viru, is obtained from HUT-78 cells infected with STLV-III, 0O of ee 15 spots C and D isolates obtained, respectively, from the..viruies of the abovementioned two African patients, S-spot E negative contrbl cell extract obtainPd from uninfected HUT-78 cells, 20 spot F virus obtained from a patient from 20 Zaire suffering from AIDS, which had been cultured in normal T lymphocytes in the presence of TCGF, 0* All the spots were obtained with an amount of virus corresponding to 25,000 dpm of reverse transcriptase activity, except for the spots C 15,000 dpm.

The following observations were made 000 O* The genomic RNAs of the two HIV-2 isolates obtained from purified viral particles did not hybridize with any of the probes under the strihgent conditions described above, although the viral particles were isolated and purified from culture supe.natants of highly infected cells showing evidence of high reverse transcriptase activity.

Under the non-stringent conditions described above, the following observations were made all the i ~j

I:/

21 probes hybridized intensely with the geiomic RNAs obtained from the control HIV-1 preparations and from another isolate obtained from a patient from Zaire suffering from AIDS.

Two of the probes obtained (nucleotides 990- 1070 and 990-1260, both originating from the gag region of HIV-1) hybridized slightly with the spots from extracts of the HIV-2 retroviruses only one of these two probes (nucleotides 990-1260) 'also showed slight hybridization with the STLV-III spot (Figure 3) As regards the probe containing a fragment of the pol region (nucleotides 2170-2240), hybridization was observed with SSTLV-III and, albeit much more weakly, with the RNA of HIV-2. The other probe of the pol region (nucleotides 15 *ee 15 3370-3640) did not give hybridization with any of the HIV-2 and STLV-III spots.

Lastly, the probe modified by nick translation and containing the entire env gene and the LTR (nucleoe g.

I 0 tides 5290-9130) of HIV-2 did not hybridize either with 20 S the RNAs of STLV-III or with those of HIV-2.

s e It will also be noted that anoter probe which contained the 5' end of the pol reading frame of HIV-1 (corresponding to the protease region) did not hybridize either with the RNAs of HIV-2 or with the RNAs of STLV- 0 C. III.

0 S It consequently also results from the foregoing that the HIV-2 virus appears more remote, from the structural standpoint, from the HIV-1 virus than it is from STLV-III. HIV-2 nevertheless differs significantly from STLV-III, which bears out the different results observed in respect of the infective CapAcities of the HIV-2 vruses, which are virtually nil in monkeys, compared wjith the unquestionable ineffective capacities of STLV-III viruses in these same specites of monkeys.

NT Q i

:P:

22 The restriction maps and the genomic RNA sequences of HIV-2, or of the cDNAs obtained from these gnomic RNAs are accessible to those versed in the art, since the strains of HIV-2 deposited with the CNCM can, after suitable multiplication, provide him with the genetic equipment required for the determination of these restriction maps and nucleotide sequences. The conditions under which the restriction map of the genome of one of the HIV-2 isolates of this invention were established, and the conditions under which certain portions of cDNA derived from these genomes were sequenced, are described below.

The restriction map of the genome of a retrovirus which is representative of HIV-2 retroviruses is shown in Figure 4, The restriction map of a substantial fragment of this cDNA is shown in Figure 5, Finally, a portion of this latter fragment has been sequenced.

This sequence, and a ,number of the restriction sites which it contains, cre shown in Figure 6. The cloned whole cDNA or cloned fragments of this cDNA can themselves be used as specific hybridization probes, 0 2/ cDNA and fragments of this cDNA derives, respectively, from the RNA of HIV-2 The conditions under which the abovementioned 25 cDNA was obtained are described' below, The first stage of manufacture of this cDNA comprised the production of an oligo(dT) serving as a primer or of ar, initiator cDNA strand, by carrying out an endogenous reaction activated by a detergent, using the reverse transcriptase of HIV-2, on purified virions obtLined from supernatants of infected CEM cells. The CEM cell line was a lymphoblastoid CD4 cell line described by' G.E.Foley et al, in Cancer 18 522-529 (1965), which is considered to be incorporated herein by reference These CEM cells used are infected with an ROD reference. These CEM cells used are infected with an ROD x 23 isolate, which was shown to produce substantial amounts of HIV-2 continuously.

After the synthesis of the second strand (in the presence of nucleotides and a bacterial DNA polymerase), the double-stranded cDNAs were inserted into a bacterial phage vector M13 TG130. A phage library of recombinant M13 phages was obtained and subjected to an in situ screening with an HIV-1 probe. The latter con- Stains a 1.5 kb fragment originating from the 3' end of the cDNA derived from the RNA of the LAV isolate (shown *in Figure 7A), Approximately 50 positive plaques were detected, purified and characterized by crossed hybridization of the inserts and sequencing of the ends.

I This procedure enabled different clones to be S" 15 isolated, containing sequences approximately complementary to the 3' end of the polyadenylated RNA of the LTR [abbreviation for "long terminal repeat" of HIV-1, described by S. Wain Hobson et al. in Cell 40 9-17 I (1985)] region, considered to be incorporated herein by 20 reference.

I The largest of the inserts of the group of M13 clones in question, which hybridize with the 3' LTR region of HIV-1, is an approximately 2 kb clone designated E2, Like the 3' LTR region of HIV-1, the clone E2 con- 25 e* tains an AATAAA signal situated approximately 20 nucleotides upstream from a poly(A) terminal portion, and a 3' LTR region corresponding to that of HIV-2. After partial sequencing, this 3' LTR region of HIV-2 proved to possess a distant relationship with the homologous region of HIV-1.

Figure 5 is a restriction map of the fragment of E2 (elongated rectangular area) incorporated in plasmid pSPE2 which contains it. It comprises part of the R Sregion and the 03 region of HIV-2. The drawing does not t show the boundaries of the R and U3 regions.

T OY i ween the 3' LTR regions of HIV-1 and HIV.2 is illustrated in Figure 7. In effect: only approximately 50% of the nucleotides of the two LTR sequences can be placed in alignment (approximately 50% sequence homology), at the cost of some insertions or deletions. In comparison, O* 24 Ththe sequee mologsequence of the corresponding region Figure the different variant Amerific restriction sites are indicated therein, The small degree of relationship between the 3' LTR regions of HIV-1 and HIV'2 is illustrated 'in Figure 7. In effect, only approximately 50° of the nucleotides of the two LTR sequences can be placed in alignment (approximately 50Q sequence homology), at the cost of some insertions or deletions. In comparison, the sequence homology of the corresponding regions i-; the different variant American and African isolates of HIV-1 is greater than 95', without insertion or dele- S tion.

oO- The clone E2 was used as a specific probe for HIV-2, for the identification on a hybridization filter of the sequencesoriginating from HIV-2 and present in other clones, This probe also detects the genomic RNA of HIV-2 under stringent, conditions. It likewise permits f 20 detection, by the so-called "Southern blot" iiethod on 20 the DNA of CEM or similar cells infected with an ROD isolate or with other HIV-2 isolates. No signal is detected under the same stringency conditions in tests of hybridization of this probe with cDNAs originating from uninfected cells or from cells infected with HIV-1.

I 25 These results confirmed the exogenous nature of HIV-2 with respect to HIV-1. An approximately 10 kb species, probably corresponding to the non-integrated viral DNA, was detected as a principal constituent in the undigested DNA of cells infected with HIV-2. Anoter DNA having an apparent size of 6 kb, possibly corresponding to a circular form of the viral DNA, was also detected, The other portions of the HIV-2 genome were also identified. For this purpose, a genome library was constructed in phage lambda L47. Phage lambda L47.1 has been described by W.A.M. Loenen et al. in Gene 10 249- 259 (1980), which publication is considered to be incorporated herein by reference.

The genome library is constructed with fragments obtained by digestin of the DNA originating from the CEM cell line infected with HIV-2 ROD, after digestion with the enzyme Sau3AI.

Approximately 2 x 106 recombinant plaques were 1 screened in situ with a clone containing the labelled E2 insert of the HIV-2 cDNA. Ten recombinant phages were detected on plaques and purified, The restriction maps of three of these phages, characterized by their capacity for "Southern blot" hybridization with the E2 insert under stringent conditions, as well as with subgenomic probes of HIV-1 under non-stringent conditions.

A clone bearing a 9,5 kb insert and derived from the whole circular viral DNA, containing the complete HIV-2 genome, was identified, It was designated "Lambda ROD The other two clones, Lambda ROD 27 and Lambda ROD 35, derived from integrated proviruses, bear LTR sequences of the viral coding sequences and adjacent cell DNA sequences, The different sequences are shown in Figure 8.

25 Fragments of the Lambda clones were subcloned in plasmid vector pUC18. The fragments originating from A ROD 4, A ROD 27 and A ROD 35, and subclones respectively, in the abovementioned plasmid vector, are also seen in Figure 8, The following sublclones were obtained: 0 pROD 27-5, derived from Lambda ROD 27, contains a 5,2 kb region of the HIV-2 genome and adjacent cell sequences LTR and 5' coding viral sequence around an EcoRI site); pROD 4,8, derived from Lambda ROD 4, contains an appro ately 5 kb 35 fragment. This fragment an approximately 5 kb HindlIt fragment. This fragment 26 corresponds to the central portion of the HIV-2 genome; pROD 27-5' and pROD 4.8 contain HIV-2 inserts chich overlap each other; pROD 4.7 contains a 1.8 kb HindIII fragment of Lambda ROD 4; this fragment is placed in the 3 direction with respect to the subcloned fragment in pROD 4.6, and contains approximately 0.8 kb of coding viral sequences and a portion situated between the BamIII and HindIII cloning sites of the left arm of phage Lambda (Lambda L 47,1 pROD 35 contains all the HIV-2 coding sequences in the 3 direction with respect to Lth EcoRI site, the 3' LTR end and approximately 4 kb of adjacent nucleotide sequences of cellular origin pROD 27-5' and pROD 35, present in E. coli HB 101, were deposited on November 21, 1986 with the CNCM under 1-626 and 1-633 pROD 4.7 and pROD 8, present in E. coli TG1, were deposited on November 21, 1986 with the CNCM, 2 respectively, under n's 1-627 and 1-628.

The complete HIV-2 ROD genome, the restriction map of which is seen in Figure 4, was reconstituted from pROD 35, lirearized beforehand with EcoRI, and pROD 27- The EcoRI insert of pROD27-5 was ligated in the cor- 2 rect orientation in the EcoRI site of pROD The degree of relationship between HIV-2 and the other human or simian retroviruses was assessed by mutual hybridization experiments. The relative homology between the different regions of HIV-1 and HIV-2 genomes Swas determined by tests of hybridization of fragments oR 30 originating, respectively, from cloned HIV-1 genome and from radioactively labelled lambda ROD 4. The relative positions of these fragments (numbered from 1 to 11) with respect to the HIV-1 genome are seen at the bottom of Figure 9.

a major envelope glycoprotein, 27 Even under very low stringency conditions (Tm- 42*C), the HIV-1 and HIV-2 genomes hybridize only at the level of their respective g genes (spots 1 and 2), Sreverse transcriptase ,regions in Pol (spot end regions of pol, Q (or sor) genes (spot 5) and F or 3' orf) genes and 3' LTR (spot 11), The HIV-1 fragment used for detecting the first cDNA clones of HIV--2 corresponds to the subclone of spot 11, which hybridizes relatively well with HIV-2 under non-stringent conditions. A signal originating from spot 5 is the only one which perists after stringent washing. The envelope gene, the tat gene region and part of pol appear to be highly divergent.

These data, as well as the sequence obtained with LTR (Figure demonstrate that HIV-2 is not (at all events, as regards its envelope) a variant of HIV-1.

It is observed that HIV-2 is more closely related to SIV [described by M. D. Daniel et al in Science 228 1201-1204 (1985)], which must be considered to be incorporated herein by reference] than it is to HIV-1, All the proteins of SIV, including the envelope protein, are immunoprecipitated by sera of patients infected with HIV-2, while the serological cross-reactivity of HIV-1 and HIV-2 is limited to the core proteins. However, SIV and HIV-2 can be distinguished by the differences mentioned above in respect of the molecular weights of their proteins.

As regards the nucleotide sequences, it is also noted that HIV-2 is related to SIV.

Furthermore, the characterization of HIV-2 30 also makes it possible to demarcate the region of the envelope glycoprotein which is responsible for the binding of the virus to the surface of the target cells and the subsequent internalization of the virus. The interaction takes place via the CD4 molecule itself, and it appears that HIV-1 and HIV-2 use the same receptor, 1L1 f-r ii

N

Thus, although there are large differences between the env g7nes of HIV-1 and 2, the restricted homologous regions of the envelopes or the two forms of HIV can be considered to be constituents of binding to a common receptor of T4 lyphocytes. These sites are called on to form epitopes bearing the immunogenicity of peptides which might be used to elicit in man a protective immuno.esponse against HIV viruses, Advantageous sequences for forming probes in hybridization reactions with the genetic material of patients carrying viruses or proviruses, in particular for detecting the presence of HIV-2 virus RNA in thoir lymphocytes, contain a nucleotide sequence resulting from the combination of 5 kb HindIil fragments of ROD 4 and E2 cDNA, The experiments can be carried out by all methods, in particular by the "Northern blot", "Southern blot" and "dot blot" techniques.

Further characteristics of the invention will 2 !so energe, without implied limitation, in the course of the description which follows of examples of identification of certain portions of the retroviral genome and of the production of a number of recombinant DNAs involving various portions of a cDNA derived from the retroviral genome of HIV-2.

EAMPLES

EXAMPLE I DNA probe, for use in kits for diagnosis of HIV-2 A cDNA complementary to the genome RNA, obtained from purified virions, was prepared by the following method The supernatant obtained after 48 hours' culturing of CEM cells infected with an HIV-2 ROD isolate of HIV-2 was ultracentrifuged, The centrifugation pellet rontaining the virion was centrifuged on a sucrose gradient to form a new centrif~ugation pellet, substantially by the same method as that described in European Patent Application 84/401,234 0,138.667, already mentioned.

The purified HIV-2 preparation was used for the synthesis of cDNA, employing an endogenous reaction activated by a detergent, In summary, the virioi preparation was added to a reaction mixture containing 50 mM1 Tris-HCL, 5 mM MgCI.

2 10 mM'DTT, 0,025% of the detergent marketed under the xiame TRITON, and 50 pM of each of the 4 deoxynucleoside triphosphates and an oligo(dT) initi 'ator, The reaction was carried out for 90 minutes at 371C, After extraction with phenol of the proteins present in the first reaction medium, the second cDNA chain was synthesized in the presence of RNAse, E.coli DNA polymerase 1 and the 4 deoXynucleotides 1 for 1 hour at 15*C and 1 hour at. 22*C, Blunt ends were qreated on double-stranded cDNA by the action of T4 PNA polymerasei All, the reagents for this. procedure are c-nmmercially available (AMERSHAM ctrhNA kit) and tqere used aprecommended by the supplier, After ligation of adapter~s (lirkers) containing an ggL4I, site (marketed, by PI-armacia) to t-he blunt ends of the, cDNA in the presence of a T4 DNA litgase (marketed by BIOLABS), digestion of theste linkers with tho rastriction endonucleaoie j~~4I and (3) remnoval of, tho linker f 4gments by gel f'ilt*,ation (gel marketed under thc name U3LTROGEL) on ACA 34 the eDNA is inserted in 4n M 13 TG 130 vetctoz.

cleaved with ~coRI, A library of cDNAs was obtained after transformation of E,coli strain TG1,, Approximately recombinant M13 plaques were olbtaiied, To select, in the cDNA library, recombinant ,13 clones containing the HIV-42 cONA, the Itechnique of i I plaque hybridization was used, The DNA of the M13 plaques was transferred to nitrocellulose filters and hybridized with subgsenomic HIV-1 probes derived from the "lambda J19" clone of an LAV (or HIV) virus decribed in the European patent application. This probe ontainod an insert consisting of a portion having an approximate length of 150C base pairs (bp) of HIV-1 DNA, This insert was bounded by two HindIII restriction sites, respectively, inside the open reading frame of the "env" gene and in the R segment of the 3' LTR end of HIV-1, This probe contained the 3' end of the env gene, the whole F gene, the U3 segment and a portion of the R segment of the LTR, having an approximate length of 1500 base pairs (bp) The probe contajning the 1,5 kg RId1.II insert was labelled with 32 P]-dCTP and -dTTP (3000 Ci x 1Q 3 mole) by incubating the probe in the presence of initiators and Klenow DNA polymerase I for 4 ho)rs -t (using an AMERSHAM kit), The tests of hybridization of the cDNA clones of the library were performed overnight under low stringescy conditions, in a solution of a hybridization medium containing 5 X SSC, 5 X Denhartf of formamide# 100 Pg/ml of denatured salmon sperm DNA and the labelled probe (2 x 10 7 cim with a specificity of O10 cpm/pg) at 37C The filtes were subjected to three washing stages, successively in the presence of thb three solutions who.-e compositions are stated ats follows t Washing n' It SXSSC 0.1% SDs at 25C' for 4x15 minutes ashing n' 2t 2XSSC, 0.1% SDSat 42'C for 2XV )'intes Washing n' J:0.1XSSC, c0,1i DS, at for 2x30minuP i'r Each washing is followed by autoradisgraphy of t~h 41'1ters, several positive Clones were detected after washing n' 1 and were still detected after washing 2 /1 1 However, all the signals disappeared aftez washing n' 3.

Thi:s indicates that the PQitivc* clones had only a weak relationship with the NIV-I genome, which was ieverthe- 7,ufficient to perform the abovementioned selection.

The positive clones were subcultured, redeposited an plaques and again hybridized with the same probe under the stringency conditions corresponding to washing n* 1.

Most of them were stil. 7ositive.

The clones were also selected using a total DNA probe under conditions of moderate stringency and by hybridization in 5 X SSC, 5 X Denhart and formamide, followed by washing in 1 X SSC, 0,1% SDS at NonCA of the previously positive clones was deand consequently did not corre ;pond to specific repeated DNA or to the cDNA of the ribosomal. RNA.

The positive M13 recombinant clones were cia.tured in a liquid medium and characterized az follows (1)Size of their irt,sertion; An M13 single-stranded type DNA was obtained from each individual clone, and the synthe,,.is of the second strand was performed with an M13 17-mer initiatjr sequence and the 1Klenow enzymiz, The inserts were excised vsing EcoRI (BOEHRINGER) and analysed by agarose gel electrophoteosis, The majority of tho inserts contained from 200 to 600 and 200 bp, with thc' exception of the clone designated E2,1f which had an approximate length of 2 kbp.

Analysis of the nucleotide s eUenc~e Several clones were parytially sequenced using the dideoxy method of Sanger et described in Proc.

Netl. Acad. Sci. 74:5463-7 (1977), which forms part of tne present description. Various independent c?,ofles contamned similar tucleotide sequences, with the exception Q the poly(A) chains at their 3' ends, the lengths of hich were different. These results demonstrate that Jli

'I

L

I __ii these cDNA clones were derived from the RNA template.

Detailed sequence analysis of these cDNA clones, including the 3' end of the HIV-2 genome, showed a limited relationship with HIV-1.

Hybridization with the qenomic RNA and DNA of HIV-2 Production of the genomic RNA of HIV-2 An infected supernatant was centrifuged (50.000 revolutions, 30 minutes). The pellet of the deposit was resuspended in 10 mM Tris pH 7.5: 1 mM EDTA, 0,1% SDS. One of the insertion clones, F1.,1, was labelled and used as a probe for hybridization with the genomic RNA of different viral isolates, according to the "dot-blot" technique.

1 f The "dot-blot" t-echnique comprised the following stages Depositing the sample ,HIV-2 lysate) in spots nn a nitrocellulose menbrane soaked beforehand in 20 X SSC (3 M NaCl, 0.3 M sodium citrate) and dried in the air, (ii) baking the membrane for 2 hours at 80C, and (iii) performing the hybridization, This hybridization was performed under high stringency conditions (5 X SSC, 5 X Denhart, 50" formamide at 42'C). It was followed by washing in 0.1 X SSC, 0.1% SDS at 5'C, Under these conditions, the probe hybridizes strongly to the spots originating from two independent isolates of HIV-2, including LAV-II ROD, fron which the cloned cDNA originated, A weak hybridi- ;ation signal was detected with the spot formed by STLV- S II mac [Simian T-lymphottopic Virus (also known as type III macaque], and no hybridization was detected with the HIV-1 isolates, The "Southern blot" experiments, employing the clone E2.1 containing the 2 kb insert as a 32P-labelled probe, did not revecl any hybridization with the DNAs of 46 cells. rt has a reverse transcriptase activity which 2. 33 uninfected cell1s, but detected bands in detached cells infected with HIV-2, under high stringency conditions.

HIV-2 shows polymorphism at levels of its restriction which are equivalent to those of the restriction maps of H-IV- 1 With the complete- cellular DNA of infected cells, two types of signal are detected by the Southern blot" method in DNA fractions having molecular weights MW of approximately 20 kb and more, i,,i case of integrated forms Iof the virus, and in virus not integrated in the genome.

These characteristics are highly specific to a retrovirus.

Some experiments performed with STLV-III (Slyfrom infected cells enabled it to bt: established that the simian retrovirus is relativ..-,ly distant from H-IV-2 the signal Ls detected exclusively under low stringency conditions), These experiments show that the abovementoo* 4 55 tioned probes permit the specific detection of HIV-2, *0 Subcloninq of the cDNA of HIV- in a bacterial Plasmid vector GO GS The positive M13 clone, E 2.1, was selected and subcloned in a plasmid vector, Thp DNA of the recombinant M 13 (TG 130) phage E 2 was purified in the form lao 25 AGOO, 0of a single-stranded DNA (M-I32-QD-E2) containing the :09if 2 kb insert contai-ning the 3' portibQr cf the HIV-2 genome (obtained from HIV-2 ROD), This insert w~.s transfetred to plasmid r.3P65, described by Me~ton, D.A. in 357 Nucleic Acid Res. 12,035-7056 (1984).

A second chain was constructe~d in vitro in the presence of the 17-nier initiator sequenice (AMERSHAM), th, four nucleotides A, C, T, G, and DNA polymerase I (Kienow), The EcoRI insert. was excised by .E.QRI digestion and purified on agarose gel, and then ligated to 35pSP65 which had itself been digec~ted be,,forehand with 34 EcoRI. The ligation mixture was used to transform E.coli strain DH1, and recombinants were selected on the basis of their capacity for resistance to ampicillin. The recombinants identified were cultured on LB medium (Luria medium) containing 50 pg/ml of ampilillin. These recombinant plasmids were purified and monitored for the presence of the correct inserted fragment.

One of the clones obtained, designated by the reference pSPE2, was deposited with the CNCM in Paris, 10 France, under access n' I-595 on 5th September 1986.

The inserts derived from the cDNAs of HIV-2 oo'i. and which were present inserted in the abovementioned probe contained the nucleotide sequence which has been f defined above, in conformity with a part of E2.

15 EXAMPLE II Cloning of a cDNA compleme.itary to the DNA complementary to the genomic RNA of HIV-2 virions HIV-2 virions were purified from 5 litres of a culture supernatant from a CEM line infected with a ROD 20 e isolate, A first strand of cDNA was synthesized in contact with sedimented purified virus, in the presence of an oligo(dT) initiator and employing an endogenous reaction activated by a detergent, according to the technique described by Alizon et al., Nature 312, 757-760 25 *Moo* (1984). The RNA/cDNA hybrids were purified by extraction 0 with a phenol/chloroform mixture and by precipitation with ethanol. The second strand of cDNA was produced in the presence of DNA polymerase I/RNAse H, according to Sthe method described by Gubler and Hoffman The description in this paper is considered to be incorporteO herein by reference.

The double-stranded cDNA was provided with blunt ends in the presence of DNA polymerase T4, using the constituents of a cDNA synthesis kit marketed by

AMERSHAM.

r EcoRI adaptors (linker), marketed by PHARMACIA were attached to the end of the c:DNA the cDNA thereby modified was inserted, after digestion in the presence of EcoRI, into a dephosphorylated phage vector M13tg130 which was itself digested with EcoRI, also marketed by AMERSHAM. A cDNA band was obtained after transformation of E.coli strLin TG1. Recombinant plaques (104) were screened in situ on filters permitting replicas by hy- Sbridization with the clone J19 containing the 1.5 kb oooo *HindIII fragment mentioned above, originating from HIV- 1 The filters were prehybridized in the presence of a medium containing 5 X SSC, 5 X DENHARDT solution, 25% formaldehyde and denatured salmon sperm DNA (100 15 micro-grammes/ml), at 37"C for 4 hours, and then hybridized for 16 hours in the same buffer (Tm -42'C) in the presence of additional labelled probe (4 x 107 cpm), to provide a final hybridization buffer solution containing 6 10 cpm/ml, 20 Washing was carried out with a 5 X SSC, 0.1, SDS solution at 25'C for 2 hours (it being understood that 20 X SSC corresponds to a 3 M NaC1 and 0,3 M sodium citrate solution), The plaques which responded positively were purified and the M13 single-stranded DNAs were r 25 prepared and t.heir ends sequenced according to the method of Sanger et al, Hybridization of a DNA of cells infected with HTV-1 and HIV-2 and of RNAs of HIV-1, HIV-2 and of SIV virions, 3f respectively, with a probe derived from a cloned cDNA of HIV-2.

The DNAs were extracted from infected CEM cells continuously producing HIV-1 and HIV-2, respectively. DNA samples of these two retroviruses, digested in Ssome cases with 20 pg of PstI, and undigested in other cases, were subjected to electrophoresis on 0.8% agarose M NT 36 gel and transferred by the "Southern" method to a nylon membrane. Small volumes of infected supernatant, taken up in an NTE buffer containing 0.1% of SDS and having the same reverse transcriptase activity, were deposited on nitrocellulose which had been soaked beforeland in a 2 X SSC solution.

A prehybridization was carried out in a solution containing 50% of formamide, 5 X SSC, 5 X Denhart c and 100 mg/ml of denatured salmon sperm DNA, for 4 hours 10 at, 42'C. A hybridiztion was performed in the same buf- 6 fer, to which 10% of de.cranr sulphate and 10 cpm/ml of 9 E2 labelled insert (specific activity 10 cpm/pg) had been added, for 16 hours at 42'C. Two washings were then carried out with a 0,1 X SSC, 0.1% SDS solution for min each. After exposure for 16 hours to an intensifying screen, the Southern spot is dehybridized in 0,4 N NaOH, neutralized, and rehybridized under the same conditions 9 S• with the HIV-1 probe labelled with 10 cpm/pg.

EXAMPLE III S. Cloning in phage lambda of the complete DNA of the HIV-2 provirus The DNA of CEM cells infected with HIV-2 ROD (figure 2, bands a and c) is partially digested with

*@S

Sau3AI. The 9-15 kb fraction vAs selected on a 5-40% sucrose gradient and ligated to the BamHI arm of the lambda L47.1 vector. The plaques (2 x 106) obtained after in vitro packaging and deposition on E.coli strain LA 101 were screened in situ by hybridization with the Sinsert of the E2 cloned cDNA, Approximately 10 positive clones were purified on plaques and propagated in E.col1 C600 recBC. The clones lambda ROD 4, ROD 27 and ROD were amplified, and their DNAs characterized by drawing up their restriction maps and by hybridization by Southern's method with the cDNA clone of HIV-2 under stringent conditions and with the qaq-pol probes of HIV-1 T Al n

I

I- i i 37 under non-stringent conditions.

Figure 8 shows schematically the structures of 3 of the recombinant phages obtained, ROD 4, ROD 27 and ROD The elongated rectangular portions of these diagrams correspond to proviral sequences originating from the DNAs of the initially infected CEM cells, the clear portions corresponding to retroviral sequences, the shaded portions to portions of cellular DNAs and the black portions to the LTR in the said viral sequences, IJ The thin lines designated by the letters L and R correspond to the arms originating from the Lambda I L47.1 phage vector which was used for the cloning, 1 Some of the restriction sites have also been S. 15 indicated these are, more especially, thi4 following sites B BamHI E EcoRI H HindIll K Kpn Ps PstI Pv PvuII S SaI X XbaI.

These viral sequence have portions in common Swith the E2 sequence. The relative positions of these S portions, determined by hybridization with E2, are also seen in the figures, ROD 4 is derived from a circular viral DNA, ROD 27 and ROD 35 are derived from proviruses integrated in a cellular DNA structure.

2. Lastly, the inserts subcloned under the conditions described above, and their relative positions with respect to the corresponding ROD 4, ROD 27 and ROD sequences, are shown in these figures.

These are, more especially, the inserts of plasmids pROD 27-5', pROD 35-3', pROD 4.6, pROD 4,8 and pROD 4.7.

Figure 9 is a representation of the relative intensities of the hybridization spots Wnich were produced between RO-4 and sub-fragments 1 to 11 originating, respectively, from the different portions of a N A 38 single-stranded DNA originating from an M13 subclone containing a nucleic acid derived from the whole LAV genome. The relative positions of these various frag- Sments with respect to the whole LAV genome (determined by sequencing) are shown at the bottom of the figure, Point 12 corresponds to a control spot produced using a control DNA of the phage lambda.

The hybridization experiments in the spot transfer (dot blot) method were carried out under the i! low stringency conditions of Example II using, by way of Sa probe, the lambda ROD 4 recombinant containing the total cDNA of HIV-2, The washings were then carried out successively under the following conditions 2 X SSC, 0.1% SDS at 25'C (Tm-42'C), 1 X SSC, 0.1% SDS at 15 (Tm-20'C) and 0.1% x SSC, 0.1% SDS at 60'C (Tm-3C).

The "spofs shown were obtained after radiographic exposure overnight, EXAMPLE IV In vitro diagnostic test for the presence of HIV-2 virus 20 in a biological medium MATERIAL AND METHODS Patients HIV-2-infected patients were recruited among else individuals visiting the Egas Moniz Hospital in Lisbon 25 25' either for hospitalization or for consultation, between September 1985 and September 1986. For this selection, all individuals of African origil, or having stayed in Africa underwent a serum test for antibodies against both HIV-1 (Immunofluorescence -IFA- and/or ELISA) and HIV-2 (IFA), Only those patients who were proved serologically to be infected with HIV-2 were included in the study.

Virus isolation In 12 patients, HIV isolation was attempted as described, Briefly the patients' peripheral previously described, Briefly, the patients' peripheral 1 I ~39 blood lymphocytes (PBL) were stimulated with PHA, cocultured with normal human PHA-stimulated PBLs and maintained in the presence of interleukin-2 Culture s monitored for the presence of cytopathic effect (CPE) and for reverse transcriptase (RT) activity in the supernatant.

Immunofluorescence assay (IFA) IFA slides were prepared as follows -HIV-2infected MOLT-4 cells were washed twice in PBS and laye- 4 red onto IFA glass slides (10 cells/well), air dried *and fixed with cold acetone. For IFA these cells were -reacted with a 1/10 dilution of, the test serum for so 0 minutes at 37*C, washed, dried, and reacted with a fluogoat antihuman IgG, A, MI (1/1030 diluted) for 30 minutes at 37*C. After washing, cells were counterstained in 0,006% Evans blue, mountedi in 90% glycerol, 10% PBS and examined under a fluorescence microscope.

0 see a Some patients' sera 4ere examined for antibodies to HIV-1 using the commercially available serum to tests ELAVIA (Pasteur Diagnostics) or ABBOTT, Radioimmunopreci pitation assay (RIPA) HIV-1 o)r HIV-2 infected CEM cells were cul- *tured in the presence of 35 cysteine (200 microCi/il) SW S :or 16 hours. The supernatant was collected, viral Paztidles were pelleted and lysed in RIFA buffer (Trin-HCL mM pH 7,5, NaCl 150 mM, EDTA 1 mM, 1% Triton MOO0, sodium deoxycholate SDS For each reaction, microlitres of a dilution of lysate corresponding to 5 cpm was reacted with 5 microlitres of test serum for 18 hours. at 4*C. Immune complexes were bound to Sepharose-protein A (PHARMACIA), washed, and eluted by boiling for 2 minutes, Eluted antigens were then analysed SOS -polyacryl -amide gel electrpphoresis and autoradiography.

r3 Dot-blot hybridization Virus isolated from patients' PBLS were pelleted and lysed in Tris-HCL 10 mM pH 7.5, NaCi. 10 mM, EDTA 1 M SOS 0.510. One microlitre of each lysate, corresponding to 50,000 cpm of RT activity, was dep;osited onto nitro-cellulose. Hybridization and washing were conducted in high stringency conditions :hybridization in 6 X SSC, 5 X Denhart, 500, formamide, for 18 hours at 1042 *C ;and washing in 0,1 X SSC, 0,1% SDS at 65*C, W: 32 u:e us ed HIV- 1 and HIV-2 probes, ~P label I td to a specifi.

actvit of 1 8cpm/microgram, The HIV-1 probe corresoee*ponds to the complete genome of, the LAV BRU isolate, and HIV-2 probe was derived from a 2 kilobases cDNA clone from LAV- 2 RO isolate, sees RESULTS ,Patient. population Thirty patients with serological and/or virologic evidence o f HIV-2 infection were studied, They 12 males and 18 females, The mean age was 35, ranging 11-55. All patients, except one, have stayed for several years ikk West Africa :26 were born and living Sin Guinea-Bissau and 2 were originating from the Cape 'Verde Islands, One patient was an 11-year old boy from 5An~gola who had lived in the Cape Verde islands for sevexal' years. The only European in, the stiidy popul, tion *was a 40O year-old Portuguese man who had lived for 8 years in Zaire, and denied any sitay in West Afri(', Clinical presentation Among the 30 patients 17 had AIDS, according to the CDC criteria. The major symptomi in these patients was chronic diarrhoea, together in most cases witha weliqht loss of more than 10 kilogramz in a year. in patients the diarrhoea was found to be associated with 3the ptosence of an intestinal opportunistic infection; in 7 catses the pathogen was tsospora bethi alone, one patient had Cryptosporidium alone and 2 had both pathogenis, In 3 cases no opportunistic intes tinal. pathogen was f ound. Among all 17 AIDS cases, oesophageal. candiwas diagnosed in 8. Six AIDS patients h-ad respirator? symptoms. Pulmonary tuberculosis was diagnosep in 2 and another unidentified mycobacterium was found in one. Two patients had pulmonary aspergillosis, one following a tuberculosis. Two other AIDS patients had ro-current episodes of pneumonitis with no pathogen identified, and one patient had Pneumocystis carinji pneurnorlia, which was only diagnosed post mor tem. Four osf the 17 AIDS patients had Kaposi's sarcoma :in 3 cases it 0 0 appeared limited to the skin, and in one patient postexamination revealed disseminated visceral lesions, Central nervous system disorders wore fou~nd in 2 AIDS patients :one had cerebral lymphoma, anil the other had subacute encephalitis of unknown cause, Four patients were presenting with the symee.ptoms of the AIDS-related compl1exc (ARC) ;two had diffuse lymphadenopathy with persistent fever, one had see 6chronic diarrhoea with weight loss, anid otie had recurrent epi.~cdes of bronchopneumonia antd multiple lymphadenopathies, Amolig the 9 remai ning patients, 6 had no symptoris that~ could be considered as related to HTV infection, one fifi pulmonary tuberculosis alone, one had persistent diffuse lymphadenopathy alone, anO one presente6 with neurologic syphillis, During the 12 months$ pperiod of the study 7 patients died, all presenting With

AIDS,

Serologrical studiesz Each patient had at least one serum test for antibodies to both H-IV-1 and tiIV-2, All patients' sera tested by IFA for antibodies to HXV-2, and all were positive- Among them, 21 were also tiessted tr antibodies 42 t: HIV-2 b y RIPA all clearly precipitated the highmolecular weight envelope glycoproteii of the virus, termed gp 140, and 16 of them also reacted with the major core protein p26, whereas only one reacted with Another viral core protein, termed p16.

The sera were evaluated for the presence of cross-reacting antibodies to HIV- 1 using different assays, An IFA test was usc'd in 24 sera ;12 were nega tive, 1Q were weakly reactive, and 2 were positive. In ELISA, 21 were tested :16 were negattLve, and 5 were positive. Finally, 11 sera were ttested for antibodies tr, HIV-1 proteins by RIPA, Three! failed to react with any *.viral protein, 2 only precipitated the pol gene product p34, and 5 reacted with the major core protein p25, Two reacted only f,intly with the envelope glycoprotein gp 110 of. HIV-1 These two sqra, and all sera with pQsitiVe IFA or ELISA tests for anibrodiets to HIV- 1 had a s@*strong rteactivity with the gp,140 of HIV,2 in RIPA,in 20 dicative of intection with 1-IV2 rather tha wihHV1 only one patient, that we. did not include in the study *poPulation was serologically found to be infected with HIV-1 and not with HIV-2, This patient was a 21-year-old woman trom Central Africa (Sao Tome TIahdi) with AID$.

isolfati .on of rettoviruses Ifrom peripheral blood lymphocytes was attempted in 12 patients, HIV was isolated in 11, according to the presence of, a typical cytopathic effqct, and of a peak rif par ticle-assoqiated reverse transcriyptase activity in tha Culture Zupern4tants, All 11 isolates$ were identified as RIV-2 using a dot-blot hybridization technique. Viral, dots from i s o a te s wero found to ,-trconq ly hybridize in stringent conditions of hybridization and Washing with a HIV-2 probe derived from a cloned, HIV 2 CON'A, whereas none of 413 thjem. hybridized with a HIV-1 probc in the same conditionls. OnQ isolate only f aintl y hybridized with the HIV-2 probe, but it flailed hybridize with the HIV-1 Immunological evaluation Thirteen patients were evaluated for the number of circulating lymphocyte.- iden$:ifi.ed as helper T cells (CD4+) and the ratio of helper; supxt-'-ss:r T cells, Among these patientst 11 had AIDS -,their mean abs Jute 10 helper T cells count was 213 300/mircroliLre and th'eir so.mean helper :suppressor ratio was 0.25 Q,15. One p4tient, clinically presenting with ARlC, had a number of So *helper T lymphocyte-- of 240/microlitrQ and a ratio of Osseo0, 18, Another patient, with neurological syphil is and no evident HIV-'reJated symptom, had a helper T "ymphocyte count of 69Q/micro3,itre and -k ratio of 0.82,

DISCUS.SION

*9901 20 thc stdtw demonstrated, HIV-2 infi.ction in n3 W ost African paties h rrloia n i goo** o roloq-L( profile:s that we observed indicate that' HIV-2 inf# ction was not often associatt .d 0.th EIV-1 infection in our Patients, Despite imnportant an-tigonic and genetic djitferencoo, HIV-1 and NIV-2 display similar tropism for Coq+ T lymphocyt~s# similar cytoP~thic Offectst sirnil4r and iohartz cmmon lmmunreactive epitopos in some of their constitutive proteins, SincfL all West African patie~nts With H1IV in otitn in this stUdy were found to be infeotod with HTV-2 and none of them with HIV-1, the now virus IRIV- may be thie majtor ottusc of In Wesit Afzric4 The symnptoms of 111V-2-telated AXMS Wore no0t 44 different from those of 1-IV-1 related AIDS in Centra, Africa The most common symptomr was chronic diarrhoea, with important weiyht loss, mostly due to Isospora belli and/or Cryptosporidium, The frequency of other opportu- ,nistic infections, such as candidia;,-is, mycobacteria (including M, tuberculosis) and toxoplasmo.9is was fomnd comparab.e to that in H-IV-1-related African AIDS, Pnaumocy-tis, carinii pneumonia, a very common complicatiti of AIDS in the USA and Europe, ha,- Only been found oncer in our study, and cj4 qcoc-al meningitis, was not do~te, ted, BUNevertheless, the immunologjqal abnormlities Sfound in H-IV-2-infected AIDS patients are identical to those described in HIV-1-related

AIDS,,

Among thQ 30 patients, who all had serum antibodies reactive with HIV-2 an~igens, cNnly 7 had HIV-1 .:pecific antibodies detectable 'using IFA Or ELISA, In IP&#'A all~ of these 7, patien1ts had 4ntIbodie5 reacti-le *with the othier major tcore proteins, p'2$ (H-IV-1) or p2G HXV~),which share strongly immunoi'eactive epitopes, .Five patients lacked such antiboidies all 41$ had a negative HIV-1 VLISA, IFA w 0 bOrderjiiir %n I and tiegativE, In 2. Howt;,ver, although some of them were not cml~~L evaluated, w tound 9 patients with serum antibodies to V, the vital ~t e In 1)26 of HTV-2 who had a weakly reactive cir rhega tve HIXV- -,Jrif1C TFA atnd/or ELISA, These findingo nt to the ImpottAnce of tnCltudinq H-2 antigens in thE HIV crum tust, u;ad In Af-ica and perhapts in other areas, A xetrov4rus wais iso1tcd freom thQ. peripheral.

1ympocyt~ o 11 aenti, in all Qazes, viral growth wasl obtained within 2 woak:5, characterized by the prosoen e o~reverse tf~nsriptasp- activity in thie supernatant And of cytopathic effect, However, thiz CYtoPAthic~ etfect apeared, to vary in iMportanle from one isolate to another: s4o.mi isolates provided numerous large-sized syncytia togrtlher: with important cell lysis, whereas others exhibited only few syncytia, limited s i.ze, and affected -poorly the viability of the culture, RNA from all but one isolate was found to clearly hybzdize in high stringency eondi1iins with a prove derivsed from a HIV-2 cDNA clone, rcpres.4nting the 103 end of. the genome. None hybridized with a FIV i prove in the same conditions, Thi demonstra'-es th(At the iwlaesioecin these patients all belonged tothe go same type if virus. one isolate only poorly hybridized with HIV'-1. This virus, however, waz isolated from a :,patient with serum antibodieF; reacting with all the antigens of HIV-2 in4' RIPA, This invention relatezs generally, in addition to HJV-2 viruo its 4ariants, to any Pquivalent virus *se.

which is infectiou* fi~r man and possesses inuralogical characteristics specific to HIV-2. The invention relatesr 0generally to any virus which, in addition to the properties possessed by the HIV-2 viruses deoosited with the CNCN, also possesses the characteristics which foallow, 25 The proferred target for the HIV-2 rettovirus '*consists of homan Lqu 3 rells r T4 lymphocyte~s) and and immortalizod' cells derived from th e se T4 lymphocytes, for eXample cells of the HUT 78 lincs dealt.

with in the context of th, patent application. in other wordst It has ai *pfeific trQp~sm for these cellc,, It can be cultturrcd in termanient liliej of the HtIT, CEM, MOLT or similar type, olpressing the T4 protein, It is riot Inf ectioous for T,9 lymphocytes, is cytotoxic.' for the human TV lymphocytes, The cytopathogeaic nature of HIV-2 with~ respect to T4 lymphocytes manifests itselft in partir,!ular, by the appear, nce of tultinucleated 46 cells. I t ha's a reverse transcriptase activity which requires the presenc, o f Mg ionis and haz a strong affinity f o- polyadenylate n1.igodenxythymidy late (poly(A)-oligo(dT) 12-18). It has a density of approximately 1.16 in a sucrose gradient. It has a mean d iameter of 140 nanometres and a core having a mean diameter of 41 nanometres The lysates of this virus contain a p26 protein which does not cross immunolo-, *gically with the p2j protein of HTLV-1 virups or HTLV. IT virus. These p26 proteins hence have a molecular weight *Cwhi ch is slightly higher (by approximately 1000) than t the corresponding p 2 5 proteins cif HIV-1 and slightly *'lower (again, of the order of approximately 1000 lower) ~*than the corresponding p27 proteins of the SIV, The lysates of HIV-2, contain, in addition, a p16 protein which is not immunologically zecognized by the p1 9 protein o 4 HTLV-1 or of HTLV-II' in RIPA (abbreviation fox radi~immunoprecipi-Latiol Assay) experiments, They in addition, an envelope glycoprotein having a molecular weight of the order of, 130,000 140,000, g *which does not cross immunologically with the gp 110 of 14-V- 1 but which, on the oth,.r hand, cros:.es of STLV-III, These lysates also contain proteins or glycoproteins which can be labelled with VS)c 'steinc, 11;7,ving molecular weights, respectively, of the order of 36,000 and. 4Z,000 45,000. The genotnic RNA P~f HIV-2 do es not hybridize withi the genomic RNA of H4IV- 1 Linder stringent conitions, Under non-stringent conditions, it does not hybridize With nucleotide sequence derived from 1H1v- i anid <:oftaining the env gene and the LTR o,\djacent to it. In partict~ar, it does not hybridize with the nucleotide sequence 6290-91i0 of HIV-1, nor with sequences of the R21 region of the EiIV-1 genome, in particular with the nucleotide sequence 2170-2240, under Snon-stringent conditions, it hybridizes weakly with nucleotide sequences of the HIV-1 region, in particular the nucleotide sequences 990-1070 and 990-1260.

It should be noted thd; any retrovirus which is infectious for man, capable of inducing one of the forms of AIDS, having the abovementioned essential' properties and whose genomic RNA is capable of hibridizing under stringent conditions with those HIV-2 viral strains deposited with the CNCM (or with a cDNA or icDNA fragment derived from these genomic RNAs) is to be considered to be an equivalent of HIV-2, The invention also relates to each of the antigens, in particular proteins and glycoproteins in Sthe purified state, such as may be obtained from HIV-2.

SReference to "purified" proteins or glycoproteins implies that these proteins or glycoproteins lead, respectively, only to single bands in polyacrylamide gel electrophoresis, in particular und4r the experimental seen. conditions which have been described above. Any suitable 0 2 0 method of separation and/or purification for obtaning 20 each of these can be used, By way of example of a technique which can be employed, that describes by R.C.

MONTELARO et al., J. of Virology, June 1982, pp.

1029-1038, will be mentioned, The invention relates generally to all oo 25 S* antigens, in particular proteins, glycoroteins or polypeptides, originating from an HIV-2 and having immunological properties equivalent to those of these antigenic compounds of HIV-2. Two antigens are said to be "equivalent", in the context of this account, inasmiuh as they are recognized by the same antibodies, in particular antibodies which can be isolated from a serum obtained from a patient who has been infected I/ith an HIV-2, or inasmuch azs they meet the conditions for "immunological equivalence" stated below.

bPL+S e t, o 4% I Sa 0

S

a' a' S S 36 00 S *a S a. a 9* a a a 06 Se OS u

S

Among equivalent polypoptides, proteins or glycoproteins, there must be included fragments of the above antigens (or peptides reconstituted by chemical inasmuch as they give rise to immunological cross-reactions with the antigens from which they are derived. In other words, the invention relates to any polypeptide which has, in common with abovementioned antigens, identical or similar epitopes capable of being recognized by the same antibodies. £elonging to this 10 latter type of polypeptides are the products of expression of corresponding sequences ot the DNAs which code for the corresponding polypeptide sequences.

The HIV-2 virus has proved to be usable as a source of antigens for "etectinq antibodies in all people who have come into ci .cact with the HIV-2 virus, The invention relates generally to any composition which can be used for. the diagnosis of the presence in a biological fluid serum, in particular of 2 people who have come into contact with HIV-2, of antibodies against at least one of the antigens of HIV-2, This composition can be applied to the selective diagnosis of the corresponding variety of AIDS, employing diagnostic techniques such as those described in the European patent application cited above, except that 25 exhacmts t k lysates o purified antigens of HIV-2 re used instead of those of HIV-1, In this connection, the invention relates more especially to compositions containing at least one of the proteins p12, p16, p26, which are the internal proteins, or p36 or gp 140. By way of examples of compositions, those which simultaneously contain the following will be mentioned.

p26 and gp 36 p26, p36 and gp 140, p12, p 16 and p26, p16 p26 and gp 140, etc P16, p26 and gP 140, etc.

lei 411 0 it is self-evident that these compositions signify only examples. In particular, the invention relates to the viral extracts or lysates containing this group of proteins and/or glycoproteins or all fractions from which one or more of the abovementioned proteins or glycoproteins has been separated beforehand.

The invention also relates to compositions containing a combination of proteins and/or *glycuproteins of an HIV-2 with proteins and/or 10 glycoproteins of an HIV-1, for example: either core proteins of HIV-1 and HIV-2, in particular the p25 of an HIV-1 anr. p26 of an HIV-2, or alternatively the p18 of an HIV-1 and the p16 of an HIV-2, or envelope glycoproteins of an HIV-1 and envelope glycoproteins of an HI.V-2, in particular the gp 110 of HIV-1 and the gp 140 of HIV-2, or alternatively the p42 of HIV-1 and the p36 or p42-45 of HIV-2,

C*

or, of course, mixtures of proteins and/or 20 glycoproteins of an HIV-1 and proteins and/or glycoproteins of and HIV-2.

Such compositions, used for diagnosis, consequently make possible procedures for diagnosis of AIDS or of the symptoms which are associated with it, which extend over a wider spectrum of the aetiological agents responsible. It goes without saying that the uso for diagnostic procedures of compositions which contain only proteins and/or glycoproteins of HIV-2 is nevertheless useful for more selective diagnosis of the category of retrovirus which can be held responsible for the disease.

The invention also relates to the DNAs or DNA fragments, more especially cloned DNAs and DNA fragments, obtained from the RNA and cDNAs derived from the 35 oRNA of the HIV-2 r ttrovirus, The invention also

I'I

So 0 so.

0 Os@0ee *0 0 .6.

S.

S.

*5 S0 0055

S

relates especially to all equivalent DNAs, in particular any DNA possessing sequence homologies with the DNA of HIV-2, especially with the sequences which code for the env and pol regions of the strain of HIV-2 deposited with the CNCM, equal at least to 50 preferably to and still more advantageously to 90 a. It will also be stated generally that the invention relates to any equivalent DNA (or RNA) capable of hybridizing with the DNA or RNA of HIV-2 in the "spot blot" technique, under non stringent conditions as defined above.

The invention likewise relates to the sera capable of being produced in animals by inoculating the latter with HIV-2. The invention hence relates more especially to the polyclonal antibodies directed more specifically again4t each of the antigens, in particular proteins or glycoproteins, of the virus. It also relates to the monoclonal antibodies which can be produced by traditional techniques, thes.e monoclonal antibodies being directed, respectively, more specifically against the different proteins of HIV-2.

These polyclonal or monoclonal antibodies can be used in different applications. Their use for neutralizing the corresponding proteins or even inhibiting the infectivity of the whole v'rus, will mainly be mentioned. They can also. be used, for example, for demonstrating the viral antigens in biological preparations or for carrying out procedures for purification of the corresponding proteins and/or glycoproteins, for example by using them in affinity chromatography columns.

It is understood that, in genera, the available technical literature (in particular that for which the bibliographic references are in the context of the present description) in respect of HIV-1 and the virus designated HTLV-II1 is to be considered to be

U

incorporated herein by reference, inasmuch as the techniques described in this literature are applied under similar conditions to the isolation of HIV-2 virus or of the equivalent viruses, and to the production from these viruses of their different constituents (in particular proteins, glycoproteins, polypeptides and nucleid acids). Use can also be made of the teachings of *:see: this technical literature as regards the application of the different constituents in question, -n particular to diagnostic procedures of the corresponding forms of LAS **0 or AIDS.

The pr usent invention relates more especially Sto a method for in vitro diagnosis of AIDS, which Scomprises bringing a serum or another biological medium originating from a patient who is the subject of the diagnosis into contact with a composition containing at least one of the proteins or glycoproteins of HIV-2, or alternatively an extract or lysate of the virus, and the detection of the immunological reaction. Examples of 20 such compositions have been stated above, Preferred methods invo've, for example, immunoenzymatic reactions of the ELISA or immunofluorescence type. The titrations can be measurements by direct or indirect immunoflueorescence, by direct or indirect immunoenzymatic assays.

Thus, the present invention also relates to extracts of virus (either an extract of one or more HIV-2 viruses alone, or a mixture of extracts origina- Sting from one or more HIV-2 viruses, on the one hand, and one or more HIV-1 viruses, on the other hand), these extracts being labelled. Any suitable type of label can be used enzymatic, fluorescent, radioactive and the like.

Such titrations comprise, for example the deposition of specified amounts of the 1 extract or of the composition referred to according to 52 the present invention in the wells of a microtitration plate introduction into these wells of increasing dilutions of serum principally containing the antibodies whose presence is to be detected in vitro the incubation of the microtitration plate careful washing of the microtitration plate with a suitable buffer the introduction into the wells of the microtitration plate of labelled antibodies specific for S. human immunoglobulins, thc labelling being carried out with an enzyme chosen from those which are capable of hydrolysing .a substrate in such a way that the latter Sthen undergoes a modification of its absorption of radiation, at least in particular wavelength band, and the detection, preferably in comparative fashion relative to a control',, of the extent of hydrolysis of the substrat-,, as a measurement of the 20 potential risks or of the effective presence of the see disease.

The present invention also relates to outfits or kits for the above diagnosis, which comprise an extract or a more highly purified fraction S* 25 of the types of virus stated above, this extract or fraction being labelled,. for example radioactively, enzymatically or by immunofluoescence anti-(human immunoglobulins) or a protein A (advantageously, bound to a support which is insoluble in water, such as agarose beads) an extract of lymphocytes obtained from a person in good health buffers and, where appropriate, substrates for the visualization of the labelling.

t emerges from the foregoing that the invention relates to the diagnosis of HIV-2 virus, or of -~3 diography.

53 a variant, as a result o f the use o f t'he probes described above, in a method employing different stages recorded below, these stages being arranged specifically to bring out the characteristic properties of HIV-' virus, The invention naturally also relates to the use of the cONAs or their fragmentzs (or reccornbinants OVOG:containing them) as probes for the diagnosis of the a 0:0. 10 presence or absence of H-IV-2 virus in samples of serumt or of other biological fluids or tissues obtained from ol0 patients suspected of being carriers of the HIV-2 virus, These probes axe preferably also labelled (radinctivc,, enzymatic, fluorescent labels, and the like). Especially probes for carrying out the method for diagnosis oIf the HIV-2 virus, or of a variant of H-IV'-2, can be characterized in that they comprise all or a fraction of the cDNA complementary to the genome of the I-IV-2 virus, or altornatively,, in particular, the 20 fragments present in the various clo:nes identified a.above, There will be mentioned, more especially, a f r a,.t ion of -thle CONA of HIV-2 present in the clon., E21, more e~jpecially the sequence of the 3' end (LTR) and/or o f the 5' end of the HIV sequence of)' thle abovementioned *clone E2# or alternatively the cDMA t.ontaining the cenv region, of the cDNA of the HIV-2 virus, The probeLs employed i r, this method for diagnosis of the HIV-2 virus and in the diagnostic kits a re in no way limited to the, probe, describeud abov., They comprise, on the, contrary, i I the nuclootide sequences or ig inating9 from the gonomc of TeHIV-2 virus, o)f a variant of HIV-2 or of a structurally related virus, inasmuch as they en a b Ie an t i b o di directed against an -IV-2 to be detected, in biological of peoplc capable of developing one of the forms o f AIDS. Naturally, the use of nucleotide sequences 54 originating from an IIIV-Z which is initi~ally infectious for man in nevertheless preferred.

Thet- d t te t io n can be cdrried out i n all known per se, in particular by bringing these probes into contact either with the nucleic acids obtained from cells present in thcse sera or other biological media, for example cerebrospinal fluids, saliva, and the like, or with these media themselves inasmuch a~s their nucle4j,c acidc have been rendered o.acqessible to hybridizat~ion wi th these prbthis being under conditions which peirmit hybridization qbetween these probes and these rulicacids, arid by *detection of the hybridization which may be produced, abovementioned diagnosis, involving hybridization reactions, c an al~so b e carried out using mixtures of *fee probes or igi.n at ing, res,7pectively, from an HIV-1 and an HIV-'21 inso fa r as it is unnecessaxy to differentiato *between, the type of H-IV, V.,irus saouqht, 0In general, method for diagnosis of the presence or absence of the RIV-2 virus or a variant, in samples of qeza or other tluidt or tissues obtained from patients suspected of being carriers of the HIV-2 virus, comprises the following stagesalbeedpo, 1) the manufacture ofalbeedpo, 2) at least one hybridization stage performed under stringer-nt conditions, by bringing the DNA of cells in the sample tr- the suspect patient Into contact With the said labelled probe on a suitable membrane, 33) washing of the said Membrane with a .qolution which provides for the retention of itheoe stringent conditions for the hybridization, and 4) the doteQtion of the presence or absence ot the HTV-2 virus by an immunodetection method.

In ano)ther Vfr(trtad embodiment of the method according to the invention, the abovementioned r i jiiF~i hybridization is performed under non-stringent conditions and the washing of the membrane is carried out under conditions adapted to those for the hybridization.

The invention relates in particular to HIV-2 viruses, characterized in that their viral RNA corresponds with a cDNA whose gAG and ENV genes comprise respectively the nucleotidic sequences which follow.

They result from the sequencing of correspond- 10 ing regions of cDNA corresp6nding to the genome HIV-2 Rod. They are in correspondance with the aminoacids that they code, 0

S

eo me e 'em 00 00 em S. q

SO

C

SO

mm a

S

me 9 ,J S l~i ,I i: i f: P Li: silu* LL; 2/ 2 56 GAG R0DU Ne tG IyA IaArgAsnSevaLeuArgG IyLysLysA IaAspG Iu

ATGGGCGCCAGAAACTCCGTCTTGAGAGGG'AAAAAGCAGATGAA

LeuGluArgI leArSLeuArgFro~l7G lyLj s Lys LysTyrAr g TTAGAAGAATCAGGTTACG ;CCC' -CGCAAAGAAAAAGTACAGG LeuLysnis I le Va lTrpAlaA laAs nlysLeuAs pArgPheG 1ly *CTAAAAC ATATTGT:GTGGGCAGCGKAAAATTGGA

CAGATTOGGA

100 Le uA IaG uSerLeuLeu G2uS erLyG luGlyLy!; G loys II e 10 ~TTAGCAGAGACC TGTJ'i..XAG CAAAGAGGGTTGTCAAAAAATT Le uThrVa 1LeuAs ;Prokl tVa ;roTh rG IyS ;rG IUA suL e u CTTACAGTTTTAGATCrCAATGGTACCGACAGGTT

CAGAAAATTTA

200 Lys SerLeu~heAsnThr Va iCys Va 1 eTrpCys I.1e~is Ala AAAA G 7CTT TTTAA TAC TG T CTGCG TCAT TTGG TG C ATA C ACCCA.

GAAGA GAAAG TOAAA GATAC TOAAGCGAG CAAAA CAAATA GTGC GO ArgflisLeuValAlaGluiThrGly~hrAlaGluLysxle rProSer 4AGA CAT CTA GTGGOCAGA AACAG &AACtGCAGAGAAAAVC CAA GC ThrS4rtrgProThrAlaPrQ~ererO1~uLysGlyGlyAsnTyr

ACAAGTAGACCA.ACAGCACCATCTAGCGAGAAGGGAGGAAATT'AC

400 ProVa iGIniis V iOlyGlyA~ nTyrThrlis IieProLeiS er @005 C C4GTGCAACATGTAGGCGGCAACTACACCCATATACCGCTGAG;T P'roAr gThrLeuAs nAlaTrp Va lLys Leu Va lG luG IuLys Lys C CCC GAACCCTAAAT'GCCTGGGTAAAATTAGTAGAGGAAAAAAAC PheGlyAlaGIuValVa1ProGlyPheoln~laLeuSerctucly

TTCGGGGCAGAAGTAGTGCCAGGATTTCAGGCACTCTCAIGAAGGC

500 CysThr~roTyrAspIleAsnGln'4 etLeuAsnCysValoly~sp- TGCAC CCC C TATGA TATC AACC AAATGCTTAA TTGT CTGG GOCAC C AT CAAG0C AG CCATO CAGA TAAT CAGO GA GATTLAT CAAT GAG GAA 600 *I A IaAIa G ru'repA sp Va 1 G1 Hi S ;r61I~e? r o G yP r oL e u Pr G CA G CAGAA rGG GATG TG CAA CAT C CAATA C CAGG C C C CC TTAC C A aG 1 YG tmLsm ArgGIUP roArg G ySe rAs pI 1 eAl1aG lyT~ir 0GG C C CAC ZITAGCA q tC C AAG G GGATC0TG A CATA GC AG C A CA a 700 TN~k Thr S 4rTh rVa u G 1u GlI 1e G 1 nT r p 1-e t he A r Pr oG I n A GA G C AC ACTA GAAGOA.ACA G AT C CA GT CG AT CTT TA GG C C A CAA t~ As uProVaUroVal ('IyA anuI eTyrArZArZTrp I IeG I a Ie AAT CC TGTA"' ,A GTAGGAA ACAT CTATAGAAG ATG ATCC A ATA 800 GlyLeuclnLysCysVaiArglletTyrAsnProThrAsnhleLeu GGATT GC A CAAGTGTGTC AGGATGTACAACCCG ACCAACATCCTA Asp I IeLys lnGlyProLysGluProPb;G InSerTyrValAs p GA CAT AAAAC AGGG ACC AAA G G AGCC GTT CCA-AAG CTATG TAGAT 900 Ar -Ph eTyrLysSerLeuAr .A IaG~uG lnThrAspProAlaVal

AGATTCTACAAAAGCTTGAGGGCAGAACAAACAGATCCAGCAGTG

10Lys As nTrpJle tThrGlnThrLeuLeuVa IlGlnAsnu:laAsuPro AAGAATTGGATGACCCAJLAC AC TGC TAG TACAAAATGCCAACCC A eAs pCysLysLeuVa lLeuLysG IyLeuGlyMe tAsnProThrLe a S-.CA CTGTAAAT TAG TGC TAAA AGG A CTAG GGATGAA CC CTACC TTA 1000 0 GluGluMetLeuThrAlaCysGln3GlyVaiACiyGlyProGly~ll GAA GAGAT GC TGACC GCC TG TCAGGGGGTAGGTGG GCCAGG CCAG POO$ LysAlaArgL-,u~!etAlaGiuAlaLeuLysG~uVa II~eGlyPro AAA G CTAGATTAAT GG CA GA G GCC CTGAAA GAG G TCATAG CACC T *1100 :AlaProllePro~heAlaAlaAlaGnGlnArgLysAlaPbeLys G CCCC TA TCCCATTCG CAC CAG CC CAG CAGAGAAAGG CATTTAAA CysTrpAsnCys~lyLysC luG lylisSerAlaArgGlnCysAr; TGC TGGAAC TGTGGAAAGGAAGGGCACTCGG CAAGACAATGCCGA 1200 sees*AlaProArgArgGlnGlyCysTrpLysCys~lyLys~ro~ly~is S 5Ilele tThrAsnCysProkspAr-gGInAlaG ly:PbeLeuGlyLeu

ATCATGACA.AACTGCCCAGATAGACAGGCAGGTTTTTTACGACTG

a 1300 Gly~roTrpGlyLysLysProAr-AsnPheProValAlaGltiVaI C GC C CTT GGAAAGAAGCC CCGC CAAC TTCCC CGTG GCC CAAGTT ProG InGlyLeviThrProThrAlapr P roVa lAspProAlaVa.* C CGCAGGGGCTGACACCAACAG CACCCCCAGTGGAT ccAGCAGTG AspLeuLeuGluLysTyr*iletG 1nGlnG'%yLy'sArgG~nAr-.Glu GAT C TAC TCCAGAAATATATG CAGCAA(QGGAAAAGACAGAGAGAG 1400 a 0 SlnArgG luArgProTyrLy sG lu Va ,ThrGluAspLeuLeu~i.s CAGAGACGAGACACCATACAAGGAAGTCAkCACAGGACTTACTGCAC LeuG luCGC1yG luTbrProTy rAr-GOluroP%,oThrC luAs p

CTCGAGCAGGGGGAGACACCATACAGGGCCCACOAJ.CAGAGCAC

1500 0 LeuLeuHi4sLeuAsuSerLeuPhe~lyLysAspCln TTCCTGCA CC T CATT CT CTC TT TCGAAAA CACC AG lietMe tAsnGIn LeuLeu IleA Ia I IeLeuLeuA Ia SerA IaCys ATGATGAAT CAGCTGCTTATTGCCATTTTATTAGCTAGTG"'TTGC ~LeuVa lTyr~ysThrG lnTyrVa lThrValP be TyrG ly;a lPro T TA GTA TATT GC ACC C AATAT GT AAC TGTTTTC TATGGCGCTACC C ThrTrpLysAsnAlaThrIle~ro~euPheCys1*IaThrAraAsn A CGTGG AAAAATGCAA CCA ATTOCCCCTC TTTT GTG CAA CCA GAAAT ArgAspThrTrpGlyThrlleGlnCysLeuProAspAsnAspAsp lo1 AGGGATACTTGGGGACCATACAGCTTGCCTGACAATrATGAT TyrGlnGlulleThr .LeuAsnVal~hrGluAlaPheAspAlaTr; TATCAGGAAATAACTTTGAATGTAACAGAGG CTTTTGATGCATGG 200 AsnAs nThrVa l IThr G Iu GIn Al1 all e GIu As p Val1T r p i sL eu AATAATA CAGTAACAGAACAAG CAATAGAA GAT GT CTG GCAT CTA FheGluTbrSer~leLysProCysValLysLeuThrProLeuCy3 T~GAGA CAT CAATAAAACCAT GTGTCAAA CTAACAC C TTTA TGT 6000 *300 ValAlaZ -ctysCysSerSerThrGluSerSerThrG~yAsnAsn G T.CA GC CAA'GA A AT G C AG C AG C A C A GCA GAC CAG C A C AGC GGAA C AA C 20ThrThrSerLysS-rThrSerThrhrThrTharThrProThrAs; 20 ACAACCTCIAAAGAGCACAAGCACAACCACAACCACACCCACAGAC 11 400 C inC LuC InClutleSe rGluAsplhrProCysAlaArgAlaAs p CAGCOAG CAA GAGATAAGT(AGGATACTCCA"ifGCGCACG CGCAGAC see$ £0.55. AsnCys Se rGlyLeuGlyGluG u~luTbrl leAsnCysG lnPhe AACTGC TCAGGATTGGCAGACGGAA GAAACGATCAATTGCCAGTTC tThr~ly.Leu~luArgAspL~lsLysLysGlnTyr~snClu AATAr CCAG GAT TA AAA GAG ATAA GAAAAAA CAC TA TAATGCAA ThrTrpTyrSerLysAspValVal ys~luThrAsnAsnSerTh;

ACATGGTACTCAAAAGATGTGGTTTGAGACAAATAATAGCACA

A snGin Thr G .nC ysI yr Mlet Asn Ei sC y sAs n hr S e ralll1e

AATCAGACCCACTGTTACATGAACCATTCCAACACATCAGTCALTC

600 Thr~u~erCysAspLyst'dsTyr'rpAs pAl al IeArgI'e, r ACAGAAT CILTCTA'ACAAC CACTATCGGATGCTATAAGGTTTAGA TyrCysAla~roProG lyTyrklaLeuLeuArgCysAsnAspThr

TACTGTGCACCACCGGGTTA'TGCCCTATTAACATGTAATGATACC

~700 0 AsnTyrSerGljPheA1&oProAsnCysSerLysValV*lA~aSer ~ALIt AATTATTCAGGCTTTGCACCCAACTGTTCTAAAGTAGTAGCTTCT

LA

-9- ThrCysThrArgxetxetcluThrclnlhrSerThrrpPhe~lY

ACATGCACCAGGATGATCGA:AACCCAAACTTCCACATGGTTTGGC

0 800 PheAs nG IyThrArgAl aG luAsnArglhrTyrl e TyrTrp~is TVT41AAT GG CAC TA GAG CAGAGAATAGAA CATATAT C TATTGGCAT GlyAraAspAsnArgThrIleIleSerLeuAsflLysTyrTyrAsf G GC ACAGATAATA GAAC TAT CA T CAG C TTAAAC AAA TA TTATAAT 0 0 900 Leu~~~e rLuisyLy sAr -P roG I yAs nLy sTh rVa lLysOI C CTCAGTTTCGCATTGTAAGAGGC CAG GGAATAAGA CAGTCAAACAA 11 e~e tLe uMe tS erG IyHJ.s Va 1'P he~isS e rEi sTy r nP r o

ATAATGCTTATGTCAGGACATGTGTTTCACTCCCACTACCACCC

TrpLy sAs pAl aMetC inCluVa iLys ThrLeuAl1aL.ysflisP ro TGGAAkAGACGCCATGCAGGAGGTGAAGACCCTTGCA-AAACATCCC Lg&yrArgG lyThrAsnAs pTbrArgAsnlleS erPbeAlaAla

AGGTATACAGGAACCAATGACACAAGGAATATTAGCTTTGCACCG

*1100 ?roGlyLys~lySerAspProC luVa lAlaTyr~e tTrplbrAsn CCAGCAAAAGGCTCAkGACCCAGAAGTAGCATACATGTGGACTAAC 205 20CysArgGlyC uPb-eteulyrCysAsniletThrTrpPheLeuAsl .TCCAGAGCAGAGTTTCTCTACTCCAACATGACTTGC

TTCCTCAAT

*1200 TrpIleGluAsnLysThrHisArgAsnTyrAlaProCys~isIle

~'.TGCATACAGA-ATAAGACACACCGCAATTATGCACCGTGCCATATA

0 LysGlnlleIlesnTrTrp~isLysValGlyArgAsnValTyr AAG CAAATIAATTAA CA CAT GCATAAGGTA GGCA GAAATGTATAT t 0 1300 LeuP roProAraG luGl1yC luLeuS erCysAsSe rThr~a IThr TTG CC TCC CAG GGAAGGG GAG CTGT CC TGCAA CT CAA CAGTAACC SerIlelleAlaAsnIleAspTrp~lnAsnAsAsUGllThrAsn AG CATAATTG CTAACATTGAC TCGCAAAACAATAAT CACACAAA C 11I eThrPhe SerAlaG IuVa lAl aG luLeulyrArg LeuGluLeu .A ,TA CC TTTAG TG CA GAG G TC GCAGA A C A TACAGCATTGGAGTTG 1400* GlJyAs pTyrLysLetLValG luIl eThrProlleG lyPheAla? ro GOAGoATTATAAATTGGTAGAAATAACACCAATIGGCTTCGCACCT ThrLysG IuLysAr-TyrSerSerAlaaisG I yAi&gHisThrA:g A CAAAAGAAAAAAGATAC TCC T CTG CTC AC G GAGA CATACAAGA a 1500 0 GlyValPheValLeu~ly'heLeu~lyPheLeuAlaThrAlalY 4 GTGTGTTCGTGC TAG GGTT CTTGGGTTTT CTCGCAACAG CAGGT SerAlalietGlyAlaAr-A~aSerLeuTbrVa1 r' laG inSer IC TGCAA TG GG CGCTCGAG CGTCC CTGACC GTGTCGGCT CAGTCC 1600 ArgThrLeuLeuAlaG lyl eVa iCInG inC uGmG lnLeuLeu CnGACTTTA C TGGCGG GATAGTG GAG CAA CAG CAA GAG CTG TTG &&pValVa1lysArgGlnGinGluLeuLeuArgLeuThrValITr~p S .ACGTGGTCAAGAGACAACAAGAACTGTTGCGACTGACCGTCTGG *1700 @0 a1yThrLysAsnLeuGlnAlaArgVa1ThrAlaIleGluLysTyr

~.CGAACGAAAAACCTCCAGGCAAGAGTCACTGCTATAGAGA-AGTAC

LeuG InAs pG lnAlaArg Le uAs Se rT r Gly Cy sAla~h eArg CTACAGGACCA GGCCCGGCTAAATTCATGGGGATGTCCGTTTAGA 0 1800 G InVa lCy s Eis ThrTh rVa1P ro~rpVa 12s nAs pSe rLeuA la CAAGTCTGCCACACTACTGTACCATGGGTTAArGATTCCTTAGCA es' Ir oAs pTrpA pAsnlle ThrTrpG InCluTrpG luLy sO inza 1 C CTGACTGC'GACAATATGACGTGG CAGGAATGGGAAAAACAAGTC 1rj~et A Asll A r&Ty-,e.G l eSe rLys S e rleG 1'G fnkA 1'G iLu-

CGC'IACCTGGAGGCAAATATCAGTAAAAGTTTAGAACAGGCACAA

1900 I11eG~a nCrIGuLysAs Of;etTy rG luLeuG InLysLeu~snSer AlTTCAGCAAGAGAAAAATATGTATGAACTACAAAAATTAAATAGC TrpAspIlePheGlyAsuTrp~heAspLeuThrSerVrpValLys

TGCGATATTTTTGGCAATTGGTTTGACTTAACCTCCTGGTCAAG

2000 TyrIleGlnTyrGlyValLeuIleIleValAlaVal1.eAlaLeu TATAT C AA TAT GGAG TO CTTATAA TAG TACCAGTAAI'AGC2 TA ArgleVaIle'ZyrValValGlnIetLeuSerAzgLeuArgLys kGAATAGTGATATAT GTAG TA CAAAT GTTAAG TAG GCTrA GAAAG 210,0 .lTyrAr&ProVa 1P heSerSer~ro~roG lyTyrI leGlti~1n CTATAGGCCTGTTTTCTCTTcCCCCCCCCGTTATATCC&AAOk ~NT O 61.

I IeFis I Ie~isLysAspArZG IyG~nProA~aAsnG luGluThr AT CC AT AT CC A CAAGCACC GGGA CA CCA G CCAACUAAGAAAC A 2200 C luG luAs pG IyG lyS erAs -,GlyG lyAspAr-TyrTrpProTrp GAAGAA GA CGGTGC AAGGAACGG CTGGAGAC AG ATAC TGCC CT'GG 00 too: Pr o I!eA Ia TyrllIeRis~heLeui eArgG2.nLeu I IeArgLetu GCGATAGCATATATACAT" iT CC TGATCCGC CAG CTCATTCGCCTC a0 0 ~.TTC. CC AGACTA'EACAG CAT CTGCAGGG ACTTACTAT CCAGGAG 2300 0 ow Ph eLeuThrLeuGIn Leu I IeyrG InAsnLeuArgAspTrp 1.4u TTCCTG ACC C TCCAAC7 ;'AT CTACCAGAATCTCAGAGACTGGCTG ArgLeuArg~hrA IaPbeLeuGlImlyrG 1yCys~luTrp2eG Ila AGA CTT AGAACAGCC TTCTTGCAATATGGGTGCGAGY GCAT CC AA 402400 GluA IaPheG InAlaAlaAlaArg; laT,A rG iu'hrLeuA 1 a GAAGCATTCCAGGCCGCCGCGAkGGGCTACAAGAGAGACTCTTGCG 20G I yAlaCy s~rgG I. yLeuTrpAr-Va ILeuG luAr- 1.2. eG I yArg

GGCGCGTGCAGGGGCTTCTGGAGGGTATTGGAACGAATCGGGAGG

*2500 a GlyleLeuAlaValProAr-ArgIleArgGlnGlyAla~lulle

GGAATACTCGCGGTTCCAAGAAGGATCAGACAGGGAGCAGAAATC

AlaLeuLeu*'**GlyThrAlaVa2.SerAlaGlyAr-Leu~yrGlu GCCCTCCTcQTGAGGGACGGCAGTATCAGCAGGGAGACTTTATGAA 2600 TytSer~ietGlUGlyProSerSer~krgLys~lyGluLys~heVa 1 TAkCTCCATGGA.AGGACCCAGCAGCAGAAAGGGAGAAAAATTTGTA 62 As already stated above, the invention naturally results to all HIV-2 viruses whose RNAs .e'n ess similar characteristics, particularly GAG and ENV regions which comprise sequences having nucleotidic sequence homologies of at least 50 preferably 70 and still more advantageously 90 with the corresponding GAG and ENV sequences of HIV-2 Rod.

The invention relates more particularly to the cDNA 10 fragments which code, respectively, for the p16, p26 and p12 whose S structures are also included in GAGRODN. In particular, it relates to the sequences extending from nucleotide to nucleotide 405 (coding for p16) from nucleotide 406 to nucleotide 40 155 (coding for p216) from nucleotide 406 to nucleotide 1 155 (coding for p26) 15 and from nucleotide 1 156 to nucleotide 1 566 (coding for p12).

It also relates particularly to the cDNA fragment which codes for the gp140 included in ENVR and extending from the nucleotide 1 to the nucleotide 2 574.

20 The invention also relates to nucleotide sequences which distinguish from the preceding ones by nucleotide substitutions o* taking advantage of the degeneracy of the genetic code, as long as the substitutions do not involve a modification of the aminoacid sequences encoded by said nucleotide sequences.

25 Likewise the invention concerns proteins or glycoproteins whose aminoacid sequences correspond to those which are indicated in the preceding pages, as

I

well as equivalent peptides, i. e. peptides which result from the preceding pages by addition, substitution or dilution of aminoacids which do not affect the overall immunological properties of said peptides.

The invention concerns especially the envelope glycoprotein which exhibits the aminoacid sequence encoded by ENVRN.

The invention also relates to an immunogenic 10 composition characterized in that it comprises dosage units of envelope antigen, particularly the gp140 of the HIV-2 virus, such as to enable the administration of oeee dosage units from 10 to 500, particularly from 50 to S 100 mg/kg of body weight.

15 Finally the invention concerns a process for producing any of the above indicated proteins (p12, p16 or p26) or of the protein having the structure of gp140, or of any determined part of said proteins, which process comprises inserting the corresponding nucleic 20 acid sequence in a vector capable of transforming a suitably chosen cellular host and to permit the expression of an insert contained in said vector, transforming said chosen host by said vector which contains said nucleic sequence, culturing the cellular host transfori" 25 med by said modified vector, recovering and purifying the protein expressed.

The techniques disclosed in European patent application 85 905513.9 filed on October 18, 1985 for the production of peptides or proteins consisting of expression products of nucleic acid sequences derived of the genome of HIV-1 are also applicable to the production of the above said peptides or proteins derived of HIV-2. The description of this European application is incorporated h- ei n by reference, particularly as concerns the techniques.

As an indication, molecular weights (MP) of 41 A" HIV-2 proteiiis are given in comparisdn with those of HIV-1.

MP of HIV-2 proteins M ~P of HIV-1 proteins k d k d entire R_458,3 entire 3a 55, 8 p 16 15 p 18 14,9 26 27, 6 p 12 15,8 efv98,6 env 97,4 external env 57,4 15 Transtnerbrane env 4, HIV-2 Mir and HIV-2R0D have also been depo- 20 sited in the "National Collection of Animal Cell 00Cultures" (ECACC) in Salisbury (Great-Britain) on .00. January 9, 1987, under accessing numbers 87 011001 and 87 011002 respectively.

Moreover, plasmids pfl0D35 and pfl0D27,5 have been deposited at the "National. Collection of Industrial '*Bacteria" (NCIB) in Aberdeen (Great-Britain) on January 9, 1987 under accessing numbers 12 398 and 12 399 respectively, All the publication!5 which are referred to in the Present disclosure are incorporated herein by reference.

111*1~1~ ~z

BIBLIOGRAPHTE

1 F. Barr6-Sinoussi et al., Science 220, 868 (1983) 2 L. Montagnier et al., In Human Tcell leukemia Orlymphoma viruses (Gallo, Essex, Gross, L., eds.) Cold Spring Harbor Liboratory, New York, 363 (1984).

3 M. Popovic, MG. Sarngadharan, E. Read, R.C. Gallo, Science 224, 497 (1984).

4 J. Levy et al., Science 225, 840 (1984).

P. Sonigo et al., Cell 42, 369 (1985).

7 J.W. Curran et al,, Science 229, 1352 (1985).

8 A. Ellrodt et al., Lancet i, 1383 (1984).

P. Piot et al., Lancet ii, 65 (1984).

F. Brun-Vezinet et al., Science 226, 453 (1984), 11 N. Clumeck et al, N. Engl. J. Med. 313, 182 (1985).

1 A.B, Rabson and M.A. Martin, Cell 40, 477 (1985).

13 S, Benn et al., Science 230, 949 (1985) 14 M, Alizon, Manuscript in preparation, F. Brun-Vezineto Unpublished dAta 16 M.D. Daniel et al., Science 228, 1201 (1985).

17 Kanki et al,, Science 228, 1199 (1985) 18 NL. Letwin et al., Science 230, 71 (1985) 19 A. Gatzar et al, Blood 55, 409 (1980).

D. Klatzmann et al., Science 225, 59 (1984).

21 L Montagnier et al., Virology 144, 283 (1985), 22 J,S, Allan et al., Science 228, 1091 (1985).

23- F, CHIVel, Manuscript in preparation, 24*- F, diMarzo Veronese et al., Science 229, 1402 (1$85).

V.S. Kalyanaraman et al., Science 218, $7 (1982).

26 I,S,Y, Chen, J. McLaughlin, J.C. Gasson, S.C. Clark and D.W. Golde, Nature 305, 502 (1983).

27 F, Barin at al, Lancet ii, 1387 (1985), 28 P.J. Kanki, J, Alroy, M, Essex, Science 230, 951 (1985).

66 29 H. Towbin et al., Proc. NatI. Acad. Sci. USA 76, 4350 (1979).

S. Wain-Hobson, P. Sonigo, 0. Dano S. Cole et M. Alizon, Cell 40, 9 19 85) 31 M. Alizon et al., Nature 3 12, 757 (1984) OV 0 ese* 0:4:: 1 -66a- PREPARATION OF ANTI-HIV--2 MONOCLONAL ANTIBODIES Different strains of mice were immunized against inactivated HIV-2 -Subcutaneous inject~ons were done each ten days, with complete Freund adjuvant (lO0p1) mixed with virus suspension With thl-, methodology anti p26 aind anti monoclonal antibodies were isolated and characterised.

The use of both recombinant protein and different peptides are actually tested and give other possibilities to obtain several r.tew specificities (for *'*.e~emple monoclonal antibody against gpl4O).

During the immunization, after two injections, mice were bled by eye ponctipn (lO0pl) Antibody polyclonal activity was tested. When this activity was sufficiently high, hybridoma preparation was done,~ the Smonocl~onal antibodies which Were producced an d ~recovered fromi these hybridoma are given hereatter With their chai'actaristics.

noc tonal lmrnunogeni isotype recognised 50% inhlibitio~n -'.Vodtes Pame J Potein of UIV-2 22 inactivated HIV-2 1 8 0:L-9 p26 p55 2 pLg/ml 32 gG2a-K of 2,5 p g/ml 4$ I IgGza-K it2 5 f4'/M1' Il2 Tgol -K O"i 0,1 umI

Claims (3)

1. 87.011001 and 87.011002 (correspondting C 3c "nc' e~g...to n 0 1-502 and 1-532 respectively) #A or a* variant of one of these retroviruses comprising all the antigens which are recognized by the antibodies raised against ::*the corresponding antigens of anyone of the retroviruses having been deposited with the CNCM or with the ECACC as said above. J2/ Human retrovirus accor ding to claim 1, characterised in that its genomic RNA is capable of hybridizating under stringent conditionsA with the complementary *chain of a c DNA or c DNA f ragment derived from the genomic RNA of anyone of the retroviruoes deposited with the CNCM Under no 1-502, 1-532, 1-642 and 1-643 and with the ECACC Under WO 0 87.011001 and 87.011002 (corresponding to n 0 1-502 and 1-532 respectively). 3/ Human retrovirus according to claim 1, characterised in that it complliaes a set of antigens formed by core proteins h~iving molecular we;tghts of the order or 12000, 16000 and I CO -0 altons respectivelir, prot6i,ne or glycoprteJA, ha'n7 molecular wieights respoctively of 00~ t3-'o daltons and of the order of 4200-1501 Q ",0tww and a, major el~velope gly-coprotijin weight of thk! order of 13,1000-1400~C 4/ Human purified 'ro~rovi,; claim 1# pathogenic f-kz man and cap, qlt'-.1ing AIDS, characteride-. by the WhOleo fOllowIL,, gooerties U 68 -tl.,e preferred target for, the HIV-2 retrovi.rus consioits of human Leu 3 cells ('or T4 lymphocytes) and for permanent cell lines derived of said T4 lymphocytes; it is capable of having a cytopathogeiic effect for the human T4 lymphocytes which it infects; it has a reverse transcriptase activity which requires the pregence of Mg%* ions and has a strong affinity for polyadenylate oligodeoxythymidylate (Lpoly(A)-oligo(dT)12-18) -it has a d4nsity of approximately 1.16 in a sucrose gradient -it has a mean diameter of 140 nanometres and a core having inean diameter of 41 nanometres;I it can be cultivated in ,permanent cell lines 0*SS expressing the T4 protein,'; -it is not infectiou's in T8 .Ayiphocytes the lysates of this virus c~ontain p26 protein which doeas not crossreact immunologically with p24 protei~n of the HTLV-1 virus or of the HTLV-2 said lyeates further contCan p16 protein which is not recognized immunologically by pi9 protein of HTLV-1 or of HTLV-2 in radioimmunopr~eipitation assays said lysates further contaia an envelope glycoprotein having a molecular weight of the order of 130,000-140,000 daltons which does not crcossreact immunologically wi th the envelope. glycoprotein, ,.p11O of HTLV-1 retrovirus:, aid Lyoates further contain a protein or a glycoprotein which can be lebelled by having a. molecular weight of the order of 36,000 daltons; the genomic RNA of does not hybridize under stringent conditions with tigenomic RNA of HIV-1 and 69 does not hybridize under non-stringent conditions either with the env gene, or with the LTRB of HIV-1 V -the genomic RNA of HIV-2 hybridizes weakly under non-stringent conditions with nucleotide sequences comprising on the one hand nucleotides 990-1070 and on the other hand nucleotides 990-1260 of the GAG region of the HIV-1 genome. Retrovirus according to anyone of claims 1 to 4, characterised in that it does not multiply in chronic fashion in the lymphocytes of macaques rhesus monkeys, when it has been injected in vivo and in working 00*conditions which permit the developmient of the STLVIIInse virus, a.j have been described by Letvin et al, Science* (19n) vol. 230, 71-75. 6/ The retrovirus of any of claims 1 to 0000 characterised in that the sequence comprising the R region and the U3 region of the sequence comprising its genomic RNA also contains a nucleotidic sequence eg which corresponds to the follow~ing nucleotide sequence 0001 ft 0..I I 'QAAOOCCACACTOAAhCGAGAAATACTOAGAAcJ4 0care AccTTCTLATA GCcrGC.Jzt~ *j Am)4_/ 70 7/ Retrovirus according to anyone of claims I to characte~rised in that its genomic RNA contains a ciag sequence corresponding to the following nucleotide sequence Q** off* C/O 0. so A I 0 CLTAGCCCCATCAACCCAO'.UGICACAGLLAALACAO1?OL Ti"CCAACTLACTACT 0C CGCCGLMCAJ.MTAC TrCAco A6 CA .AGG AA A OCiGAC C. *9 CCTACLACACCCCACCCCAAATGCACCATTA7G 00 CAT CAC C COCTATCA.L A CAACCCT CMAACU 000 iCATACAATTOATCCMCTCGCCGAACACCCCCACA~ 90 AMO~iACTU.AT-ATC7C -CACTCACATCCACC.CCA ACA GCACAAGIOACA CGA ACCC CLLACACCC *1 0 '00060 0 0 000000 0 *000 0 00 00 0 00 0 0 00 00 0 0 4060 0000 0 00.0 0000 0 00 00 0 00 00 0 000 0 0060 0 0 0000 *o 0e 0e 9 0 0 w 72 MCCT CCCAACOLLTACAT CTXCAJ CACCLA CCU S 000 C"?CCACCGGTCAGGCAGACCCCCCACSCCA A" CALATCAGC CCLA CGCCCLC ?C CATA C ACT JCATCTACCALACCCACCG CACAICAC"ACLCCACCJC?@ ACA.CGACTCAACCACAC GCACTACLAAICC"CCACA *120 GCACCTAAA??AGCALACCGCLCl4gCA2CCCCA CCCA 100000 CMCACAGCGACCGC"CACCCCCCCCGC-cccae. 00 CTCCTA C CCA??CA C C A G CCCCAAACA CG CA CTA@ CCA CA CAA!C CALA Ci CCC CAt CA. CCT Ch CLTOC AC0- C CCACCMOAAO AACAC.CCTCALACCCLTaACccjcGjGAO TGCTCACLTAATCCCCTCAATCCAACA CjU?c~a .2 j -73- 8/ Retrovirus according to anyone of claims 1 to 6 characterised in that its genomic RNA contains a env sequence corresponding to the following nucleotide sequence 0 96 00 00000 000 *01 0 0 sees T0 74 INTLE 4, 0 es too a *at* JTOAT CA.AT;Ar.CTr.CTTATTGC'CAITTTATTACCTACTGCTTiC TTA riA TITT BCAC C CIA TAT GTAACTGTTTTCTATC CC CTAC CC A CGT C GAAAAAT C CA.ACCATT CC CC TC TTTT C79CAAC CA GIAAt 100 ACGOATA CTTCC GGAACCATACAGTGCTTGCCTCACLAT CAT CA? It a. 1 0 0 0 iACACC-A-AATAAC'rTTGAATCTA,&CACACOCTITICATC.CLTCi 204, AATAATACAGTAACAC"C"GCAATAC"CATgTCTGOCATCU TT CCA CA CATICAA TAAAA C CAT 441CAAAC TAACACC TTTA TbI 301 CTACCAAtG"ATOCACCACCACACAGLGCACCLCACCiLACJLAC ACAACCTCAAACACCAC"CCACAACCAC"CCACiCCCACAGAi .400 CA;GAGCAAGAGATAACTCAC-CATACTCCATGCCCiCGCOCAGAi AAC TG C 7 CAG GATT CPGCACACCAACAAA CCATCIAITO C CAOTTO AATATCACACCATTACAAACACATAAGAW"CACTATAATCAA ACATCGTACTCAAAACATGTr.CTTTiTCJLCACA.AATIATACCACL AAT CAGA CC CACTGTTA CAT UACCATTG CJLA CACAT CACT CATC 600 ACAGAATC4TGTCAC"CCACTATTGGCLTGCT.&TAAGiTTTACA 'tACTCTGCACCACCCCC-,TATCCCCTATTAACATOTAATCATACC 700 AATTATTCACCCrTTaCACCCA.ACTCTTCTAAACAGTACCITCt 0 40 a 6 C 600040 S 0 000... 0 ~h Og 00 S S. 0 0 0* *~a S 0 00 0 o* 9000 0 -74a- LCATCECACCAGATCCGAAACC CAAAC??CCA'eA?CT?CG@ TTTMATGCCACTACACCICGACAATACAALCAUULTCTAUICCCAt 0 OCAGL CAT AA A GAAC TAT CAT CAC CC TTAAACAAATATT CCAC?TCCA?!CTTAACACCCCAC CG.LATAIACCICTCLU.CLLk AT*G TTTCGACTQG T CA CCATCCGS o A TAA TAA CA CCA CACCA CAT CIG TT CA AA CAC C 6 0 ACAATAA.GAAhCCCACACAACCGTCAACCTCALA CAAALCGCCLCACACCTCAAGLTCCAfGCAACACAwTC TCATATCACATCACCCLCCLATCTATLCTCCCT 100100 CAC ACC C CACC GAO G AG C TLCLC? At T AT 1401 CCAAGLAAAAGACCLCACCA.LTTCAC~CGCCCALA 0 A4 kT O i. -74c- ATCC AACC ACA!t. .CC a~ CC!CAG CCACCCMACCIAAAAA CA *CdLCAAGATTCATACA TCCG T CCCC CA CG?CGCC 240 GACCAAGCA?ACAT??CCC 0CCACCAGCGACTGCCC ?7iCCATCAGACTACTTCACCACCGACTCACAiCCGACC& 6000 e4 AAg. CCCT COG TTg ?C CAAC CATACTAC CAOCCACACAGC 6S...C~ N, -74b- A CMAAAAAAAGATACTCC TC ?CCACCCGAGACATACLACA 0 1500' GGTGTGTCCGTOCTAGG TTC TCCG?TTCCCCAACACCAC G? ?C GCAA TGGCCC TCGAG CC G CC C TGACCGTGTCGGCTCAGT CC 1600 **w *0fCAA.C CA.AACCTCC A AGTC OCT AC AGT C0 CCCACCACCGCGCOGCACCA.4CLCCACAG.CTGT6 6O 4h 0 0 C T A T C A AA A C C T O A C AG CL A A T S 00 CCCCAT GC.CAATCATACGTA ACC?CTA AACCAAACCGCCA.UATCACTAUAiCLACTAQ AGUCACOATCAC0CTCAATAGTAGCGCO?AA 0 100 egoCLACCCCTITTTICTCTTCCCCCGTTAGACCUCA 0 4. r I. A 7d 0. 44 a 0 *00 9/ Retrovirus accordi'-, to anyone of claims 1 to 8, characterised in that its RNA does not hybridize under stringent condi~t ons with the genomic RNA of HIV-l and does not hybridize under non-stringent conditions, with the env gene and the LJTR close to it, more particularly witt the nucleotidic sequence 5290-9130 of HIV-1 and does not hybridize under non-stringent conditions with sequences of tihe pol region of the HI'V-l genome, particularly with the nucleotide sequence 2170-2240. S '.55 0* S. S SO S S S 0 *SSS *5 S S 0 Tho rettyirus ef anycr.C ef elaims whose RNjk virtlially hybridizes neither with -NV gene and the LTR close to it, particu with the nucleoti- de sequence 5290-913 RtV-1, nor with tne sequences of the RO 1xon of the HIV-l genorne, particularly with th~ ~~~teu.e nuloic 9rz 170 224O3'-0-+-" A composition comprising at least one anti- gen, particularly a protein or glycoprotein of HIV-2 vi- ,ccorc~ing to anyone of claims 1 tp q 4,Lw. 8106lit.0The composition of claim /0 which consists .q:of total extract or lysate of said retrovir's. 1 Aa3,2 The Composition of, claim 4 R9 wherein said antigen consists of at least one of the internal ccr proteins of said virus, particularly p12, p16 and p26, have apparent molecular weight of the order of 120000t 16 ,Q00L and-'2 6, 000, 13 4.,The composition of, cla im4*, characterized in that it contains a gpJ40 lycoprotein having an ap- parent molecular weight of about 130,000-140,000, S. 20 An antigen which provides a single b~ound in electrophoxesis on a polyacrylamid gel which coillpri- ses, in common with one of the purified antigens of *GeVHIV-'2 retrovirus, an epitope that is recognized by the serum of a carrier of antibody against HI-,Q~pv- 9ISA purified antigen hav-ing the immnunologi- cal characteristics of one of the following proteins or glycoproteins of HIV-2: p12, p16, p2,6, p36, p42 and g p14 0. AQr% -i Ae) A n antigen of claim 4~ 4:3 which has the ami noacid seq~uence or a part of said sequence recognized by anti-p12 antibodies A'p ~'VT 0'< 76 JrSLysAlaPbeLyx 0000 ysTrpsaysIy~yt;CyisSeiAlaArgC;InysArg9 ~e A~~ro~r~rgG~G1~Cs~rpLysCysClyLysrGlylis 1eOtT1rAsnCyrPoAspAr-clnAlaG ly;PeLeuGly~e S 1300 GlyI~ro~rpGlyLysLys~roAr-,AsnFliePro)ValAlaG~nVal ProG 11yLeuTrPoThrAlaPro~roValApProAlaVal 00 oAspL~euLetiCluLysTyrtie G),nGlnG 1400 0500LeuGlUG~nGlyGluThrProTyrkr-Glu?roProTbrcliuAsp ~Z500 BI LJU I An antigen of clairn 1 M which has the fol- lowing aminoacid sequence o, a part of said sequence recognized by anti-p16 antibodies lie tGlyAl a 'rCAjn~erVaiLeuAr&G IyLysLys AlaispG I LeudluArglleArgLenArg.Pro~l 3 ClyLyr.LysLy3YrArg' *:..:L~uLysHisIeVa.ITrpAlaaAlannysLeuAspArPb-Gly 10 S LeuAlaGluSerLeuLeuGluSerLysClu~lyCysGlnLyslle %se -*Luh' 1e.s~oeCVal.ProThrClySerGluAsnLeu *S,00 200 e LysSerLeuPbeAsnThrVa iCys ValIleTrp-CysIleI~isAla GluGluLys Va1LysAspThrGlu'GlyAlaLysGlnl leValAr 1 0000 S00 ~Ar S is Leua lAiG luT~rGlyThrAlziGluLyslle Oro Ser TbrS;rArgProTbrAlaProSerer'cluLysC~Glys~ 400 :%ego S 0 S a e.g. S. 0e. I 49 6* 0 0 t~ *0 S. C 0 I C 0* *0 0 S* C S *S9~ C C* CS a a S 78 An antigen of claim, which has the f ol- lowinq ainnoacid sequence or a part of said sequence recognized by anti-p26 antibodies: ProV IGlnHisValGi yGlyA.,nTyrTlhr'isIleProLeuSer ProAr,-TLvrLeu.AsnAiaTrpValLysLeuValGiv.GluLysLys' whbeGlyAlaGluValValProGiyrheGInAliLeuSerGluc1 7 500* CysThrProT~li. IleAsnGlnlletLeuAsnCysVa1GCyAs; His G nAaAallIerClnhieIleArt'C~ulleIleAsnGluqc.1 AiaAiaCiu~r~nAspValGnisPro~ilep'-OiyrroLeuProI AlaC IyGIn~euA'r-.GuProArgCiySer.&spIleA'lawlyThr 700 27hr~e rThr VaA 'Ii GluGlnIleC inT'rptletLP1eAra-ProGia Gi yLeuGlnLysCysValAr-11et7vrAsnProThriaIle.Leu AspI ieLysGlnGlyProLysciuProPbe-GlnSerTyrvalAs.. LysAsuTrpflletThTGluThrLeuLenValGIcnAsnA',kaAs;Pro. As pC ys Ly Len VaLeuLysac yLi uGlyl. tAs nPr nThrten
2. 1000. GluGlu~etLeuThrAlaCyGtnc 1ValGlyGlyProGlycln 'LysAiaArLeut-!e't~iacuAla~euLlscluVa1leclyPro 1100 AlaP rzIieProPheAlaAlaAIaG Ijnl IT 0 0. *00 0 icl, 79 1 An antigen of claim4W ,-hiich has the fol- lowing aniinoacid sequence or a part of said sequence recognized by anti-gp14O antibodies ENVRI 1I-et!etAsG~nLeLeuIleAlaliO-LauLeuAlaSerAlaCys Le uVa iTyr~ys'fbrG inTyr Va lThrVa iPhbeTyrGl1y~a iPro 10 Th rlrpLy sAsnAl aTbrl eP roL euP heCy sAiaThrArgAsu ArgAs pThrTrpGlylhr Il eG InCy sL euProAs pAsmAspAsp T y rG 1nG I uII e ThrL euA s nVa 1Tbhr GlIuAIa Ph eA spA 1a Tr p 15 200 AsnAs nTbhr Va 1th r Gru G InA AaI11e G IuA spV a 1T rpH i sLfu Phb e G 1uThr Se r 1 e Ly s P r o Cs Va IlLy sL e u ThrP r oLe uCy S 300 V a I Ala 11e t Ls C y sS e rS e rThrGlIu S e rS erThr G 1yA snAs n T b r TbrS erLy sS er TbiS e rT hr Th rTh rTh rTh r Pr oThr A s 0 400 G InGCl nGlulleSe rG luAspTbr~roCysklaAr',AlaAs 1 A s nCy gSe, r G IyL e uG 1 yG lu G I uGC lu Th I I eAs mC v s C n P be AsnlletThrGIyLej.CiuAr, AspLysLysLy sGlnTyr;Sncha 500 0 ThrTrpTyrSerLysAspValValCysG 1uTh:zAsnAszSerThr As tIC n T r C lC y sTy et A rn!i sC v sAsti Tbr Se rVal1 l1e 600 Thr~luSerCysAspLyslU TyrTrphspAlalIleA.--PheArL 0 0 0 TyrCysAlavroProGlyTyrAlaLeuLeuArCysAsnAspThr As TtirS erG lyPbeAla} oAs uCys SerxLys ValVa lAlaSet 0 TbrCysThrAr-.MletiletGluThrGlnThrSerThr7rpPheGly. 800 PheAsnGlyThrkrcAlaGluAsnAr-ThrTyrIleTyrTrpEis GlyAr-AspAsnArgTbrI eleSerLeuAsnLysTyrTyrAsu 6 6900 LeuSer.LeuE.isCystysArgProG lvAsnLysThrVa lLysG 1n 01000 Goo 0 66 lrplesly~n~s~rgrrotrgrlnAsTrySrplPr~ys~illy 100000 IlTrpryseSAl a G iluValy~hLeuA 1 a-Lys~ls~eo yA g y rGLy LTasnGlul.pThArP r o1 eS ePh eA 1aP ro 666 NT# 06 6 81 ThrLysG luLysAr.*TyrSe rS erAl aH isG IyAr.- i sThrArg 1500 G ly Va lPhe Va lLeuGlyPh eLeuG lyPh eLe uAl aTb rAlaG ly Se rA lal-e lyA laArgAlaS erL euThr Val15e rAlaGInS er *:see: 1600 ArgTbrLe'xLeuAlaGlyIleValGinGlnC1nGlnGlnLeuLeu 0S 0 000 AspValVatLysAr&GlCnnul-euLeuAr-LeuThrValTrp 0170 S 0 GlyThrLysAsnLeuGlnAlaArgVa 1TbrAlaIleCluLysTyr LeuGlnAspGlnAlaAr-Leu. snSerTrp~lyCysAlaPheArg 0000 1800 see@ GinVa lCYsHisThrThrVa lProTlrpVa lAsnAspSerLeuAla ~ProAspTrpAspAsnlletThrTrpGln~luTtpu~ysClnVa1 4~ 0 TrA~ylleG1'aA;AslI l~Se~s SLeuGr;rup~Ly;~ 02000 TyIeG 1 n rGlyasnl~LeuC~a!lafa T1 s Le ner 2000 GlyTyrArgFroVa1Phe~erSerProProGlyTyrIlelnc~n 82 IleEisIleEisLysAspAr G1yG~nProA a sn1uC1uT' 2200 0 Glu~luAsp~ly~lySerAsnGlyGlyAspAr-TyrTrpProTrp *230 0 ProIeeAhr~erIle~es~he~euI1nArgGeh~euIse~gleu 0e GlyuAysrgetly~erITe~Arg~asLu~luleAerg 2302500 :0*40 ~~ArgaL L e u G~r~ IaTh et1aV e uG l 1 arGGlI y r -u L e inyrC 02600 0000 ~GluAla~he~yn~yaly~ar~ ~rrGuh~u~ n Oe i 83 SO, Ia. A method for the in vitro detection of the presence of antibodies against as&f*HIV-2 in a bio- logical liquid, such as a serum, more particularly for the in vitro diagnosis of a potential or existing LAS or SAIDS aused by HIV-2 type retrovirus, which comprises contacting a serum or other biological medium from the person to be diagnosed with a composition according to anyone of claims 8 to 11 or with an antigen according to anyone of claims 12 to 17, detecting the immunological 0 0 conjuguate possibly formed between said anti-HIV-2- 10 antibodies and the antigen or antigens used. The method of claim %t which comprises so achieving the detection of said immunological conjuguate by reacting said immunological conjuguate possibly for- med with a labelled reagent formed either by human anti- immunoglobulih-antibodies or of a bacterial A protein, and by detecting the complexe formed between the reagent and said immunological conjuguate. Kit for "the detection of anti-HIV-2-anti- bodies in a biological fluid, particularly of a person possibly carrying such antibodies, which comprises a composition such as defined in anyone of Jo 13 claims *4 to 4= or an antigen such as defined in any of •CO *claims 14 to 19 and S 25 means for detecting the immunological com- plexe resulting from the immunological reaction between the antigen and said biological fluid. 3T. The kit of claim 21, whose means for de- tecting the immunological complexe formed comprises hu- man anti-immunoglobulins or a protein A and a means for detecting the complexe formed between the anti-HIV-2 antibodies contained in the detected immunological con- juguate. sZ. Immunogenic compositions containing an envelope glycoprotein of HIV-2 retrovirus, such as gp140 -II -11 84 of said retrovirus,~ or part of said glycoprotein, in association with a, pharmaceutically acceptable vehicle appropriate for the constitution of vaccines effective against HIV-2. 94. The composition of claim 24 which contains 'at least part of an immunogenic glycoprotein comprising the proteic backbone having the following sequence got* BA 006004 0 U NT6 ENVRI le tIle tAsnG lnLeuLeu I leA 1 a IleLeuLeuAl a SerAl ajCy$ LeuValTyr~ysThrGlnTyrVa lThrVA I*Ph eTyrGlyVa lPro ThrTrpLysAsnAlaThr I IeP ro~euPheCyskLazThrArgAszn 100 AroAspThrTrpGlyTbr I IeG lnCysLeuProAspAsnAspAsp TyrGlnGlulleThxLeuAsnVal~hr~luAl!aPheAspAla*r; 6 go 0 .116 200 sees ~AsnAz nThrVa lThrGluG lnA1alleG luAs pValTrp i sLeu Ph eGi uThb'rSer IleLysP zoCys Va iLy sLeuThrProLeu Cys 6.0:4 Va lAl alle t~ysCysSerSe rThrGluSe rSe rThrGlyAsnAsa ThrThrS erLysSerThrSe rThrThrThrThz'ThrProThrAs p 400 GlnGluGlnGluIleSerGluAspTbrProCysAaArgAlaAsp 0 AsnrCy sSe rGlyLeuGlyG luG luGluThrIleAs ~slnPhe Asnile tThrGlyLeu~luArgAs pLysLysLy sG InTyrAsnG lu 500* r~hrIrp Tyr SerLy sAsp Va Va1 y sG luTh 7AsnAsnS erThr; As n Gn Tb rGinCysTy r Iie tAs nEis Cys As nThr S er Va 11e 600 ThrGluSerCysAspLysii-isTyr~rpAspAlalleA~tgPheArg Tyr Cy sAl aP roProG I yTyrAl ateuletArg Cy sA snAspThr 700, As nTyr Se rGlyPheAlaProAsnCysSerLys V; Iva lAl aSer I 86 Tb rC ysThrAr0g?! etiie G 1uThrG 1nThrS erTbrlrp~he'G I y 800 PbeAs nG 1yThrArSA1 a GuAsmArgThrTyr I I eTyrTrpH is clyAr -As p~nArSTh I Ie I IeSerLeuAs nLyETyrTyrAso 901) cc:.LeuSer.Leu~isCysLysArgProG I AsnLysTbr~a ILys C Ii I l Ielle tLeuIle tSerGly~is Va IFbeHiz.*SerllisTyrG1I Dro 1eAsnLysArgProArG 1n.A IaTrpCysTrpbeLysG IyLys %age rpLy sAs pA I ll e GInG 1u Va iUy sThrLe uAlaLysH is? ro 1100 0 Pro~lyLys~lySerAspProGluValAlaTyrlietTrpThrAsn CysArgGly~luPbeLeuTyrCys~snlle tThrTrp~beLi.uAsn 12u0 TrpIleGluAsnLysTbrEisAr-AsnTyrAlaProCysEisIle Lys~illeIleAsnaThrT.-pF-is~ys'VaClyA-OAsnralTy; 1300 LeuProProAr-GluGlyGluLeu:Se-Cys;AsnSe'rThrV-a Thr SeI I e 11 e A 1eAspTrpC1nA I yU A s t r P a 1 G I P b c 87 TbrLys~luLys A rTyrSerSerAl'aHIs G 1yAr-HisThrArg 1500 3 GlIyVa lPheVa ILeuGlyPheLeuG IyFhe LeuA Ia TbrAlaG 1y *SerA IalletG IyA I Ar-AlaSerLeuThrVaIS er aGnSer' 1600 ~eArSThrLeuLeu A aG lyleVa 1G InG nG nG nG lnLauL eu As pVa IVA tLjskrZG nG lnG uLeuLeuAra.LeuThr~a ITrp 3 1700 GlyThrLysAsnLeuGlnAlaArZa lThz-AlaIleG lu~ysTyr **eLeiaGlnAspG InAlaAr-LeuAsnSerTrpG yCysAla~heAr& *1800 GlaValCys~lisThrl'hrVa Uro~rpVa UsnAspSerLeukla P roA4,,pTrpAspAsntie tTh-:TrpGlnG luIrpG luL,y sG InVal rA TLe G1 1aAs'nIleSeysSeru'it;1nakarij 1900 IleGlnGln~lutysAsnllet~yrGluLeuGlnLysLeu~zsnSer TrpAspt~ePheGlyAsn~rp?he~spLeuThrSerTrpValLys 2000 Tyr 1IeGlnTyrGlyValLeul ell1eva !1 aVa IT I e;,IaLeu A: 13eVa 11 leTyrVaiVa lGln~le tLeuS e :~geA~y 2100 GlyTyrArgP'roVa tPbeSerSe-rProProGlyTyrlle lnGI, Ta 88 Ile~islIe~isLysAspArZGIyGIriProAlaAsnGlu~luTh? 2200 G IuG IuAsp I yGl yS erAsnC;I yG yAs pAr -Tyr~rpP roTrp Pro IieAla TyrIl eRis PbeLeul.2eArgG~nLeuleArgLeu S. LeuTbrArg~eiuTyrSerI1 eCysAr-AspLeuLeu~er~r& Se? 2300 PbeLeuThrLeuGlnLeuleryr~lnAsnieuArgAspTrpke~u Ar-LeuArglhrAl aPheLeuC lnTyrG lyCysG iuTrp;IeG in 2 400 GluAlaPheGlnAlaAlaAlaArgAlaTrAr'GiuTh:-LeuAla 0GlyAlaCysAr-gGlyLeuTrpArgValL~uGluAr-IleG*lyArg 2500* sees ~G 1 yI eL euAI a VaIP roAr A r ZI IeAr -G IuG 17A 1aGlu I I Al aLeuLeu*G IyThrA 1aVa 1 S erAl zGlyAr- Let~yrG lu 2600 T y rSer1 I;ProSerSerA S sC1yGIuLys beVa1 Gln.Ala Tb r LysTyr Gl1y 89 ~.The immunogenic qOmposition of claim 24 or As ci :~which is dosed in antigen in order to enable the administration of a dusage-unit of 10 to 500, parti- cularly from 50 to 100 pg/kg of bodyweight. 26'Monoclonal antibody characterized by its ability to specifically recognize one of the antigens aRccording to anyone of claims 19 to 19., U. The secreting hybridomas of the monoclonal 'e~~cantibody of claim4 '4' 10 .Nucleic agiLds, 6p0ional y labelled, deri- ved of part at least of ANA of HIV.-2.kxu or of one of its vwtriance. 2PThe nucleic acid of claim 217, which con- tains at least part of the cDNA which corresponds with entire genomic RNA of HIV-2 retrovirus,, ,ges 2*1 The nucleic acid of claim 217, ','hich con- tains the nucleotide sequence GTGA~AGGCGAGACTGAAGCAAGAGAATACCATTTAGTTAAAGGAC-G se WGAACGCTATACTCGTAGC CGAG-ACACCWACG1 1 ACTACA6rCCGAGCTG2AC.GGAGGACAGG GAGTGGACGCZATATCC~TATAATATACCCGrTGC'T7G C) CACTIcGCCGGGCTGGCAGACGCCcAGC 1A ACCTTCCIIXATAMAGCI'GCGTAGAAGCX .1 0 0 .000.0 0000 000 **do 000 *00 34- The nucleic acid of claim, 27, w~hich con- tains a nucleotidic sequence coding for at least part of the,aniinoacid sequence indicated hereafter GAGRO DlI MetClyAlaArgAsnSerValLeuArgGlyLysLysAlaAspClu Leu~l uArgI leArgLeuAr.-ProGl7G lyLys Lys LysTyrArg teuL~sHis IleVa lTrpAla.AlaAainlqsLeuAspAr-PheG ly 100 LeuAla~luSerLeuLeuGluSerLys~luGlyCysGnLys~le LermThValLeuAa;Fro~1e ValProThrClySerG~uAsnLeu 200 LysSerLeuPheAsnThrValCysVallleTrpCyslelisAla GluG iuLy G ValLyAs pTr luGOyAjaLys G n I e Va lArg ArgHis LeuVa lA laG luThrGlyTbrA laG luLy stIco ,ProSe r TbrS;rArZFz S 4' t9 G iLYsG lyG1 *400 P r o Val C I u~ 2. s V a 1 GC1 y Cly A aT y rThr;H Is IIe Pr oL e uSe r Pb eG 1 A I;lu Va 1Va1 ,o G 1yP h eGInA 1a Le u S e rGIuG 1y 500 00 ACI aGbyG noc~yr&p luP roGAt& Ie reAs p IysAal ly~hr 600700 ATarlaelTrpAspla lloilla~rletrobeyrQ&Pro /4 4% ~44 A~ 4K-k S S S S 060600 6 6656 OS 66 S OS 6 S. 66 S S 0656 0650 6 656* 06 @6 6 O6 6S 0 066 0 5606 6 6566 05 9 6 Aan 4 Pro"Va11. oValGlyAanlleTyrArgArgTrpI71edflIlle- Gl yLeuGlnLysCysV- 1ArgIetyrAsnPoThAsnIeLeu Aspl leLysGlnGlyProLysGluPro~lieGlnSerTytValAsp a 900 Ar-.PbeTyrLysSerLeuArgAlaLuG ln'bhrAspPtoAlaVal LysAsnTrpl-e tTbrGlnThirLeuLeuValGlaAsnAIa~nFlro AspCysLysLeuVa1LeuLysGly~euGlytletAsnProT".rLeu 1000 GluGluMetLeuT1arAaCysGnG lyVG iGlyPro IyGlu Ly sAla~krgLeutdle tAlaGluA1.a~euLysG luVa II leGlyPt a 1100 A1,aPrQlleProrheAlaAaAlaGl~GnArLyAa~heLya CysTrpAsnCysGlyLysCluGlyHis SerAlaArgGlnuCysAr; Al*o s~ cGn *y 1200 Ala~a~.gA~~lnly;sTrpLysCysGlyLysFroGlyHis I lelle tThrAs nCysP roAs pAr.-G lnAlaG lyb eLeuG tyLeu 9 1300 G lyoTpGly.ysLysProAt-Asnpbe~roValAlaGloVaI P roGinG~yLeu.Th;ProThrAl a~roPro VAlAspproAlaVaI 1400 4 Cr nArG urPoTyrLy sG uVa ThrGuAsp LeuLeulis LeuGluGlnG'lyGluThrProTyrArtC uPro~r oThrG luAs p LeuLcuflisLeuAsaSerLeuPheGyL-v AspGiu RAZ _Tr f 1100 -S AlaPr'I~~eProPheAla.AlaklaGC 92 I ~3 3M.' The nucleic acid of cl.anm 27, which con- tains a nucleotidic sequence coding for at least part of the aminoa~cid sequeric. indicated hereafter: Ar&LysAla~belys AlaProArgrA~GCnGIyCysTrpLysCysGlyLysProGly~is 4,10 11 e;tT rAsnCY;P roAs pAr-G 1nA IaG lyP heLeuGlyLeu es 1300 GlPor~yysy orAs~ eProVa lAlaG1nVa1 P roG zG 1 yLeuThrProThrA 1aP roFro Va 14;spP roAla K pL.euLe uGIu Ly sTy,1 e tG 1nG 1nG 1Ts Ar aG Inrgu 1400 G InAroG 1uAr -P roTyrLy s G uVa IThrG 1uAs pLeuIeu~lis Leu~luGlnC 1yGluThrProTyrArG luProProThrGluAs p LeuLeuHisLeuAsuSerLeuPheGlyLysAs pGln 1 1 93 32. The nucleic acid of claim 29, which con- tains a nucleotidic sequence coding for at least part of the aminoacid 5equence indicated hereafter Miet~lyAlaz'rgAsnSerValLeuaArgGlyLysLysAlaAspGlu Le uG uAr g 11eAr gLe uAr&Pr oG I.'C1Ty s Ly sLy s TyrAr g 10 LeuA Ia GI u Se rLeu Le u G uSe rLy s G lu GyCy sGInLy s 11e) *LeuThrValLeuAspProllet*ValProThrGlySerGluAsnLeu 200 Lys SerLeu?b- suThrVa I1Cys~allIeTrpCys't~e~fsA~a *-Zee G IuGluLys Va1LysAspThrGUuGlyA IaLy s GiIle Va Arg SB *300 Ar g ,isLe uVa IA 1wt.G luThrG I yThrAlaGl1uLy s~e r.Pra Se r Thr SerAr-ProThrAlaPraSerSerGluLysGlyGlyAsnTyr .Bg~ 400 Osoq r I 1. 0 ee..s 0 0 *00060 0 OOSS 0S 0O 0 S S. 5 0 0060 a 0050 0000 S S *0 S @0 S. I CSO 0 SOS. @55. *5 00 S S 0 94 24. The nucleic acid of claimi 29, which con- tains a nucleotidic sequence coding for at least part of the arninoacid sequence indicated hereafter Pro Va lGlnIijVaIGlyGlyAznTyrThrHis IleProLeuSer IroAr-gTbrLeuAsnAlaTrpValLysLeuValG luGluLysLys* PhbeG 1y& Ia GluValVal1?roG I yheG1 ala LeuSerG luG Iy $00 0 10 CysTbr~rc Tyr.AsprmeAsmG I n~etLeuAsnCys Val I lIyAsp His GlnAlaAlalle tGlaiI eleArGlullel leAsnGluGlu 600 AlaAlnG 1u~TrpA~pVa IC InHfL1sProtllePro GlyProLeuPro klaClyG~nLeuAr-GluProArg~lySerAspIleA~1aG lyThr ThrS,!rThrValGluGluClIleC lnTrpt-e t~heAr-,ProCln Ann? roVa11'roVa1G1AnIIeTyrAr&Ar& Trp I eGInI le GlyLeuGlnLysCy ;Va 1Ar-litTyrAsuProThrAznI1 eLeu AspIleLysC1nC17ProLysClu~roP' eGlnSerlyrValA4i *900 Ar gPhnefyrLys ~erLeuArgAlaG luG 1~ ThrAs p1roA1laVa 1 Ly s As ~r pl-e tbrC lnThrLe uLeuVa IC 1AsuAl a~snro AspCysLysLeu Va lUeuLy sG lyLeuGlytle tAs n~rolhrLea 1000" GluGlti)ieELeuThrAlaCysC luGlyVai~lyGlyProc lyGlin LysA~aArgLeti~etaAlaGu&aLeuLytluqalIle ;lyPro AlaProtle?-o'eAlaAlaAlaIGl NT The nucleic acid of claim 29, which con- tains a nucleotidic sequence coding for at least part of the aminoacid sequence indicated hereafter Me t~e tAsnG lnLeuLeuI 1eA IalleLeuLeuA 1aS erA.aCys Leu Va lTyr~ysThrG inTyr Va lThrVa lPh eTyrG 1y Va 1?ro Thrlrpt ysAsn,'laThrl ePro~eu~heCysAl aThrA--Asn* 0 100 Arg~sCy slLpe y hrrlo An sspeA sonspssnAs s p 2 00 A snAs u Th rV a 1T hr G IuG InA 1 II e G1 uAs pV a 1T r pHi sLe u PheGluThrSerIleLysProCysVa lLysLeuThrProLeuCys 300 Va 1A1ple tLysCysSerSerThrGluSe zSe rThrGlyAsmAsn *seesThrThrSerLysSerThrSerThr~bThlTr'hrThrProTbrAs p 00400 'SGlnGluGln~luIleSerGluAspTbrProCysAlaAr-AlaAsp AsnCysSerGlyLeuGlyG'GluGluThrlleAsnCys~inPhe AsniletThr~lyLeuGluArgAspLysLysLysGlnTy~smClu Th~pT' S erLy As pVa 17a 1 C 1 sG;IuThrA s nAs nS erThnr As nGlnTr nCy sTyr1. e tAsnE isC.sAs nTh rS e r T"aI Ie 600 ThrG lu S erCysAs pLI-ys 11is sTyrTrpAspA I aI I e A Pbe A r Tyr C ysAl aProProG 1 yTyrAl aLeuLeuArt:C ysAsnAspThr 700 Asn~yrSerClyPheAl AProAsnCysSerLys Va IVaA aSer 96 ThrCysTbrArgliet}1etGluThrG lnTbrSerThrTrpP'heC ly 800 -PbeA ;nCyTirArgAlaG~uAsn~rgThrTyrIle~yrTrpHis GlyArg-Asp) snArgThrIleIleSerLeuAsnLysIyrTyrAsfl @0090 *900 LeuSerLeu~i,sCysLysArProclyAsnLvsThrValLysGfl 1* T~Ile U e tL eu 1e tS erG 1yE isV alPh eH ES e r is 7yrCl n~rD IleAsnLysAr;ProArg-GlnAla~rpCys~rpPbeLysGlyLyS 1000 TrpLysAspAla~letGlnGluVaiLysThrLeuAlaLys~is~ro A-ngTyrArgGlyTbrAsnAspThrArQAsnI1 4SerPheAlaAla *lo 1100 1Fro~lyLysG lySerAspProG luValAl aTyrIle ;Irp~hrAsn CysArtgGlyGluPbeLeuTyrCys;snI-letThrTphetAs 5Trp11 eG 1u~nLysThrR17,AranAsnTyrA a~r oCysflis Ile LysG~nlleIleAsu'Thr7:pF-i*s~ysValGlyAr-AsnoVallyr *1300 L euP roProAr-GlCu Gly C1u L e uS erC ysAs .S e rT h rV a !T7h SerlleIleAlaAsnle.splrp~lnAsnAsnAsnGlnlhr-kso IleThr~beSerAlaGluVa1AlaGluLeu~yrAr.LeuC~luLeu GlyAspTyrLysLeuValGluIle tbr~rolleGlyPbe.Ala~r. 97 ThzLysGu sArTrSerSerAIaaisGIyAr-HisThrArg 1500 *GlyValFbheVa 1LeuG Iy~heLeuGily~heLeuAl a~hrAlaGi1Y SerAla1-le tIyAlaArgA1aS erLeuThrva 1SeAail 0 1600' 6 A r gT r L e uL e uA 1y a'GIL e Va I Gi1:1. G n 1 m Gi1 inL eu Le u A sp Va 1iVa I L s Arg G nG I n G uL e uL e uA r-L e uTh r Va 1iTr p 1700 001800 09Slvs r e u U, Leuglnr~spGini~aAs'nleuGr.Sr Glys leargi 01900 *2000 ~Tyrlli ln~ai~ysihrVneIlro'trVa I~Asp~aeIl eAlae P r a s T a seyVa~ 1G MetThr n tCe S e r pG2. Ler, y LyCinVs '2100 AyTyr~ru~iuA~aIsnIeeSer~rors~yer~e~uIle Ian 98 IleEisIleEisLysAspArgClyG~nProAlaLsnluGluThr 7200 G C1u G uAsG IyG yS erA SnG lyG yA s Ar-7yrrpr oTrp 902300 em:.ProIlA~yrGlyeuispheg~euI euGnlurgIerGleu *2500 AlLeuALeuyrGlyerIlaeaysrAsle~lyLu rGl 230600 Tyr eerleuGI;ProeuI er~~rLe y luxsPbi-pL.1 AGlneuarThr~LaP'nelyu ny~yy~ur~el NT9 1 I S 9SSS@ S.. S I. S SS S *1 S S. S: @65 S 37, 99 The nucleic acid of anyone of claims4 1 to 34 which is formed a recombinant nucleic acid comprising a nucleic acid from a vector and in which said cDNA or part of said cDNA is inserted. 37 l. The recombinant nucleic acid of claim 1 which is labelled. 3IS. A process for the detection of HIV-2 re- trovirus or of its RNA in a biological liquid or tissue, particularly for the in vitro diagnosis in man of the 10 potentiality or existence of LAS or of AIDS, which com- prises contacting nucleic acids contained in said bio- logical liquid or tissue with a probe containing a nu- cleic acid according to anyone.of claims 28 to 36 under (as a stringent hybridization conditionsAfor the time neces- sary for said hybridization to occur, washing the hybri- de formed with a solution ensuring the preservation of said stringent conditions, and detecting the hybride formed, W. A process for the production of HIV-2Are- trovirus which comprises culturing human T4 lymphocytes or permanent cell lines derived from said T4 lymphocytes and carrying the T4 phenotype, which lymphocytes or cell lines had previously been infected with an isolate of HIV-2 virus and, particularly when the level of reverse transcriptase activity has reached a determined thre- shold, recovering and purifying the amounts of virus released in the culture medium of said lymphocytes or cell lines, particularly by differential centrifugation in a gradient of sucrose or metrizamide. 30 aa"' A process for the production of specific .0 (as hPerM-. Ae\ried) antigen of HIV-2Aretrovirus which comprises lysing, par- ticularly by means of detergent such as SDS (for instan- ce 0.1 SDS in a RIPA buffer) and recovering the lysate containing said antigens; selpral ~e -ctans \by eAec rl Process for the production of one of the 43. Process for the production of one of the i -CL _I i 100 9 9659 *r 0* B .9 S *9 above defined proteins (p12, pi6 or p26) or of a protein having the structure of gp140 or of determined parts of said proteins, which process comprises inserting the corresponding nucleic acid sequence in a vector capable of transforming an appropriate host, enabling the expres- sion of an insert containing in said vector, transfor- ming said host by said vector which comprises the said nucleotidic sequence, culturing the transformed cell lines host, recovering and purifying the expressed protein. 43 44. Process for the production of a hybridiza- tion probe for the detection of the RNA of HIV-2 retro- virus which comprises4a DNA sequence, particularly ac- cording to anyone of claims 29 to 37, in a cloning vec- 15 tor by in vitro recombination, cloning the modified vector obtained in a competent cellular host, and reco- vering the DNA-recombinants obtained, -Rm/ A S OSS* S S 59 5 S. 5 0S9 S S .9 9 Ur A M 123 4 5 B 1 23 4 c 12 3 93 69 43 C FlIG.1 4w ap"g' 0005 eweb 06e o of-* A B 140-A-i 0-1'-1 -140 2791± 68 26 :IF 25 3 1 18 -3 FIG.Z A B CD0E F S.. 0e @2 @3 F16.3 GAG PC Q S ENV F NMI MAP S 0666.0 S 0 000065 0 0* 60 6 09 p *0 06 0 S 506S *004 6 0606 6 6 6 SOS S *00(i 6 *00* 66 9* S 9 6 1 1d PY HO B Ps Ps E -FIG.4, X SH py v v Py I I L VLI 2 200pb S bee... S 04Sh S S *S 9 SS *0 SS SS SO 0555 *905 S 55*4 Oe 00 S 9. S S S S 0.SS *0 90 .9 9 5 310H Wn)i Rf U3 I Eco RI IL RyUI I hvull Bci I Eco RI PvuI 11PSP6S aicI Baml Hi -W-~nd III poty (A)I 9tl t t Pst ii BarHI IcDENApSFEF 2 Ctone FIG. Ell: I C C C C C C C C C S SC *S C. C S S C S *S S S S S C C S C S *S CCC i0 20 30 40 50 60 70 s0 9p~ IOU GT GGAAGrICGAGACIEAAAGCAACACCGAATACCATTTAGITAMCCGACA OGMEAGCTAIAE ITC 6 GCACO 6 CAGCAAGTAA CIAACAGAMACAC MNLI ALUI MAE111 pyll ALU I fiDEl 110 120 130 Ito 150 ISO 170 180 190 200 AC'VGCA GGGACTTCCACMA GCSGCTGTAc C-AAGG CATGGGAGGAG CTCCTGGCCCMCGCCTCAIAITCTCT GTATAATATACCCGCTGCTTG MAE11! SlY' MNU HLAII! AMl MMLI MNLI BBYI FHU 1.HI THIIII 210 220 230 240 250 260 270 280 290 300 tATTh IACTTCACTCGCTCTG COGACA CGCTCCCAGCATIC CCCCTGGAGCATCT CTCCAGCACTA CACCOATOAC CCTCC CTGCCC T6 CTAOACTCT CA ~AI mmLI BAN!! MNLI BSP12SE XHOII APY! UpNi E COI 0.1 HOE 11 S CRFI SAUIIIA MAE! APYI BSP1255 MAE! HPH! B STI HINFI ECORI! 'S CR f! BANI 310 320 330 340 "So 360 370 380 C CA 6CA CITGGCCMEGGCAGCGGEC ACGC TGCTGTTAA CCT TTAAA T C TA AA MAE!!! HAP 11 HPA 11 MSPI HAEII! SAUSSA AMJ a evi [N kH! I FIG.! g rig pol 4 env F HIV-2 cDNA tn B Ps p F HIV.2 AVU r6 1 XCT AG -r 6AGAC1 4GG6AC A6G66C1 HM AOT-AC T AAGAAC6CA--C-AeT -GA o 6 CAA 6 -4G 6A CII TC oA6 G AC 16 9000 9009030 H IV. 2 AA CCA A 6--00GA 0 66A CA IG 6A 6- GA 6CT GOT 6 1 A A C C CCTCC IV, I ,CIG66CGG6AC AG1 9050 9060 9070 9000 9090 a H: N 2, AIATTCITG fTATM AATA CCC6CG CTOCATIGTA C1TCA6T CGCT [I CAC, A G HI GATG6-- CTIGC AAT A AG ACT 0 ClITTTTOCC -7 TACT 6 -61CT I TCTGOTTABAC- 9100 9110 91 20 91301 9140 VHIV. 2 T 60 CAGATIGAG CC CIOGAGOT TCT Cl CAUCACTA CA GTGIAAOCC I&OGT 6TCCC HI I VJ, O--~ATT AOC C 16 6AO C-T CT C0CTrA CIA OAA 9150o 916 0 9170 9 i8a0 919 0 HIV, 2 10 C1AGA CT C ICACCA OCA CT100 CE~O GT 0 O6CAOA CODCCC ACG CT 10C ITOCTT HIM. AAAA1CTCCTT AATAAAC-6tC---AO I T0AA0CA H I. A CT CAANOCT I CCr OAI CTT CAA 4 Hind iII I ROD 4 PROD 4. 6 I pROD 4.b F- N Plt1 R r p ROD 417 E 2 0g es SO S S *5 S. S ROD 27 i E, 0 v 0 0 tit p ROD 27- 6' R Orj35 B R LI R k FIG.8 !Pcke HIV- 2- 1 2 3 t 6 67 b 9 Tm-42 0 Tm S 0 00 0 0 *06S.e .9 9 400b*9 9.9 I 09 0S 9 .9 a 9* S. 0 9 Tm- 3 H IV-1 Tm-3 0e0 0 0 0 0 0 .00 S LIR gogL pot q enlv F LR LL..J L e u L.Lj JLJ 12 3 5 5 7 5 9alol lkb 9099 0999 9990 09 9 @9 9 9 909 9 F1 G. 9 9. 99 S 9 0 I. INTERNATIONAL SEARCH REPORT Imlai olnalApplicalion Me PCT/FR 87/00025 CLASSIPICATION OF SUBJECT MATTER (it several Classification 81ymbols1 Molt, Indicate 811)'* Accoein~gto IC 07 K 15/01 Int.1. :C 12 N 5/00; C 12 N 15/00; C 12 Q 1/70; C 12 P 21/02 II. PIELDG SEARCHED Minimum Documentation Sarched' Classification 3yafem Classification llynbola 41 Int.C1. jC 12 N; C 12 P; A 61 K Documentation Searched other than Minimum Documentation to the Eatont that such Documents ase Included In the Itieldo 3Serched I Ill. DOCUMENTS CONSIDERED TO SE RE111LEVAIP~t Category I Citation of Document." with indication, whoere appropriate. of the relevant passages Is Rlvntt li No. Is A The Lancet, no. 8469/70, 21-28 December 19851 (London, GB) F. Barin et al., "Serolo- gical evidence for virus relatee. to si- mian T-lymphotropic retrovirus III in residents of West African, pages 1387- 1389, see the whole document 1-41 A WO, A, 85/04897 (THE UNITED STATES OF AMERIC.P 7 November 1985, see claims 1,6 1-41 A Science, vol. 2,28, 7 June 1985, P.J. Kanki et al., "Serologic identification and characterization of a Macague T-lympho- tropic retrovirus closely related to HTLV-III, pages 1199-1201, see the whole 1-41 document A Science, vol. 228, 7 June 1985, M.D. Daniel et al., "Isolation of T-cell tropic HTLV- 120-1203, eeru page 1203cfiues 2p1-41
3. 1201-1203, repavirus froicgures page4 Soecial cateGriee of Cited decuments: is T' later document publish"d after the International filing date or priority dale and not in Conflict with the application but 'Al document deliningi the genertal stat. of the art which is not cited to Uderstand the principle or theory Underlying the considered to be of particular relevance Invention It earier document but published en ef after tme 11nte1"0ational X documentf of particular sire,o the claimoof Invention filing date csiot be considored nloval or conniot be considered to ILI document which may throw doubts on porit claim(s) Or )v an Inventive step which Is cited to establish the Publication date of oaor docuWme of particular rolovence* the claimed Invention citation oW other special reason (as specifled) cannet be ronsidered to Involve an Inventive step when the documet referring Io en oral discloure. ue, eahibitien Or document is combined with one or mRet other such docu. other nieena meta. such combination being obvoeus to a peran ariuied document Published prior to the International fili dolle butl in the art later than the Prieritil date claimed W. decument member of the same patent family IV. CERTIFICATION Datei of the Actual Completion of the international Search Date, of Mailing of this lrralelSeerch Report 21 April 1987 (21.04.87) 22 May 1987 (22.05.87) Intornational Searching Authority SleEIIUS)U of Autiosod Oftier EUROPEANPATENTOFFICE Form OCTIISAM~O rsatond aheeti (jenuerv insi PCT/FR 87/00025 00j O Wm~mU bAIin -OW OM P NmN Chi=GOD fm.~dfft Oftmu ft~i NUNN OGNUMa rrrnuu au MWm ftusa A Science, vol. 230, 22 November 1985, P.J. Kanki et al., "Isolation of T-lymphotropi retrovirus related to HTLV-III/LAV from, wild-caught African green monkeys", pages 1-41 951-954, see the whole documeiit X,P Compte Rendus de l'Acaddmie des Sciences Paris, vol. 302,series III, no. 13, 7 April 1986, F. Clavel et al., "LAV type II: un second r~trovirus associd au SIDA enAfriquede 1'Ouest", pages 485-488, 11-4.1 see the whole document =a (u low" Weft IN* L-Y w~j~ ANNEX TO iHE INTERNATIONAL SEARCH REPORT UN .NTERNATIONAL APPLICATION NO. PCT/FR 87/00025 (SA 15920) Thi, Annex lists the patent family members relating to the patent documents cited in the above-mentioned international search report. The members are as contained in the European Patent Office EDP file on 06/05/87 The European Patent Office is in no way liable for these particulars which are merely given for the purpose of information. Patent document cited in search report Publication date Patent family member(s) Publication date WO-A- 8504897 07/11/85 AU-A- 4292685 15/11/85 EP-A- 0179871 07/05/86 JP-T- 61500767 24/04/86 US-A- 4647773 03/03/87 US-A- 4652599 24/03/87 For more details about this annex see Official Journal of the European Patent Office, No. 12/82 11 4- .1 RAPPORT DE RECHERCHE INTERNATIONALE Demands international@ N, PCT/ FR 87 /00025 1. CLASSIMANT DI LINVENTIOP (ai plualeurs symboles de classification 3ont applicable$, its indiquer tout) I Soion I& classification International* des brevets (CIS) ou A Is toilsolon In classification nationals at Is CIS CIB 4 C 12 N 7/00; A 61 K 39/1 G 01 N 33/569; C 07 K 15/06; :C 12 N 5/00; C 12 N 15/00; C 12 Q 1/70; C 12 P 21/02 I1. DOMAINKS SUR LISQUILS LA RECHERCHE A PORTE______ Docum~entation minimal@ coiisulthol Systime do clasifll ion ISyMbolas do classification CIB 4C 12 IN; C 12 P; A 61 K Documentation consuitA. sut. quo Is documientation minimal* dens is rnosure oi4 do tals documents font patti des domalnes sur loaquets Ia recherche. a pontA Ill. DOCUMENTS CONSI11011111:1S1 COMME PERTINENTS FCatolgorlo *Identification dos documents cilsrnil avoc lnition, sl nicassairo, N, des revntlcations A The Lancet, no. 8469/70, 21-28 d6cernbre 1985, (Londres, GB) F. Barin et "lSerolo- gical evidence for virus related to si- mian T-lymphotropic retrovirus III in residents of West Africa", pages 1387- 1389, voir le document en entier 1-41 A Wa, A, 85/04897 (THE UJNITED STATES OF AMERI- CA) 7 novembre 1985, votr revendications 1-41. 1, 6 A Science, vol. 228, 7 juin 1985, P.J. Kanki et al., "Serologic identification and characterization of a Macaque T-lynipho- tropic retrovirus closely related to HTLV-111U", pages 1199-1201, voir le do- 1-41 cument an entier A Science, vol. 228, 7 juin 1985, M.D. Daniel et al., "Isolation of T-cell tropic HTLV-III-like retrovirus from macaques", pages 1201-1203, voir page 1203, figure 1-41 Catligofies spolcilis do documents citls: i to eTv docuimr-;ultiorlsur publl posttiroarment h Isdateado4606t aA,* document dirinislant Plitat gin~ral do In techique, non intarrnotionat ou A Ia date dtorriftt at n'appartanant Pas consd~bcome Prtiulieemet prtientA 114tat do is technique pertinent, mals citAl Pourto 'prne consd~rAComm oaricuiorasnt arlientI* Principe ou is thilotis constituent 1o bass dh. lin=ni0 a Est documant antlriaur, mots oubtik A In date do d4p~t Initerna. a X w document particulilitrent Pertinent: l'iivantion rovendi. tional oU apr05 calls dtet quAo. nau out Ar conaidirile comms nouvalie oti comm. at La* documant pouvant jot Un douta our un. revoncititon do Imptiquanit una 4ctivitil inventive priorit ou titif Pour ustrminer to datoa ce ublicaion d'uns if Ya documiant particui~rom~rnt pertinent, linvonlion revon* autre citation ou pout Una roison so~cialot (tslte nu'indiq ue) dliquie na petit tr itonsidlroka comma impliquotrit un. it0 it document a. roltrn 4 Un. divulgation orals, A un usage, 4 activit6 inventiva iortouq to document set assoeit a un ou Unaex*positionl ou tous auite$ moyes piusiturs autra, documents do m~mw nature, cqtta tombi- a 11) document publiol avant ta date do dfoo6t international, mais naisgint 6tant evidenta pour Una varsonne du mittoor. postiuratment a Is datte do prionlt* rovendiqUde wLv document quo Nwit portit dolIs mime lamill. do brivots IV, CERTIFICATION Date A isquello Ia rechierche inlernalionale a oltAl oftoctivementl Date d'expodition du o enljappdrt do recthercihe internationsle 21 avril_1987 Actminlatration 1;hargie dolI r c hearche international Signature du tonCtionnair a 544 OPPTCE EUROPEWI DES BREVC~TS M. VAN MOL Formulairs PCTIISA12tC (deumiithe tauil.) (Jonvitar iges) I -2- Demands International@ NP T F 87 0 2!" (SUITE 019 RENSEIGNEMENTS INOUtS SUR LA III. DOCUMENTS CONSlOdRiS COMME PERTINENTS 1 OEUX19I~ IFEUILLE) Identiflcation dos documents cit6s, I'4 avec indication, si nMcessaite N* des reveridiCations Cat~gorit des passages pertinents If visdes to 2 A x,P Science, vol. 230, 22 novembre 1985, P.J. Kanki et al., "Isolation of T-lym- photropic retrovirus related to HTLV- III/LAy from wild-caught African green monkeys", pages 951-954, voir le docu- ment en entier Compte Rendus de l'Acad~nmie des sciences Paris, vol. 302, s6rie III, no. 13, 7 avril 1986, F. Clavel et al., "1LAV type II: un second rdtrovirus associ6 au SIDA en Afrique de l'Ouest", pages 485-488, voir le document on entier 1-41 1-41 I omutAirs PC; I5A,21O (fuwl, 4ddftlonnelfe) (Octtot(e 10411) 7 ANNEXE AU A~APPORT DE RECHEPC~E INTERNATIONALE RELATIF Ij A LA DEMANDE INTERNATIONALE NO. PCT/FR 87/00025 (SA 15920) La pr~sente annexe indique les membres de la famille de brevets relatifs aux documents brevets cit~s dans le rapport de recherche international vis6 ci-dessus. Lesdits membres sont ceux contenus au fichier informatique de l'Offi4ce europ~en des brevets A la date dlu 06/05/87 Les renseignements fournis sont donn~s A tit,"e indicatif et n engagent pas responsabiJlit6 de l'Office europ~en des brevets. Document brevet cit6 au rapport, de recherche Date de publication Membre(s) de la famille de brevet2 Date de publication WO-A- 8504897 07/11/85 AU-A- 4292685 15/11/85 EP-A- 0179871 07/05/86 JP-T- 61500767 24/04/86 US-A- 4647773 03/03/87 US-A- 4652599 24/03/87 Four tout renseignement concernant cette annexe: voir Jou~rnal. Officie. de l'Office europ6en des brevets, No. 12/82 A