DE19825082C1 - Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein - Google Patents

Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein

Info

Publication number
DE19825082C1
DE19825082C1 DE19825082A DE19825082A DE19825082C1 DE 19825082 C1 DE19825082 C1 DE 19825082C1 DE 19825082 A DE19825082 A DE 19825082A DE 19825082 A DE19825082 A DE 19825082A DE 19825082 C1 DE19825082 C1 DE 19825082C1
Authority
DE
Germany
Prior art keywords
cells
pcr
tumor
epithelial
carcinoma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
DE19825082A
Other languages
German (de)
Inventor
Gabriele Jaques
Silke Henrich
Almut Wachtel
Ulf Seifart
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to DE19825082A priority Critical patent/DE19825082C1/en
Application granted granted Critical
Publication of DE19825082C1 publication Critical patent/DE19825082C1/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Abstract

A method (I) for detecting single epithelial carcinoma cells in various body samples, is new and comprises extracting RNA from cells and using RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using two primers (i and ii) which encode a 40kD epithelial glycoprotein (GA733-1). A method (I) for detecting single epithelial carcinoma cells in various body samples, is new and comprises extracting RNA from cells and using RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using two primers (i and ii) which encode a 40kD epithelial glycoprotein (GA733-1), where (i and ii) have the following sequences: 5' Primer: TAAGGCCAAGCAGTGCAAC (i) 3' Primer: GGATCCAGTTGATAACGCGT (ii).

Description

Die Erfindung betrifft ein Verfahren zum Nachweis einzelner epithelialer Karzinomzellen eines breiten Spektrums ver­ schiedener Tumorentitäten in unterschiedlichen Körperproben, insbesondere Knochenmark, peripherem Blut, Leukapheresaten für die autologe Stammzelltransplantation und Ergüssen.The invention relates to a method for the detection of individual epithelial carcinoma cells of a wide spectrum ver different tumor entities in different body samples, especially bone marrow, peripheral blood, leukapheresis for autologous stem cell transplantation and effusions.

Die Nachweismöglichkeit einzelner Tumorzellen im peripheren Blut, Knochenmark und Leukapheresaten bei Patienten mit soliden Tumoren ist vor allem in zweierlei Hinsicht von großer klinischer Bedeutung:
The possibility of detecting individual tumor cells in peripheral blood, bone marrow and leukapheresis in patients with solid tumors is of great clinical importance above all in two ways:

  • 1. kann das Vorhandensein zirkulierender Tumorzellen bei Diagnose eines eigentlich lokal begrenzten Tumors das therapeutische Vorgehen entscheidend beeinflussen; und1. can contribute to the presence of circulating tumor cells Diagnosing an actually localized tumor decisively influence therapeutic procedures; and
  • 2. kann eine Reinfusion von autologem Knochenmark oder peripheren Stammzellen, die mit Tumorzellen kontaminiert sind, den Therapieerfolg z. B. nach einer Hochdosistherapie zunichte machen.2. can be a reinfusion of autologous bone marrow or peripheral stem cells that are contaminated with tumor cells, the therapeutic success z. B. after high-dose therapy do.

Es sind bereits verschiedene Methoden für den Nachweis einzelner Tumorzellen bekannt. Am häufigsten wird die Tumorzellsuche mittels immunzytochemischer Färbung oder mit der Polymerase-Kettenreaktion (PCR) durchgeführt. There are already various methods of detection individual tumor cells known. The most common is Tumor cell search using immunocytochemical staining or with the polymerase chain reaction (PCR).  

Die Sensitivität und/oder Spezifität des immunzytochemischen Nachweises (Pantel et al. Oncology Today 11, 4-9, 1994; Schlimok et al. J clin. Oncol 8, 831-837, 1990; Schlimok et al. Proc. Natl. Acad. Sci. 84, 8672-8676, 1987) hängt entscheidend von den eingesetzten Antikörpern und der nachfolgenden Entwicklungsmethode, vor allem aber von dem geschulten Auge von minimal zwei Untersuchern ab, die mikroskopisch eine Tumorzelle unter einer Million mononuklea­ ren Zellen des Blutes erkennen müssen. Die zur Zeit am häufigsten eingesetzten Antikörper richten sich gegen Zytokeratine und epithelspezifische Proteine (Pantel et al. Oncology Today 11, 4-9, 1994; Schlimok et al. J Clin. Oncol 8, 831-837, 1990; Schlimok et al. Proc. Natl. Acad. Sci. 84, 8672-8676, 1987). Mit Hilfe dieser Methode können bisher Tumorzellen, die aus soliden Tumoren (Mammakarzinom, Kolonkar­ zinom, Brochialkarzinom, etc.) stammen, erkannt werden. Falsch-positive Ergebnisse sind bei Proben, die zu Artefakt­ bildung neigen, möglich. Schwachgefärbte Zellen können leicht übersehen werden und somit zu falsch-negativen Ergebnissen führen. Da das Probenvolumen häufig nur in begrenztem Umfang zur Verfügung steht, ist eine Wiederholung der Bestimmung bei uneindeutigem Ergebnis nur nach erneuter Probennahme durch­ führbar.The sensitivity and / or specificity of the immunocytochemical Detection (Pantel et al. Oncology Today 11, 4-9, 1994; Schlimok et al. J clin. Oncol 8, 831-837, 1990; Schlimok et al. Proc. Natl. Acad. Sci. 84, 8672-8676, 1987) crucial from the antibodies used and the subsequent development method, but especially from that trained eye from a minimum of two examiners who microscopically a tumor cell under one million mononucleae need to recognize ren cells of the blood. The currently on Most commonly used antibodies are directed against Cytokeratins and epithelial-specific proteins (Pantel et al. Oncology Today 11, 4-9, 1994; Schlimok et al. J Clin. Oncol 8, 831-837, 1990; Schlimok et al. Proc. Natl. Acad. Sci. 84, 8672-8676, 1987). So far, with the help of this method Tumor cells made from solid tumors (breast cancer, colon cancer zinom, Brochialkarzinom, etc.) originate, are recognized. False-positive results are for samples that are too artifact education tend to be possible. Weakly stained cells can easily are overlooked and thus lead to false negative results to lead. Because the sample volume is often limited is available, is a repetition of the determination at ambiguous result only after sampling again feasible.

Die Polymerase-Kettenreaktion (als RT-PCR) gilt inzwischen als etablierte Methode zum Nachweis verschiedener bösartiger Erkrankungen (Datta et al. J. of Clin. Oncol. 12, 475-483, 1994). Die beschriebene Nachweisempfindlichkeit ist vergleich­ bar mit der Immunzytochemie und wird mit von bis zu einer Tumorzelle in 106 mononukleären Zellen des Blutes angegeben (Lopez-Guerro et al. Clin. Chim. Acta 263, 105-116, 1997; Helfrich et al. Br. J. Cancer 76, 29-35, 1979). Inzwischen sind PCR-Verfahren veröffentlicht, die die mRNA für Zytokera­ tine (Lopez-Guerro et al. Clin. Chim. Acta 263, 105-116, 1997; Traystman et al. J. Hematother. 6, 551-61, 1997), für den EGF- Rezeptor (DE-OS 44 31 174 A1), für die Neuronspezifische Enolase (NSE) und HPV 16/18 (DE-OS 44 31 174 A1) oder den pankarzinomasssozierten Tumormarker EGP-2 (KSA oder 17-1A Antigen) (Helfrich et al. Br. J. of Cancer 76, 29-35, 1997) zur Identifizierung von Tumorzellen in unterschiedlichen klinischen Proben einsetzen.The polymerase chain reaction (as RT-PCR) is now considered an established method for the detection of various malignant diseases (Datta et al. J. of Clin. Oncol. 12, 475-483, 1994). The detection sensitivity described is comparable to immunocytochemistry and is indicated with up to one tumor cell in 10 6 mononuclear cells of the blood (Lopez-Guerro et al. Clin. Chim. Acta 263, 105-116, 1997; Helfrich et al. Br J. Cancer 76, 29-35, 1979). In the meantime, PCR methods have been published which contain the mRNA for cytokeratin (Lopez-Guerro et al. Clin. Chim. Acta 263, 105-116, 1997; Traystman et al. J. Hematother. 6, 551-61, 1997), for the EGF receptor (DE-OS 44 31 174 A1), for the neuron-specific enolase (NSE) and HPV 16/18 (DE-OS 44 31 174 A1) or the pancarcinoma-associated tumor marker EGP-2 (KSA or 17-1A antigen ) (Helfrich et al. Br. J. of Cancer 76, 29-35, 1997) to identify tumor cells in different clinical samples.

Der Nachweis epithelialer Zellen über die mRNA für Zytokeratin (CK) 19 hat sich inzwischen als problematisch herausgestellt, da der spezifische Nachweis von CK 19 mRNA durch die Gegenwart eines bekannten CK 19 Pseudogens mit hoher Homologie behindert wird. Dieses Pseudogen ist verantwortlich für falsch-positive Ergebnisse bei verschiedenen, nicht epithelial bedingten malignen Krankheiten (Savtchenko et al. American Journal of Human Genetics, 43, 630-637, 1989).The detection of epithelial cells via the mRNA for cytokeratin (CK) 19 has now proven to be problematic since the specific detection of CK 19 mRNA by the present of a known CK 19 pseudogen with high homology becomes. This pseudogen is responsible for false positives Results in various non-epithelial conditions malignant diseases (Savtchenko et al. American Journal of Human Genetics, 43, 630-637, 1989).

Aus der DE-OS 197 10 802 A1 ist ein Verfahren zum Nachweis von kontaminierenden Karzinomzellen in peripheren Blutzellen und in Leukapheresaten mittels Reverse-Transkriptase Polymerase- Kettenreaktion bekannt, das die RT-PCR mittels eines oder mehreren EGF-Rezeptor-Primer-Paaren (EGF-R) durchführt. Diese Veröffentlichung hat den Tumorzellnachweis für das Mammakarzi­ nom erbracht, eine Austestung erfolgte allerdings nur an drei verschiedenen Zellinien von Mammakarzinomen, die sich als richtig-positiv gegenüber der Lymphom- oder Leukämiezellinie abgrenzen. Es ist bekannt, dass nicht alle Karzinome den EGF-R exprimieren, bspw. kann der EGF-R beim kleinzelligen Bron­ chialkarzinom, das häufig sehr früh metastasiert, nicht oder nur selten nachgewiesen werden. Hier besteht das Problem, dass der EGF-Rezeptor nicht oder nur in sehr geringem Maße exprimiert wird.DE-OS 197 10 802 A1 describes a method for the detection of contaminating carcinoma cells in peripheral blood cells and in leukapheresis using reverse transcriptase polymerase Chain reaction known that the RT-PCR using one or several EGF-receptor-primer pairs (EGF-R). This Publication has the tumor cell detection for the breast cancer nom, but only three were tested different cell lines from breast cancer, which are known as right-positive compared to the lymphoma or leukemia cell line delimit. It is known that not all cancers have the EGF-R express, for example, the EGF-R in small cell bron chial carcinoma, which often metastasizes very early, or not are rarely demonstrated. The problem here is that the EGF receptor is not or only to a very small extent is expressed.

In der DE-OS 44 31 174 ist bereits ein Nachweisverfahren für tumorspezifische mRNA in einer Körperprobe beschrieben worden, bei dem über mehrere, an sich bekannte Verfahren Schritte mit für Tumormarker spezifischen Primern eine amplifizierte cDNA gewonnen wird. Ein einziger, universell anwendbarer Tumormar­ ker, bei dessem Nachweis eine sichere Aussage über das Vorliegen eines Tumors möglich ist, wird dort allerdings nicht beschrieben. Vielmehr werden verschiedene für Tumormarker spezifische Primer nacheinander eingesetzt und abhängig davon, welche cDNA amplifiziert wird, Rückschlüsse darauf gezogen, wo der Patient Krebs hat und ob überhaupt.In DE-OS 44 31 174 there is already a detection method for tumor-specific mRNA has been described in a body sample, in the steps involving several known methods  an amplified cDNA for tumor marker-specific primers is won. A single, universally applicable tumor tumor ker, with its proof a reliable statement about the However, the presence of a tumor is not possible there described. Rather, they are different for tumor markers specific primers used one after the other and depending on which cDNA is amplified, conclusions drawn where the patient has cancer and if at all.

Die europäische Patentanmeldung 0 376 746 betrifft ein DNA- Segment, das für das GA733-1 Antigen kodiert. Dieses Segment zeigt zwar gewisse Übereinstimmungen mit der DNA und der Aminosäuresequenz des Antigens GA733-2, jedoch sind die Unterschiede in den Aminosäuresequenzen zwischen beiden Antigenen so erheblich, dass die Immunoreaktivitäten beider Antigene deutlich verschieden voneinander sind. Ein universel­ ler Tumormarker mit hoher Sensitivität wird dort nicht beschrieben.European patent application 0 376 746 relates to a DNA Segment that codes for the GA733-1 antigen. This segment shows certain similarities with the DNA and the Amino acid sequence of the GA733-2 antigen, however Differences in the amino acid sequences between the two Antigens so significant that the immunoreactivities of both Antigens are clearly different from each other. A universal There is no tumor marker with high sensitivity described.

Das Gleiche trifft auch auf die internationale Patentanmeldung WO 93/08289 zu, die auf die Herstellung von löslichen Varianten des GA733-2 Oberflächenantigens gerichtet ist. Die besonderen diagnostischen Möglichkeiten, die sich durch den Einsatz der mRNA des epithelialen Tumormarkers GA733-2 ergeben, werden dort nicht angesprochen.The same applies to the international patent application WO 93/08289 relating to the production of soluble Variants of the GA733-2 surface antigen. The special diagnostic possibilities, which are characterized by the Use of the mRNA of the epithelial tumor marker GA733-2 result, are not addressed there.

Auch die 1997 von Helfrich et al. (Bt. J. of Cancer 76, 29-35, 1997) veröffentlichte Methode, die als Tumormarker das EGP-2 (KSA oder 17-1A) Antigen über RT-PCR nachweist, kann zwar die Mehrheit der Kolorektal-, Lungen- und Brusttumore erfassen, jedoch ist diese Methode nur für die Analyse von Blutproben geeignet. Knochenmark, mit die aussagekräftigste klinische Probe zur Tumorzellsuche, liefert mit ihrem Nachweisverfahren falsch-positive Ergebnisse.The 1997 by Helfrich et al. (Bt. J. of Cancer 76, 29-35, 1997) published method which, as a tumor marker, EGP-2 (KSA or 17-1A) can detect antigen via RT-PCR Majority of colorectal, lung and breast tumors, however, this method is only for the analysis of blood samples suitable. Bone marrow, with the most significant clinical Sample for tumor cell search, delivers with its detection method false positive results.

Ausgehend von den oben dargelegten Nachweisverfahren besteht die Aufgabe der Erfindung darin, eine optimierte Methode zum Nachweis von Tumorzellen zu entwickeln, die im Rahmen von Krebsvorsorge und/oder Therapiekontrolle bei verschiedenen Krebserkrankungen eingesetzt werden kann.Based on the verification procedures outlined above the object of the invention is to provide an optimized method for To develop evidence of tumor cells developed within the framework of Cancer screening and / or therapy control in various Cancer can be used.

Im einzelnen sollten folgende Teilziele erfüllt sein:
The following individual goals should be met:

  • 1. Die Entwicklung eines empfindlichen Nachweisverfahrens für kontaminierende Karzinomzellen, das1. The development of a sensitive detection method for contaminating carcinoma cells, the
  • 2. universell einsetzbar für ein breites Spektrum unter­ schiedlicher Tumorentitäten ist und2. Universally applicable for a wide range of different tumor entities is and
  • 3. in unterschiedlichen Körpergeweben anwendbar ist.3. is applicable in different body tissues.

Dazu soll ein möglichst
To do this, one should

  • 1. geringes Probenvolumen benötigt werden und1. small sample volume are required and
  • 2. die Interpretation der Ergebnisse sollte einfach und eindeutig sein.2. The interpretation of the results should be simple and to be clearly.

Zur Lösung dieser Aufgabe wurde nun ein Verfahren zum Nachweis einzelner Karzinomzellen epithelialen Ursprunges in ver­ schiedenen Körperproben mittels der Reverse-Transkriptase- Polymerase-Kettenreaktion (RT-PCR) durch Gewinnung von RNA aus Zellen, die nach üblichen Methoden zu cDNA revers trans­ kripiert werden, gefunden, bei dem als Sonden die Primer
To solve this problem, a method has now been found for the detection of individual carcinoma cells of epithelial origin in different body samples by means of the reverse transcriptase polymerase chain reaction (RT-PCR) by obtaining RNA from cells which are reverse transcribed to cDNA by conventional methods, found the primers as probes

eingesetzt werden, die für ein 40 kD epitheliales Glycoprotein (GA733-2) kodieren. are used for a 40 kD epithelial glycoprotein Encode (GA733-2).  

Durch das erfindungsgemäße Verfahren ist es nun möglich, Tumorzellen aus den verschiedensten Ursprungsgeweben zu identifizieren. Das gewählte Zielgen, das Gen GA733-2 ist auf Zellen epithelialen Ursprungs exprimiert und fehlt auf Zellen mesenchymalen Ursprungs. Deshalb ist es besonders geeignet zur Tumorzellsuche, da die meisten Tumorzellen aus soliden Tumoren stammen und Zellen epithelialen Ursprungs sind, während die Körperprobe (Blut, Knochenmark, Ergüsse) nicht epithelialen Ursprungs ist. Entartete Blutzellen wie Leukämien werden durch dieses Verfahren nicht erfasst.With the method according to the invention it is now possible to Tumor cells from a wide variety of origin tissues too identify. The selected target gene, the GA733-2 gene, is on Cells of epithelial origin are expressed and absent on cells mesenchymal in origin. Therefore it is particularly suitable for Tumor cell search since most tumor cells are from solid tumors stem and cells are of epithelial origin, while the Body sample (blood, bone marrow, effusions) non-epithelial Is of origin. Degenerate blood cells like leukaemias are caused by this procedure is not covered.

Damit ist es nun möglich, eine ganze Reihe von unterschiedli­ chen Tumoren mit Hilfe eines einzigen Tumormarkers, des GA733- 2, zu erfassen. Hierzu zählen das Mammakarzinom, Prostatakar­ zinom, Bronchialkarzinom, Kolonkarzinom, Ovarialkarzinom und Endometriumkarzinom. Für das Bronchialkarzinom (unterteilt in kleinzelliges und nicht-kleinzelliges) ist dies der erster Marker, der gleichzeitig beide Subtypen mit hoher Trefferquote erfassen kann.It is now possible to use a number of different options tumor using a single tumor marker, the GA733- 2, capture. These include breast cancer, prostate cancer zinom, bronchial carcinoma, colon carcinoma, ovarian carcinoma and Endometrial cancer. For bronchial carcinoma (divided into small cell and non-small cell) this is the first Marker that simultaneously hits both subtypes with a high hit rate can capture.

Grundsätzlich hat das erfindungsgemäße Verfahren auch den Vorteil, dass in einer ganzen Reihe unterschiedlicher Körperproben die Tumorzellsuche vorgenommen werden kann, ohne dass das jeweilige Gewebe selbst falsch-positive Signale abgibt. Vereinfachend kommt hinzu, dass die unterschiedlichen Körperproben nicht nach verschiedenen Verfahren aufgearbeitet werden müssen. Das erfindungsgemäße Verfahren eignet sich vor allem auch für die Tumorzellsuche in Leukapheresaten für die autologe Stammzelltransplantation. Diese Präparate werden den Patienten nach erfolgter Chemotherapie zurückgegeben und sollten daher möglichst frei von Tumorzellen sein.Basically, the method according to the invention also has the Advantage in a whole range of different Body samples the tumor cell search can be made without that the respective tissue itself has false positive signals delivers. To simplify matters, the different Body samples were not processed using different methods Need to become. The method according to the invention is suitable especially for the tumor cell search in leukapheresis for the autologous stem cell transplant. These preparations are the Patients returned after chemotherapy and should therefore be as free as possible from tumor cells.

Mit dem erfindungsgemäßen Verfahren ist weiterhin eine eindeutigere Interpretation des Versuchsergebnisses möglich, da die Beurteilung einer Bande sich einfacher als die mikroskopische Beurteilung einer vermeintlichen Tumorzelle gestaltet.With the method according to the invention there is also a clearer interpretation of the test result possible, because judging a gang is easier than that  microscopic assessment of a putative tumor cell designed.

Die Gefahr falsch-positiver Ergebnisse ist bei diesem erfindungsgemäßen Verfahren gering, zumal für GA733-2 bisher keine Pseudogene bekannt sind. Die Analyse der in Frage kommenden Körperproben (peripheres Blut, Knochenmark, Leukapheresate, Ergüsse) hat bisher in keinem Fall falsch­ positive Signale gezeigt.The danger of false positive results is with this low process, especially for GA733-2 so far no pseudogenes are known. The analysis of the in question upcoming body samples (peripheral blood, bone marrow, Leukapheresate, effusions) has never been wrong positive signals shown.

Vorteilhaft für das erfindungsgemäße Verfahren ist weiterhin das sehr geringe Probenvolumen. Außerdem ist die Lagerfähig­ keit der cDNA sehr lang, so dass noch nach Jahren Wiederho­ lungsbestimmungen durchgeführt werden können.It is also advantageous for the method according to the invention the very small sample volume. It is also storable of the cDNA is very long, so that even after years of repetition can be carried out.

Dem erfindungsgemäßen Verfahren liegt die Idee zugrunde, dass epithelspezifische mRNA nur von Epithel- und Karzinomzellen, nicht aber von Zellen mesenchymalen Ursprungs exprimiert wird. Die Methode eignet sich zum Nachweis von Karzinomzellen in folgenden Körperproben: peripheres Blut, Knochenmark, Leukapheresaten, Pleuraergüssen, Pericardergüssen und Aszites. Die mRNA aus diesen Proben kann nach reverser Transkription in cDNA durch spezifische Primer in einer Polymerase-Kettenre­ aktion (PCR) durch Amplifikation nachgewiesen werden.The inventive method is based on the idea that epithelium-specific mRNA only from epithelial and carcinoma cells, but is not expressed by cells of mesenchymal origin. The method is suitable for the detection of carcinoma cells in following body samples: peripheral blood, bone marrow, Leukapheresate, pleural effusion, pericardial effusion and ascites. The mRNA from these samples can be after reverse transcription in cDNA by specific primers in a polymerase chain action (PCR) can be detected by amplification.

Die Körperproben werden den Patienten entnommen und können kurzfristig bei 4°C gelagert werden. Blut und Knochenmark wird mit gerinnungshemmenden Agentien (vorzugsweise Heparin) versehen. Anschließend werden die mononukleären Zellen und ggf. Tumorzellen von den Granulozyten und Erythrozyten der jeweiligen Körperproben abgetrennt. Diese Extraktion, wird nach dem vom Hersteller vorgegebenen Standardprotokoll für Lymphozytenextraktion durchgeführt und erfolgt mittels Dichtegradientenzentrifugation mit Ficoll-Paque (Pharmacia). Das so gewonnene Zellpellet wird direkt weiterverarbeitet oder mit einem DMSO-haltigen Einfriermedium bei -80°C gelagert. Aus den Zellpellets wird die Gesamt-RNA isoliert. Zur RNA- Extraktion können herkömmliche Verfahren wie z. B. RNAzol® (WAK Chemie, Bad Soden)-Extraktion verwendet werden. Die ex­ trahierte RNA, die die mRNA beinhaltet, wird einer unspezi­ fischen reversen Transkription unterzogen. Hierzu werden handelsübliche Oligonukleotide (z. B. Oligo (dT) (12-18) Primer, GibcoBRL), MMLV-reverse Transkriptase (z. B. Super­ script TM RT, Gibco BRL) usw. verwendet. Die RNA muss zuvor noch bei 70°C denaturiert werden, danach wird der komplette Reaktionsansatz für zwei Stunden bei 37°C inkubiert. Im Anschluss daran wird die Reaktion bei 95°C gestoppt. Dieses Verfahren dient dazu, die mRNA in cDNA zu übersetzen. Diese cDNA wird in die Polymerase-Kettenreaktion, unter Verwendung einer Taq-Polymerase (z. B. Boehringer Ingelheim), eingesetzt. Als Zielgen dient GA733-2, das für ein epithelspezifisches 40 kD Glykoprotein kodiert. Folgendes Primerpaar wurde zum Nachweis des Gens GA733-2 ausgewählt und eingesetzt. Die für die Auswahl der Primer zugrundeliegende Sequenz des Gens wurde von Szala et al. (Natl. Acad. Sci. USA 87, 3542-46, 1990) veröffentlicht.The body samples are taken from the patient and can be stored at 4 ° C for a short time. Blood and bone marrow are treated with anticoagulant agents (preferably heparin). The mononuclear cells and possibly tumor cells are then separated from the granulocytes and erythrocytes of the respective body samples. This extraction is carried out according to the standard protocol for lymphocyte extraction specified by the manufacturer and is carried out by means of density gradient centrifugation with Ficoll-Paque (Pharmacia). The cell pellet obtained in this way is processed further directly or stored at -80 ° C. using a freezing medium containing DMSO. The total RNA is isolated from the cell pellets. For RNA extraction, conventional methods such as. B. RNAzol® (WAK Chemie, Bad Soden) extraction can be used. The extracted RNA, which contains the mRNA, is subjected to an unspecific reverse transcription. Commercial oligonucleotides (e.g. oligo (dT) (12-18) primer, GibcoBRL), MMLV reverse transcriptase (e.g. Super script TM RT, Gibco BRL) etc. are used for this. The RNA must first be denatured at 70 ° C, then the entire reaction mixture is incubated at 37 ° C for two hours. The reaction is then stopped at 95 ° C. This procedure is used to translate the mRNA into cDNA. This cDNA is used in the polymerase chain reaction using a Taq polymerase (e.g. Boehringer Ingelheim). GA733-2, which codes for an epithelium-specific 40 kD glycoprotein, serves as the target gene. The following pair of primers was selected and used to detect the GA733-2 gene. The sequence of the gene on which the primers are based was developed by Szala et al. (Natl. Acad. Sci. USA 87, 3542-46, 1990).

GA733-2 (epithelialer Marker zum Nachweis von Karzinomzellen) GA733-2 (epithelial marker for the detection of carcinoma cells)

PCR Bedingungen für GA733-2 Primer:PCR conditions for GA733-2 primers:

Anlagerungs-(Annealing-)Schritt: 61°C, 30 Sekunden
Verlängerungs-(Extension-)Schritt: 72°C, 30 Sekunden
Denaturierungs-(Denaturation-)Schritt: 95°C, 30 Sekunden
Zyklenzahl: 28 Annealing step: 61 ° C, 30 seconds
Extension step: 72 ° C, 30 seconds
Denaturation step: 95 ° C, 30 seconds
Number of cycles: 28

Zur Kontrolle der oben beschriebenen Extraktion der RNA und deren Übersetzung in cDNA wurde als endogener Expressionsstan­ dard eine GAPDH (Glycerinaldehydphosphat-dehydrogenase)-PCR mitgeführt.To control the extraction of RNA and their translation into cDNA was used as an endogenous expression stan dard a GAPDH (glyceraldehyde phosphate dehydrogenase) PCR carried along.

Glycerinaldehydphosphatdehydrogenase Glyceraldehyde phosphate dehydrogenase

PCR-Bedingungen für GAPDH Primer:PCR conditions for GAPDH primers:

Anlagerungs-(Annealing-)Schritt: 58°C, 60 Sekunden
Verlängerungs-(Extension-)Schritt: 72°C, 60 Sekunden
Denaturierungs-(Denaturation-)Schritt: 95°C, 60 Sekunden
Zyklenzahl: 20
anschließend 10 Minuten 72°C Verlängerungs-(Exten­ sion-)Schritt. Die mittels PCR amplizierte DNA wird nach Standardmethoden nachgewiesen. Herkömmlich wird diese über ein Agarose Gel (1,5-1,7%) aufgetrennt und mit Ethidiumbromid (0,01%) sichtbar gemacht. Zur Kontrolle wird zusätzlich noch ein Größenmarker (100 bp, z. B. GibcoBRL) auf das Gel mit aufgetragen. Gleiches gilt auch für die in der Kontroll-PCR amplifizierte DNA.Annealing step: 58 ° C, 60 seconds
Extension step: 72 ° C, 60 seconds
Denaturation step: 95 ° C, 60 seconds
Number of cycles: 20
then 10 minutes 72 ° C extension step. The DNA amplified by PCR is detected using standard methods. Conventionally, this is separated on an agarose gel (1.5-1.7%) and visualized with ethidium bromide (0.01%). As a control, a size marker (100 bp, e.g. GibcoBRL) is also applied to the gel. The same applies to the DNA amplified in the control PCR.

Das erhaltene Ergebnis in Form einer Bande einer Größe von 219 bp gibt Aufschluss darüber, ob die Körperprobe Tumorzellen aufweist, die die spezifische mRNA des gesuchten Gens (in unserem Fall: epitheliales Glykoprotein, 40 kD) exprimieren.The result obtained in the form of a band of size 219 bp provides information about whether the body sample is tumor cells which contains the specific mRNA of the gene sought (in our case: express epithelial glycoprotein, 40 kD).

Die Vorteile der erfindungsgemäßen Methode ergeben sich daraus, dass mit unserer Methode ein sehr breites Spektrum der verschiedensten Tumorentitäten auf eine mögliche Tumorzell­ kontamination hin untersucht werden kann. Ein großer Vorteil besteht auch darin, mit diesem Verfahren eine geeignete Methode gefunden zu haben, die zum Nachweis einzelner Tumorzellen, abstammend vom kleinzelligen Bronchialkarzinom (SCLC), eingesetzt werden kann. Bislang war es nur schwer möglich, Zellen des kleinzelligen Bronchialkarzinoms in den oben angegebenen Körperproben ausreichend nachweisen zu können.The advantages of the method according to the invention result from the fact that with our method a very broad spectrum of different tumor entities on a possible tumor cell contamination can be examined. A big advantage  also consists in using this procedure a suitable one To have found the method for the detection of individual Tumor cells derived from small cell bronchial carcinoma (SCLC), can be used. So far it has been difficult possible cells of small cell bronchial carcinoma in the sufficient evidence of the body samples given above can.

Zur Spezifitätskontrolle unserer Methode haben wir Zellinien diverser Karzinome auf mRNA Expression des GA733-2 Gens hin untersucht.We have cell lines to check the specificity of our method various carcinomas due to mRNA expression of the GA733-2 gene examined.

Abb. 1 zeigt 13 Zellinien des kleinzelligen Bron­ chialkarzinoms (SCLC), die mittels unserer Methode auf eine mRNA Expression des GA733-2 Gens hin untersucht wurden. 9 der 13 SCLC- Linien zeigen ein deutlich positives Signal in Form eines 219 bp großen PCR-Produktes. Lediglich die Zellinien NCI-H82, NCI-H60, SCLC 86M1 und NCI-H1092 zeigen kein Signal. Zur Kontrolle der mRNA Extraktion und der Überset­ zung derselben in cDNA wurde eine GAPDH-PCR- Reaktion durchgeführt. Alle 13 analysierten Proben zeigen ein deutlich positives Signal für diese Kontroll-PCR. Fig. 1 shows 13 cell lines of small cell bronchial carcinoma (SCLC), which were examined by our method for an mRNA expression of the GA733-2 gene. 9 of the 13 SCLC lines show a clearly positive signal in the form of a 219 bp PCR product. Only the cell lines NCI-H82, NCI-H60, SCLC 86M1 and NCI-H1092 show no signal. A GAPDH-PCR reaction was carried out to control the mRNA extraction and the translation thereof into cDNA. All 13 analyzed samples show a clearly positive signal for this control PCR.

Abb. 2, 3 und 4 zeigen weitere Karzinomzellinien, die eben­ falls auf eine mRNA Expression des GA733-2 Gens hin untersucht wurden. Mit diesen Ab­ bildungen soll noch einmal deutlich gemacht werden, dass das erfindungsgemäße Verfahren tatsächlich für ein breites Spektrum von Tumorentitäten geeignet ist. Desweiteren soll auch im folgenden die hohe Spezifität der Methode verdeutlicht werden. Fig. 2, 3 and 4 show further carcinoma cell lines, which were also examined for mRNA expression of the GA733-2 gene. These images are intended to make it clear once again that the method according to the invention is actually suitable for a broad spectrum of tumor entities. Furthermore, the high specificity of the method should be clarified in the following.

Abb. 2 zeigt Zellinien des nicht-kleinzelligen Bron­ chialkarzinoms aufgeführt. Auch hier ergaben 6 der 13 untersuchten Zellinien ein positives Signal in Form des für die GA733-2 mRNA spezi­ fischen PCR-Produkts von 219 bp. Ebenfalls dargestellt in dieser Abbildung sind die GAPDH-Kontroll-PCRs der jeweiligen Zellinien. Fig. 2 shows cell lines of non-small cell bronchial carcinoma listed. Here, too, 6 of the 13 cell lines examined gave a positive signal in the form of the 219 bp PCR product specific for the GA733-2 mRNA. The GAPDH control PCRs of the respective cell lines are also shown in this figure.

Abb. 3 zeigt, dass 3 von 3 untersuchten Prostata- Karzinomzellinien und 3 von 3 untersuchten Kolon-Karzinomzellinien das gesuchte Gen exprimieren. Zusätzlich wird eine Mesotheliom­ zellinie aufgeführt, die erwartungsgemäß negativ für den gesuchten Marker ist. Darunter werden auch hier die Kontroll-PCRs der analy­ sierten Zellinien dargestellt. Fig. 3 shows that 3 out of 3 prostate carcinoma cell lines and 3 out of 3 colon carcinoma cell lines examined express the gene sought. In addition, a mesothelioma cell line is listed that is expected to be negative for the marker sought. The control PCRs of the analyzed cell lines are also shown here.

Abb. 4 zeigt, dass 3 von 3 Mamma-karzinomzellinien, 2 von 3 Ovarial-Karzinomzellinien, 2 von 2 Endometrium-Karzinomzellinien den gesuchten Marker exprimieren. Die untersuchte Zervix- Karzinomzellinie zeigt kein positives Signal. Darunter werden wieder die Kontroll-PCRs der Zellinien dargestellt. Fig. 4 shows that 3 of 3 breast carcinoma cell lines, 2 of 3 ovarian carcinoma cell lines, 2 of 2 endometrial carcinoma cell lines express the marker sought. The examined cervical carcinoma cell line shows no positive signal. The control PCRs of the cell lines are shown underneath.

Abb. 5 zeigt eine Auflistung der derzeit von uns untersuchten Körperproben, die als Negativkon­ trollen eingesetzt wurden. Hierzu wurden 57 Proben von peripherem Blut von gesunden Spen­ dern, 3 Knochenmarkaspirate von Patienten ohne soliden Tumor, ein Pleuraerguss eines Patien­ ten mit einer Herzinsuffizienz, Leukapheresate von Patienten ohne soliden Tumor sowie negati­ ve Zellinien (Leukämien und Mesotheliome) untersucht. Diese Kontrollen belegen, dass unsere Methode zu keinerlei falsch-positiven Signalen bei Patienten ohne Karzinom führt. Keine der analysierten Proben zeigt somit ein falsch-positives PCR-Produkt für GA733-2. Dadurch konnte die hohe Spezifität der Methode belegt werden. Fig. 5 shows a list of the body samples we are currently examining that were used as negative controls. 57 samples of peripheral blood from healthy donors, 3 bone marrow aspirates from patients without a solid tumor, pleural effusion from a patient with heart failure, leukapheresis from patients without a solid tumor, and negative cell lines (leukaemias and mesotheliomas) were examined. These controls show that our method does not produce any false positive signals in patients without carcinoma. Therefore none of the analyzed samples shows a false positive PCR product for GA733-2. This demonstrated the high specificity of the method.

Abb. 6 zeigt erste Ergebnisse von Patientenproben (Banden Nr. 2-5, 7-9) die ein PCR-Produkt für GA733-2 aufweisen, aufgrund dessen eine Tumor­ zellkontamination in den jeweiligen Proben nachgewiesen werden konnte. Desweiteren werden in dieser Abbildung einige Negativkontrollen (Banden Nr. 6, 10, 11, 13) von Patienten ohne soliden Tumor aufgeführt. Darunter werden auch hier die Kontroll-PCRs der jeweiligen Proben dargestellt.
Als weitere Spezifitätskontrolle haben wir das PCR-Produkt in einem Sequenzierungslabor (Seq. Lab. Göttingen) einer Sequenzanalyse unterwor­ fen und konnten somit die Identität des Pro­ dukts bestätigen lassen.
Diese Methode ist für sehr viele Tumore epi­ thelialen Ursprungs geeignet und besitzt somit eine größere diagnostische Breite als die bisher bekannten Marker. Wie auch die anderen RT-PCR Methoden zum Nachweis kontaminierender Tumorzellen ist auch unser Verfahren zum äußerst spezifischen und sensitiven Nachweis von geringsten Mengen an Tumorzellen geeignet.
Die Sensitivität der Methode ist vergleichbar mit den bisher bekannten immunzytochemischen Untersuchungen. Es konnten mindestens 1 posi­ tive Zelle pro 1 × 106 mononukleärer Zellen immunzytochemisch nachgewiesen werden. Zum Methodenvergleich standen uns 15 Knochenmark­ aspirate von Patienten mit einem kleinzelligen Bronchialkarzinom zur Verfügung, die wir sowohl immunzytochemisch, als auch mit der von uns etablierten PCR-Methode untersuchen konn­ ten. Darunter befanden sich zwei Knochenmark­ aspirate, in denen wir eine Tumorzelle unter 1 × 106 mononukleären Zellen im Knochenmark immunzytochemisch nachweisen konnten. Diese beiden Proben zeigten beide auch in der PCR- Methode ein deutliches Signal. Aufgrund dessen kann man davon ausgehen, dass unser Verfahren eine den bereits bekannten Verfahren ver­ gleichbare Sensitivität aufweist. Fig. 6 shows the first results of patient samples (bands No. 2-5, 7-9) which have a PCR product for GA733-2, on the basis of which a tumor cell contamination could be detected in the respective samples. Furthermore, some negative controls (bands No. 6, 10, 11, 13) of patients without a solid tumor are shown in this figure. The control PCRs of the respective samples are also shown here.
As a further specificity control, we subjected the PCR product to a sequence analysis in a sequencing laboratory (Seq. Lab. Göttingen) and were thus able to confirm the identity of the product.
This method is suitable for a large number of tumors of epithelial origin and thus has a greater diagnostic breadth than the previously known markers. Like the other RT-PCR methods for the detection of contaminating tumor cells, our method is also suitable for the extremely specific and sensitive detection of the smallest amounts of tumor cells.
The sensitivity of the method is comparable to the previously known immunocytochemical studies. At least 1 positive cell per 1 × 10 6 mononuclear cells could be detected immunocytochemically. To compare the methods, we had 15 bone marrow aspirates from patients with small cell bronchial carcinoma, which we were able to investigate both immunocytochemically and with the established PCR method. Among them were two bone marrow aspirates in which we had a tumor cell under 1 × 10 6 were able to detect mononuclear cells in the bone marrow immunocytochemically. Both of these samples also showed a clear signal in the PCR method. Because of this, it can be assumed that our method has a sensitivity comparable to that already known.

Beispielexample Nachweis von spezifischer mRNA aus Knochenmark eines Patienten mit kleinzelligem BronchialkarzinomDetection of specific mRNA from a patient's bone marrow with small cell bronchial carcinoma

Einem an einem kleinzelligen Bronchialkarzinom erkrankten Patienten wurden ca. 5 ml Knochenmark aus dem Beckenkamm entnommen. Dieses Knochenmark wurde in ein mit Heparin versehenes Blutröhrchen aufgenommen und 12 Stunden bei 4°C gelagert. Die Abtrennung der Granulozyten und Erythrozyten erfolgte mittels Ficoll-Dichtegradientenzentrifugation. Die Zellen wurden anschließend in Einfriermedium bei -80°C weggefroren und einige Tage später aufgearbeitet. Aus dem Zellpellet wurde die Gesamt-RNA mittels RNAzol® extrahiert. Die extrahierte mRNA wurde einer unspezifischen, reversen Transkription unterzogen, wobei käufliche Oligo (dT) (12-18) Primer und MMLV reverse Transkriptase (Superscript™ RT GibcoBRL) verwendet wurden. Der Reaktionsansatz wurde nach Denaturierung der mRNA für zwei Stunden inkubiert. Hierzu wurden die von uns etablierten Primer und eine käuflich erhältliche Taq-Polymerase (Boehringer Ingelheim) verwendet. Folgendes Primerpaar wurde zum Nachweis der mRNA Expression des GA733-2 Gen eingesetzt.One with small cell bronchial carcinoma Patients received approximately 5 ml of bone marrow from the iliac crest taken. This bone marrow was made using heparin provided blood tube and 12 hours at 4 ° C. stored. The separation of granulocytes and erythrocytes was carried out using Ficoll density gradient centrifugation. The Cells were then placed in freezing medium at -80 ° C frozen away and worked up a few days later. From the The total RNA was extracted from the cell pellet using RNAzol®. The extracted mRNA became an unspecific, reverse  Undergo transcription, using commercially available oligo (dT) (12-18) Primer and MMLV reverse transcriptase (Superscript ™ RT GibcoBRL) were used. The reaction batch became after Denaturation of the mRNA incubated for two hours. For this became the primers we established and one for sale available Taq polymerase (Boehringer Ingelheim) was used. The following primer pair was used to detect mRNA expression of the GA733-2 gene.

GA733-2 Primerpaar GA733-2 primer pair

PCR Bedingungen für GA733-2 PrimerPCR conditions for GA733-2 primers

Anlagerungs-(Annealing-)Schritt: 61°C, 30 Sekunden
Verlängerungs-(Extension-)Schritt: 72°C, 30 Sekunden
Denaturierungs-(Denaturation-)Schritt: 95°C, 30 Sekunden
Zyklenzahl: 28Annealing step: 61 ° C, 30 seconds
Extension step: 72 ° C, 30 seconds
Denaturation step: 95 ° C, 30 seconds
Number of cycles: 28

Zur Kontrolle der beschriebenen Extraktion der RNA und deren Übersetzung in cDNA wurde eine GAPDH (Glycerinaldehydphos­ phatdehydrogenase)-PCR unter den folgenden Bedingungen und mit folgenden Primern durchgeführt.To control the described extraction of the RNA and its Translation into cDNA was a GAPDH (glyceraldehyde phosph phatdehydrogenase) -PCR under the following conditions and with following primers.

Glycerinaldehydphosphatdehydrogenase (GAPDH) Primerpaar (endogener Expressions-standard) Glyceraldehyde phosphate dehydrogenase (GAPDH) primer pair (endogenous expression standard)

PCR-Bedingungen für GAPDH PrimerPCR conditions for GAPDH primers

Anlagerungs-(Annealing-)Schritt: 58°C, 60 Sekunden
Verlängerungs-(Extension-)Schritt: 72°C, 60 Sekunden
Denaturierungs-(Denaturation-)Schritt: 95°C, 60 Sekunden
Zyklenzahl: 20
anschließend 10 Minuten 72°C Verlängerungs-(Exten­ sion-)Schritt.Annealing step: 58 ° C, 60 seconds
Extension step: 72 ° C, 60 seconds
Denaturation step: 95 ° C, 60 seconds
Number of cycles: 20
then 10 minutes 72 ° C extension step.

Die mittels PCR amplifizierte DNA wurde auf einem 1,5%igen Agarosegel aufgetrennt und mit Ethidiumbromid (0,01%) sichtbar gemacht. Zur Kontrolle wurde ein Größenmarker (100 bp, GibcoBRL) auf das Gel mit aufgetragen. In Abb. 6 ist unter KM9/SCLC die positive Bande für GA733-2 eindeutig sichtbar.The DNA amplified by PCR was separated on a 1.5% agarose gel and visualized with ethidium bromide (0.01%). As a control, a size marker (100 bp, GibcoBRL) was also applied to the gel. In Fig. 6 the positive band for GA733-2 is clearly visible under KM9 / SCLC.

Claims (6)

1. Verfahren zum Nachweis einzelner Karzinomzellen epi­ thelialen Ursprunges in verschiedenen Körperproben mittels der Reverse-Transcriptase-Polymerase-Kettenreaktion(RT-PCR)durch Gewinnung von RNA aus Zellen, die nach üblichen Methoden zu cDNA revers transcribiert wird, dadurch gekennzeichnet, dass als Sonden die Primer
TAA GGC CAA GCA GTG CAA C (5'Primer, 422-440)
GGA TCC AGT TGA TAA CGC GT (3'Primer, 640-621)
eingesetzt werden, die für ein 40 kD epitheliales Glykoprotein (GA733-2) kodieren.1. A method for the detection of individual carcinoma cells of epi thelial origin in different body samples by means of the reverse transcriptase polymerase chain reaction (RT-PCR) by obtaining RNA from cells, which is reverse transcribed to cDNA by conventional methods, characterized in that as probes the primers
TAA GGC CAA GCA GTG CAA C (5'Primer, 422-440)
GGA TCC AGT TGA TAA CGC GT (3'Primer, 640-621)
are used which code for a 40 kD epithelial glycoprotein (GA733-2). 2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass epitheliale Zellen aus dem Mammakarzinom, dem Prostatakarzi­ nom, dem Kolonkarzinom, dem Bronchialkarzinom (nicht-klein­ zellig und kleinzellig), dem Ovarialkarzinom und dem Endome­ triumkarzinom nachgewiesen werden.2. The method according to claim 1, characterized in that epithelial cells from breast cancer, prostate cancer nom, colon carcinoma, bronchial carcinoma (non-small cellular and small cell), ovarian cancer and the endome trium carcinoma can be detected. 3. Verfahren nach den Ansprüchen 1 und 2, dadurch gekenn­ zeichnet, dass als Körperproben peripheres Blut, Knochenmark, periphere Stammzellen (Leukapheresate), Pleuraergüsse, Pericardergüsse und Aszites eingesetzt werden.3. The method according to claims 1 and 2, characterized records that peripheral blood, bone marrow, peripheral stem cells (leukapheresate), pleural effusions, Pericardial effusions and ascites are used. 4. Verfahren nach den Ansprüchen 1 bis 3, dadurch gekenn­ zeichnet, dass alle Körperproben nach einem einheitlichen Verfahren (Ficoll-Dichtegradientenzentrifugation) aufge­ arbeitet werden.4. The method according to claims 1 to 3, characterized records that all body samples according to a uniform Process (Ficoll density gradient centrifugation) established be working. 5. Verwendung des Verfahrens der Ansprüche 1 bis 4 zum Nachweis von Tumorzellen aus soliden Tumoren in der Tumorvor­ sorge und/oder Therapiekontrolle. 5. Use of the method of claims 1 to 4 for Detection of tumor cells from solid tumors in the tumor pre care and / or therapy control.   6. Verwendung des Verfahrens der Ansprüche 1 bis 4 zur Überprüfung von Blutkonserven auf etwaige Kontaminationen mit Tumorzellen.6. Use of the method of claims 1 to 4 for Checking blood supplies for possible contamination with Tumor cells.
DE19825082A 1998-06-05 1998-06-05 Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein Expired - Fee Related DE19825082C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE19825082A DE19825082C1 (en) 1998-06-05 1998-06-05 Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE19825082A DE19825082C1 (en) 1998-06-05 1998-06-05 Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein

Publications (1)

Publication Number Publication Date
DE19825082C1 true DE19825082C1 (en) 2000-02-24

Family

ID=7869959

Family Applications (1)

Application Number Title Priority Date Filing Date
DE19825082A Expired - Fee Related DE19825082C1 (en) 1998-06-05 1998-06-05 Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein

Country Status (1)

Country Link
DE (1) DE19825082C1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GR1003455B (en) * 1999-11-12 2000-10-12 Limeart Limited New method for the detection of the 17-1a (ga733-1 and ga733-2) antigen in the peripheral blood and tissus and determination of metastatic tumour cells to patients suffering from various types of cancer
WO2001034837A1 (en) * 1999-11-12 2001-05-17 Limeart Limited Diagnosis and prognosis of cancer through detection of the tumor antigen 17-1a by rt-pcr

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0376746A2 (en) * 1988-12-29 1990-07-04 The Wistar Institute Gene family of tumor-associated antigens
WO1993008298A1 (en) * 1991-10-18 1993-04-29 The Wistar Institute Of Anatomy And Biology Soluble variants of type i membrane proteins, and methods of using them
DE4431174A1 (en) * 1994-09-01 1996-03-07 Deutsches Krebsforsch Detecting tumour specific mRNA by conversion to cDNA and amplification

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0376746A2 (en) * 1988-12-29 1990-07-04 The Wistar Institute Gene family of tumor-associated antigens
WO1993008298A1 (en) * 1991-10-18 1993-04-29 The Wistar Institute Of Anatomy And Biology Soluble variants of type i membrane proteins, and methods of using them
DE4431174A1 (en) * 1994-09-01 1996-03-07 Deutsches Krebsforsch Detecting tumour specific mRNA by conversion to cDNA and amplification

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GR1003455B (en) * 1999-11-12 2000-10-12 Limeart Limited New method for the detection of the 17-1a (ga733-1 and ga733-2) antigen in the peripheral blood and tissus and determination of metastatic tumour cells to patients suffering from various types of cancer
WO2001034837A1 (en) * 1999-11-12 2001-05-17 Limeart Limited Diagnosis and prognosis of cancer through detection of the tumor antigen 17-1a by rt-pcr

Similar Documents

Publication Publication Date Title
DE60105411T2 (en) METHOD FOR THE DIAGNOSIS OF CANCER
EP1693109A1 (en) Container for separating tumor cells
WO2003023057A2 (en) Method and diagnosis kit for selecting and or qualitative and/or quantitative detection of cells
DE10143776A1 (en) Selection and determination of specific cells, useful particularly for diagnosis and monitoring of tumors, by antibody-mediated selection then detecting specific mRNA
JPS63502484A (en) Method for characterizing cell origin tissue and/or cell abnormality
DE102005052384B4 (en) Method for the detection, labeling and treatment of epithelial lung tumor cells and means for carrying out the method
WO1988009385A1 (en) Process for investigating an acellular biological fluid for cellular oncogenic transcripts or fragments thereof
WO2006018290A2 (en) Method and kit for diagnosis of a cancerous disease method for determining the reaction of a patient to the treatment for a cancerous disease medicament for the prophylaxis or treatment of a cancerous disease
EP1753877B1 (en) Cdna production from cells after laser microdissection
DE19825082C1 (en) Detecting single epithelial carcinoma cells in body samples comprises RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) using specific primers that encode an epithelial glycoprotein
EP1529206B1 (en) Method for the immunocytological or molecular detection of disseminated tumor cells in a body fluid and kit that is suitable therefor
CN108342478B (en) Circulating tumor cell metabolism typing marker and application thereof
EP2504698B1 (en) Method for predicting the response of a tumour disease to a therapeutic measure
Tres et al. Inorganic cations in the cell nucleus: selective accumulation during meiotic prophase in mouse testis
CN111122857A (en) Marker of fetal trophoblast cells, identification method, detection kit and application
EP0370032A1 (en) Process for testing a biological fluid for cellular oncogen dna or fragments thereof
DE112016003660T5 (en) Preparation of biological sample for testing
EP2634249A1 (en) Process for the separation of groups of malignant cells and groups of stroma cells from an ex vivo malignant tissue sample
EP1792186B1 (en) Uses of carbamoyl phosphate synthetase 1 (cps 1) as a humoral biomarker for the diagnosis of tumour diseases
CN108929909A (en) A kind of kit for screening of the metastatic screening of the small papillary carcinoma of thyroid gland
DE60216045T2 (en) CANCER DIAGNOSTIC PROCEDURE
EP1922545A1 (en) Functional in vitro immunoassay
DE112011105191T5 (en) Process for liquid phase extraction and detection of nucleic acids
JP2019509468A (en) Multiple phenotypic subtype classification of biological samples using sequential fluorescence quenching and re-staining
EP0991780A2 (en) Method and test kit for detecting malignant tumours

Legal Events

Date Code Title Description
8100 Publication of the examined application without publication of unexamined application
D1 Grant (no unexamined application published) patent law 81
8322 Nonbinding interest in granting licences declared
8364 No opposition during term of opposition
8339 Ceased/non-payment of the annual fee