NZ219024A

NZ219024A - Hiv-2 retrovirus protein and nucleic acid sequences and detection methods

Info

Publication number: NZ219024A
Application number: NZ219024A
Authority: NZ
Inventors: Christine Katlama; Luc Montagnier; Solange Chamaret; Mireille Guyader; Pierre Sonigo; Francoise Brun-Vezinet; Marianne Rey; Christine Rouzioux; Denise Guetard; Marc Alizon; Francois Clavel
Original assignee: Pasteur Institut
Priority date: 1986-01-22
Filing date: 1987-01-22
Publication date: 1990-04-26
Also published as: DE3752319D1; EP0320495B1; DE3752319T2; PT84182A; GR880300056T1; DK200500170A; ES2150897T3; OA08468A; PT84182B; JP2735521B2; DK175959B1; HK62091A; DK493487D0; EP0320495A1; JPH0937778A; AU6891187A; WO1987004459A1; JPH07233196A; ATE195148T1; JPH08113598A

Description

<div class="application article clearfix" id="description"> M -A /"•" k .t- -'i'. 7 ft' ? ,(■' y. ... .-i • t»r *» " ■*' » * " " * /• ti ' c' _ * ^ ^ (--■•■<- ' ^ecifi*-jtion Fiied: C.V,/.... ."" C\<fj?/r0.c Vj £c-7/</y 1 ' V • * *•«•»»«*••«•■ j'8 APR ;?qn » v » ♦ k "i •■% * t * fl M J-* *•: J Patents Form No. 5 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION NEW RETROVIRUS CAPABLE OF CAUSING AIDS, MEANS AND METHODS FOR DETECTING IT IN VITRO X/We, INSTITUT PASTEUR of 25-28, rue du Dr. Roux, 75724 Paris Cedex 15, France, a French Public Establishment, hereby declare the invention, for which jf/we pray that a patent may be granted to xm/us, and the method by which it is to be performed, to be particularly described in and by the following statement: - 1 - (followed by page la)' t v t n y%. i /V - : /■'v "C.\\ |U V 19 MAR 1987;=;! ^ /' M a A A yl i a v la abstract. NEW RETROVIRUS CAPABLE OF CAUSING AIDS. MEANS AND METHODS FOR DETECTING IT IN VITRO The invention relates to a new class of retroviruses, designated by HIV-2, of which samples have been deposited to the ECACC under numbers 87.01.1001 and 87.01.1002 and to the NCIB under numbers 12.398 and 12.399. It relates also to antigens capable to be obtained from this virus, particularly proteins p12, p16, p26 and gp140. These various antigens can be used for the diagnosis of the disease, especially by contacting these antigens with a serum of a patient submitted to the diagnosis. It relates to immunogenic compositions containing more particularly the glycoprotein gp140. Finally it concerns nucleotidic sequences, which can be used especially as hybridization probes, derived from the RNA of HIV-2. ~ // _ h t> r //'« f i 'V i' ^ f 19 MAR 1987 S) II (followed by page lb) & 1 b New retrovirus capable of causing AIDS, means and methods for detecting it in vitro 5 The invention relates to a new class of viruses having the capacity to cause lymphadenopathies, which are then capable of being replaced by acquired immune deficiency syndrome (AIDS) in man. The invention 10 also relates to antigens capable of being recognized by antibodies induced in man by this new class of virus. It also relates to the antibodies induced by antigens obtained from these viruses. This invention relates, furthermore, to cloned 15 DNA sequences possessing sequence analogy or complementarity with the genomic RNA of the abovementioned virus. It also relates to the methods for preparing these cloned DNA sequences. The invention also relates to polypeptides 20 containing amino acid sequences encoded by the cloned DNA sequences. In addition, the invention relates to applications of these antigens to the in vitro diagnosis in man of potentials for certain forms of AIDS and, in 25 respect of some of these antigens, to the production of immunogenic compositions and vaccinating compositions against this retrovirus. The invention likewised relates to the applications of the abovementioned antibodies for the same purposes and, for some of them, to their appli-30 cation to the production of acitve principles of drugs against these forms of human AIDS. Finally, the invention relates to the application of the cloned DNA sequences, and of polypeptides obtained from these sequences, as probes in diagnostic 35 kits. 2 The isolation and characterization of a first retrovirus, known as LAV, whose responsibility in the developement of AIDS had been recognized, formed the subject of a description in a paper by F. BARRE-SINOUSSI 5 et al. already in 1983 (Science, vol. 220, N* 45-99, 20, p. 868-871). Application of some extracts of this virus, and more especially of some of its proteins, to the diagnosis of the presence of antibodies against the virus was described more especially in European Patent Appli-10 cation n" 138.667. Since then, other similar strains and some variants of LAV have been isolated. Examples which may be recalled are those known by the names HTLV-III and ARV. To apply the new rules of nomenclature pu-15 blished in Nature in May 1986, the retroviruses capable of inducing in man the abovementioned lymphadenopathies and AIDS will be given the overall designation "HIV", an abbreviation of the term "Human Immunodeficiency Virus". The subgroup of retroviruses formed by LAAV and its va-20 riants was initially designated by the terms "LAV type I" or "LAV-I". The latter subgroup will be designated hereinafter HIV-1, it being understood that the term LAV will still be retained to denote that strain, among the strains of retrovirus (in particular LAAV, IDAV-4 and 25 IDAV-2) belonging to the HIV-1 virus class which are described in the abovementioned European Patent Application 138,667, which was used in the codmparative experiments described later, namely LAV_ , which was o KU deposited with the Collection Nationale des Cultures de 30 Micro-organismes (CNCM) (National Collection of Microorganism Cultures) of the Institut Pasteur de Paris, France, on 15th July 1983 under n* 1-232. The new retrovirus which forms the subject of the present patent and the virus strains which are rela-35 ted to it and which are, like it, capable of multiplying / : 19 MAR 19871 Z 1 9 0 2 3 in human lymphocytes, formerly known as. "LAV type 11" or "LAV-II", are henceforward known as "HIV-2", it being understood that the designations of certain HIV-2 isolates described later will be followed by three letters which refer to the patients from whom they were isolated. The "HIV-2" group can be defined as a group of viruses having jji vitro a tropism for human T4 lymphocytes, and which have a cytopathogenic effect with respect to these lymphocytes when they multiply therein, and then either cause generalized and persistent polyadenopathies or one of the forms of AIDS. The HIV-2 retroviruses have proved to be different from the HIV-1 type viruses under the conditions mentioned later. Like these latter viruses, they are different from the other human retroviruses which are already known (HTLV-I and HTLV-II). Although there is fairly wide genetic variability in the virus, the different HIV-1 strains isolated to date from American, European, Haitian and African patients have antigenic sites in common conserved on their principal proteins, i.e. core protein p25, envelope glycoprotein gp110 and transmembrane protein gp41-43. This relationship makes it possible, for example, for the prototype LAV strain to be used as a strain of antigens for detecting antibodies against all HIV-1 class viruses, in all people who carry them, regardless of their origin. This strain is hence currently used for detecting anti-HIV-1 antibodies in blood donors and patients, in particular by immunofluorescence and in particular by the technique known as ELISA, "Western Blot" (or immuno-imprinting) and "RIPA", an abbreviation for Radioimmunoprecipitation Assay. However, in a serological study pefoirmed with an HIV-1 lysate on patients who originated from/Weste^N f" % \ \\V , C %• A n_; \f 19 MAR 1987?! J/ y fi s i nr-. 2 7~* ? / ESfBS •"~> ** **• / *' «lm» 10 4 Africa, it was observed that some of them gave seronegative or very weakly positive reactions, whereas they showed clinical and immunological signs of AIDS. The cultured lymphocytes of one of these patients were the source of a first HIV-2 retrovirus isolated, whose structure in electron microscopy and whose proteine profile in SDS gel electrophoresis show a resemblance to those of HIV-1. However, this new retrovirus HIV-2 possesses overall only a slight relationship to HIV-1, from the standpoint both of the antigenic homology of its proteins and of the homology of its genetic material. This new retrovirus, or retroviruses having equivalent antigenic and immunological properties, can 15 hence constitute sources of antigens for the diagnosis of infection by this virus and the variants which induce an AIDS form of the type which had been observed in the initial instances in African patients or in people who had spent time in Africa. Typically, this virus was isolated from the blood, drawn in the presence of heparin, from a 28-year-old heterosexual patient who had never been transfused and who was not a drug addict. Since 1983, he had had substantial chronic diarrhoea, and substantial weight loss (17 kg) with intermittent fever. More recently, he had had Candida and Serratia infections, including an oesophageal candidiasis typical of AIDS. This patient also had anaemia, cutaneous aner-gy, Lymphopenia and a T4 lymphocyte/T8 lymphocyte ratio 20 25 30 of 0.15, with a T4 lymphocyte level of less than 100 per 3 mm of serum. His lymphocytes in culture did not respond to stimulation with phytohaemagglutinin and concanaval in A. This patient was also diagnosed as suffering from recurrent bacteriaemia due to enteriditis. cryptospo-35 ridioses, infections due to Isospora belli and cerebral., ... '<5 * O v\ toxoplasmoses. 19MARW87 5 This combination of signs was evidence of "complex symptoms linked with AIDS" or "ARC" (abbreviation for "AIDS-Related Complex"), of the type caused by HIV-1 virus. These various observations were also in 5 conformity with the criteria applied by the Center of Disease Control (CDC) of Atlanta, USA. patients and the isolation of the retrovirus were performed according to the technique already described for 10 the isolation of HIV-1 in the paper by BARRE-SINOUSSI et al. and European Patent Application n* 84/401.834 -0.138.667. They are recalled briefly below. Lymphocytes stimulated for 3 days with phytohaemagglutinin (PHA) were cultured in RPMI 1640 culture medium to which 10\ - 5 15 of foetal calf serum and 10 M p-mecaptoethanol, in-terleukin-2 and anti-(human interferon a) serum are added. reverse transcriptase activity. In the culture super-20 natant, the peak viral activity appeared at between day 14 and day 22, and then decreased. The decline and death of the cell culture followed. As with HIV-1, sections of lymphocytes infected with HIV-2 showed, in electron microscopy, virions which had reached maturity, and viral 25 particles budding at the surface of the infected cells. The cell lines used for producing the cultures of these isolated viruses can be, depending on the case, cell lines of the HUT, CEM or MOLT type, or any immortalized lymphocyte Line bearing T4 receptors. 30 The virus was then propagated in cultures of lymphocytes from blood donors, and then in continuous lines of leukaemic origin, such as HUT 78. It was then characterized by its antigens and its nucleic acid as being substantially different from HIV-1. The virus was 35 purified as described in the prior documents already The culturing of the lymphocytes from these The production of virus was followed by its 2ii)02i - 6 - mentioned. A first isolate of this virus was deposited with CNCM on 19th Decmeber 1985 under n" 1-502. It was subsquently designated with the CNCM on 21st February 1986 under n° 1-352 ROD. These isolates will sometimes be referred to later simply as MIR or ROD. In one aspect, this ivention provides a purified HIV-2 retrovirus which is capable of infecting human T4. lymphocytes and causing AIDS in humans, the retrovirus selected from those deposited in the CNCM under numbers 1-502, /I-532, 1-642 and 1-643 and those deposited in the ECACC under numbers 87.011001 and 87.011002, or a variant of the retrovirus, the variant comprising an antigen which is recognised by antibodies raised to any one of the deposited retroviruses; the retrovirus or the variant being obtained by a process which comprises: culturing human T4 lymphocytes or permanent cell lines derived from the T4 lymphocytes and carrying the T4 phenotype, or both the lymphocytes or cell lines having being infected with an isolate of HIV-2 virus; and when the level of reverse transcriptase activity reaches a selected threshold, recovering and purifying the virus released in the culture medium of the lymphocytes' or cell lines, or both. The genomic RNA may contain a GAG sequence as follows: GAGRODN (followed by page 6a) 218 - 6a - a7gggcgcgagaaactccgtctigagagggaaaaaagcagatgaa' » • »- • ttagaaagaatcacgttacggcccggcggaaagaaaaagtacagg # ■ •• • ctaaaacatattgtgtgggcagcgaataaattggacagattcgga 100- • « • ttagcagagagcc tgttggagtcaaaagagggttgtcaaaaaatt cttacagttttagatccaatggtaccgacaggttcagaaaatxxa 200 . . aaaagtcxttttaatactgtctgcgtcattxggtgcatacacgca* gaagagaaagtgaaagatactgaaggagcaaaacaaatagtgcgg 300 agacatctagtggcagaaacaggaactgcagagaaaatgccaagc acaagtagaccaacagcaccatctagcgagaagggaggaaattac 400 ccagtgcaacatgtaggcggcaactacacccaxataccgctgagt • • • • •w cccc gaaccc taaatgcctgggtaaaattagtagaggaaaaaaag* ttcggggcagaagtagtgccaggaittcaggcactctcagaaggc 500 tgcacgccciatgatatcaaccaaatgcttaaxxgtgtgggcgac catcaagcagccatgcagataatcagggagattatcaaxgaggaa • 60 0 « • a gcagcagaatgggatgtgcaacatccaa7accaggccccttacca gcggggcagcttagagagccaaggggatctgacatagcagggaca • • *700 • ''v# • ~; . ' " • acaagcacagtagaagaacagatccagtggatgtttaggccacaa (followed by page 6b) - 6b - aatcctciaccagtaggaaacatctatagaagatggaxccagata • • S 00 • ggatxgcagaagxgxgxcaggaigxacaacccgaccaacaxccxa • * • gacataaaacagggaccaaaggagccgttccaaagcxaxgtagat »• • « • 900 agattctacaaaagcttgacggcagaacaaacagaxccagcagxg •. • • • . / - * ' * aagaattggatgacccaaacactgctagiacaaaatgccaaccca. gactgtaaarragtgctaaaaggactacggatgaaccctacctxa 1000 . • *■ £ gaagagatgctgaccgcctgtcagggggiaggtgggccaggccag aaagctagattaatggcagaggccctgaaagaggtcataggacct 1100 • • gcccctatcccatxcgcagcagcccagcagagaaaggcatxtaaa * • * • • TGCTGGAACTGTGGAAAGGAAGGGCACTCGl;laagacaatgccga 1200 gcacctagaaggcagggctgctggaagtgtggtaagccaggacac axcatgacaaactgcccagatagacaggcaggtritttaggacig 1300 : • ~ "■* *"■ ggcccxtggggaaagaagccccgcaacttccccgtggcccaAgxt ccgcaggggctgacaccaacagcacccccagtggaiccagcagxg gaxctactggagaaaiaiaxgcagcaagggaaaagacagagagag 1400 * • *—_ • cagagagagagaccaxacaaggaagxgacagaggacxtactgcac- cxcgagcagggggagacaccaxacagggagccaccaacagagg-ac r 1500 ■ . " . . //>- ' • I' '*'Ni tlgctgcacctcaatxcxcxcttxggaaaagaccag - v, ■ 1 V (followed by page 6c) 2190; - 6c - Also, the genomic RNA may contain an ENV sequence as follows: envrn 5 atgatgaatcagctgcttattgccattttattagctagtgcttcc • ► • i t tag tat att gc acccaatatgtaactgttttctatggcgtaccc • ,9 * • » ft 10 acgtggaaaaatgcaaccattcccctcttttgtgcaaccagaaat 100 V . . agggatacttggggaaccatacagtgcttgcctgacaatgatgat tatcaggaaataactttgaatgtaacagaggcttttgatgcatgg 15 - . 200- aataatacagtaacagaacaagcaatagaagatgtctggcatcta 20 ttcgagacatcaataaaaccatgtgtcaaactaacacctttatgt 300 gtagcaatgaaatgcagcagcacagagagcagcacagggaacaac 25 acaacctcaaagagcacaagcacaaccacaaccacacccacagac • . . . .400 caggagcaagagataagtgaggatactccatgcgcacgcgcagac • • • • * • AACTGCTCAGGATTGGGAGAGGAAGAAACGATCAATTGCCAGilC 30 35 aatatgacaggattagaaagagataagaaaaaacagtataatgaa 500 . acatggtactcaaaagatgtggtttgtgagacaaataatagcaca aatcagacccagtgttacatgaaccattgcaacacatcagtcatc • 6 00 v- m • acagaatcatgtgacaagcactattgggatgctataaggtitaga tactgtgcaccaccgggttatgccctattaagatgtaatgat"acc —. 700 aattatt caggctttgcacc caactgttctaaagtagtagcttct (followed by page 6c - 6d - acatgcaccaggatgaxggaaacgcaaacrxccacatggxitggc • • • 800 '. xtiaaxggcaciagagcagagaaiagaacataiaiciaixggcat ggcagagataaxagaactatcatcagcttaaacaaaiattataat • * ' § • 900 ctcagtttgcattgtaagaggccagggaataagacagtgaaacaa • • • • • .... • »• axaaxgcxxatgxcaggacaxgxgxxxcacxcccacxaccagccg axcaataaaagacccagacaagcatggtgctggxtcaaaggcaaa 1000 . . - tggaaagacgccaxgcaggaggxgaagacccxxgcaaaacaxccc aggxaxagaggaaccaaxgacacaaggaaxaxxagcxxxgcagcg 1100 ccaggaaaaggcxcagacccagaagxagcaxacaxgxggacxaac igcagaggagagxxxcxciacxgcaacaxgacxxggxxccxcaai . . 1200 iggatagagaaxaagacacaccgcaaxxaxgcaccgxgccaxaxa aagcaaaxaaxiaacacatggcaxaaggxagggagaaaxgxasax 1300- " r txgccxcccagggaaggggagcxgxcctgcaacxcaacagtaacc agcataaxigcxaacatxgacxggcaaaacaaxaaicagacaaac aixaccixxagtgcagaggxggcagaacxaiacagaixggagixg 140 0 ■ • • • • ggagaxxaiaaaxtggxagaaaiaacaccaaxxggcitcgcaccx (followed by page* f. I ' ■o* - 6e - 219 acaaaagaaaaaagaiactccxcigcxcacgggagacatacaaga 1500- ggtgxgtxcgigciagggi7c7igggxixxcicgcaacagcaggt tctgcaatgggcgcxcgagcgtcccxgaccgtgtcggctcagtcc 1600 • • • cggacxtxacxggccgggaxagxgcagcaacagcaacagcxgiic gacgxggxcaagaga'caacaagaacxgitgcgacxgaccgxcxgg . ' . 17 00 ggaacgaaaaacciccaggcaagagicactgcxatagagaagxac ciacaggacc aggcgcgg ciaaaiicaxggggaigxgcgixiaga • • « • 1800 caagxctgccacaciacxgtaccatgggttaaxgaticctxagca • • • ccigacigggacaaxaigacgxggcaggaaxgggaaaaacaagxc cgciacctggaggcaaaiatcagxaaaagxxtagaacaggcacaa 1900 aixcagcaagagaaaaaiaxgxaxgaacxacaaaaaiiaajkxagc xgggaxatxxxxggcaaxxggixxgacixaaccxccigggt-caag 2000 . ,r xaxaxxcaaxaxggagtgcxxaxaaxagxagcagtaaxagcxxxa agaaxagxgaxaxaxgxagxacaaaxgxxaagxagg cxxagaaag 2100 ggcxaxaggccxgxxxicxcxxccccccccggxxaxaxccaacag (followed by page 6f) - 6f - . ... ■y axccaxax cc acaa ggacc ggggacag ccag ccaa c gaagaaaca 2200 gaagaagacggxggaagcaacggxggagacagaxaciggccctgg gcgaxagcaiaxaxacaxxxccxgaxccgccagcxgaxxcgccxc { t • • • * " xxgaccagacxaxacagcaxcxgcacggacxxacxaxcca'gcag'c 230 0 . . xxccxgauu-CXCCAACXCAXCXACCAGAAXCXCAGAGACXGGCXG agactxagaacagccxxcxxgcaaxaxgggxgcgagxggaxccaa 2400 . . gaagcattccaggccgccgcgagggcxacaagagagacxcxxgcg ggcgcgtgcaggggcxxgxggagggtattggaacgaaicgggagg 2500 ggaatacxcgcggticcaagaaggatcagacagggagcagaaatc gcccicctgtgagggacggcagiaicagcagggagaciitaigaa « • t 2600 • xaciccaiggaaggacccagcagcagaaagggagaaaaa-ttigia c ag g c aa caa a at atg g a (followed by p3.ge-^6gj A H ' i/O j/ tk, °N\ "t\'x -n 0 o 2190 ~ 6g - In a further aspect, this invention provides an antigen, or a part of an antigen, which provides a single band in electrophoresis on a polyacrylamide gel which comprises an epitope that is recognised by the serum of a carrier of antibody against HIV-2, the antigen or part of the antigen obtained by a process which comprises inserting the corresponding nucleic acid sequence in a vector capable of transforming an appropriate host enabling the expression of an insert contained in the vector; transforming the host with the vector; culturing the transformed host; and recovering and purifying the expressed antigen. The antigen may have the amino acid sequence 'ArgLysAlaPneLya Cy e TrpAsn'Cy sCljLysGTnG 1'yHisSefAlaAr gGlnCysArg r200 Ala? roArgArgGlaGljCysTrpLysCy^GlyLysProGlyHii IleHetThrAsiiCysProA'spArsGlnAlaG ly?h eLsuGlyLea 1300 Gly?roTrpGlyLysLysProAr«jA.sn?be?roValAlaGlaVal AspL.euLeuGluLysTyrliecG lnGl'nG lyLysAr gGlnArgGln 140 0 Gln.ArgGIuArg?roTyrLy sG luValihr GluAs p Leu Leu His LeuGluGlaGlyGluTbrProTyrArgGluPro?r oThrGl LeuL enllisLeuAsn.SerLetil'h eG lyLy s As pG la r5oo (followed v < 219&24 10 15 20 - 6h - or the sequence lletGlyAlaArgAsaSerValLeuArjjGlyLysLysAlaAspGlu 5 . •» • . LeuGluArglleArgLeuArgProGlyGlyLysLysLysryrArg' • • A » *. • LeuLysRisIle ValTrpAlaAlaA&aLjsLeuAEpArgPhe-Gly 100 . ' . XeuAlaGluSerLettLeuGluSerLyeGluGlyCysGlaLysIle; « • • • ' • Leu.ThrVa lLeuAsp?rol!2 cValProThrGlySerG XuAsnLea 200 . Lys SerLeuPheAealhrValCysValllelrpCysIleHisAla. • • .• • # GluGluLy s ValLysAspThrGluGLyAlaLysGlnlleValArg' 300 ArgHisLeu ValAlaGluT'nrGlyThrAlaGluLy sMe tProSer • » •• • • TbrSerArgProTbrAlaProSerSerGluLysGlyGlyAsnTyr ... 400 or the sequence : r ProVa lGlaHis ValGlyGlyAsnTyrTlxrHis IleProLeuSsr 5 ' • ' •• » ProAr gTBrLenAsnAlaTrp ValLysLeuValGluGluLysLys r • • • ' PheGlyAIaGluValVal?roGly?b.eGliiAlaLeuSerGluGly 500. . # . ^ CysThrProTyrAspIlsAsaGlnlle cLeuAs nCys 7alG 1 yAsp _ • , . - ' 6 .y--\ N, * " ■ • j;^ (-;'A HisGlnAlaAlaHeCGlnIleIleAr»GluIleIleAsnGluGla// « ^ •••••'• ' i' SNr%\ ~i V. y (followed by page. S^- \ - 6i - 219024 i 600 • ■ • AlaAlaGluTrpAspValGlaEisProTlcProGly?roLeuPro" AiaGlyGlnLettArgGluPxoArsGlySerAspIlsAlaGlylhr • « ' • 700 • . . . . TbrSerThrValGluGluGlalleClnlrjtle t?beArgProGla AflaProValP-roValGlyAsalle 7yrArgArgTrpIleGlalle •• • •• »■ soo GlyLeuGlaLysCyp ValArglle tXyrAsnProrhrAsalleLea • • • • Asp IleLysGlaGlyProLysGluProPhsGInSerXyrValAsp • » • . • 900 ArgPheTyrLys SerLeuArgAlaGluG lnlarAsp?roAla?al • « • • • Lys AsaTrpUe tlbrG laXhrLeuLeo Va 1G laAsaAlaAsaPr o . • • • • « AspCysLysLeu ValLeuLy sG lyLeuGlylle tAsaProIhrLeu 1000 •• » • • » . GluGluMetLeuTbrAlaCysGlaGlyValGlyGlyProGlyGla LysAlaArgLeuMe tAlaGloAlaLeuLjsGluVallleGlyPro - "iioo • •' ... AlaFroIleProPheAlaAlaAlaGlaG la, 219024 - 61 - or the sequence ^ 5 L3 e die tA s aG laLeuLeuIleAlall eLeuL euA laSerAlaCys » • • I LeuValTyrCysXbrGlaTyrValXhrValPheXyrGlyValPro • • • • « XhrXrpLysAsaAlaXbrlie?roLeuPheCysAlaXhrArgAsa# . 100 . . . • _ t ArgAspTbrXrpGlyXhrlleG laCysLeuProAspAsaAspAsp* • • • • • XyrGlaGluIlelhrLeuAsaValXhrGluAlaPheAspAlalrp *] 5 • 200 • • AsnAsaThrVallhrGluGlaAlalleGluAspValTrpEisLeu • *• • • « PheGluXhrSerlleLysProCysVa lLysLeuXhrProLeuCys 20 300 ValAlalletLysCysSerSerlbrGluSerSerlhrGlyAsnAsn » • I • • TbrlbrSerLyBSerlbrSerXhrThrThrlhrlhrProXhrAsp A00 GlnGluGlaGluIleSerG luAspXhrPr oCy sAlalr'gAlaAsD • • • • • AsaCysSerGlyLeuGlyGluGluGluXbrlleAsnCvsGlnPhe ; • » -.."Z ». • * • • • «*-- A s nl-Ie tThrG lyLeuG luAzgAspLy sLy sLy sGlalyrAsnG lu 500 . . . . ; J TbrlrpXyrSerLysAspValValCvsGluXhrAsaAsaSerTar i 30 - i • • • • AsaGlaXbrGlaCysIyrKetAsaEisCysAsaXhrSerVallle 25 ^*" lV 35 • ^ ® ® XbrGluSerCysAspLysHisXyrTroAspAl all eArgPheAr® /£ 7 K ' f/y ' f/>, XyrCysAlaProProGlyXyrAlaLeuLeuArgCysAsaAspXhr — 700 AsnTyrSerGlyPbeAlaProAsnCysSerLysValValAlaSer \\C (followed by page 6k) - 6k - ThrCy e ThrAr gile tMecG luThrC lnlhrSerThrlrpPheGly • « • 800 » PheAsaGlyThrArgAlaGluAs aArsTnrTyrIleTyrTrpEio • * • • GlyArsAs?AscAr£7hrIleIleSerLeuAsnLysTyrTyrAsa *900 LeuSer-LeuHisCysLysArgProGlyAsnLy sThrValLys.G In IlelletLeuilecSerGlyHisValPheHisSerELsTyrGlaPro 11eAs aLysArg?roArgGInAlaXrpCysTrpPheLysGlyLys 1000 ► . TrpLysAspAlaMetGlnGluValLysThrLeuAlaLysHisPro • • • * • A^gTyrArgGlyThrAsnAspThrArgAsnl1eSerPheAiaAla 1100 ProGlyLysGlySerAspProGluValAlalyrHetTrpThrAsn > • • • • • CysArgGlyGluPheLeuTyrCysAsnMetThrTrpPheLeuAsn c XiuO IrpIleGluAsnLysThrRisArgAsaTyrAlaProCysKijIle • • * r • LysGlnllelleAsnThrTrpHisLysValGlyArsAsnVaMyr 1300 LeuProProArgGluGlyGluLeuSerCysAsnSerThrValThr i o • • • SerllelleAlaAsnlleAs^TrpGlnAsnAsEAsnGlnThrAsn • mm m • IleThrPheSerAlaGIuValAlsGluLeuTyrArgLeuGluLeu 140 0 G LyAspTyrLysLeuValGlu.HeT nrP rol leG lyPheALaP ro (followed - 61 - TarLysGluLysArgTyrSerSerAlaEisGlyArgHisThrArg 1500 GlyVslPheValLeuGlyPheLeuGlyPheLeuAlaTbrAlaGly SerAlaHetGlyAlaArgAlaSerLeuThrValSerAlaGlnSer * . - . 1600 . - . Arg7hrLeuLeuAlaGlyIle7alGlaGlaGlnGlaGlnLeuLeu- Asp7al7alL£sArgGlaGlaGluLeuLeuArgLeurhr7alTrp 1700 GlyThrLysAscLeuGlaAlaArgVa IThrA lalleGluLysTyr LeuGlnAspGlaAlaArgLeuAssSexTrpGlyCysAlaPheArg 1800 GIa7alCysEisThrThr7al?roTrp7a lAs nAs pSerLeuAla ProAsp7rpAspAsnKetrhrTrpGlnGluTrpGIuLysGln7al ArgTyrLeuGluAlaAsnlleSerLysSerLeuG iuGlaAlaG in 1900 IleGlnGlnGluLysAsaMetTyrGluLeuG InLysLeuA-s.nSer Tr?AspIlePheGlyAsaTr??heAspLeuThrSerTrjVa*lLys 2000 TyrIleGlnTyrGlyValLauIleIle7alAla7allleAlaLeu ArgIleValIleTyr7alValGln:iet:LsuSerArgLeuArgLys 2100 GlyTyrArgFroValPheSerSerProProGlyTyrlleGlnGln (followed by. page 2190^ 6m - IleSisIleZisLysAspArgG 1 yGlaProATaABnG luGluTbr ~ 2200 GluGluAspGlyGlySerAssGlyGlyAspArsTyrlrpProTrp ProIleAlaTyrlleH isPb eLeuIleArgGlnLeuIleArg-Leu LeuTbrArgLeuTyrSerlleCysArgAspIeuLeuSerArgSer 2300 . — PbeLeuThrLeuGlnleuIleTyrGlnAsnLeaArgAspTrpLeu ArgLeuArgThrAlaPbeLeuGlnTyrGly'CysGliiTrpIleGla 2400 . GluAlaPheG laAl aAlaAlaArgAlaThrArgGluTbrLeuAla GlyAlaCysArgGlyLeuTrpArgValLeuGlaArglleGlyArg 2500 GlylleLeuAlaValProArgArglleArgGlnGlyAlaGluIle AlaLeuLeu'-**GlyThrAlaValS erAl aGIyArgLeuTy.rG lu * • % 260 0 r . TyrSerMecGluGlyProSerSerArgLysGlyGluLysPbeVal GlnAlaThrLysTyrGly / ' / {followed by page 6n)~^ - 6n - 2190^4 The invention also relates to a method for producing the. HIV-2 virus or variants of the latter in permanent cell lines derived from T4 lymphocytes, or 20 lymphocytes bearing- the T4 phenotype, this method consisting in .. culturing these lines which have been infected beforehand with HIV-2 virus and, in particular when the level of reverse transcriptase activity has reached a specified threshold, in recovering the amounts 25 of virus released into the culture medium. A preferred permanent line for the purpose of culturing HIV-2 is, for example, of the HUT 78 cell type. An HUT 78 line infected with HIV-2 was deposited on 6th February 1986 with the CNCM under n* 1-519. Cul-30 turing is, for example, carried out as follows : The HUT 78 cells (106/ml) are co-cultured with infected normal human lymphocyte (10 /ml). The culture medium is RPMI 1640 with 10?i foetal calf serum. After 15 to 21 days, a cytopathogenic effect is observed in the 35 HUT 78 cells. The reverse transcriptase is assayed one (followed by page 7) week after this observation, in the culture supernatant. It is then possible to begin to recover the virus from this supernatant. Another preferred line for culturing belongs to the lines known under the designation CEM. The infection and then the culturing of the infected CEM cells can be carried out, in particular, as follows. virus and uninfected cells of the CEM line are co-cultured for the time required for infection of the CSM. The culture conditions are then, moreover, continued in a suitable medium, for example that described below, and when the reverse transcriptase activity of the infected cells has reached a sufficient level the virus produced is recovered from the culture medium. under the conditions specified below, of human T4 lymphocytes which had been infected five days beforehand with a strain of HIV-2 virus originating from a patient hereinafter designated "ROD", on the one hand, and CEM, on the other hand. The infected T4 lymphocytes, activated beforehand with phytohaemagglutinin, proved to possess a re- g verse transcriptase activity of 5.000 cpm/10 normal T lymphocytes three days after the beginning of the infection. Culturing was continued until the measured reverse transcriptase activity reached 100.000 cpm in the supernatant. These T4 lymphocytes were then placed g in contact with CEM cells (3 x 10 infected normal T lymphocytes) and reincubated in the following culture medium ; RPMI 1640 containing 2.92 mg/ml of L-glutamine, 10% of decomplemented foetal calf serum, 2 ug/ml of Polybrene, 0.05% of anti-interferon-alpha^erum, 100.000 ug/ml of penicillin, 10 ug/ml of streptomycin and^-tO^OjOO T4 lymphocytes infected beforehand with HIV-2 In particular, co-culturing was carried out, ug/ml of neomycin. 8 The culture medium is changed twice weekly. The measurements of reverse transcriptase activity measured in the supernatant were as follows : A CEM culture infected with HIV-2 virus was deposited with the Collection Nationale de Cultures de 10 Micro-organisraes (CNCM) of the Xnstitut Pasteur under n" 1-537 on 24th March 1986. A few characteristics of the antigens and nucleic acids involved in the structure of HIV-2 emerge from the experiments carried out under the conditions 15 described below. They will, in many cases, be better assessed by comparison with the same type of characteristics relating to other types of retrovirus, in particular HIV-1 and SIV. In that which follows, reference will be made 20 to the drawings, in which : Figures 1a, 1b and 1c relate to crossed immu-no-precipitation experiments between sera, respectively, of patients affected with HIV-1 and HIV-2, and of rhesus monkeys infected with STLV-III, on the one hand, and vi-25 ral extracts of HIV-1, on the other hand ; Figures 2a and 2b show comparative results for the electrophoretic mobilities of the proteins of HIV-1, HIV-2 and STLV-III respectively, in SDS-polyacrylamide gels ; 30 ~ Figure 3 shows the results of crossed hybridi zation between genomic sequences of HIV-1, HIV-2 and STLV-III on the one hand, and probes containing different subgenomic sequences of the HIV-1 virus, on the other hand : 5 on day 0 : on day 15 : on day 21 : on day 35 : 1.000 (background) 20.000 200.000 1.000.000 35 Figure 4 is a restriction map of the cDNA derived from the RNA of HIV-2 ROD ; Figure 5 is a restriction map of an E2 fragment of the cDNA derived from HIV-2, this fragment containing a region corresponding to the 3' LTR region of HIV-2 ; Figure 6 is a nucleotide sequence of a portion of E2, this sequence corresponding to the L'3/R region of HIV-2 ; Figure 7 shows : - on the one hand, and schematically, structural elements of HIV-1 (Figure 7A) and, aligned with a region containing the HIV-1 3' LTR, the sequence derived from the E2 region of the HIV-2 cDNA, and on the other hand, the common nucleotides present, respectively, in the sequence derived from the E2 region of HIV-2 and in the corresponding sequence of HIV-1, placed in alignment at the cost of a number of deletions and insertions (fig. 7B); Figure 8 shows schematically the structures of several clones of a phage modified by several inserts originating from the cDNA derived from HIV-2 (clones R0D4, R0D27 and R0D35) ; sequences derived, in their turn, from R0D4, ROD27 and ROD35, subcloned in a plasmid pUC18, have also been shown schemetically in this figure, these latter sequences being placed to correspond with the regions of R0D4, ROD27 and ROD35 from which they respectively originate ; Figure 9 shows the relative intensities of hybridization between a/ eleven fragments removed from different regions of the complete HIV-1 genome (the fragments being shown schematically at the bottom of the figure), on the one hand, and the HIV-2 cDNA, present ,in R0D4, on the other hand, and 10 /""N b/ fragments originating from HIV-2 with the same cDNA. Generelly, the HIV-2 antigens used in the comparative tests, the description of which follows, ori-5 ginate from the HIV-2 MIR strain deposited with the CNCM under n" 1-502, and the DNA sequences derived from the genomic DNA of HIV-2 originate from the strain HIV-2 ROD deposited with the CNCM under n* 1-352. I " ANTIGENS, IN PARTICULAR PROTEINS AND 10 £X,YCOPRQTEINS The virus initially cultured in HUT 78 was la- 35 3 5 belled metabolically with [ S]systeine and [ Sjmethio- nine, the infected cells being incubated in the presence of these radioactive amino acids in culture medium de- -]5 void of the corresponding unlabelled amino acid, for a period of 14 to 16 hours, especially according to the technique described in the paper designated as reference (21) in the bibliography presented at the end of the 35 description, as regards the labelling with [ S]cystei-20 ne, The supernatant is then clarified and the virus then ultracentrifuged for one hour at 100.000 g on a cushion of 20% sucrose. The principal antigens of the virus separated by electrophoresis in a polyacrylamide gel (12.5%) under denaturing conditions (SDS), or in a gel 25 composed of poly-acrylamide (10%) + bisacrylamide (0.13%) with SDS (0.1% final concentration). The following coloured markers are used as molecular weight references : myosin : 200 kd 30 phosphorylase B : 97.4 kd BSA : 68 kd ovalbumin : 43 kd a-chymotryps in : 25.7 kd p-lactoglobulin : 18.4 kd 35 lysozyme : 14.3 kd (y If 19 MAR 1987" . <"> /i // A A - ! U 2 % 11 Other molecular weight markers were used in other experiments. This applies, in particular, to Figures 1a, 1b and 1c, which refer to other known mole-cular weight markers (under the letter M in these fi-5 gures). The antigens are still more readily distinguished after immuno-precipitation (RIPA) or by immuno-imprinting (Wastern blot), using the antibodies present in the patient's serum : their apparent molecular weights, determined by their apparent migrations, are 10 very close to those of the HIV-1 antigens. It is generally specified that, in the text which follows, the numbers which follow the designations "p" and/or Hgp" correspond to the approximate molecular weights of the corresponding proteins and/or glycopro-15 teins, divided by 1000. For example, p3 6 has a molecular weight of the order of 36.000. It is, however, understood that these molecular weight values can vary within a range which can reach 5%, 10% or even more, depending on the techniques used for the determination of these 2o molecular weights. Repetition of the experiments enabled the apparent molecular weights of the HIV-2 antigens to be determined more accurately. Thus, it was found that the molecular weights of the three core proteins, which had 25 initially been assigned molecular weights of the order of 13.000, 18.000 and 25.000, respectively, in fact had apparent molecular weights closer to the following values : 12.000, 16.000 and 26.000, respectively. These proteins are hereinafter designated by the abbreviations 30 P12, p16 and p26. The same considerations apply to the existence of protein or glycoprotein bands whose apparent molecular weights were assessed at values which could range from 32.000 to 42.000-45.000. Repetition of the measu-35 rements finally enabled a band corresponding to an o •' 19 MAR 1987mi rJ n; Op,.!!;/ 12 apparent molecular weight of 36.000 to be precisely defined. In the text which follows, this band is designated by the abbreviation p36. Another band at 42.000-45.000 (p42) is consistently observed also. One or other of p36 or p42 probably constitutes a transmembrane glycoprotein of the virus. cular weight of the order of 130-140 kd is consistently observed : this glycoprotein is designated hereinafter by the terra gp140. It is appropriate to note that, in general, the molecular weights are assessed with an accuracy of ± 5%, this accuracy even being capable of becoming a little lower for antigens of high molecular weight, as was fournd for gp140 (molecular weight of 140 ± 10%). This group of antigens (when they are labelled with 3 5 [ S]cysteine is only faintly recognized, if at all, by sera of patients containing anti-HIV-1 antibodies in the detection systems used in the laboratory or by the use of tests employing HIV-1 lysates, such as those marketed by DIAGNOSTICS PASTEUR under the name "ELAVIA". Only the p26 protein was weakly immunoprecipitated by such sera. The envelope protein was not precipitated. The serum of the patient infected with the new virus (HIV-2) faintly recognizes a p34 protein of HIV-1. In the detection system used, the other HIV-1 proteins were not recognized. which show some immunological relationship with comparable structural proteins or glycoproteins, separated under similar conditions from a retrovirus recently isolated from captive macaques of the rhesus species, whereas this immunological relationship tends to become obliterated for other proteins or glycoproteins. This latter retrovirus, which is presumed to be the—aetialo- gical agent of AIDS in monkeys, was designated A major envelope glycoprotein having a mole- In contrast, HIV-2 possesses some proteins ■v 13 investigators who isolated it [bibliographic references (16-18) below] by the name "STLV-III M. For convenien- iuac ce of reference, it will be designated in the text which follows simply by the term "STLV-III" (or alternatively 5 by the term SIV, an abbreviation for "Simian Immunodeficiency Virus " ) . Another retrovirus, designated "STLV-III, " or ^as been isolated in wild green monkeys. However, in contrast to the virus present in rhesus 10 monkeys, the presence of "STLV-III^^" does not appear to induce an AIDS-type disease in African green monkeys. Nevertheless, the immunological relationship of the structural proteins and glycoproteins of HIV-2 on the one hand and the STLV-III and STLV-III.-, retro- mac AGM 15 viruses on the other hand, and consequently the relationship of their nucleic acid sequences, remains limited. Experiments have enabled a first distinction to be established between the retroviruses capable of infecting man or monkeys ; the following emerges ; 20 The HIV-2 virus does not multiply in chronic fashion in the lymphocytes of rhesus monkeys when it has been injected in vivo and under working conditions which permit the development of the STLV-III virus, as have ma c been described by N. L. Letvin et al., Science (1985), 25 vol. 230, 71-75. This apparent inability of HIV-2 to develop in monkeys under natural conditions enables the HIV-2 virus, on the one hand, and the STLV-III virus isolates, on the other hand, to be differentiated biologically. 30 Employing the same techniques as those recor ded above, it was found that it was also possible to obtain the following from STLV-III : a principal p27 core protein, having a molecular weight of the order of 27 kilodaltons, 35 a major envelope glycoprotein, gp140, " 1 9mar1987.v ' /% /' - f. X'.sS xr ?! /T*> 14 a p32 protein, probably transmembrane, which is not observed in RIPA when the virus has been labelled beforehand with [^S]cysteine, but which can be observed in immuno-imprinting experiments (Western blots) in the form of broad bands. The major envelope glycoprotein of HIV-2 has proved to be immunologically closer to the major envelope glycoprotein of STLV-III than co the major envelope glyco-protein of HIV-1. These findings apply not only in respect of the molecular weights, 130-140 kilodaltons for the major glycoproteins of HIV-2 and STLV-III compared with approximately 110 for the major envelope glycoprotein of HIV-1, but also in respect of the immunological properties, .jej since sera drawn from patients infected with HIV-2, and more especially antibodies formed against the HIV-2 gp140, recognize the STLV-III gp140 whereas, in comparable experiments, the same sera and the same antibodies to HIV-2 do not recognize the HIV-1 gp110. However, an-ti-hiv-2 do not recognize the HIV-1 gp110. However, an- 10 20 25 30 ti-HIV-1 sera which have never reacted with the HIV-2 3 5 gp140s precipitate a [ S]cysteine-labelled 26kd protein present in extracts of HIV-2. The major core protein of HIV-2 appears to have an average molecular weight (approximately 26.000) intermediate between that of the HIV-1 p25 and the p27 of STLV-III. These observations are derived from experiments carried out with viral extracts obtained from HIV-2 isolated from one of the abovementioned patients. Similar results have been obtained with viral extracts of HIV-2 isolated from the second patient. Cells infected, respectively, with HIV-1, HIV-2 and STLV-III were incubated in a medium -sen-taining. 35 E 'V f/ 1 G -■> ■"V- 1 1 9 mar 1987r c. 15 3 5 200 p Ci/ml of [ S]cysteine in a medium free from unla-belled cysteine for 16 hours. The clarified supernatants were centrifuged at 60.000 g for 90 minutes. The pellets were lysed in an RIPA buffer (1), immunoprecipitated with different sera and then subjected to electrophoresis on polyacrylamide gel charged with sodium dodecyl sulphate (SDS-PAGE). The results observed are illustrated by figures 1a, 1b and 1c. Figure 1a shows the observed results of immu-no-precipitation between a viral extract of HIV-1 obtained from a CEM C1.13 cell line and the following sera, respectively: anti-HIV-1-positive serum (band 1), serum obtained from the first patient mentioned above (band 2), serum of a healthy African carrier of anti-HIV- 1 antibodies (band 3), serum obtained from a macaque infected with STLV-III (band 4), and serum of the second patient mentioned above (band 5). In Figure 1b, there are recorded the observed results of immunoprecipitation between the HIV-2 antigens obtained from the first patient, after prior culture with HUT-78 cells, and different sera, more especially the serum of the abovementioned first patient (band 1), the anti-HIV-1-positive serum (band 2), the serum of the macaque infected with STLV-III (band 3) and the serum of the abovementioned second patient (band 4). Finally, Figure 1c illustrates the observed results of immunoprecipitation between the antigens of an STLV-III isolate obtained from a maca^iie"hWing a simian AIDS. The sera used, to which the bandsi-j^lfji&^S^ refer, are the same as those recorded above itf^belatioif. /' to Figure 1a. /' V t 19mari987 16 M refers to the markers myosin (200 kd), ga-lactosidase (130 kd), bovine serum albumin (69 kd), phosphorylase B (93kd), ovalbumin (46kd) and carbonic anhydrase (30 kd). Figures 2a and 2b show comparative results for the electrophoretic mobilities of the proteins of HIV-1, HIV-2 and STLV-III. Figure 2a relates to the experiments carried 35 out with extracts of virus labelled with [ S]cysteine, after immunoprecipitation on SDS-PAGE. The different bands relate to the following virus extracts : virus obtained from patient 1 and immunoprecipitated by the serum originating from the same patient (band 1), extract of the same virus immunoprecipitated with a negative control serum originating from a person not carrying anti-HIV-1 or anti-HIV-2 antibodies (band2), extract of STLV-III virus immunoprecipitated with a serum originating from a macaque infected with STLV-III (band 3), immunoprecipitation observed between extracts of the same virus and a negative control serum (band 4), and extract of HIV-1 immunoprecipitated with the serum of a European patient infected with AIDS. Figure 1b shows the results obtained in Western blot (immuno-imprinting) experiments. Cell ly-sates originating from uninfected or infected HUT-78 cells were subjected to electrophoresis on SDS-PAGE, and then transferred electrophoretically to a nitrocellulose filter before being reacted with the serum of the above-mentioned first patient (serum diluted 1/100). The nitrocellulose filter was then washed and the detection of 1 25 the bound antibodies visualized with I-labelled goat anti-human IgG. The spots observed in bands 1, 2 and 3 relate, respectively, to the agglutination experiments between 17 the abovementioned serum and extracts of uninfected HUT-78 cells (band 1), extracts of HUT-78 cells infected with an HIV-2 virus (band 2) and extracts of HUT-78 cells infected with STLV-III (band 3). The numbers which 5 appear in the margins beside each of the bands correspond to the approximate molecular weights of the most representative viral proteins (molecular weights in kilodaltons). II - NUCLEIC /VCXP5 10 1 / Th*? RNAs of the HIV-2 retrovirus The RNA of the virus, deposited on a filter according to the "spot blot" technique, did not hybridize, under stringent conditions, with the DNA of HIV-1. By "stringent conditions", there are under-15 stood the conditions under which the hybridization reaction between the RNA of the HIV-2 and the chosen probe, 32 radio-actively labelled with p (or labelled in a different manner), followed by the washing of the probe, are carried out. The hybridization, on a membrane, is 20 carried out at 42*C in the presence of an aqueous solution of 50% formanide (volume/volume) in 0.1% SDS/5X SSC for 18 hours. The membrane on which the hybridization reaction has been carried out is then washed at 65*C in a buffer containing 0.15% of SDS and 0.1 X SSC. 25 By "non-stringent conditions", there are un derstood the conditions under which the hybridization reaction and the washing are carried out. The hybridization is carried out by bringing into contact with the 32 chosen probe, labelled with P (or otherwise labelled), 30 namely at 42*C in a 5 X SSC buffer, 0.1% SDS, containing 30% of formamide for 18 hours. The washing of the membrane is carried out at 50*C with a buffer containing 0.1% of SDS and 2 X SSC. Hybridization experiments were also carried,., 35 /"> > o1' •5 <: ? MAR 1987 18 out with a hybridization probe consisting of a recombinant puiaoWip pBT1 obtained by cloning the DNA of HIV-1 originating from J19 (Cell 1985, vol. 40, p. 9) in the vector pUC18. Under non-stringent conditions, only very weak hybridization was observed between the RNA of HIV-2 and the cloned DNA derived from HIV-1. Other probes containing cloned sequences of HIV-1 were used : a/ single-stranded probes of subgenomic DNA of HIV-1, produced from subclones of the HIV-1 genome and inserted in phage M13. The cloned regions related to the protease gene or the "endonuclease" gene. Only one probe of the endonuclease region of HIV-1 (nucleotide sequence between bases n's. 3760 and 4130) gave a weak hybridization under non-stringent conditions with HIV-2. The "protease" probe (HIV-1 nucleotide sequence between bases n's. 1680 and 1804) did not hybridize even under non-stringent conditions with HIV-2. b/ A probe pRS3, consisting of the sequence coding for the "envelope" region of HIV-1 (subcloning in PUC18) did not give hybridization under non-stringent conditions with HIV-2. The "spot blot" technique is also known as "dot blot" (transfer by spots). Further results of hybridization between genomic RNAs of HIV-1, HIV-2 and STLV-III, on the one hand, and probes containing different subgenomic sequences of the HIV-1 virus, on the other hand, appear in Figure 3, The supernatants of the different culture media (in the proportion of 0.5 to 1 ml for each spot) were centrifuged for 5 minutes at 45.000 revolutions per minute ; the pellets were resuspended in an NTE buffer containing 0.1% of SDS and deposited on a nitrocellulose Z/9. 0\ fy ' I'" 1 9 MAR 1987 < « tr\ b \ " jt 8 o 8 i L i U 19 filter. The latter was pre-soaked in a 2 x SSC medium (0.3 M NaCl, 0.03 M sodium citrate). After baking (for 2 hours at 80*C), the filters were hybridized with various probes contraining genomic sub-fragments of HIV-1, under non-stringent conditions (30% formamide, 5 X SSC, 40'C), washed at 50*C with a 2 X SSC solution containing 0.1% of SDS and then autoradiographed for 48 hours at -70'C with enhancing screens. obtained by the "prime cut" method as described in (25). Briefly, the single-stranded fragments originating from the M13 virus and bearing subgenomic HIV-1 inserts (30) were ligated to oligomeric fragments (17 nucleotides) originating from M13 (BI0LABS). The complementary strand was then synthesized with Klenow enzyme in a TM buffer (10 mM Tris, pH 7.5, 10 mMMgC^) in the presence of dATP, dGTP, dTTP and dCTB, labelled with 32P at the alpha-position (Amersham, 3000 Ci/mmol). The DNA was then digested with the appropriate restriction enzymes, heat denatured and subjected to electrophoresis on a denaturing polyacrylamide gel (containing 6% of acryla-raide, 8 M urea in a TDE buffer). The gel was then autoradiographed for 5 minutes. The probe was then cut out and eluted in a 300 mM NaCl, 0.1% SDS buffer. Specific activities (SA) of these single-stranded probes were 8 9 estimated at 5 x 10 10 disintegrations per minute/microgram (dpm/ug). The characteristic sequences present in the different probes were as follows : Probe 1 : nucleotides 990-1070, Probe 2 : nucleotides 980-1260, Probe 3 : nucleotides 2170-2240 Probe 4 : nucleotides 3370-3640. The numbering of the above nucTeot"ides are those envisaged in the paper under reference (3( The probes 1-4 are single-stranded probes i" 19MARI987 f 20 Lastly, the probe 5 consists of a plasraid PUC18 bearing the EcoR1-Sac1 fragment of the HIV clone in Aj 19 (31), which was subjected to nick translation to 8 obtain an SA of approximately 10 dpm/pg. The relative arrangements of the subgenomic fragments present in the probes with respect to the whole HIV-1 genome are shown schematically in Figure 3. The different spots correspond, respectively, as follows : spot A : a virus is obtained from a culture of CEM C1.13 cells infected with HIV-1, spot B : a virus is obtained from HUT-78 cells infected with STLV-III, spots C and D : isolates obtained, respectively, from the viruses of the abovementioned two African patients, spot E : negative control cell extract obtained from uninfected HUT-78 cells, spot F : virus obtained from a patient from Zaire suffering from AIDS, which had been cultured in normal T lymphocytes in the presence of TCGF. All the spots were obtained with an amount of virus corresponding to 25.000 dpm of reverse transcriptase activity, except for the spots C : 15.000 dpm. The following observations were made : The genomic RNAs of the two HIV-2 isolates obtained from purified viral particles did not hybridize with any of the probes under the stringent conditions described above, although the viral particles were isolated and purified from culture supernatants of highly infected cells showing evidence of high reverse transcriptase activity. Under the non-stringent conditions described above, the following observations were made.: all the 21 probes hybridized intensely with the genomic RNAs obtained from the control HIV-1 preparations and from another isolate obtained from a patient from Zaire suffering from AIDS. 5 Two of the probes obtained (nucleotides 990- 1070 and 990-1260, both originating from the gag region of HIV-1) hybridized slightly with the spots from extracts of the HIV-2 retroviruses ; only one of these two probes (nucleotides 990-1260) also showed slight hybri-10 dization with the STLV-III spot (Figure 3). As regards the probe containing a fragment of the pqI region (nucleotides 2170-2240), hybridization was observed with STLV-III and, albeit much more weakly, with the RNA of HIV-2. The other probe of the pol region (nucleotides 15 3370-3640) did not give hybridization with any of the HIV-2 and STLV-III spots. . Lastly, the probe modified by nick translation and containing the entire env gene and the LTR (nucleotides 5290-9 130) of HIV-2 did not hybridize either with 20 the RNAs of STLV-III or with those of HIV-2. It will also be noted that anoter probe which contained the 5' end of the poI reading frame of HIV-1 (corresponding to the protease region) did not hybridize either with the RNAs of HIV-2 or with the RNAs of STLV-25 nr- It consequently also results from the foregoing that the HIV-2 virus appears more remote, from the structural standpoint, from the HIV-1 virus than it is from STLV-III. HIV-2"nevertheless differs significantly 30 from STLV-III, which bears out the different results observed in respect of the infective capacities of the HIV-2 viruses, which are virtually nil in monkeys, compared with the unquestionable ineffective capacities of STLV-III viruses in these same specites'of monkeys. 35 . 22 The restriction maps and the genomic RNA sequences of HIV-2, or of the cDNAs obtained from these genomic RNAs are accessible to those versed in the art, since the strains of HIV-2 deposited with the CNCM can, 5 after suitable multiplication, provide him with the genetic equipment required for the determination of these restriction maps and nucleotide sequences. The conditions under which the restriction map of the genome of one of the HIV-2 isolates of this invention were es-10 tablished, and the conditions under which certain portions of cDNA derived from these genomes were sequenced, are described below. The restriction map of the genome of a retrovirus which is representative of HIV-2 retroviruses is 15 shown in Figure 4. The restriction map of a substantial fragment of this cDNA is shown in Figure 5. Finally, a portion of this latter fragment has been sequenced. This sequence, and a number of the restriction sites which it contains, are shown in Figure 6. The clo-20 ned whole cDNA - or cloned fragments of this cDNA - can themselves be used as specific hybridization probes. 2/ cDNA and fragments of this cDNA derives. respectively, from the RNA of HIV-2 The conditions under which the abovementioned 25 cDNA was obtained are described below. The first stage of manufacture of this cDNA comprised the production of an oligo(dT) serving as a primer or of an initiator cDNA strand, by carrying out an endogenous reaction activated by a detergent, using 30 the reverse transcriptase of HIV-2, on purified virions obtained from supernatants of infected CEM cells. The CEM cell line was a lymphoblastoid CD4 + cell line described by G.E.Foley et al. in Cancer 18 : 522-529 ( 1965), which is considered to be incorporated~h-e-r-ei-n~-by 35 reference. These CEM cells used are infected with an^R&Drr-, ^ E N / //'<? * o \ /'v "'V' ; 1 9KARI987/. *40?+ 4" . I 219 0 2 23 isolate, which was shown to produce substantial amounts of HIV-2 continuously. After the synthesis of the second strand (in 7; the presence of nucleotides and a bacterial DNA poly- 5 merase), the double-stranded cDNAs were inserted into a 4 bacterial phage vector M13 TG130. A phage library of 10 recombinant M13 phages was obtained and subjected to an in situ screening with an HIV-1 probe. The latter con-tains a 1.5 kb fragment originating from the 3' end of 10 the cDNA derived from the RNA of the LAV isolate (shown in Figure 7A). Approximately 50 positive plaques were detected, purified and characterized by crossed hybridization of the inserts and sequencing of the ends. This procedure enabled different clones to be 15 isolated, containing sequences approximately complementary to the 3' end of the polyadenylated RNA of the LTR [abbreviation for "long terminal repeat" of HIV-1, described by S. Wain Hobson et al. in Cell 40 : 9-17 (1985)] region, considered to be incorporated herein by 20 reference. The largest of the inserts of the group of M13 clones in question, which hybridize with the 3' LTR region of HIV-1, is an approximately 2 kb clone designated E2. Like the 3' LTR region of HIV-1, the clone E2 con-25 tains an AATAAA signal situated approximately 20 nucleotides upstream from a poly(A) terminal portion, and a 3' LTR region corresponding to that of HIV-2. After partial sequencing, this 3' LTR region of HIV-2 proved to pos-sess a distant relationship with the homologous region 30 of HIV-1. Figure 5 is a restriction map of the fragment of E2 (elongated rectangular area) incorporated in plas-raid pSPE2 which contains it. It comprises-part of the R region and the U3 region of HIV-2. The drawing d^ce|^Kto^: 35 show the boundaries of the R and U3 regions. ^ 19 MAR 1987Zil '•K<V , r. ^// 24 The sequence of part of E2 is shown in Figure 6. The positions of specific restriction sites are indicated therein. The small degree of relationship between the 3' LTR regions of HIV-1 and HIV-2 is illustrated in Figure 7. In effect, only approximately 50% of the nucleotides of the two LTR sequences can be placed in alignment (approximately 50% sequence homology), at the cost of some insertions or deletions. In comparison, the sequence homology of the corresponding regions of the different variant American and African isolates of HIV-1 is greater than 95%, without insertion or deletion . The clone E2 was used as a specific probe for HIV-2, for the identification on a hybridization filter of the sequences originating from HIV-2 and present in other clones. This probe also detects the genomic RNA of HIV-2 under stringent conditions. It likewise permits detection, by the so-called "Southern blot" method on the DNA of CEM or similar cells infected with an ROD isolate or with other HIV-2 isolates. No signal is detected under the same stringency conditions in tests of hybridization of this probe with cDNAs originating from uninfected cells or from cells infected with HIV-1. These results confirmed the exogenous nature of HIV-2 with respect to HIV-1, An approximately 10 kb species, probably corresponding to the non-integrated viral DNA, was detected as a principal constituent in the undigested DNA of cells infected with HIV-2. Anoter DNA having an apparent size of 6 kb, possibly corresponding to a circular form of the viral DNA, was also detected. The other portions of the HIV-2 genome were also identified. For this purpose, a genome library was constructed in phage lambda L47. Phage lambda L47. 1 has X -!».»*•** • . ' \»> 19 MAR 1987 - // Cjtj 25 been described by W.A.M. Loenen et al. in Gene _1£) 249-259 (1980), which publication is considered to be incorporated herein by reference. The genome library is constructed with frag-5 ments obtained by digestin of the DNA originating from the CEM cell line infected with HIV-2 ROD, after digestion with the enzyme Sau3AI. Approximately 2 x 10° recombinant plaques were screened jji situ with a clone containing the labelled E2 10 insert of the HIV-2 cDNA. Ten recombinant phages were detected on plaques and purified. The restriction maps of three of these phages, characterized by their capacity for "Southern blot" hybridization with the E2 insert under stringent conditions, as well as with subge-15 nomic probes of HIV-1 under non-stringent conditions. A clone bearing a 9,5 kb insert and derived from the whole circular viral DNA, containing the complete HIV-2 genome, was identified. It was designated "Lambda ROD 4". The other two clones, Lambda ROD 27 and 20 Lambda ROD 35, derived from integrated proviruses, bear LTR sequences of the viral coding sequences and adjacent cell DNA sequences. The different sequences are shown in Figure 8. Fragments of the Lambda clones were subcloned 25 in plasraid vector pUC18. The fragments originating from X ROD 4, X ROD 27 and X ROD 35, and subclones respectively, in the abovementioned plasraid vector, are also seen in Figure 8. The following sublclones were obtained: 30 ~ pROD 27-5, derived from Lambda ROD 27, con tains a 5.2 kb region of the HIV-2 genome and adjacent cell sequences (5' LTR and 5' coding viral sequence around an EcoRI site); pROD 4.8, derived from Lambda ROD 4, contains 35 an approximately 5 kb Hindlll fragment. This fra'gmlhtT' / ' o A/ 1 9 MAR !987. 21902 I 10 15 20 25 30 26 corresponds to the central portion of the HIV-2 genome; pROD 27-5' f.nd pROD 4.S contain HIV-2 inserts chich overlap each other; pROD 4.7 contains a 1.8 kb Hir.dlll fragment of Lambda ROD 4; this fragment is placed in the 3 direction with respect to the subcloned fragment in pRCD 4.3, and contains approximately 0.3 kb of coding viral sequences ar.d a portior. situazec between the Ea.t.HI ar.d H ic 111 cloning sites of the left arm of phage Lambda (Lambda 1 47.1) ; pRCD 35 contains all the HIV-2 coding sequences in the 3 direction with respect to the EcoRI site, the 3' LTR end and approximately 4 kb of adjacent nucleotide sequences of cellular origin ; pRCD 27-5' and pROD 35, present in E. coli K3 101, were deposited on 21/11/1986 with the CNCM under 1-626 and 1-633 ; pROD 4.7 and pROD 8, present in E. coli TGI, were deposited on 21/11/1986 with the CNCM, respectively, under n's 1-627 and 1-628. The complete HIV-2 ROD genome, the restriction map of which is seen in Figure 4, was reconstituted frcm pROD 35, linearised beforehand with EcoRI, and pROD 27-5'. The EcoRI insert of pROD27-5 was ligated in the correct orientation in the EcoRI site of pROD 35. The degree of relationship between HIV-2 and the other human or simian retroviruses was assessed by mutual hybridization experiments. The relative homology between the different regins of HIV-1 and HIV-2 genomes was determined by tests of hybridization of fragments originating, respectively, from cloned HIV-1 genome and from radioactively labelled lambda ROD 4. The relative positions of these fragments (numbered from 1 to 11) with respect to the HIV-1 genome are seen at the bottom of Figure 9. 27 Even under very low stringency conditions (Tm~ 42*C), the HIV-1 and HIV-2 genomes hybridize only at the level of their respective crag genes (spots 1 and 2), reverse transcriptase regions in pqI (spot 3), end regions of pqI, Q (or sor) genes (spot 5) and F (or 3" orf) genes and 3' LTR (spot 11). The HIV-1 fragment used for detecting the first cDNA clones of HIV-2 corresponds to the subclone of spot 11, which hybridizes relatively well with HIV-2 under non-stringent conditions. A signal originating from spot 5 is the only one which persists after stringent washing. The envelope gene, the tat gene region and part of pqI appear to be highly divergent. These data, as well as the sequence obtained with LTR (Figure 3), demonstrate that HIV-2 is not (at all events, as regards its envelope) a variant of HIV-1. It is observed that HIV-2 is more closely related to SIV [described by M. D. Daniel et al in Science 228 : 1201-1204 (1985)], which must be considered to be incorporated herein by reference] than it is to HIV-1. All the proteins of SIV, including the envelope protein, are immunoprecipitated by sera of patients infected with HIV-2, while the serological cross-reactivity of HIV-1 and HIV-2 is limited to the core proteins. However, SIV and HIV-2 can be distinguished by the differences mentioned above in respect of the molecular weights of their proteins. As regards the nucleotide sequences, it is also noted that HIV-2 is related to SIV. Furthermore, the characterization of HIV-2 also makes it possible to demarcate the region of the envelope glycoprotein which is responsible for the binding of the virus to the surface of the target cells and the subsequent internalization of the virus. The interaction takes place via the CD4 molecule itself, and it appears that HIV-1 and HIV-2 use the same receptor'.'"" // * O !i ~ 1 9 MAR 1987 21902' 28 Thus, although there are large differences between the env genes of HIV-1 and 2, the restricted homologous regions of the envelopes of the two forms of HIV can be f \ ' considered to be constituents of binding to a common - ,V 5 receptor of T4 lyphocytes. These sites are called on to form epitopes bearing the immunogenicity of peptides which might be used to elicit in man a protective immu-noresponse against HIV viruses. Advantageous sequences for forming probes in 10 hybridization reactions with the genetic material of pa-tiens carrying viruses or proviruses, in particular for detecting the presence of HIV-2 virus RNA in their lymphocytes, contain a nucleotide sequence resulting from the combinatin of 5 kb HindiII fragments of ROD 4 and E2 15 cDNA. The experiments can be carried out by all methods, in particular by the "Northern blot", "Southern blot" and "dot blot" techniques. Further characteristics of the invention will also emerge, without implied limitation, in the course 2Q of the description which follows of examples of identification of certain portions of the retroviral genome and of the production of a number of recombinant DNAs involving various portions of a cDNA derived from the retroviral, genome of HIV-2. 25 EXAMPLES EXAMPLE I DNA probe, for use in kits for diagnosis of HIV-2 A cDNA complementary to the genome RNA, ob-30 tained from purified virions, was prepared by the following method : The supernatant obtained after 48 hours' culturing of CEM cells infected with an HIV-2 ROD isolate of HIV-2 was ultracentrifuged. The centrifugation pellet 3 5 containing the virion was centrifuged on aP°"STic-r©se— KV F; A/" // < O A ■ ^ ■ il ? 9MARJ987--: ! \\ . \j • rsUJ • & '•in-ma *~'V 29 gradient to form a new centrifugation pellet, substantially by the same method as that described in European Patent Application 84/401.234 - 0.138.667, already men-tioned. i 5 The purified HIV-2 preparation was used for the synthesis of cDNA, employing an endogenous reaction activated by a detergent. In summary, the virion preparation was added to a reaction mixture containing 50 tnJM Tris-HCL, 5 mM ■J 10 MgC^, 10 mM DTT, 0.025% of the detergent marketed under the name TRITON, and 50 jjM of each of the 4 deoxynucleo-side triphosphates and an oligo(dT) initiator. The reaction was carried out for 90 minutes at 37*C. After extraction with phenol of the proteins 15 present in the first reaction medium, the second cDNA chain was synthesized in the presence of RNAse, E.coli DNA polymerase 1 and the 4 deoxynucleotides, for 1 hour at 15*C and 1 hour at 22*C. Blunt ends were created on this double-stranded cDNA by the action of T4 DNA poly-2o merase. All the reagents for this procedure are commercially available (AMERSHAM cDNA kit) and were used as recommended by the supplier. After (1) ligation of adapters (linkers) containing an EcoRI site (marketed by Pharmacia) to the 25 blunt ends of the cDNA in the presence of a T4 DNA li-gase (marketed by BIOLABS), (2), digestion of these linkers with the restriction endonuclease EcoRI. and (3) removal of the linker fragments by gel filtration (gel column marketed under the name ULTROGEL) on AcA 34 30 (LKB-IBF) , the cDNA is inserted in an M 13 TG 130 vector cleaved with EcoRI. A library of cDNAs was obtained after transformation of E.coli strain TG1. Approximately 4 10 recombinant M13 plaques were obtained. To select, in the cDNA library, recombinant 35 M13 clones containing the HIV-2 cDNA, the technique of // ° V n a a a C I y V L 30 plaque hybridization was used. The DNA of the M13 plaques was transferred to nitrocellulose filters and hybridized with subgenomic HIV-1 probes derived from the '"V "lambda J19" clone of an LAV (or HIV) virus decribed in 5 the European patent application. This probe contained an insert consisting of a portion having an approximate length of 1500 base pairs (bp) of HIV-1 DNA. This insert was bounded by two Hindlll restriction sites, respecti-vely, inside the open reading frame of the "env" gene 10 and in the R segment of the 3' LTR end of HIV-1. This probe contained the 3' end of the env gene, the whole F gene, the U3 segment and a portion of the R segment of the LTR, having an approximate length of 1500 base pairs (bp) . 15 The probe containing the 1.5 kg Hindlll insert was labelled with [32P]-dCTP and -dTTP (3000 Ci x 10~3 mole) by incubating the probe in the presence of initiators and Klenow DNA polymerase I for 4 hours at 15"C (using an AMERSHAM kit). The tests of hybridization of 20 the cDNA clones of the library were performed overnight under low stringency conditions, in a solution of a hybridization medium containing 5 X SSC, 5 X Denhart, " 25% of formamide, 100 pg/ml of denatured salmon sperm 7 DNA and the labelled probe (2 x 10 cpm with a specifi- 9 25 city of 10 cpm/pg) at 37'C. The filters were subjected to three washing stages, successively in the presence of the three solutions whose compositions are stated as % follows : Washing n* 1 30 Washing n* 2 Washing n* 3 5XSSC, 0.1% SDS,at 25*C for 4x15 minutes 2XSSC, 0.1% SDS,at 42*C for 2x30 minutes 0.1XSSC, 0.1% SDS, at 65*C for 2x30minutes Each washing is followed by autoradiography of the filters . Several positive clones were detected after 35 washing, n* 1 and were still detected after w?a£nT£rrg~n-s~-2.- P-. 5 %£ U £, 31 However, all the signals disappeared after washing n* 3. This indicates that the positive clones had only a weak relationship with the HIV-1 genome, which was nevertheless sufficient to perform the abovementioned selection. The positive clones were subcultured, redeposited on plaques and again hybridized with the same probe under the stringency conditions corresponding to washing n* '. Most of them were still positive. human DNA probe under conditions of moderate stringency and by hybridization in 5 X SSC, 5 X Denhart and 40?i formamide, followed by washing in 1 X SSC, 0.1% SDS at 50"C. None of the previously positive clones was detected, and consequently did not correspond to specific repeated DNA or to the cDNA of the ribosomal RNA. The positive M13 recombinant clones were cultured in a liquid medium and characterized as follows : (1) Size of their insertion : from each individual clone, and the synthesis of the second strand was performed with an M13 17-raer initiator sequence and the Klenow enzyme. The inserts were excised using EcoRI (BOEHRINGER) and analysed by agarose gel electrophoresis. The majority of the inserts contained from 200 to 600 and 200 bp, with the exception of the clone designated E2.1, which had an approximate length of 2 kbp. (2) Analysis of the nucleotide sequence : the dideoxy method of Sanger et al., described in Proc. Natl. Acad. Sci. 74:5463-7 (1977), which forms part of the present description. Various independent clones contained similar nucleotide sequences, with the exception of the poly(A) chains at their 3' ends, the lengths of which were different. These results demonstrate that The clones were also selected using a total An M13 single-stranded type DNA was obtained Several clones were partially sequenced using 32 these cDNA clones were derived from the RNA template. Detailed sequence analysis of these cDNA clones, including the 3" end of the HIV-2 genome, showed a limited relationship with HIV-1. (50.000 revolutions, 30 minutes). The pellet of the deposit was resuspended in 10 mM Tris pH 7.5, 1 mM EDTA, 0. 1\ SDS. One of the insertion clones, F1.1, was labelled and used as a probe for hybridization with the genomic RNA of different viral isolates, according to the "dot-blot" technique. The "dot-blot" technique comprised the following stages : (1) Depositing the sample (HIV-2 lysate) in spots on a nitrocellulose membrane soaked beforehand in 20 X SSC (3 M NaCl, 0.3 M sodium citrate) and dried in the air, (ii) baking the membrane for 2 hours at 80C, and (iii) performing■the hybridization. stringency conditions (5 X SSC, 5 X Denhart, 50% formamide at 42*C). It was followed by washing in 0.1 X SSC, 0.1% SDS at 65 *C. Under these conditions, the probe hybridizes strongly- to the spots originating from two independent isolates of HIV-2, including LAV-II ROD, from which the cloned cDNA originated. A weak hybridization signal was detected with the spot formed by STLV-III mac [Simian T-lymphotropic Virus (also known as "SIV"), type III macaque], and no hybridization was detected with the HIV-1 isolates. probe, did not reveal any hybridization with the" DNA's'oH (3) Hybridization with the genomic RNA and DNA of Hiy.-3 : (a) Production of the genomic RNA of HIV-2 : An infected supernatant was centrifuged This hybridization was performed under high The "Southern blot" experiments, employing the 32 clone E2.1 containing the 2 kb insert as a P-labelled JV £m 33 uninfected cells, but detected bands in detached cells infected with HIV-2, under high stringency conditions. HIV-2 shows polymorphism at levels of its restriction i map which are equivalent to those of the restriction 5 maps of HIV-1. With the complete cellular DNA of infected cells, two types of signal are detected by the "Southern blot" method : (1) in DNA fractions having molecular weights mw of approximately 20 kb and more, in yy the case of integrated forms of the virus, and (2) in 10 the fractions of lower MW (9,10 kb), in the case of the virus not integrated in the genome. These characteristics are highly specific to a retrovirus. Some experiments performed with STLV-III (SIV-15 3) from infected cells enabled it to be established that the simian retrovirus is relatively distant from HIV-2 (the signal is detected exclusively under low stringency conditions). These experiments show that the abovementioned probes permit the specific detection of HIV-2. 20 (4) Subcloning of the cDNA of HIV-2 in a bacterial plasmid vector : The positive M13 clone, E 2.1, was selected ^ and subcloned in a plasmid vector. The DNA of the recom binant M 13 (TG 130) phage E 2 was purified in the form 25 of a single-stranded DNA (M-13-ROD-E2) containing the 2 kb insert containing the 3' portion of the HIV-2 genome (obtained from HIV-2 ROD). This insert was transferred to plasmid pSP65, described by Melton, D.A., in 357 Nucleic Acid Res. 12:035-7056 (1984). 30 A second chain was constructed in vitro in the presence of the 17-mer initiator sequence (AMERSHAM), the four nucleotides A, C, T, G, and DNA polymerase I (Klenow). The EcoRI insert was excised by EcoRI digestion and purified on agarose gel, and then ligated~tcF 35 pSP65 which had itself been digested beforehan^'fw^^^ /••V ^ t\\ \ 19 MAR 1987 "y if ~*/r 1 M TuT £ 34 EcoRI. The ligation mixture was used to transform strain DH1, and recombinants were selected on the basis of their capacity for resistance to ampicillin. The recombinants identified were cultured on LB medium (Luria medium) containing 50 yg/ml of ampilillin. These recombinant plasmids were purified and monitored for the presence of the correct inserted fragment. One of the clones obtained, designated by the reference pSPE2, was deposited with the cncm in Paris, France, under access n* 1-595 on 5th September 1986. The inserts derived from the cDNAs of HIV-2 and which were present inserted in the abovementioned probe contained the nucleotide sequence which has been defined above, in conformity with a part of E2. EXAMPLE .II Cloning of a cDNA complementary to the DNA complementary to the genomic RNA of HIV-2 virions HIV-2 virions were purified from 5 litres of a culture supernatant from a CEM line infected with a ROD isolate. A first strand of cDNA was synthesized in contact with sedimented purified virus, in the presence-of an oligo(dT) initiator and employing an endogenous reaction activated by a detergent, according to the technique described by Alizon et al., Nature 312. 757-760 (1984). The RNA/cDNA hybrids were purified by extraction with a phenol/chloroform mixture and by precipitation with ethanol. The second strand of cDNA was produced in the presence of DNA polymerase .I/RNAse H, according to the method described by Gubler and Hoffman ( ). The description in this paper is considered to be incorpo-rted herein by reference. The double-stranded cDNA was provided with blunt ends in the presence of DNA polymerase T4, using "t-r r _ the constituents of a cDNA synthesis kit marketed by AMERSHAM, ■' ^ ^ ^ ^ UN fLl 19 MAR ;987 *2 *1 U i S 'J I£ £ i a u c *t 35 EcoRI adaptors (linker), marketed by PHARMACIA were attached to the end of.the cDNA ; the cDNA thereby modified was inserted, after digestion in the presence 'l^x of EcoRI, into a dephosphorylated phage vector M13tg130 5 which was itself digested with EcoRI, also marketed by AMERSHAM. A cDNA band was obtained after transformation 4 of E.coli strain TG1. Recombinant plaques (10 ) were screened in situ on filters permitting replicas by hy-bridization with the clone J19 containing the 1.5 kb 10 Hindlll fragment mentioned above, originating from HIV-1 . The filters were prehybridized in the presence of a medium containing 5 X SSC, 5 X DENHARDT solution, 25% formaldehyde and denatured salmon sperm DNA (100 15 micro-grammes/ml), at 37*C for 4 hours, and then hybridized for 16 hours in the same buffer (Tm -42'C) in the 7 presence of additional labelled probe (4 x 10 cpm), to provide a final hybridization buffer solution containing 10 cpm/ml. 20 Washing was carried out with a 5 X SSC, 0.1% SDS solution at 25'C for 2 hours (it being understood that 20 X SSC corresponds to a 3 M NaCl and 0.3 M sodium "} citrate solution) . The plaques which responded positive ly were purified and the M13 single-stranded DNAs were 25 prepared and their ends sequenced according to the method of Sanger et al. Hybridization of a DNA of cells infected with HIV-1 and HIV-2 and of RNAs of HIV-1. HIV-2 and of SIV virions, respectively, with a probe derived from a cloned cDNA of 30 HIV-2. The DNAs were extracted from infected CEM cells continuously producing HIV-1 and HIV-2, respectively. DNA samples of these two retroviruses, digested in some cases with 20 pg of PstI. and undigested in other 35 cases, were subjected to electrophoresis on 0.8% agarose ■ "19MARI987;"1; gel and transferred by the "Southern" method to a nylon membrane. Small volumes of infected supernatant, taken up in an NTE buffer containing 0.1% of SDS and having the same reverse transcriptase activity, were deposited on nitrocellulose which had been soaked beforehand in a 2 X SSC solution. A prehybridization was carried out in a solution containing 50% of formamide, 5 X SSC, 5 '.< Denhart and 100 mg/ml of denatured salmon sperm DNA, for 4 hours at 42 *C. A hybridization was performed in the same buf- 6 fer, to which 10% of dextran sulphate and 10 cpm/ml of o E2 labelled insert (specific activity 10 cpm/yg) had been added, for 16 hours at 42*C. Two washings were then carried out with a 0.1 X SSC, 0.1% SDS solution for 30 min each. After exposure for 16 hours to an intensifying screen, the Southern spot is dehybridized in 0.4 N NaOH, neutralized, and rehybridized under the same conditions 9 with the HIV-1 probe labelled with 10 cpm/pg. EXAMPLE XII Clonincr in phage lambda of the complete DNA of the HIV-2 provirus The DNA of CEM cells infected with HIV-2 ROD (figure 2, bands a and c) is partially digested with Sau3AI. The 9-15 kb fraction was selected on a 5-40% sucrose gradient and ligated to the BamHI arm of the C lambda L47.1 vector. The plaques (2 x 10 ) obtained after in vitro packaging and deposition on E.coli strain LA 101 were screened in situ by hybridization with the insert of the E2 cloned cDNA. Approximately 10 positive clones were purified on plaques and propagated in E.coli C600 recBC. The clones lambda ROD 4, ROD 27 and ROD 35 were amplified, and their DNAs characterized by drawing up their restriction maps and by hybridization by Southern's method with the cDNA clone of HIV-2 unchs-r~-s-trin-._ gent conditions and with the gaa-pol probes of HJLfcl ^T E /( < ' o ,V '/ ' |l, 19MAX1987 37 under non-stringent conditions. Figure 8 shows schematically the structures of 3 of the recombinant phages obtained, ROD 4, ROD 27 and ROD 35. The elongated rectangular portions of these diagrams correspond to proviral sequences originating from the DNAs of the initially infected CEM cells, the clear portions corresponding to retroviral sequences, the shaded portions to portions of cellular DNAs and the black portions to the LTR in the said viral sequences. The thin lines designated by the letters L and R correspond to the arras originating from the Lambda L47.1 phage vector which was used for the cloning. Some of the restriction sites have also been indicated : these are, more especially, the following sites : B : fiaiSHI ; E : £caRI ; H : Hindlll ; K : jC£nI ; PS : £s£I ; Pv : PvuII ; S : Sacl ; X : Xbal. These viral sequences have portions in common with the E2 sequence. The relative positions of these portions, determined by hybridization with E2, are also seen in the figures. ROD 4 is derived from a circular viral DNA. ROD 27 and ROD 35 are derived from proviruses integrated in a cellular DNA structure. Lastly, the inserts subcloned under the conditions described above, and their relative positions with respect to the corresponding ROD 4, ROD 27 and ROD 35 sequences, are shown in these figures. These are, more especially, the inserts of plasmids pROD 27-5', pROD 35-3', pROD 4.6, pROD 4.8 and pROD 4.7. Figure 9 is a representation of the relative intensities of the hybridization spots which were produced between ROD-4 and sub-fragments 1 to 11 originating, respectively, from the different^portions of a /,'d£?k ri "ISO 2 A 38 single-stranded DNA originating from an M13 subclone containing a nucleic acid derived from the whole LAV genome. The relative positions of these various fragments with respect to the whole LAV genome (determined 5 by sequencing) are shown at the bottom of the figure. Point 12 corresponds to a control spot produced using a control DNA of the phage lambda. The hybridization experiments in the spot transfer (dot blot) method were carried out under the 10 stringency conditions of Example II using, by way of a probe, the lambda ROD 4 recombinant containing the total cDNA of HIV-2. The washings were then carried out successively under the following conditions : 2 X SSC, 0.1% SDS at 25 * C (Tm-42'C), 1 X SSC, 0.1\ SDS at 60*C 15 (Tm-20'C) and 0.1% x SSC, 0.1\ SDS at 60*C (Tm-3*C). The spots shown were obtained after radiographic exposure overnight. EXAMPLE IV In vitro diagnostic test for the presence of HIV-2 virus 20 in a biological medium MATERIAL AND METHODS Patients HIV-2-infected patients were recruited among individuals visiting the Egas Moniz Hospital in Lisbon 25 either for hospitalization or for consultation, between September 1985 and September 1986. For this selection, all individuals of African origin or having stayed in Africa underwent a serum test for antibodies against both HIVF-1 (Immunofluorescence -IFA- and/or ELISA) and 30 HIV-2 (IFA). Only those patients who were proved serologically to be infected with HIV-2 were included in the study. Virus isolation In 12 patients, HIV isolation was attempted as 35 previously described. Briefly, the patients' peripheral h r'\ | 1 9 MAR 1987^1 V. 0 / £ I *1 I S V £h v C, -g 39 blood lymphocytes (PBL) were stimulated with PHA, co-cultureds with normal human PHA-stimulated PBLs and maintained in the presence of interleukin-2 (IL-2). Cul-tures were monitored for the presence of cytopathic ( ' 5 effect (CPE) and for reverse transcriptase (RT) activity in the supernatant. IfflmunoQugrggcenqg assay (IFA) IFA slides were prepared as follows : HIV-2-infected MOLT-4 cells were washed twice in PBS and laye- ■w-* 4 10 red onto IFA glass slides (10 cells/well), air dried and fixed with cold acetone. For IFA these cells were reacted with a 1/10 dilution of the test serum for 45 minutes at 37*C, washed, dried, and reacted with a fluo-rescein-conjugated goat antihuman IgG, A, M (1/100 di-15 luted) for 30 minutes at 37*C. After washing, cells were counterstained in 0.006% Evans blue, mounted in 90% glycerol, 10% PBS and examined under a fluorescence microscope . elisa 20 Some patients' sera were examined for antibo dies to HIV-1 using the commercially available serum tests ELAVIA (Pasteur Diagnostics) or ABBOTT. Radioimmunoprecipitation assay (RIPA1 r HIV-1 or HIV-2 infected CEM cells were cul-25 tured in the presence of 35S cysteine (200 microCi/ral) for 16 hours. The supernatant was collected, viral particles were pelleted and lysed in RIPA buffer (Tris-HCL 50 mM pH 7.5, NaCl 150 mM, EDTA 1 mM, 1% Triton X100, sodium deoxycholate 0.1%, SDS 0.1%). For each reaction, 30 50 microlitres of a dilution of lysate corresponding to 5 10 cpm was reacted with 5 microlitres of test serum for 18 hours at 4*C. Immune complexes were bound to Sepha-rose-protein A (PHARMACIA), washed, and eluted by boiling for 2 minutes. Eluted antigens were then analysed 35 by SDS-polyacryl-araide gel electrophoresis and autora- diography. ,/c- ^ c iV /. y < 1 9M,1piooto! r,ijj ^ // i v r£ fAx 40 Dot-blot hybridization Virus isolated from patients' PBLs were pelleted and lysed in Tris-HCL 10 mM pH 7.5, NaCl 10 mM, EDTA ^ 1 mM, SDS 0.5"*. One microlitre of each lysate, corres- 5 ponding to 50.000 cpm of RT activity, was deposited onto nitro-cellulose. Hybridization and washing were conducted in high stringency conditions : hybridization in 6 X SSC, 5 X Denhart, 50\ formamide, for 18 hours at ^ 42*C ; and washing in 0.1 X SSC, 0.1\ SDS at 65"C. We 1 y 32 10 used HIV-1 and HIV-2 probes, P labelled to a specific g activity of 10 cpm/microgram. The HIV-1 probe corresponds to the complete genome of the LAVQOTt isolate, and fcjk u HIV-2 probe was derived from a 2 kilobases cDNA clone from LAV-2R0D isolate. 15 RESETS Patient population Thirty patients with serological and/or viro-logic evidence of HIV-2 infection were studied. They were 12 males and 18 females. The mean age was 35, ran-20 ging 11-55. All patients, except one, have stayed for several years in West Africa : 26 were born and living in Guinea-Bissau and 2 were originating from the Cape Verde Islands. One patient was an 11-year old boy from Angola who had lived in the Cape Verde islands for se-25 veral years. The only European in the study population was a 40 year-old Portuguese man who had lived for 8 years in Zaire, and denied any stay in West Africa. Clinical presentation "~-y Among the 30 patients 17 had AIDS, according 30 to the CDC criteria. The major symptom in these patients was chronic diarrhoea, together in most cases with a weight loss of more than 10 kilograms in a year. In 10 patients the diarrhoea was found to be associated with the presence of an intestinal opportunistic infection ; 35 in 7 cases the pathogen was Isospora belli aloneT "one : 1 9 MAR J987& *•"v. vwv.-v ■%««•****. ■><*.>>.« « - — —— — -- — — — ."*5 1 t w V 41 patient had Cryptosporidium alone and 2 had both pathogens. In 3 cases no opportunistic intestinal pathogen was found. Among all 17 AIDS cases, oesophageal candidiasis was diagnosed in 8. Six AIDS patients had respiratory symptoms. Pulmonary tuberculosis was diagnosed in 2 and another unidentified mycobacterium was found in one. Two patients had pulmonary aspergillosis, one following a tuberculosis, Two other AIDS patients had recurrent episodes of pneumonitis with no pathogen identified, and one patient had Pneumocystis carinii pneumonia, which was only diagnosed post-mortem. Four of the 17 AIDS patients had Kaposi's sarcoma : in 3 cases it appeared limited to the skin, and in one patient postmortem examination revealed disseminated visceral lesions. Central nervous system disorders were found in 2 AIDS patients : one had cerebral lymphoma, and the other had subacute encephalitis of unknown cause. Four patients were presenting with the symptoms of the AIDS-related complex (ARC) : two had diffuse lymphadenopathy with persistent fever, one had chronic diarrhoea with weight loss, and one had recurrent episodes of bronchopneumonia and multiple lymphadenopathies . Among the 9 remaining patients, 6 had no symptoms that could be considered as related to HIV infection, one had pulmonary tuberculosis alone, one had persistent diffuse lymphadenopathy alone, and one presented with neurologic syphillis. During the 12 months' period of the study 7 patients died, all presenting with AIDS. Serological studies Each patient had at least one serum test for antibodies to both HIV-1 and HIV-2. All patients' sera were tested by IFA for antibodies to HIV-2, and all were positive. Among them, 21 were also tested for 'antibodies ! 19 MAR 1987 a 219 0 2 42 to HIV-2 by RIPA : all clearly precipitated the high-molecular weight envelope glycoprotein of the virus, termed gp 140, and 16 of them also reacted with the major core protein p26, whereas only one reacted with 2 another viral core protein, termed p16. The sera were evaluated for the presence of cross-reacting antibodies to HIV-1 using different assays. An IFA test was used in 24 sera : 12 were nega-<"> tive, 10 were weakly reactive, and 2 were positive. In ^ ELISA, 21 were tested : 16 were negative, and 5 were positive. Finally, 11 sera were tested for antibodies to HIV-1 proteins by RIPA. Three failed to react with any viral protein, 2 only precipitated the pol gene product p34, and 5 reacted with the major core protein p25. Two j2 sera reacted only faintly with the envelope glycoprotein gp 110 of HIV-1. These two sera, and all sera with positive IFA or ELISA tests for antibodies to HIV-1, had a strong reactivity with the gp 140 of HIV-2 in RIPA, indicative of infection with HIV-2 rather than with HIV-1. Only one patient, that we did not include in the study population, was serologically found to be infected with HIV-1 and not with HIV-2. This patient was a 21-year-old woman from Central Africa (Sao Tome Islands) with AIDS. Virus isolation Isolation of retroviruses from peripheral blood lymphocytes was attempted in 12 patients. HIV was isolated in 11, according to the presence of a typical cytopathic effect, and of a peak of particle-associated reverse transcriptase activity in the culture superna-tants. All 11 isolates were identified as HIV-2 using a dot-blot hybridization technique. Viral dots from 10 isolates were found to strongly hybridize in stringent conditions of hybridization and washing-with a HIV-2 probe derived from a cloned HIV-2 cDNA, whereas none of 20 25 30 1 9Kf" '7S7 43 them hybridized with a HIV-1 probe in the same conditions. One isolate only faintly hybridized with the HIV-2 probe, but it failed to hybridize with the HIV-1 probe. 5 Immunological evaluation Thirteen patients were evaluated for the number of circulating lymphocytes identified as helper T cells (CD4+) and the ratio of helper:supressor T cells. Among these patients, 11 had AIDS : their mean absolute ^0 helper T cells count was 243 + 300/microlitre and their mean helper : suppressor ratio was 0.25 + 0.15. One patient, clinically presenting with ARC, had a number of helper T lymphocytes of 240/microlitre and a ratio of 0.18. Another patient, with neurological syphillis and .jcj no evident HIV-related symptom, had a helper T lymphocyte count of 690/microlitre and a ratio of 0.82. In this study, we demonstrated HIV-2 infection in 30 West African patients presenting either with AIDS, 20 ARC or with no apparent HIV-related symptoms. The results nevertheless permit the conclussion that HIV-2 must be considered to be a major aetiological agent of AIDS in West African patients. The serological and vi-rologic profiles that we observed indicate that HIV-2 25 infection was not often associated with HIV-1 infection in our patients. Despite important antigenic and genetic differences, HIV-1 and HIV-2 display similar tropism for CD4+ T lymphocytes, similar *cytopathic effects, similar morphology, and share common immunoreactive epitopes in 30 some of their constitutive proteins. Since all West African patients with HIV infection in this study were found to be infected with HIV-2 and none of them with HIV-1, the new virus HIV-2 may be the major cause of AIDS in West Africa. ... 35 The symptoms of HIV-2-related AIDS w^xgnot E N 7--vn. \. * '• V 1 9 MAR 198?« /L_ I W vr ft—. « /""V 10 ft) 44 different from those of HIV-1 related AIDS in Central Africa : The most common symptom was chronic diarrhoea, with important weight loss, mostly due to Isospora belli and/or Cryptosporidium. The frequency of other opportu-5 nistic infections, such as candidiasis, mycobacteria (including M. tuberculosis) and toxoplasmosis was found comparable to that in HIV-1-related African AIDS. Pneumocystis carinii pneumonia, a very common complication of AIDS in the USA and Europe, has only been found once in our study, and cryptococcal meningitis was not detected . Nevertheless, the immunological abnormalities found in HIV-2-infected AIDS patients are identical to those described in HIV-1-related AIDS. 15 Among the 30 patients, who all had serum anti bodies reactive with HIV-2 antigens, only 7 had HIV-1 specific antibodies detectable using IFA or ELISA. In RIPA, all of these 7 patients had antibodies reactive with the other major core proteins p25 (HIV-1) or p26 2q (HIV-2), which share strongly immunoreactive epitopes. Five patients lacked such antibodies : all 5 had a negative HIV-1 ELISA. IFA was borderline in 3 and negative .in 2. However, although some of them were not. completely evaluated, we found 9 patients with serum antibodies to the viral core protein p26 of HIV-2 who had a weakly reactive or negative HIV-1-specific IFA and/or ELISA. These findings point to the importance of including HIV-2 antigens in the HIV serum tests used in Africa and perhaps in other areas. A retrovirus was isolated from the peripheral lymphocytes of 11 patients. In all cases, viral growth was obtained within 2 weeks, characterized by the presence of reverse transcriptase activity in the culture supernatant and of cytopathic effect. However, this cytopathic effect appeared to vary in importance /■ "• C-"\ • v. ^ 1 O r> 'oq-? 25 30 35 '' W fl- —iT 45 from one isolate to another: some isolates provided numerous large-sized syncytia together with important cell lysis, whereas others exhibited only few syncytia ^ of limited size, and affected poorly the viability of ' the culture. 5 RNA from all but one isolate was found to clearly hybridize in high stringency conditions with a prove derived from a HIV-2 cDNA clone, representing the 3' end of the genome. None hybridized with a HIV-1 prove g in the same conditions. This demonstrates that the isolates infecting these patients all belonged to the same type of virus. One isolate only poorly hybridized with HIV-1. This virus, however, was isolated from a patient with serum antibodies reacting with all the antigens of HIV-2 in RIPA. 13 This invention relates generally, in addition to HIV-2 virus its variants, to any equivalent virus which is infectious for man and possesses immunological characteristics specific to HIV-2. The invention relates generally to any virus which, in addition to the properties possessed by the HIV-2 viruses deposited with the CNCM, also possesses the characteristics which follow. The preferred target for the HIV-2 retrovirus __ consists of human Leu 3 cells (or T4 lymphocytes) and and "immortalized" cells derived from these T4 lymphocytes, for example cells of the HUT 78 lines dealt with in the context of this patent application. In other w words, it has a specific tropism for these cells. It can 2Q be cultured in permanent lines of the HUT, CEM, MOLT or similar type, expressing the T4 protein. It is not infectious for T8 lymphocytes. It is cytotoxic for the human T4 lymphocytes. The cytopathogenic nature of HIV-2 viruses with respect to T4 lymphocytes manifests itsjgXf, ^ in particular, by the appearance of multini^leate& c/ f ' ' /i r> » « ' ~ '-""-7 I v r JS fjr tm.+ IT 46 cells. It has a reverse transcriptase activity which 2 4* requires the presence of Mg ions and has a strong affinity for polyadenylate-oligodeoxythymidylate (poly(A)-oligo(dT) 12-18). It has a density of appro- ^ ximately 1.16 in a sucrose gradient. It has a mean diameter of 140 nanometres and a core having a mean diameter of 41 nanometres. The lysates of this virus contain a p26 protein which does not cross immunolo- 'gically with the p24 protein of HTLV-1 virus or HTLV-II virus. These p26 proteins hence have a molecular weight which is slightly higher (by approximately 1000) than the corresponding p25 proteins of HIV-1 and slightly lower (again, of the order of approximately 1000 lower) than the corresponding p27 proteins of the SIV. The ^ lysates of HIV-2 contain, in addition, a p16 protein which is not immunologically recognized by the P19 protein of HTLV-1 or of HTLV-II in RIPA (abbreviation for radioimmunoprecipitation assay) experiments. They contain, in addition, an envelope glycoprotein having a 20 molecular weight of the order of 130,000 - 140,000, which does not cross immunologically with the gp 110 of HIV-1 but which, on the other hand, crosses immunologically with the gp 140 envelope glyco-protein of STLV-III. These lysates also contain proteins or 35 25 glycoproteins which can be labelled with ( S)cystexne, having molecular weights, respectively, of the order of 36,000 and 42,000 - 45,000. The genomic RNA of HIV-2 does not hybridize with the genomic RNA of HIV-1 under stringent conditions. Under non-stringent conditions, it 20 does not hybridize with nucleotide sequence derived from HIV-1 and containing the env gene and the LTR adjacent to it. In particular, it does not hybridize with the nucleotide sequence 5290-9130 of HIV-1, nor with sequences of the pol region of the HIV-l'^eTSoWe";—in - particular with the nucleotide sequence 2170-2 240^^^^^ non-stringent conditions, it hybridizes '•v "C"' f 19 M An 1987,z 19 0 2 10 \ 15 47 weakly with nucleotide sequences of the HIV-1 region, in particular the nucleotide sequences 990-1070 and 990-1260. It should be noted that any retrovirus which is infectious for man, capable of inducing one of the forms of AIDS, having the abovementioned essential properties and whose genomic RNA is capable of hibridiring under stringent conditions with those HIV-2 viral strains deposited with the CNCM (or with a cDNA or cDNA fragment derived from these genomic RNAs) is to be considered to be an equivalent of HIV-2. The invention also relates to each of the antigens, in particular proteins and glycoproteins in the purified state, such as may be obtained from HIV-2. Reference to "purified" proteins or glycoproteins implies that these proteins or glycoproteins lead, respectively, only to single bands in polyacrylamide gel electrophoresis, in particular under the experimental conditions which have been described above. Any suitable method of separation and/or purification for obtaning each of these can be used. By way of example of a technique which can be employed, that describes by R.C. M0NTELAR0 et al., J. of Virology, June 1982, pp. V 1029-1038, will be mentioned. The invention relates generally to all antigens, in particular proteins, glycoproteins or polypeptides, originating from an HIV-2 and having immunological properties equivalent to those of these antigenic compounds of HIV-2. Two antigens are said to be "equivalent", in the context of this account, 3 0 inasmuch as they are recognized by the same antibodies, in particular antibodies which can be isolated from a serum obtained from a patient who has been infected with an HIV-2, or inasmuch as they meet the conQltrran-s—fo.r.. "immunological equivalence" stated below. ib 20 25 10 48 Among equivalent polypeptides, proteins or glycoproteins, there must be included fragments of the above antigens (or peptides reconstituted by chemical synthesis), inasmuch as they give rise to immunological cross-reactions with the antigens from which they are derived. In other words, the invention relates to any polypeptide which has, in common with abovementioned antigens, identical or similar epitopes capable of being recognized by the same antibodies. Belonging to this latter type of polypeptides are the products of expression of corresponding sequences of the DNAs which code for the corresponding polypeptide sequences. The HIV-2 virus has proved to be usable as a source of antigens for detecting antibodies in all ■15 people who have come into contact with the HIV-2 virus. The invention relates generally to any composition which can be used for the diagnosis of the presence in a biological fluid serum, in particular of people who have come into contact with HIV-2, of 20 antibodies against at least one of the antigens of HIV-2. This composition can be applied to the selective diagnosis of the corresponding variety of AIDS, employing diagnostic techniques such as those described in "S the European patent application cited above, except that 25 extracts , lysates or purified antigens of HIV-2 are used instead of those of HIV-1. In this connection, the invention relates more especially to compositions containing at least one of the proteins p12, p16, p26, _*) which are the internal proteins, or p36 or gp 140. By way of examples of compositions, those which simultaneously contain the following will be mentioned. p26 and gp 36 p26, p36 and gp 140, p12, p16 and p26, p16, p26 and gp 140, etc. 30 35 , ? 9MAR;?S7r 10 15 20 25 30 35 49 it is self-evident that these compositions signify only examples. In particular, the invention relates to the viral extracts or lysates containing this group of proteins and/or glycoproteins or all fractions from which one or more of the abovementioned proteins or glycoproteins has been separated beforehand. The invention also relates to compositions containing a combination of proteins and/or glycoproteins of an HIV-2 with proteins and/or glycoproteins of an HIV-1, for example: either core proteins of HIV-1 and HIV-2, in particular the p25 of an HIV-1 and p26 of an HIV-2, or alternatively the p18 of an HIV-1 and the p16 of an HIV-2, or envelope glycoproteins of an HIV-1 and envelope glycoproteins of an HIV-2, in particular the gp 110 of HIV-1 and the gp 140 of HIV-2, or alternatively the p42 of HIV-1 and the p36 or p42-45 of HIV-2, or, of course, mixtures of proteins and/or glycoproteins of an HIV-1 and proteins and/or glycoproteins of and HIV-2. Such compositions, used for diagnosis, consequently make possible procedures for diagnosis of AIDS or of the symptoms which are associated with it, which extend over a wider spectrum of the aetiological agents responsible. It goes without saying that the use for diagnostic procedures of compositions which contain only proteins and/or glycoproteins of HIV-2 is nevertheless useful for more selective diagnosis of the category of retrovirus which can be held responsible for the disease. The invention also relates to the DNAs or DNA fragments, more especially cloned DNAs and DNA fragments , obtained from the RNA and cDNAs derived from the RNA of the HIV-2 retrovirus. The ....invention al'So T / U 19 MAR 1987 .r-i-j a $ // ■'-£<? G I > " 219 0 2 4 10 15 50 relates especially to all equivalent DNAs, in particular any DNA possessing sequence homologies with the DNA of HIV-2, especially with the sequences which code for the env and pol regions of the strain of HIV-2 deposited 2 with the CNCM, equal at least to 50 %, preferably to 70 % and still more advantageously to 90 %. It will also be stated generally that the invention relates to any equivalent DNA (or RNA) capable of hybridizing with the ^ DNA or RNA of HIV-2 in the "spot blot" technique, under non stringent conditions as defined above. The invention likewise relates to the sera capable of being produced in animals by inoculating the latter with HIV-2. The invention hence relates more especially to the polyclonal antibodies directed more specifically against each of the antigens, in particular proteins or glycoproteins, of the virus. It also relates to the monoclonal antibodies which can be produced by traditional techniques, these monoclonal antibodies being directed, respectively, more specifically against the different proteins of HIV-2. These polyclonal or monoclonal antibodies can be used in different applications. Their use for neutralizing the corresponding proteins, or even inhibiting the infectivity of the whole virus, will mainly be mentioned. They can also be used, for example, for demonstrating the viral antigens in biological preparations or for carrying out procedures for purification of the corresponding proteins and/or W glycoproteins, for example by using them in affinity chromatography columns. It is understood that, in general, the available technical literature (in particular that for which the bibliographic references are in the context of the present description) in respect of HIV-1 and the virus designated HTLV-III is to be considered"to~be-- 20 25 35 ..^TTaT>>x jy ■' o ■V " 1 9 MAR 1987sl \\/> //' ^ . r. o Ss' X--J7 t V f:.^r • £19 0 2 51 incorporated herein by reference, inasmuch as the techniques described in this literature are applied under similar conditions to the isolation of HIV-2 virus or of the equivalent viruses, and to the production from these viruses of their different constituents (in particular proteins, glycoproteins, polypeptides and nucleid acids) . Use can also be made of the teachings of this technical literature as regards the application of the different constituents in question, in particular to diagnostic procedures of the corresponding forms of LAS or AIDS. to a method for in vitro diagnosis of AIDS, which comprises bringing a serum or another biological medium originating from a patient who is the subject of the diagnosis into contact with a composition containing at least one of the proteins or glycoproteins of HIV-2, or alternatively an extract or lysate of the virus, and the detection of the immunological reaction. Examples of such compositions have been stated above. noenzymatic reactions of the ELISA or immunofluorescence type. The titrations can be measurements by direct or indirect immunoflueorescence, by direct or indirect immunoenzymatic assays. extracts of virus (either an extract of one or more HIV-2 viruses alone, or a mixture of extracts originating from one or more HIV-2 viruses, on the one hand, and one or more HIV-1 viruses, on the other hand), these extracts being labelled. Any suitable type of label can be used : enzymatic, fluorescent, radioactive and the like. Such titrations comprise, for example : the deposition of specified amounts of the extract or of the composition referred to-according to The present invention relates more especially Preferred methods involve, for example, immu- Thus, the present invention also relates to if 1 9 MAR 1937 v 52 the present invention in the wells of a microtitration plate ; introduction into these wells of increasing dilutions of serum principally containing the antibodies whose presence is to be detected in vitro ; the incubation of the microtitration plate ; careful washing of the microtitration plate with a suitable buffer ; the introduction into the wells of the microtitration plate of labelled antibodies specific for human immunoglobulins, the labelling being carried out with an enzyme chosen from those which are capable of hydrolysing a substrate in such a way that the latter then undergoes a modification of its absorption of radiation, at least in particular wavelength band, and the detection, preferably in comparative fashion relative to a control, of the extent of hydrolysis of the substrate, as a measurement of the potential risks or of the effective presence of the disease. The present invention also relates to outfits or kits for the above diagnosis, which comprise : an extract or a more highly purified fraction of the types of virus stated above, this extract or fraction being labelled, for example radioactively, enzymatically or by immunofluorescence ; anti-(human immunoglobulins) or a protein A (advantageously, bound to a support which is insoluble in water, such as agarose beads) ; an extract of lymphocytes obtained from a person in good health ; buffers and, where appropriate, substrates for the visualization of the labelling. It emerges from the foregoing—that_ the invention relates to the diagnosis of HIV-2 virus^^r^ of // -? • & i 1 9 MAR t?37 jHV /» C 1 4 * » ■ «; £ i ^ u £ 9 53 a variant, as a result of the use of the probes described above, in a method employing different stages recorded below, these stages being arranged specifically to bring out the characteristic properties of the HIV-2 virus. The invention naturally also relates to the use of the cDNAs or their fragments (or recombinants containing them) as probes for the diagnosis of the presence or absence of HIV-2 virus in samples of serum or of other biological fluids or tissues obtained from patients suspected of being carriers of the HIV-2 virus. These probes are preferably also labelled (radioactive, enzymatic, fluorescent labels, and the like). Especially advantageous probes for carrying out the method for diagnosis of the HIV-2 virus, or of a variant of HIV-2, can be characterized in that they comprise all or a fraction of the cDNA complementary to the genome of the HIV-2 virus, or alternatively, in particular, the fragments present in the various clones identified above. There will be mentioned, more especially, a fraction of the cDNA of HIV-2 present in the clone E2, more especially the sequence of the 3' end (LTR) and/or of the 5' end of the HIV sequence of the abovementioned clone E2, or alternatively the cDNA containing the env region, of the cDNA of the HIV-2 virus. The probes employed in this method for diagnosis of the HIV-2 virus and in the diagnostic kits are in no way limited to the probes described above. They comprise, on the contrary, all the nucleotide sequences originating from the genome of the HIV-2 virus, of a variant of HIV-2 or of a structurally related virus, inasmuch as they enable antibodies directed against an HIV-2 to be detected in biological fluids of people capable of developing one of the forms of AIDS. Naturally, the use of nucleotide sequences // O -V 19MAR1987^, 54 originating from an HIV-2 which is initially infectious for man in nevertheless preferred. The detection can be carried out in all manners known per. se, in particular by bringing these probes into contact either with the nucleic acids obtained from cells present in these sera or other biological media, for example cerebrospinal fluids, saliva, and the like, or with these media themselves inasmuch as their nucleic acids have been rendered accessible to hybridization with these probes, this being under conditions which permit hybridization between these probes and these nucleic acids, and by detection of the hybridization which may be produced. The abovementioned diagnosis, involving hybridization reactions, can also be carried out using mixtures of probes originating, respectively, from an HIV-1 and an HIV-2, insofar as it is unnecessary to differentiate between the type of HIV virus sought. In general, the method for diagnosis of the presence or absence of the HIV-2 virus or a variant, in samples of sera or other fluids or tissues obtained from patients suspected of being carriers of the HIV-2 virus, comprises the following stages : 1) the manufacture of a labelled probe, 2) at least one hybridization stage performed under stringent conditions, by bringing the DNA of cells in the sample from the suspect patient into contact with the said labelled probe on a suitable membrane, 3) washing of the said membrane with a solution which provides for the retention of these stringent conditions for the hybridization, and 4) the detection of the presence or absence of the HIV-2 virus by an immunodetection method. In another preferred embodiment of the method according to the invention, the abovementioned h 19M _isw igfjim 219024 J TO 15 20 25 30 35 55 hybridization is performed under non-stringent conditions and the washing of the membrane is carried out under conditions adapted to those for the hybridization. As is self-evident, and as indeed emerges already from the foregoing, the invention is in no way limited to those of its modes of application and embodiment which have been envisaged more especially ; on the contrary, it encompasses all the variants. The invention relates in particular to HIV-2 viruses, characterized in that their viral RNA corresponds with a cDN'A whose GAG and TW cc-r.es contain nucleotide sequences as set out on pages 6 to 6f. As already stated above, the invention naturally relates to all HIV-2 viruses whose RNAs possess characteristics resembling, in particular, the GAG and ENV regions containing sequences having homologies of at least 50 %, preferably 70 % and still more advantageously 90 %, with respect to the sequences set out on pages 6 to 6f. The invention relates more especially to the cDNA fragments which code, respectively, for the p16, p26 and pl2 proteins which also appear on pages 6g to 6m. In particular/ it relates to the sequences stretching; between nucleotide 1 and nucleotide 405 (coding for pl6) between nucleotide 406 and nucleotide 1155 (coding for p26) and between nucleotide 1156 and nucleotide 1166 (coding for p12). The invention likewise relates to the proteins or glycoproteins whose amino acid sequences correspond to those which appear on pages 6g to 6m, as well the equivalent 7hf $2 0 FEB |99o m wcw A **>■ axyuy 56 peptides, namely peptides which differ from those which appear in the figures by addition, substitution or deletion of amino acids which do not affect the overall ('•*V f -i immunogenic properties of the said peptides. The invention relates more especially to the envelope glycoprotein possessing the amino acid sequence which appears on pages 6g to 6m. It is recalled that the amine acids are represented by single letrers according to the following 10 15 20 25 30 35 internation nomenclature : M Methionine L Leucine I Isoleucine V Valine F Phenylalanine S Serine P Proline T Threonine A Alanine Y Tyrosine H Histidine Q Glutamine N Asparagine K Lysine D Aspartic acid E Glutamic acid C Cysteine W Tryptophan R Arginine G Glycine It is mentioned that the cytopathogenic nature of the HIV-2 virus with respect to lymphocytes is characterized by the appearance of multinucleated celles. The invention also relates to an immunogenic composition, characterized in that it contains a 57 specified dose of antigen, such as the gp 36 or gp 140 of the HIV-2 virus, so as to permit the administration of a dose of 10 to 500, and in particular of 50 to 100, yg per kg of body weight. 58 The invention relates in particular to HIV-2 viruses, characterized in that their viral RNA corresponds with a cDNA whose GAG and ENV genes comprise respectively the nucleotidic sequences which follow (voir p. 57, ligne 5 du texte francais). They result from the sequencing of corresponding regions of cDNA corresponding to the genome HIV-2 Rod. They are in correspondance with the aminoacids that they code. As already stated above, the invention naturally results to all HIV-2 viruses whose RNAs possess similar characteristics, particularly GAG and ENV regions which comprise sequences having nucleotidic sequence homologies of at least 50 %, preferably 70 % and still more advantageously 90 % with the corresponding GAG and ENV sequences of HIV-2 Rod. The invention relates more particularly to the cDNA fragments which code, respectively, for the p16, p26 and pl2 whose structures are also included in GAGRODN. In particular, it relates to the sequences extending : - from nucleotide 1 to nucleotide 405 (coding for p16) ; from nucleotide 406 to nucleotide 1 155 (coding for p26) ; and - from nucleotide 1 156 to nucleotide 1 566 (coding for pi2J. It also relates particularly to the cDNA fragment which codes for the gp140 included in ENVR and extending from the nucleotide 1 to the nucleotide 2 574. The invention also relates to nucleotide sequences which distinguish from the preceding ones by nucleotide substitutions taking advantage of the degeneracy of the genetic code, as long as the substitutions do not involve a modification of the aminoacid sequences encoded by said nucleotide sequences. Likewise the invention concerns proteins or glycoproteins whose aminoacid sequences correspond to those which are indicated in the preceding pages, as ?.T'7 10 15 59 well as equivalent peptides, i. e. peptides which result from the preceding pages by addition, substitution or dilution of aminoacids which do not affect the overall ^ immunological properties of said peptides. g The invention concerns especially the envelope glycoprotein which exhibits the aminoacid sequence encoded by ENVRN. The invention also relates to an immunogenic composition characterized in that it comprises dosage units of envelope antigen, particularly the gp140 of the HIV-2 virus, such as to enable the administration of dosage units from 10 to 500, particularly from 50 to 100 mg/kg of body weight. Finally the invention concerns a process for producing any of the above indicated proteins (p12, p16 ox p26) or of the proteins having the structure of gp140, or of any determined part of said proteins, which process comprises inserting the corresponding nucleic acid sequence in a vector capable of transforming a suitably chosen cellular host and to permit the expression of an insert contained in said vector, transforming said chosen host by said vector which contains said nucleic sequence, culturing the cellular host transformed by said modified vector, recovering and purifying the protein expressed. The techniques disclosed in European patent publication 201540 filed on October 18, 1985 for the production of peptides or proteins consisting of expression products of nucleic acid sequences derived of the genome of HIV-1 are also applicable to the production of the above said peptides or proteins derived of HIV-2. The description of this European pu&lication is incorporated herein by reference, particularly as concerns the techniques. As an indication, molecular weights (MP) of 20 25 30 35 !'Y, 60 HIV-2 proteins are given in comparison with those of HIV-1. MP of HIV-2 proteins ,• MP of HIV-I proceias kd kd entire g a % 58,3 entire 55,8 p 16 15 p 18 14,9 p 26 27 , 6 P 12 15,8 env 98,6 env 97,4 external env 57,4 Transmembrane env 41,2 HIV-2 Mir and HIV-2ROD have also been deposited in the "National Collection of Animal Cell Cultures" (ECACC) in Salisbury (Great-Britain) on January 9, 1987, under accessing numbers 87 011001 and 87 011002 respectively. Moreover, plasmids pR0D35 and pR0D27.5 have been deposited at the "National Collection of Industrial Bacteria" (NCIB) in Aberdeen (Great-Britain) on January 9, 1987 under accessing numbers 12 398 and 12 399 respectively. All the publications which are referred to in the present disclosure are incorporated herein by reference . dJ I--, 61 BIBLIOGRAPHIE 1 - F. Barre-Sinoussi et al., Science 220, 868 (1983). 2 - L. Montagnier et al., In : Human Tcell leukemia Orlym- phoma viruses (Gallo, R.C., Essex, M.E., Gross, L., eds.) Cold Spring Harbor Laboratory, New York, 363 (1984). 3 - M. Popovic, M.G. Sarngadharan, E. Read, R.C. Gallo, Science 224, 497 (1984). 4 - J. Levy et al., Science 225, 840 (1984). 5 - P. Sonigo et al. , Cell 42, 369 ( 1985). 7 - J.W. Curran et al., Science 229, 1352 (1985). 8 - A. Ellrodt et al., Lancet i, 1383 (1984). 9 - P. Piot et al., Lancet ii, 65 (1984). 10 - F. Brun-Vezinet et al., Science 226, 453 (1984). 11 - N. Clumeck et al., N. Engl. J. Wed. 313, 182 (1985). 12 - A.B. Rabson and M.A. Martin, Cell 40, 477 (1985). 13 - S. Benn et al., Science 230, 949 (1985). 14 - M. Alizon, Manuscript in preparation. 15 - F. Brun-Vezinet, Unpublished data. 16 - M.D. Daniel et al. , Science 228, 1201 ( 1985). 17 - P.J. Kanki et al., Science 228, 1199 (1985). 18 - N.L. Letwin et al., Science 230, 71 (1985). 19 - A. Gatzar et al. , Blood 55, 409 ( 1980). 20 - D. Klatzmann et al., Science 225, 59 (1984). 21 - L. Montagnier et al. , Virology 144, 283 ( 1985). 22 - J.S. Allan et al., Science 228, 1091 (1985). 23 - F. CHIVel, Manuscript in preparation. 24 - F. diMarzo Veronese et al. , Science 229, 1402 (1985). 25 - V.S. Kalyanaraman et al., Science 218, 571 (1982). 26 - I.S.Y. Chen, J. McLaughlin, J.C. Gasson, S.C. Clark and D.W. Golde, Nature 305, 502 (1983). 27 - F. Barin et al., Lancet ii, 1387 (1985). 28 - P.J. Kanki, J. Alroy, M. Essex, Science~2~30~, 95"J < 1985)- ■ ' 0 V\ tA 4 O ?■ • !\ n :no7 <"•'! > L/Of r,','j L \ 3 If z 62 * •. 4? 29 - H. Towbin et al., Proc. Natl. Acad. Sci. USA 76, 4350 (1979). 30 - S. Wain-Hobson, P. Sonigo, O. Danos, S. Cole et M. Alizon, Cell 40, 9 (1985). 31 - M. Alizon et al., Nature 312, 757 (1984). \ </div>

Claims

<div class="application article clearfix printTableText" id="claims"> - 63 - WHAT WE CLAIM IS:

1. A purified HIV-2 retrovirus which is capable of infecting human T4 lymphocytes and causing AIDs in humans, the retrovirus, selected from those deposited in the CNCM under numbers 1-502, 1-532, 1-642 and 1-643 and those deposited in the ECACC under numbers 87.011001 and 87.011002, or a variant of the retrovirus, the variant comprising an antigen which is recognised by antibodies raised to any one of the deposited retroviruses; i the retrovirus or the variant being obtained by a process which comprises: culturing human T4 lymphocytes or permanent cell lines derived from the T4 lymphocytes and carrying the T4 phenotype, or both, the lymphocytes or cell lines having being infected with an isolate of HIV-2 virus; and when the level of reverse transcriptase activity reaches a selected threshold, recovering and purifying the virus released in the culture medium of the lymphocytes or cell lines, or both.

2. A HIV-2 retrovirus according to claim 1 in which the virus - is purified by differential centrifugation in a gradient of sucrose or metrizamide.

3. A HIV-2 retrovirus according to claim 1 or claim 2 in which the genomic RNA of the retrovirus is capable of hydridizing under stringent conditions with the complementary chain o£-^ cDNA or a cDNA fragment derived from the genomic RNA of any one" of the deposited retroviruses.

4. A HIV-2 retrovirus according to claim 1 or claim 2 Wiif^h comprises a set of antigens formed by core proteins havijig ^ molecular weights of the order of 12000, 16000 and 26000 ^ daltons; proteins having molecular weights of the order of^ 36000 daltons or glycoproteins having molecular weights in the range of 42000 to 45000 daltons; and a major envelope W# ■ ■, a I I / « WAfVftl 64 glycoprotein having a molecular weight in the range 130000 to 140000 daltons.

5. A HIV-2 retrovirus of any one of claims 1 to 4 which the preferred target for the HIV-2 retrovirus consists of human Leu 3 cells (or T4 lymphocytes) and for permanent cell lines derived from the T4 lymphocytes; it is capable of having a cytopathogenic effect on the human T4 lymphocytes which it infects; it has reverse transcriptase activity which requires the 2 + presence of Mg ions and has a strong affinity for polyadenylate oligodeoxythymidylate (Lpoly(A)-oligo(dT)12-18); it has a density of approximately 1.16 in a sucrose gradient; it has a mean diameter of 140 nanometres and a core having mean diamter of 41 nanometres; it can be cultivated in permanent cell lines expressing the T4 protein; it is not infectious in T8 lymphocytes; the lysates of the virus contain p26 protein which does not crossreact immunologically with p24 protein of the HTLV-1 virus or of the HTLV-2; the lysates further contain p-16 protein which is not recognized immunologically by pl9 protein of HTLV-1 or of HTLV- 2 in radioimmunoprecipitation assays; the lysates further contain an envelope glycoprotein having a molecular weight in the range of 130000-140000 which does not crossreact immunologically with gpllO of HTLV-1 retrovirus; the lysates further contain a protein or glycoprotein which 35 can be labelled by S-cysteine, having an apparent molecular weight of about 36000; the genomic RNA of HIV-2 hybridizes under stringent conditions with the genomic RNA of HIV-1 and does not hybridise under non-stringent condition with the env gene or with the LTRs of HIV-1; the genomic RNA of HIV-2 hybridizes weakly under non-stringent condition with nucleotide sequences possesses the following properties: nucleotides 990-1070 or 990-1260 of the GAG re genome. - 65 - 2190^4

6. A HIV-2 retrovirus according to any one of claims 1 to 5 which does not multiply in chronic fashion in the lymphocytes of macaque rehesus monkeys when it has been injected in vivo and in conditions which permit the development of the STLVIII virus as described by Letvin et al. Science, (1985) mac •* ' ' v ' vol 230, pages 71-75.

7. A HIV-2 retrovirus of any one of claims 1 to 6 in which the nucleotide sequence which comprises the R region and the U3 region of the genomic RNA of the retrovirus also contains a nucleotidic sequence which corresponds to the following nucleotide sequence: GTGGAAGGCGAGACTGAAAGC\agaggaataccatttagttaaaggacag c1aacagctatacttggtcagggcaggaagtaaciaacagaaacagctgag actgcagggacmtccagaaggggctgtaaccaag3gagggac\tgggag. ' gac^tggtggggaacgcctca.tattctctgtataatatacccgctgcttg ' ca'ttgtacttca'gtcgctctgcggagaggctggcagattgagccctggad 'gatctctccagcacta(I\cggatgag'cctgggtgccctgctagactctca' CCAGCACTlTGGCCGGTGCTGGCAGACGGCXCCACGCTTGCCTGCTTAAAJi acc^tcctxaataaagctgcagtagaagca -

8. A HIV-2 retrovirus of any one of claims 1 to 7 in which genomic RNA of the retrovirus also contains a GAG sequence which corresponds to the following nucleotide sequence: s GAGRODN ATGGGCGCGAGAAACTCCGTCTTGAGAGGUAAAAAAGCAGA7GAA' TTAGAAAGA.ATCAGGTTACGGCCCGGCGGAAAGAAAAAGTACAGG CTAAAACATATTGTGTGGGCAGCGAATAAATTGGACAGATTCGGA 1 0 0 • « m • TTA GCAGAGAGCC TGTTGGAGTCAAAAGAGGGTTGTCAAAAAATT CTTACAGTTTTAGATCCAATGGTACCGACAGGTTCAGAAAATrrA 200 - 66 - AAAAGTCITTITAATACTGrCTGCGTCATTTGGTGCATACACGCA • • ,• v gaagagaaagtgaaagatactgaagcagcaaaacaaatagtgcgg . . . 300 agacatctagtggcagaaacaggaactgcagagaaaaxgccaagc • • * • • acaagtagaccaacagcaccatctagcgagaagggaggaaattac. • • » 400- ccagtgcaacatgtaggcggcaactacacccatataccgctgagt; * • • • • • * , t » ccccgaaccctaaatgcctgggxaaaaxxagxagaggaaaaaaag • I t » ttcgggg cagaagtagtgccaggattt caggcactctcagaaggc 500* • • • • tgcacgcccxatgaxatcaaccaaaxgcxxaattutgxgggcgac • i • caxcaagcagccaxgcagataaxcagggagattatcaai.gaggaa • 600'., a • • gcagcagaaxgggaxgtgcaacaxccaaiaccaggccccttacca gcggggcagcitagagagccaaggggatcxgacaxagcagggaca ... 700 acaagcacagtagaacaacagatccagtggaxgtxxaggccacaa 2i9024 - 67 - aa.tcctcxaccagtaggaaacatctatagaagatggatccagata " • • 800 « . ggat7gcagaagtgxgtcaggatgtacaacccgaccaacatccta * • • gacataaaacagggaccaaaggagccgttccaaagctatgtagat .. . . . 900 agattcxacaaaagcxtgagggcagaacaaacagatccagcagtg • •. • • t "* . * aagaartggatgacccaaacacrgctagtacaaa_&tgccaaccca- -gactgtaa.attagtgctaaa.aggactacggatgaaccctacctta 10 oo ■ r gaagagat gctgaccgcctgtcagggggiaggtgggccaggccag aaagctagattaatggcagaggccctgaaagaggtcataggacct 1.100 . . . gcccctatcccattcgcagcagcccagcagagaaaggcaritaaa » . • / • • tgctggaactgtggaaaggaagggcactcguuaagacaatgccga 1200 gcacctagaaggcagggctgctggaagtgtggtaagccaggacac atcatgacaaactgcccagatagacaggcaggtttt7taggactg 1300.= ggcccttggggaaagaagccccgcaacttccccjgtggcccaagtt ccgcaggggctgacaccaacagcacccccagtggatccagcagtg gatc1actggagaaataiatgcagcaagggaaaagacagagagag lAoa .. . . . cagagagagagaccatacaaggaagtgacagaggacttactgcac- ctcgagcagggggagacaccatacagggagccaccaacagaggac ? x 5 0 0 • • wj ^7?:a r; ttgctgcacctcaattctctctttggaaaagaccag ' '"a " . ■ f ' % <5 * - 68 - 219024

9. A HIV-2 retrovirus of any one of claims 1 to 8 in which the genomic RNA of the retrovirus contains an ENV sequence which corresponds to the following nucleotide sequence: ENVRN atgatgaa7cagctgc7tattgcca7t77attagctagtgc7tgc t7ag7a7at7gcacccaatatgtaactg777tc7a7ggcgtaccc acg7ggaaaaaigcaaccai7cccc7c77ttc7gcaaccagaaa7 100 •- aggga7aci7ggggaacca7acagtgct7gcctgacaa7ga7gat tatcaggaaataact7tgaatg7aacagaggct7tt gaxgca7gg 200- aataa7acagtaacagaacaagcaatagaagatg7ctggcatcta 77cgagaca7 caataaaaccaxgtg7caaactaacacc tttatgt 300 gtagcaa7gaaa7gcagcagcacagagagcagcacagggaacaac a caacc tcaaagagcacaagcacaaccacaaccacacccacagac • • • .400 caggag caagagataagtgaggatactcca7gcgcacgcgcagac • • • • • aactgc tcaggattgggagaggaagaaacgatcaattgccag7tc" aa7a7gacaggat7agaaagagataagaaaaaacagtataatgaa 300 . acat ggtactcaaaagatgtggtttg7gagacaaataatagcaca aat cagacccag7gttaca7gaacca77gcaacacat cagt catc . . 600 ... . . acagaatcatgtgacaagcactattgggatgciaiaagg7tiaga ~ V * tactg7gcaccaccggg7ta7gcccta77aagatgtaatgatacc />' (( --1 aattattcaggcttxgcacccaactg77c7aaagtagtagcttct \u W° ' " I" V v. * 815 - 69 - ACAXGCACC AGGATGATCCAAACGCAAACTTCCACATGGTITGGC • » • 800 • XXIAATGGCACTAGAGCAGAGAATAGAACATATAICTATTGGCAT • » • • GGCAGAGATAATAGAACTATCATCAGCITAAACAAA7ATTATAAT • 900 CTCAGTTTGCATTGTAAGAGGCCAGGGAATAAGACAGTGAAACAA • ' •• * < ' 4 t ATAATGCTTATGrCAGGACATGTGrTTCAC TCCCACTACCAGCCG m • • • » ii * » , • AXCAATAAAAGACCCAGACAAGCATGGTGCIGGTXCAAAGGCAAA ' . 1000 . . t TGGAAAGACGCCATGCAGGAGGTGAAGACCCTXGCAAAACATCCC 9 9 # » • AGGXATAGAGGAACCAATGACACAAGGAATAXTAGCTTTGCAGCG 1100 CCAGGAAAAGGCTCAGACCCAGAAGTAGCAXACATGTGGACTAAC • , • » • • IGCAGAGGAGAGTTTCTCTACTGCAACATGACTTGGTTCCTCAAT . . 1200 XGGATAGAGAATAAGACACACCGCAATTATGCACCGTGCCATATA • • • • • AAGCAAAIAATTAACACATGGCATAAGGTAGGGAGAAATGTATAT 1300 TTGCCTCCCAGGGAAGGGGAGCTGTCC TGCAACTCAACAGTAACC • • • • • AGCATAATTGCTAACATTGACTGGCAAAACAATAATCAGACAAAC • • « • AXTACC TTXAGTGCAGAGGTGGCAGAACTATACAGATTGGAGTTG 216 - :• 7 0 - f) /-""V ACAAAAGAAAAAAGATACTCCICTGCICACGGGAGACATACAAGA 1500- . GGTGIGTTCGTGCTAGGGTTCXTGGGXTXTCTCGCAACAGCAGGT TCTGCAATGGGCGCTCGAGCGTCCCTGACCGXGTCGGCTCAGTCC 1 -J .. • • 1600 CGGACTTTACTGGCCGGGATAGTGCAGCAACAG CAACAGCXGTTG" GACGXGGXCAAGAGACAACAAGAACIGXIGCGACTGACCGICTGG • • , 1700. GGAACGAAAAACCXCCAGGCAAGAGICACXGCXATAGAGAAGIAC • • m CTACAGGACCAGGCGCGGCTAAATXCAXGGGGATGTGCGTITAGA . ' . . 1800 CAAGXCTGCCACACTACXGTACCAXGGGTTAATGATTCCTXAGCA • • • CCXGACTGGGACAAXAXGACGTGGCAGGAAXGGGAAAAACAAGIC CGCXACCIGGAGGCAAAXAXCAGXAAAAGxxXAGAACAGGCACAA 1 900 . axxcagcaagagaaaaaxatgiaxgaacxacaaaaatiaaaxagc TGGGAIATTTTTGGCAATTGGITTGACTI AACCTCCTGGGTCAA.G 2000 . •• . XAXAXXCAAIAXGGAGTGCXXAXAAXAGXAGCAGTAAXAGCXXTA AGAATAGTGAXAXAXGXAGXA CAAAXGTIAAGXAGGCTTAGAAAG 2100 GGCXAIAGGCCTGXIXTCXCXTCCCCCCCCGGXXATAXCCAACAG " y/ y e o 219024 71 atcc atat ccacaaggaccggggacagccagccaacgaagaaaca 2200 gaagaagacggtggaagcaacggxggacacagaiactgcccctgg • • • • • ccgatagcaiataiacattxcctgatccgccagcxgaitcgcctc ttgaccagactaxacagcatctgcagggacttactaxccaggagc 2300 . . . ttcctgaucctccaactcatctaccagaatctcagagactggctg agacttagaacagcctxcttgcaaxatgggtgcgagxggaxccaa . 2400 . .... gaagcattccaggccgccgcgagggciacaagagagactctxgcg ggcgcgxgcaggggcttgtggagggtattggaacgaatcgggagg 2500 ggaaiacicgcggticcaagaaggaxcagacagggagcagaaaic gcccxccxgxgagggacggcagxaxcagcagggagacxxiaxgaa 2600 taciccatggaaggacccagcagcagaaagggagaaaaatttgia c a g g c aa c a a a at at gg a >\ / xi/ v e y / - 72 - 218024

10. A KIV-2 retrovirus of any one of claims 1 to 9 in which the RNA substantially does not hybridize with the ENV gene and the LTR close to it, or with the sequences of the POL region of the HIV-1 genome.

11. A HIV-2 retrovirus according to claim 11 in which the RNA substantially does not hybridise with nucleotide sequence 5290-9130 of HIV-1 or the nucleotide sequence 2170 to 2240 of HIV-1

12. A composition comprising at least one antigen of a HIV-2 retrovirus according to any one of claims 1 to 11, the composition obtained by a process comprising lysing the retrovirus and recovering the lysate containing the antigen.

13. A composition according to claim 12 in which the retrovirus is lysed using a SDS detergent.

14. A composition according to claim 12 or claim 13 which is a total extract or lysate of the retrovirus.

15. A composition according to claim 12 or claim 13 in which the antigen consists of at least one of the internal core proteins of the retrovirus, the internal core proteins having an apparent molecular weight of the order of 12000, 16000 or 26000 daltons. __

16. A composition according to claim 15 in which the internal core protein is pl2, pl6, or p26.

17. A composition of claim 12 or claim 13 which contains a gpl40 glycoprotein having an apparent molecular weight in the range 130000 to 140000 daltons.

18. An antigen, or a part of an antigen, which provides a single band in electrophoresis on a polyacrylamide gel which comprises an epitope that is recognised by the serum of a carrier of antibody against HIV-2, the antigen or part of-the., antigen obtained by a process which comprises inserting "the ^ corresponding nucleic acid sequence in a vector cape - 73 - 21S024 fT\ transforming an appropriate host enabling the expression of an insert contained in the vector; transforming the host with the vector? culturing the transformed host; and recovering and purifying the expressed antigen.

19. A purified antigen having the immunological characteristics of one of the following proteins or glycoproteins of HIV-2: pl2, pl6, p26, p36, p42 and gpl40, the antigen obtained by a process which comprises inserting the corresponding nucleic acid sequence in a vector capable of transforming ah appropriate host enabling the expression of an insert contained in the vector; transforming the host with the vector; culturing the transformed host; and recovering and purifying the expressed antigen.

20. An antigen of claim 19 which has the following amino acid sequence: lirgLysAlaPaeLys • * Cy s Tr?Aa:a~Cy'sG~IyLy>uGryHi.s5 e'rAlaAr gGlnCysArg rzoo Ala? roArgAr gG la GI jCysXrpLysC y-sG lyLysProGlyHis • • • •' __ • II el-IetThrAs nCys?roAspAr£.GlnAlaG ly.PheLeuGlysLsa .... 1300' ; GlyProTrpGlyLysLysProArs A-snPh 2?r oValAlaG InVal • • • • • ProG InG lyLeuThrProXhrAlaPr oPro Va lAs p? roAlaVal *■ • * • AspL.euLeuGluLysTyr«e EG lnGl'nG lyLysArg GlnArgGlo 1400 .... \ GlaArgGlaArgProTyrLysGluValTlirG la As pLeuLeuEis LeuGluGlnGlyGluThrProTyrArgGluProProThrGluAsp ^ ■■ . _ T500 . LeuLe-aEisLsuAsnSerLetxJh sG lyLys As pG In » - 74 - 2190kj4

21. An antigen of claim 19 which has the following amino acid sequence: 10 15 20 lie cGlyAlaArsAsaSerValletiArgGlyLysLysAlaAspGla LeuGluArgIlsArgLeuArg?roGljGlylysI.ysLyaryrArg;*' • • m • • . LeuLysHisIleVallrpAlaAlaAsaXysIeuAspArsPheSly 100 . • . . LeuAlaGluS erLenLeuGluSerLysGluGlyCysGlnLysIlfi' • • <M» ft • LeuTh,rValLeuAsp?roKet ValProTiirGlySerGluAsnLeu 200 . Lys Se rLeuPheAsaThrValCys Valll elrp-Cys I leHisAla. • • p. GluGluLysValLysAspThrGluGlyAlaLys G in lie ValAr® ' 300 * • Ar gHisLeuValAlaGluTnrGlyThrAlaGluLyslIe tProSer • ♦ *♦ • . *■ ThrSerArgProThrAlaProSerScrGluLysGlyGlyAsaTyr• • • • 400 2i9c ' - 75 -

22. An antigen of claim 19 which has the following amino acid sequence: ProValClnHisValGlyGlyAsnTyrlhrHisIleProLeuSer 5 • • *' »* • ProAr gThrLenAsaAlaTrp V&lLy sLeu ValC luGluLy sLy »' • • • PbeGlyAlaGluValValProGlyPheGlaAlaLeuSerGluGly 500 • • • 10 CysThrProTyrAspIleAsaGlnl-IetLeuAsaCysValGlyAsp Eis G lnAlaAlailecG lQllellcAr^GluIlel leAsnGluGlu 15 20 fe- 25 -Z r .• \ 35 600 ; AlaAlaGluTrpAsp ValGlaHisProIleProGlyProLeixPro- AlaGlyGlaLcaArgGluProArgGlySerAspIleAlaGlylhr •#» 700 ... ThrSexThrValGluGluGlalleG lalrpHetPheArgProGln AsaPr oValProValGlyAsa-IleTyrArgArgTrpIleGlnllc • * •• « o 00 i GlyLeuGlaLysCys ValArgMetTyrAsaProThrAEalleLeu Asp 11eLysG la GlyProLysG luProPheG laSer TyrV_alAsp . . » . . . i 900 ArgPheTyrLysSerLeuArgAlaGluG laXh r Asp Pro Alia Val LysAsaTrpUeCThrGlnTb.rLeuLea Va lGlaAsaA'laAsuPro. • • • • » AspCysLysLeuValLeuLysGlyLeuGlyllecAfi aProThrLea 1000 „ . GluGluHetLeuThrAlaCysGlaGlyValGlyGlyProGlyGla Ly sA laArgLeulIe tAl a G laAlaLeuL2 sG lu Va II1 eG lyPro 1100 s AlaProIleProPheAlaAlaAlaGlaGla, ' - N u /' - 76 -

23. An antigen of claim 19 which has the following amino acid sequence: ENVRN 5 UetMetAsnGlnLeuLeuIleAlalleLeuLeuAlaSerAlaCys t • « I LeuValTyrCysTbrGlaTyrValThrValPheTyrGlyValPro 10 ThrlrpLysAsnAlaTbrlleProLeuPbeCysAlaThrArgAsn 100 . . ArgAspIhrlrpGlyXhrlleGlnCysLeuProAspAsnAspAsp TyrGlaGluIleThrLeuAsaValThrGluAlaPheAspAlaTrp 15 .200 AsnAsnThrValThrGlu GInAlalleGluAspValTrpHisLeu PheGluThrSerlleLysProCysValLysLeuThrProLeuCys 20 25 30 35 300 ValAlalietLysCysSerSerThrGluS e r S erlhr G lyAsnAsn • « l • • ThrThr S erLy eS erlhr S e rTbrThrThrlhrThrProTbrAsp • • • 400 GlnGluGlaGluIleSerG luAspTbr?roCysAIaAr'gAlaAss • • • • 9 AsnCysSerGlyLeuGlyGluGluGluThrlleAsnCvsGinPhe * • • • A * T Asal-IetThrGlyLeuGluArgAspLysLysLysGlnTyrAsnGlu •- 500 .... ThrTrpTyrSerLysAspValValCysGluThzAsaAsnSerThr • • « • AsaGlnTbrGlnCysTyrl-iecAsnEisCvsAsnThrSerVallle • 6 00 . . m . ThrGluSerCysAspLysEisTyrTrpAspAlalleArgPh eArg • • • • TyrCysAlaProProGlylyrAlaLeuLeuArgCysAsnAspThr . 7 00 . " \ AsnTyrSerGlyPbeAlaProAsnCysSerLysVa 1Va1A1a^etf : 1 -v'x /'V o\ vn>'. -J «U'-/ _ l •' ■■■> ■! \\<° 2iS( - 77 - ThrCysThrArgMetMetGluTbrClaTbrSerThrTrpPheGly . .,"V 800 PheAsaGlyThrArgAlaGluAsnArgThrlyrIIsTyrTrpHis • ♦ • • • GlyArsAspAsnArgTbrllelleSerLeuAsnLysTyrTyrAsa O • - .900 _ • __ LeuSe r-LeuHisCy sLy s Arg? r oG lyAs aLy sThr Va ILvsG la , • <** • • IlelletLeuMetSerGlyHisValPheHisSerEisTyrGlaPro m a» • • • IleAsaLysArgProArgGlnAlaTrpCysTrpPheLysGlyLys 1000 TrpLysAspAlaMetGlnGluValLysThrLeuAlaLysHisPro 0 • * • • ArgTyrArgG lyThrAsnAspThrArgAsnlleSerPhsAIaAla 1100 ProGlyLysGlySerAspProGluValAlaTyrKe tTrpTbrAsa • • • • « CysArgGlyGlu?heLeuTyrCysAsnHet.ThrTrp?heLei:Asn [ ), . • I2u0 TrpIleGluAsnLysThrHisArgAsaTyrAlaProCysHisIle ST- 5 c • •' • * • ;J- f" Ly.s G1 al leI leAs nThr TrpE is Lvs Y2 1G 1 vAr gAsaV2 l?Ty r 1300 LeuProProArgGluGlyGluLeuSerCysAsaSerThrValThr SerlleIlsAlaAsnIleAs2TrpGlaAsaAsnAsnGlaThrAsn IleThrPheSerAlaGIuValAlaGluLeuTyrArgLeuGluLeu 1AU0 . . GlyAs pTyrLy sLeuVa1GlulleTbrProIleGlyPheAlaPro XV ,?hl( \<P - 73 - TbrLysGluLysArgTyrSerSerAlaHisGlyArgHisThrArg 1500 GlyValPheValLeuGlyPheLeuGlyPheLeuAlaThrAlaGly SerAlaKecGlyAlaArgAlaSerLeuThrValSerAlaGlaSer • . 1600 ArgT'arLeuLeuAlaGlylleValClaGLaGlaGlaGiaLeuLevr AspValValLvsArgGlnGlaGluLeuLeuArgLeuXhrValTrp 1700 G1yThrLysAsnXeuClaAlaArgValThrAlalleGluLysTyr LeuGlnAspGlaAlaArgLeuAscSerTrpGlyCysAlaPheArg 1800 GIn7a1CysEis ThrXhr7 alProXrpVaiAs nAs p S erLeuAla PraAspTrpAspAsnKetlhrTrpGlaGluTrpGluLysGlsVal # • • • • ArgTyrLeuGluAlaAsnlleSerLysSerLsuGiuGinAlaGln 1900 IlaGlnGlnGluLysAsnMetXyrGluLeuG InLy sLeuA_suS e r % • « • * * * TrpAspIlePheGlyAsaTrpPheAspLeuThrSerTr ?'V a£l L y s 2000 TyrIleGlaTyrGlyValLeuIleileVa1AlaVa11leAlaLeu • ••»! ArglleVallleTyrValValGlnlietlsuSerArgLeuArgLys 2100 GlyTyrArgFroYalPheS erS erProProGlyTyrlleGlnGln - 79 IIeEisIleEisLysAspArgGlyGlnProAraAsnG luGluIhr ^ . 2200 G luGluAs pGlyGlySerAsaGlyGlyAspArjTyrlrpProTrp ProIleAlaTyrIleHisPheLeuIleArgGlnLeuI1eArgLeu - LeuThrArgLeuTyrS erlleCysArgAs pLeaLeuS erArg Ser 23 0 0 . . »_ PheLeuThrLeuGlnLeuIleTyrG lnAsnLeoArgAspTrpL^eu ArgLeuArgThrAlaPheLeuG InTyrGly'CysGluTrpIleGIn 2400 . ' GluAlaPheGlnAlaAlaAlaArgAlaThrArgGluThrLeuAla GlyAlaCysArgGlyLeuTrpArgValLeuGluArglleGlyArg " « , .« 2500 Gly11eLeuAlaVa1? roArgArglleArgGlnGlyAlaGluIle Al aLeuLeu G lyllirAl aValSerAlaGIyArgLeuTyrGlu ■ £ * * 2600 * . TyrSerMetGluGlyProSerSerArgLysGlyGluLysPh&Val G I n A1 a T h r L y s T y r G 1 yc - 80 -

24. A method for the in vitro detection of the presence of antibodies against anti-HIV-2 in a biological liquid, which comprises contacting a serum or other biological medium from the person to be diagnosed with a composition according to any one of the claims 12 to 17 or with an antigen according to any one of claims 18 and 23; detecting any immunological conjugate formed between the anti-HIV-2-antibodies and the antigen or antigens used.

25. The method of claim 24 in which the immunological conjugate is detected by reacting any immunological conjugate formed with a labelled reagent formed either by human anti-immunoglobulin-antibodies or of a bacterial A protein, and detecting any complex formed between the reagent and the immunological conjugate.

26. A kit for the detection of anit-HIV-2-anitbodies in a biological fluid which comprises: a composition according to any one of claims 12 to 17 or an antigen according to any one of claims 18 to 23; and detection means for detecting the immunological complex resulting from the immunological reaction between the antigen and the biological fluid.

27. The kit of claim 2 6 in which the detection means comprises human anti-immunoglobulins or a protein A and a further detection means for detecting the complex formed between the anti-HIV-2-antibodies contained in the detected immunological conjugate.

28. An immunogenic composition containing an envelope glycoprotein of HIV-2 retrovirus or part of the glycoprotein, in association with a pharmaceutically acceptable vehicle appropriate for the constitution of vaccines effective against HIV-2.

29. A composition according to claim 28 in whi4^t3iS^^yelope J/ OA glycoprotein is a gpl4 0 glycoprotein. ;^wSL,W0 4 . 81 . 21S0&4

30. The composition of claim 28 or claim 29 which contains at least part of an immunogenic glycoprotein comprising the protein backbone having the following sequence: ENVRN 1-leclletAsnGlnLeuLeuIleAlaIleLeuLeuAlsSerAlaCys ft • • • LeuValTyrCysTbrGlaTyrValXhrValPheTyrGlyValPro • • * » • XhrTrpLysAsaAlalhrlleProLeuPheCysAlaXhrAr^Asa 100 . . - ArgAs pXhrXrpGlylhrI1eG InCysLeuProAspAsnAspAsp " • l i • • Tyr GlaGluIlelarLeuAsnValThrGluAlaPhsAspAlaTrp 200 AsnAsnXhrValThrGluGlaAlallsG luAspValTrpEisLeu * «» « • • PbeGluIhrSerlleLysPxoCysValLysLeuTbrProLeuCys 300 ValAlaUetLysCysSerSerThrGluSerSerThrGlyAsnAsn « t * • • ThrThrSerLysSerlhrSerThrXhrThrThrThrProihrAsp ... AGO GlnGluGlaGluIleSerGluAspThrProCy sAIzAr'gAlaAs^ • l • » • AsaCysSerGl yLeuGly G luG luGluThr IleAsaCvsGin^be • . r • • • ♦ AsnlletlhrGlyLeuGluArgAspLysLysLysGlnlyrAsnGlu 500 .... ThrXrpTyrSerLysAspValValCysGluIhrAsaAsaSerlhr » • « • AsaGlnThrGlnCy sTyrHe tAsnEisC ysAsnXhrSerVallle . 600 . • . TbrGluSerC^sAspLysEisXyrXrpAspAlalleArgPh eAr g N.,. ^ * • * "" ^ ^ TyrCysAlaProProGlyTyrAlaLeuLeuArgCysAsnAspThr <► 700. . AsnTyrSerGlyPbeAlaProAsnCysSerLy s Va 1 ValAl aS 82 ThrCyBThrArglietMeLGluTbrGlnTbrSerlbrTrpPheGlj 800 PheAsnGlyThrArgAlaGluAsnArgTbrTyrlleTyrTrpHis • • • • GlyArgAspAsnArsTbrllsIleSerLeuAsnLyETyrTyrAsn 900 LeuSe r-LeuBis Cy sLy s Arg? roGlyAsnLysThrValLysGla t • • •• IlelietLeuHeiSerGlySisValPheHisSerHisTyrGl^Pro • • 4 • • IleAsaLysArgProArgGlnAlalrpCysIrp?be-ysGlyLys 1000 TrpLysAspAlaMetGInGluValLysThrLeuAlaLysHisPro • • • • • ArgTyrArgG lyThrAsnAspThrArgAsr. II eS srPhsAlaAla 1100 FroGlyLysGlySerAspProGluValAlaTyrMetTrpTbrAsn t • • * * CysArgGlyGluPheLeuTyrCysAsnMecThrlrpPbeLsuAsa liuO TrpIleGluAsaLysThrHisArgAsaTyrAlaProCysKisIls • • • • • LysGlnIleIlsAsnTnrTrpHisLys?aiGlyArgAsnVa>Tyr 1300- ?' Le.u?roProArgGluGlyGluLeuSerCysAsc.SerThrValTbr • • • • • SerllelleAl aAsnl leAspTrpG InAs nAs nA snG lr.tcrAsn • • ♦ • IleThrPheSerAlaGluValAlaGluLeuTyrArgLeuGluLeu 14UQ . GlyAspTyrLysLeuValGluIleThrProIleGlyPheAlaPro 83 ThrLysGluLysArgTyrSerSerAlaSisGlyArg 3 i sTarArg 1500 GlyVal?'ne7alLeuGly?heLeuG lyPh eL euA laTbrAlaGly SerAlaKecGlyAlaArgAlaSerLeuThrValSerAlaGlnSfir * *• 16 00 « t ArgTarLeuLeuAlaGlylleValGlaGlaGlaGlaGlnLeuLeu AspValValLjsArgG laGInGluLeuLeuArgLeuT'arVa lTrp • • • 1700 • GlyThrLysAsaLeuGlaAlaArgVaIThrAlalleGluLysTyr LeuGlaAspGlnAlaArgLeuAszSerTrpGlyCysAlaPaeArg • • • • 1800 GlaValCysEisXurXhrValProXrpValAsnAspSerLeuAla ProAspXrpAspAsnKetThrTrpGl'aGluIrpGIuLysGlziVal ArgTyrLeuGluAlaAsnlleSe zLy 5SerLeuGiupla.AlaGi.ij 1900 IleGlaGlaGluLysAsaMetTyrGluLeuGInLysLeuAsnSe r TrpAspIlePaeG lyAsuTr pPbeAs pLeuThrS erXrpValLvs 2000 TyrllsGlnTyrGlyValLeuIlelleValAlaVallleAlaLeu ArglleVallleXyr7a1 7a 1G la!le tLsuSerArgLeuArgLys 2100 G lyTyrArsProYalPheSerSerProPr oGlyTyr I leG.lnGln 83 ThrLysGluLysArgTyrSerSerAlaHisGlyArgHisThrArg 1500 GlyVal?heValLeuGly?heLeuGly?heLeuAlaTbrAlaGly SerAlaHetGlyAlaArgAlaSarLeuIhrValSerAlaGlnSer * *• 1600 • » ArglhrLeuLeuAlaG lylleValGlnGlaGlaGlaGlaLeuLeu As p ValVa LLvsArgGlaGInGluLeuLeuArgLeuThrValTrp 1700 GlyThzLysAsaLeuGlaAlaArgVaIThrAlalleGluLysTyr LeuGlaAspGlaAlaArgLeuAsaSerTrpGlyCysAlaPheArg 1800 GlaValCysEisThrThrValProTrpValAsaAspSerLeuAla ProAspTrpAspAsuKetThrTrpGlaGluIrpGIuLysGlnVal ArgTyrLeuGluAlaAsnl1sSe rLys SerLeuGluGlaAlaGla 1900 IleGluGlaGluLysAsaMecTyrGluLeuG luLysLeuAsaS er TrpAspIlePheGlyAsnTrpPbeAspLeuThrSerlrpValLys 2000 TyrlleGlnTyrGlyValLeuIlelleValAlaVal'IleAlaLeu ArglleVallleTyrValVa 1G ln!ie cLsuS e rAr gLeuArgLy s 2100 GlyTyrArsFroValPheS erSerProP roGlyTyr11eGlaGln IleEisIleEisLysAspArgGlyGlaProAlaAsaGluGluThr 2200 CluGluAspGlyGlySsrAsaGlyGlyAspArgTyrlrpProTrp ProIleAlaTyrlleHisPbeLeuIleArgGlnLeuIleArgLen.. • • • • ' LeuThrAr gLeuTyrS erlleC ysArgAspLe uLeuS erArgSer 23 0 0 PbeLeuThrLeuGlaLeuIleTyrG InAsaLeuArgAsp 7 rpLfl-u • ♦ • • • ArgLeuAr gThrAlaPbeLeuGlnTyrGlyCysGluTrpIleGla 2400 GluAlaPheGlaAlaAlaAlaArgAlaThrArgGluThrLeuAla G1yAlaCysArgGlyLeuTrpAr gValLeuGluArgl1eGlyATg 2500 GlyIIeLsuAlaVaLProArgArglleArgGlnGlyAlaGluIle « • • • AlaLeuLeu- " GlyThrAl aVa ISerAlaGlyArgLeuTyrGlu 2600 : Tyr S erHe cGluGly?ro Se rS erArgLysG1yGluLysPheVal ♦ « GlaAUThrLysTyrGly, - 85 -

31. An immunogenic composition of any one of claims 28 to 30 which contains antigen in an amount sufficient to provide a dosage-unit of 10 to 500, y^g/kg of bodyweight.

32. An immunogenic composition according to claim 31 in which the dosage unit is 50 to 100/:g/kg of bodyweight.

33. A monoclonal antibody which is able to specifically recognize an antigen according to any one of claims 20 to 23.

34. A recombinant vector comprising a cloning vector and a nucleic acid, optionally labelled, which is derived from at least part of the RNA of HIV-2 retrovirus or at least part a variant of the retrovirus which is recognised by antibodies raised to the retrovirus.

35. A recombinant vector of claim 34 which contains at least part of the cDNA which corresponds to the entire genomic RNA of the HIV-2 retrovirus.

36. A recombinant vector of claim 34 which contains the nucleotide sequence: CTIGGAAGGCGAGACTG^^GCAAGAGGAATACCATTTAGfmAAGGACAG CL^ACACXTIATACTIGGTCJ^GGGCAGGAAGTAJtCIAACAGAAACnGCTGAG ACTGCA GGGA CTTTCCAG AAGGGG CT GT AA CCAAGG GAGGGACA.TGGGAG GA GCTG GT GG GG AA CG CCTCAT ATTCTC TG 7ATAAT ATAC CC GCTGCTTG ' C^'TlGTACTIC^CrTCGCTCrGCGGAGAGGCTGGCAGATTGAGCCCTGGAd "GATCTCTGCAGCACTAGACGGATGAGCCTGGGTGCCcfTGCTAGACTCTCA* CCACCACnGGCCGGTGCTGGCAGACGGCTCCACGCTTGCCTGCTTAAAS _ ACCTTCCTITXAATAAAGCrGCAGTAGAAGCAL. • - 86 21S024 I 'V

37. A recombinant vector of claim 34, which contains a nucleotidic sequence coding for at least part of the following amino acid sequence: GAGRODN Me tGlyAlaArgAsaSerValLeuArgGlyLysLysALaAs pGlu LeuGluArgIleArgLeuArs?roGljGlyLysLysLystyrArg 10 EeuLvsHisIIeValXrpAlaAlaAsnLysLeuAs p Ar gPh^G ly- 100 . I .. . . ; LeuAlaGluSerLeuLeuGluSerLysGluGlyCysGlaLysIle 15 LeaThrValLeuAs pProMe tVaIProThrGlySerGluAsnLeu 200 LysSerLeuPheAsnlhrValCysVallleTrpCysIleHisAla GluGluLysValLysAspXhrGluGlyAlaLysGlnlleValArg 20 3Q0 Ar-gHisLeuValAlaG luXhrGlyThrAlaGluLysMecProSer 25 ThrSe rAr2-roThrAlaProSerSerGLuLysGLyGlyAsuTyr • """ - . ' • 400 ProValGlaEisValGlyGlyAsnlyrThrHisIleProLeuSsr ProArgXhrLeuAsaAlaXrpValLysLeuValGluGluLysLys PheGlyAlaGluValValProGlyPheGlnAlaLeuSerGluGly Wr^ 30 SQQ CysThrProXyrAspIleAsnGlnMecLeuAsaCysValGlyAsp EifiGlnAlaAlaMecGlnllelleAr®GlulleileAs ntGluGlu ... — , » 6 00 « • i AlaAlaGluTrpAspValGInHisProIleProGIyProLeuPro 35 AlaGlyGlnLeuArgGluProArgGlySerAspIleAlaGlylhr 706 ThrSerThrValGluGluGlnl leG laTrpHe tPh eArgPr oGfln A* \i A i X /- i 'v , ii 87 AsuProValP.roValGlyAsalleTyrArgArgTrpIleGlnlle- • • • S 0 0 « GlyLeuGlaLysCysValArgMetTyrAsnProThrAsalleLeu AspIleLysGlaGlyProLysGluProPheGlnSerTyrValAsp • • » • 9 00 ArgPheTyrLysSerLeuArgAlaGluGlaThzAspProAlaVal LysAsnTrpMetTbrGlnThrLeuLeuValGlnAsnAlaAsa'Pro AspCysLysLeuValLeuLysGlyLeuGlyMe tAsnProThrLeu 1000 GluGluMetLeuThrAlaCysGlnGlyValGlyGlyProGlyGln LysAlaArgLeuMeCAlaGluAlaLeuLysGluVallleGlyPro 1100 AlaProIleProPheAlaAlaAlaGlnGlaAr gLysAlaPheLys Cy sTrpAs aCysGlyLysGluG1yHisSezAlaArgGlaCysArg 1200 AlaProArgArgGlnGlyCysTrpLysCy.sGlyLysProGlyHis 11 el-ietThrAsnCysProAspArgG InAlaGlyPheLeuGtyLeu

1300. r GlyProTrpGlyLysLysProAroAsuPheProValAlaGlnVal ProGlnGlyLeuThrProT'orAlaProProValAspProAlaVal AspL.euLeuGluLysTyrl-IetGlnGlnGlyLysArgGlaArgGlu 140 0 GlnArgGluArgProTyrLysGluValThrGluAspLeuL^uEis LeuGluGlaGlyGluThrProTyrArgGluProProThrGluAsj T500 . . A- \ LeuLeuHi sLeuAsnSerLeuPh eG lyLysAspGla. /(<? - 88 - 219024

38. A recombinant vector of claim 34 which contains a nucleotidic sequence coding for at least part of the following amino acid sequence: •sc** r 10 15 20 !ArsT-ysAla?beL*» CysTrpAsaCysG lyLy sG luG lyafTs'STTAlaAr gGlaCysArg 1200 AlaPr oArgArgGlaGlyCysTrpLysCy.sG lyLy sProGlySis IlelletThrAsnCysProAspArgGlnAlaGlyPhsLeuGlyLetx 1300 GlyProTrpGlyLysLysProArgAsnPheProValAlaGlnVal P roG LnGlyLeuThrProTbrAlaPra? roValAs pProAlaVal As pL.euLeuG luLy sly rile cG InG laG lyLy sAr gG InArgG lu 140 0 GlaArgGluArgProTyrLysGluValThrGluAspLeuLeuEis LeuGluGlaGlyGluThrProTyrArgGluProProThrGluAsp . rsoo LeuLeuHisLsuAsnSerLeuPbeGlyLysAspGln*

39. The recombinant vector of claim 34 which contains a nucleotidic sequence coding for at least part of the following amino acid sequence: 5 10 lie c G1 yAlaArgAsaS erVa lLeuArgGlyLysLy sA la As pGltj * «r « '• •• . • • - LeuGluArglleArgLeuArgProGlyClyLys LysLy s TyrArg • • • ' • LeuLysHisIleVaHrpAlaAlaAsnLy sLeuAs pArgPheGly 100 . : LeuAlaGluSerLeuLeuGluSerLysGluGIyCysGlaLysIle LeuThrValLeuAspProHetValProThrGlySerGluAs nLeu . . 200 . Lys S e rLeuPheAsnThrVaICys Va.111eTrpCysIleEisAla • • . • • ,» GluGluLysValLysAspThrGluGlyAlaLysGlnlleValArg 300 . - ArgRisLeuValAlaGluThrGlyThrAlaGluLy slle tPro Ser • • • •• m i 20 ThrSerArgProThrAlaProSerSerGluLysGlyGlyAsnTyr. 400 : 15 T\ vV? 5 -90- 2iS0i;

40. A recombinant vector of claim 34 which contains a nucleotidic sequence coding for at least part of the following amino acid sequence: Pro ValGlnHisValGlyGlyAEaTyrTlirHisIleProLeuSer V * * • ProArgTkrLeaAsnAlaTrpValLysLeuValGluGluLysly a' 15 25 ■ TT'1 35 w . m m * - PhsGlyAlaGluValValProGlyPheGlnAlaLeuSerGluGly - 300. • • • ■ •' 1 q CysThrProTyrAspITleAsiiGlnMetLeuAsnCys ValClyAsp • • • SIsG InAlaAlaHecGlal lelleAr^GlallelleAsnGluClu * . V • S00 • • • AlaAlaGluTrpAspValGlnHisBroIleProGlyPr cLeuPro AlaGlyGlaLeuArgGluProArgGLySerAspIleAlaGlylhr 700 • . . . . ThrSerThrValGluGluGlnlleG LnTrpIletPheArgProG In 20 AspProValP.roValGlyAflalleTyrArgArgTrpIlsGlalle - * • " " • •' SOD GlyLeuGlnLysCys ValArglletXyrAsnProXhrAsalleLeu AspIleLysGloGlyProLysGluProPheGLnSerXyrValAsp , * ... 900 ArgPheTyrLysSerLeuArgAlaG luG Inlhr As pProAlaVa.1 «• w • • • LysAsaTrpUetTTirGlnThrLeuLen ValGlnAsnA'laAsaPr o . • ^ » . . 30 AspCysLysLeuValLeuLysGlyLeuGlyHetAsaProThrLen 1000 .. ^ _ . " --~ GluGltl}ietLe&^fir£Ia^;sGlnG lyValGlyGlyProGlyGln • ■ • • ' ^ 1 A'"v\ LysAlaArgLenHeCAlaGl'uAlaLeuLysGluVallleGlyPro o\ - ' ' 1100 " -II AlaProIleProPlieAlaAlaAlaGlnClii • a sfl \ \ ThrLysGluLysArgTyrSerSerAlaEisGlyArgHisThrArg 1500 ClyValPheValLeuGlyPheLeuGlyPheLeuAlaThrAlaGly* SerAlaHetGlyAlaArsAlaSerLeuThrValSerAlaClnSer 1600 ArglhrLeuLeuAlaGlylleValGlnGlciGlnGlnGinLeuLeur AspValValLvsArgGlaGlnGluLeuLeuArgLeuThrValTrp 1700 GlyThrLysAsnLeuGlnAlaArgVaIThrAlalleGluLysTyr LeuGlnAspGlaAlaArgLeuAscSerTrpG1yCysAlaPheArg • • • • 1800 GlnValCysHisThrThrVa1? rolrpValAs nAs p SerLeuAla ProAspTrpAspAsnHetThrTrpGlaGluTrpGluLysGlnVal ArgTyrLeuGluAlaAsnlleSerLysSerLeuGlupiiiAlaGin 1900 IleGlnGlnGluLysAsnMetTyrGluLeuG InLysLeu.isnSer TrpAspIlePheGlyAsnlrpPheAspLsuThrSerlrpValLys 20 00 TyrlleGlnTyrGlyValLeuIlelleValAlaVal'IleAlaLeu ArglleVallleTyrValValGlnlietLeuSerArgleuArgLys 2100 GlyTyrArgProValPheSerSerProProGlyTyrIleGlnGln • - 9; IleEisIleZisLysAspArsG lyGlaProAlaAsnCluGluTbr 2200 GluGluAspGlyGlySsrAsaGlyGlyAspArgTyrlrpProTrp • » • • • ProIleAlaTyrlleHLsPheLeuIleArgGInLeuIlaArgLea LeuTbrArgLeuTyrSerlleCysArgAspLeuLeuSerArgSer 2300 . PbeLeuThrLeuGlnLeuIl eTyrGlaAsnLeuArgAspTrpLeJu ArgLeuArgThrAlaPbeLeuGInTyrGlyCysGluTrpIleGln 2400 GluAlaPbcGInAlaAlaAlaArgAlalbrArgGluTbrLeuAla. GlyAlaCysArgGlyLeuTrpArgValLeuGluArglleGlyArg 2500 GlylleLeuAlaYalProArgArglleArgGlaG1yAlaGluIle AlaLeuLeu*-— GlyThrAlaVaIS erAlaG LyArgLeuIyzGlu • *•" . . . 2 600 . TyrSerHetGluGlyProSerSerArgLysGlyGluLysPheVal • * GlaAlaThrLysTyrGly, p- ? j. ny ^ - 93 -

41. A process for the detection of HIV-2 retrovirus or of its RNA in a biological liquid or tissue, which coinprises contacting nucleic acids contained in said biological liquid or tissue with a probe containing a nucleic acid according to any V one of claims 35 to 4 0 under stringent hybridization conditions for the time necessary for said hybridization to occur, washing the hybrid formed with a solution ensuring the preservation of said stringent conditions, and detecting the hybrid formed.

42. A process for the production of HIV-2 retrovirus which comprises culturing human T4 lymphocytes or permanent cell line derived from said T4 lymphocytes and carrying the T4 phenotype, or both, which lymphocytes or cell lines had previously been infected with an isolate of HIV-2 virus, and when the level of reverse transcriptase activity reaches a selected threshold, recovering and purifying the retrovirus released in the culture medium of said lymphocytes or cell lines, or both.

43. A process according to claim 42 in which the retrovirus is purified by differential centrifugation in a gradient of sucrose or metrizamide.

44. A process for the production of specific antigen of HIV-2 retrovirus which comprises lysing the retrovirus and recovering the lysate containing said antigens.

45. A process according to claim 44 in which the retrovirus is lysed in SDS detergent.

46. A process for the production of a protein selected from pl2, pl6 and p26 or a protein having the structure of gpl40 or selected parts of said proteins, which process comprises inserting the corresponding nucleic acid sequence in a vector capable of transforming an appropriate host enabling the expression of an insert contained in said vector7<<JtX9nsforming said host by said vector, culturing the transfand recovering and purifying the expressed protein?" o 4 20 FEB 1990 r° - 94 - 2i&0a

47. A process for the production of a hybridization probe for the detection of the RNA of HIV-2 retrovirus which comprises inserting a nucleic acid derived from the RNA of HIV-2 retrovirus in a cloning vector by in vitro recombination, cloning the modified vector obtained in a competent cellular host, and recovering the DNA-recombinants obtained.

48. A retrovirus according to claim 1 and substantially as described in this specification with reference to the examples and the drawings.

49. A composition according to claim 12 and substantially as described in this specification with reference to the examples and the drawings.

50. An antigen according to claim 18 and substantially as described in this specification with reference to the examples and the drawings.

51. A method as claimed in claim 24 and substantially as described in this specification with reference to the examples and the drawings.

52. A kit as claimed in claim 26 and substantially as described in this specification with reference to the examples and the drawings. \ r

53. An immunogenic composition as claimed in claim 28 and substantially as described in this specification with reference to the examples and drawings.

54. A recombinant vector as claimed in claim 34 and substantially as described in this specification with reference to the examples and drawings. - 95 -

55. A process for the production of HIV-2 retrovirus as claimed in claim 42 and substantially as described in this specification with reference to the examples and drawings.

56. HIV-2 retrovirus when prepared by the process of claim 55. </div>