CN108342478B - Circulating tumor cell metabolism typing marker and application thereof - Google Patents
Circulating tumor cell metabolism typing marker and application thereof Download PDFInfo
- Publication number
- CN108342478B CN108342478B CN201810047440.0A CN201810047440A CN108342478B CN 108342478 B CN108342478 B CN 108342478B CN 201810047440 A CN201810047440 A CN 201810047440A CN 108342478 B CN108342478 B CN 108342478B
- Authority
- CN
- China
- Prior art keywords
- ctcs
- pgk1
- g6pd
- circulating tumor
- typing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses an application of circulating tumor cell metabolism typing markers, which comprise phosphoglycerate kinase 1PGK1 and 6-phosphoglucose dehydrogenase G6 PD. The functional typing of the Circulating Tumor Cells (CTCs) is carried out from the perspective of metabolic activity, and the change trend and the biological behavior of the CTCs can be better reflected. Validation of prostate cancer specimens indicates GM compared to EMT typing+The CTCs subtype is more related to tumor metastasis and can be used as an auxiliary diagnostic marker of tumor metastasis. Therefore, the CTCs glycometabolism typing is an important supplement to CTCs counting and EMT phenotype typing, can provide beneficial information for clinical disease assessment, and has good application prospect in tumor metastasis diagnosis and monitoring.
Description
Technical Field
The invention belongs to the field of biological detection, and particularly relates to an application of a circulating tumor cell metabolism typing marker.
Background
The molecular biological analysis of Circulating Tumor Cells (CTCs) mainly comprises the detection analysis of the expression and mutation of tumor specific markers, including cell morphological phenotype markers (such as EpCAM/CKs/Vimentin/Twist), tumor stem cell markers (such as CD44/CD133/ALDH1), tissue type specific markers (such as ER/PSA/ERCC1), drug targets (such as EGFR/ALK/VEGF) and the like. On the basis of CTCs separation and counting, the characteristic analysis of CTCs can further provide information related to the occurrence and development of source tumors, and has important significance for clinical diagnosis and treatment of tumors. Recently, the epithelial-mesenchymal transition (EMT) phenotypic assay of CTCs, i.e., the classification of CTCs into three subtypes, epithelial, mixed and mesenchymal, using EMT-related molecular markers, has been the most of the concern. EMT refers to a biological process in which epithelial cells are transformed into cells having a mesenchymal phenotype by a specific procedure, and is an important link in the migration and dissemination of malignant tumor cells, and thus mixed and mesenchymal CTCs are considered to be more relevant to the metastasis and poor prognosis of tumors than epithelial CTCs. However, EMT is a dynamic process of transformation, and the mesenchymal-epithelial transformation (MET) of CTCs in the blood can occur when they reach the appropriate site of colonization, thus increasing the phenotypic heterogeneity of CTCs, i.e., CTCs of the same subtype identified according to EMT markers may have different trends and outcome of changes. This regression uncertainty presents challenges to the interpretation of the results of the analysis of CTCs subtypes, thereby limiting the clinical utility of molecular biological detection of CTCs. Therefore, there is a need to develop new molecular typing methods and markers for CTCs to establish more definite association between CTCs subtypes and tumorigenesis and development characteristics, so as to promote expanded application of CTCs detection.
Metabolic reprogramming is one of the important features of tumor cells, and is closely related to the occurrence and metastasis of tumors. The main characteristics of tumor cell sugar metabolism are abnormal activity of aerobic glycolysis, pentose phosphate pathway and glutamine metabolism enhancement. The effect of metabolic reprogramming on tumors is, on the one hand, that energy metabolism provides the necessary ATP and bio-macromolecules for the growth and rapid proliferation of tumor cells; on the other hand, vigorous energy metabolism and associated cell signaling activation are closely related to tumor mobility and invasiveness. The abnormal regulation of sugar metabolism plays a decisive role in the biological behavior of tumor cells, and the up-regulated metabolic enzymes and active signal pathways can participate in inducing the proliferation, anoikis resistance, immune escape, angiogenesis and the like of the tumor cells, thereby promoting the metastasis of the tumor. Therefore, the detection of the glycometabolism characteristics and the metabolic subtypes of the CTCs can realize the analysis of the metabolic activity of the CTCs, and is helpful for judging the change trend and the regression of the CTCs and further evaluating the function of the CTCs of a specific subtype, thereby making up the deficiency of the morphological phenotype analysis of the static CTCs in the aspect of clinical explanation and promoting the application of the molecular characteristic analysis of the CTCs in the diagnosis and evaluation of tumor metastasis.
Disclosure of Invention
The invention aims to provide an application of a prostate cancer circulating tumor cell metabolism typing marker.
Another objective of the invention is to provide a circulating tumor cell glycometabolism typing method.
The technical scheme adopted by the invention is as follows:
the phosphoglycerate kinase 1PGK1 and the 6-phosphoglucose dehydrogenase G6PD are simultaneously used as the sugar metabolism typing markers of the circulating tumor cells.
The application of the reagent for quantitatively detecting PGK1 and G6PD in preparing the circulating tumor cell glycometabolism typing kit.
Further, the reagent for quantitatively detecting PGK1 and G6PD is at least one selected from a probe for detecting PGK1 and G6PD and a quantitative PCR primer for detecting PGK1 and G6 PD.
A sugar metabolism typing marker of circulating tumor cells is PGK1 and G6 PD.
A method of circulating tumor cell glycometabolism typing comprising the steps of: respectively and quantitatively detecting the expression levels of reference genes TBP, TFRC and B2M in a plurality of circulating tumor cell samples, and taking the 25 th percentile in all the expression level detection results as a judgment standard and marking as P25(ii) a The expression level of PGK1 and G6PD in the circulating tumor cells is detected by the same quantitative detection method, if the total expression level of PGK1 and G6PD is more than P25The circulating tumor cells were designated as GM+The subtype; if the total expression level of PGK1 and G6PD is ≦ P25The circulating tumor cells were designated as GM-The subtype is.
Furthermore, the quantitative detection method comprises an RNA in-situ hybridization technology, RT-qPCR, gene chip detection and sequencing.
Furthermore, the sample part of the circulating tumor cells for detecting the expression level of the reference gene is not less than 8 parts.
The application of the reagent for quantitatively detecting PGK1 and G6PD in preparing a tumor metastasis auxiliary diagnosis or diagnostic kit.
Further, the tumor is prostate tumor.
An auxiliary diagnostic kit for tumor metastasis, which contains a reagent for quantitatively detecting PGK1 and G6 PD.
The invention has the beneficial effects that:
the invention carries out functional typing on the Circulating Tumor Cells (CTCs) from the perspective of metabolic activity, and can better reflect the change trend and biological behavior of the CTCs. Validation of prostate cancer specimens indicates GM compared to EMT typing+The CTCs subtype is more related to tumor metastasis and can be used as an auxiliary diagnostic marker of tumor metastasis. Therefore, the CTCs carbohydrate metabolism typing can provide good value for clinical disease assessment.
Drawings
FIG. 1 shows the results of screening PC-3M 2B4 and PC-3M 1E8 differentially expressed genes using a glycometabolism function classification chip;
figure 2 is mRNA expression levels of PGK1 and G6PD in 5 prostate cancer cells (. P < 0.05);
FIG. 3 shows the protein expression levels of PGK1 and G6PD in 5 prostate cancer cells (. about.P < 0.05: between PC-3M 2B4 and PC-3M 1E 8; P < 0.05: between LNCAP, between PC-3 and DU 145);
FIG. 4 is GM in patients with non-metastatic and metastatic prostate cancer+The number of CTCs and H-CTCs;
FIG. 5 is a ROC curve for diagnosis of metastatic and non-metastatic prostate cancer using CTCs alone typing and a combination of tPSA and Gleason scores.
Detailed Description
The phosphoglycerate kinase 1PGK1 and the 6-phosphoglucose dehydrogenase G6PD are simultaneously used as the sugar metabolism typing markers of the circulating tumor cells.
The application of the reagent for quantitatively detecting PGK1 and G6PD in preparing the circulating tumor cell glycometabolism typing kit.
Preferably, the reagent for quantitatively detecting PGK1 and G6PD is at least one selected from a probe for detecting PGK1 and G6PD and a quantitative PCR primer for detecting PGK1 and G6 PD.
A sugar metabolism typing marker of circulating tumor cells is phosphoglycerate kinase 1PGK1 and 6-phosphoglucose dehydrogenase G6 PD.
A method of circulating tumor cell glycometabolism typing comprising the steps of: respectively and quantitatively detecting the expression levels of reference genes TBP, TFRC and B2M in a plurality of circulating tumor cell samples, and taking the 25 th percentile in all the expression level detection results as a judgment standard and marking as P25(ii) a The expression level of PGK1 and G6PD in the circulating tumor cells is detected by the same quantitative detection method, if the total expression level of PGK1 and G6PD is more than P25The circulating tumor cells were designated as GM+The subtype; if the total expression level of PGK1 and G6PD is ≦ P25The circulating tumor cells were designated as GM-The subtype is.
Preferably, the quantitative detection method comprises RNA in situ hybridization technology, RT-qPCR, gene chip detection and sequencing.
Preferably, the sample number of the circulating tumor cells for detecting the expression level of the reference gene is not less than 8.
The application of the reagent for quantitatively detecting PGK1 and G6PD in preparing a tumor metastasis auxiliary diagnosis or diagnostic kit.
Preferably, the reagent for quantitatively detecting PGK1 and G6PD is at least one selected from a probe for detecting PGK1 and G6PD and a quantitative PCR primer for detecting PGK1 and G6 PD.
Preferably, the tumor is a prostate tumor.
An auxiliary diagnostic kit for tumor metastasis, which contains a reagent for quantitatively detecting PGK1 and G6 PD.
Preferably, the reagent for quantitatively detecting PGK1 and G6PD is at least one selected from a probe for detecting PGK1 and G6PD and a quantitative PCR primer for detecting PGK1 and G6 PD.
The present invention will be further described with reference to the following examples.
Example 1 screening and identification of markers of carbohydrate metabolism associated with tumor metastasis
1. The material and the method are as follows:
(1) cell lines: PC-3M 2B4, PC-3M 1E8, LNCAP, PC-3, DU145 cells. Wherein PC-3M 2B4 and PC-3M 1E8 are a pair of prostate cancer low-metastasis and high-metastasis cell strains with gene backgrounds being homologous, and are purchased from the cell center of Chinese medical academy of sciences; LNCAP, PC-3 and DU145 are three commonly used prostate cancer cell lines, which have sequentially enhanced metastatic potential and are purchased from classical collection cell banks of the Chinese academy of sciences.
(2) Culture medium and fetal bovine serum: purchased from Guangzhou Xinbang Biotech, Inc. (manufactured by Gibco). Wherein the DMEM medium is used for culturing the prostate cancer PC-3M 2B4, PC-3M 1E8 and PC-3 cells; RPMI 1640 medium was used to culture prostate cancer LNCAP and DU145 cells; 10% fetal bovine serum was added during culture.
(3) Gene chip analysis: the kit is used for detecting the glucose metabolism gene profiles of low-metastatic PC-3M 2B4 cells and high-metastatic PC-3M 1E8 cells of the prostate cancer to screen the differentially expressed genes. The glycometabolism function classification chip type is RT2ProfilerTMPCR Array Human Glucose Metabolism (PAHS-006Z), available from Shanghai Kangbio GmbH. Extracting total RNA of 6 cell samples from 3 dishes (total 6 samples) of the two cells by a classical Trizol method, extracting by chloroform, precipitating and refining by isopropanol, washing by 75% ethanol, drying to obtain an RNA sample, and dissolving by using a proper amount of DEPC water. Subsequently, the sample is digested with DNase I to remove genomic DNA that may be contained therein, and the RNA sample is purified to check whether the sample is of acceptable quality. And performing reverse transcription on the extracted and purified qualified RNA sample to synthesize cDNA, detecting by using a functional classification chip, and operating according to a standard specification.
(4) Real-time fluorescent quantitative polymerase chain amplification (qRT-PCR): used for verifying the mRNA expression level of the chip screening gene in 5 prostate cancer cells. The kit for RNA extraction and amplification was purchased from Guangzhou Rizhen Biotech Co., Ltd (manufactured by Takara). Extracting RNA of conventionally cultured PC-3M 2B4, PC-3M 1E8, LNCAP, PC-3 and DU145 cells, purifying, performing reverse transcription and qRT-PCR detection on the expression level of chip differential genes, and standardizing the detection result by using the expression level of the reference gene ACTB. Amplification primers for PGK1, G6PD and ACTB were as follows:
PGK1-F:TGGACGTTAAAGGGAAGCGG(SEQ ID NO:1)，
PGK1-R:GCTCATAAGGACTACCGACTTGG(SEQ ID NO:2)；
G6PD-F:CGAGGCCGTCACCAAGAAC(SEQ ID NO:3)，
G6PD-R:GTAGTGGTCGATGCGGTAGA(SEQ ID NO:4)；
ACTB-F:CATGTACGTTGCTATCCAGGC(SEQ ID NO:5)，
ACTB-R:CTCCTTAATGTCACGCACGAT(SEQ ID NO:6)。
(5) western blot analysis (Western blot): is used for verifying the protein expression level of the chip screening gene in 5 prostate cancer cells. Reagents related to protein extraction, quantification, separation and detection are available from Kaiyu, Sigma, Xinbang Biotech, Inc., Guangzhou. Specific primary antibodies and labeled secondary antibodies for PGK1, G6PD and the reference protein ACTB were purchased from Biotech, Inc. of Xinbang, Guangzhou (manufactured by ABClonal). Total proteins of 5 cells were extracted, and after quantitative determination, 30ug of proteins were separated by SDS-PAGE electrophoresis and transferred to PVDF membrane. And (3) detecting a protein band by using a chemiluminescence kit after 5% skim milk powder sealing, primary antibody incubation and secondary antibody incubation, and analyzing the protein expression level by using Image J software.
2. Results
(1) Chip screening of carbohydrate metabolism markers
As shown in figure 1, the gene chip analysis screens 68 glucose metabolism genes which are differentially expressed in the prostate cancer high metastasis cell line PC-3M 1E8 and the low metastasis cell line PC-3M 2B4, wherein 51 genes with up-regulated expression and 17 genes with down-regulated expression are expressed in the PC-3M 1E8 cell compared with the PC-3M 2B4 cell. The functional pathway analysis of the differentially expressed genes is carried out by utilizing bioinformatics, and the results show that the differentially expressed genes are mainly enzymes and regulatory molecules related to cellular glycolysis, pentose phosphate pathway and tricarboxylic acid cycle process, a part of the differentially expressed genes screened by the chip are listed in table 1, and other differentially expressed genes relate to other ongoing project researches and are not listed.
TABLE 1 partial differential expression genes screened by the chip
Note: differences were statistically significant when P < 0.05.
(2) Verification of chip screening results
The chip results were verified by using qRT-PCR and western blot to detect the mRNA and protein expression levels of the up-regulated genes in 5 cells, and the results were similar to the chip screening results. The expression level of PGK1 and G6PD in the cells with stronger transferability (PC-3M 1E8, DU145) is obviously higher than that of the cells with weaker transferability (PC-3M 2B4, PC-3, LNCAP), as shown in FIG. 2 and FIG. 3.
Example 2 glycogenotypic typing of CTCs
1. Materials and methods
(1) And (3) separating and identifying CTCs: CanPatrol CTCs isolation kit, available from Guangzhou Yishou Biotechnology. 5mL of anticoagulated venous blood of a tumor patient is collected, and separation and enrichment of CTCs are carried out by using a microporous membrane filtration technology according to the difference of the sizes of white blood cells and CTCs after red blood cells are lysed. Fluorescence labeling is carried out on the CTCs enriched on the filter membrane by using DAPI dye nuclear staining and CD45 detection probes, and the CTCs are identified by combining the abnormal shape characteristics of the nucleus and CD45 expression negative.
(2) And (3) carrying out sugar metabolism typing on CTCs:
1) probes for detection of PGK1 and G6PD were synthesized, and probes for detection targeting PGK1 and G6PD were designed and synthesized by Invitrogen corporation, and the sequences were as follows:
PGK1 (in this example, the following mixtures of these probes are used to improve detection sensitivity; other probe designs and combinations are possible):
PGK1-1：AGCTGAAGCTGCGGCTGAAG(SEQ ID NO:7)，
PGK1-2：GAGAAGCGCGCGTAGAAGTC(SEQ ID NO:8)，
PGK1-3：CAGGAACTGCTTCATGGAGA(SEQ ID NO:9)，
PGK1-4：AACTCTTGCCGCAGAAACAT(SEQ ID NO:10)，
PGK1-5：AATAGCTTTAGCATCCTCAG(SEQ ID NO:11)，
PGK1-6：ATGTTCTTCTAGGCCTTTCA(SEQ ID NO:12)，
PGK1-7：GCATAAACTAGAGACCTGCA(SEQ ID NO:13)，
PGK1-8：TAAAGATCATCTTGCAGGCC(SEQ ID NO:14)；
the probe of G6PD (in this example, the following mixture of probes is used to improve the detection sensitivity; other probe designs and combinations are possible):
G6PD-1：GAAGTGTACGACCGTTTCCG(SEQ ID NO:15)，
G6PD-2：AAAAGCTCTTCCCGCAGGAT(SEQ ID NO:16)，
G6PD-3：CGACTGATGGAAGGCATCGC(SEQ ID NO:17)，
G6PD-4：CACCAGATGGTGGGGTAGAT(SEQ ID NO:18)，
G6PD-5：ACGATGAAGGTGTTTTCGGG(SEQ ID NO:19)，
G6PD-6：AGGAGTTGCGGGCAAAGAAG(SEQ ID NO:20)，
G6PD-7：TAGGAGGCTGCATCATCGTA(SEQ ID NO:21)，
G6PD-8：CATTCATGTGGCTGTTGAGG(SEQ ID NO:22)。
2) the expression level of the mixed markers of PGK1 and G6PD in the peripheral blood CTCs simultaneously was detected by the probe and RNA in situ hybridization technique. The specific operation is as follows: after the steps of fixing, permeabilizing, digesting, hybridizing, amplifying signals and the like, the enriched CTCs are scanned and analyzed by a fluorescence microscope for the expression level of the metabolic markers, and the sugar metabolism subtypes of the CTCs are distinguished according to the fluorescence signals. Firstly, the fluorescence signals of the reference genes TBP, TFRC and B2M in 100 CTCs samples are respectively detected by using an RNA in situ hybridization technique, and the number of probes for detecting the reference genes TBP, TFRC and B2M is the same as the number of probes for detecting PGK1 and G6PD, and in this embodiment, 8 probes are used (in practice, the probes are not limited to 8 probes, as long as the RNA in situ hybridization detection effect meets the requirement). After fluorescence signal detection was performed on the reference genes TBP, TFRC and B2M in 100 CTCs samples, respectively, using a fluorescence microscope, 300 fluorescence signal intensity values were obtained. Then, in the 25 th percentile (P)25) As a criterion for determining the expression levels of the metabolic genes PGK1 and G6PD, P in this example25Is 5. Total signal intensity of PGK1 and G6PD in the samples was > 5 when analyzed by fluorescence microscopy scanning (i.e., P25) Is marked as GM+A CTCs subtype; when the total signal intensity of PGK1 and G6PD is less than or equal to 5 (P)25) Is marked as GM-A subset of CTCs.
The TBP, TFRC and B2M genes are known to be low, moderate and high in CTCs, respectively, and thus are used as reference genes. The judgment standard of the results of other quantitative methods (such as quantitative detection methods such as RT-qPCR, gene chip detection, sequencing and the like) can be analogized, namely, the P of the detection results of the genes in the corresponding methods can be used25For reference, the metabolic gene test result > P25Is marked as GM+The subtype is.
2. Results
Interpretation of the detection results of the CTCs: CTCs are first isolated and identified according to current methods, including those judged by cell size and the leukocyte marker CD45, and not CTCs if the cells are small or CD45 positive; and secondly, judging by the form of cell nucleuses, wherein the cell nucleuses of the CTCs are stained by DAPI to show obvious uneven-depth cell nucleus grains, and non-specific impurities are in uniform blue.
Classification of CTCs into GM according to expression of carbohydrate metabolism markers+CTCs (Total Signal Strength of PGK1 and G6PD > 5 (P)25) Positive) and GM-CTCs (Total Signal Strength ≦ 5 (P)25) Negative) are two subtypes, namely the glycometabolism typing of the CTCs.
Example 3 correlation of glycogenotypic typing of CTCs with tumor metastasis
1. Materials and methods
(1) 48 patients with pathological diagnosis of prostate cancer were enrolled, 26 with metastases and 22 without metastases. With the informed consent of the patients, 5mL of peripheral blood was collected and the number of CTCs and the glycometabolism subtypes thereof were detected by the above method.
(2) And simultaneously detecting the EMT phenotype typing condition of the CTCs, classifying the CTCs into epithelial types (E-CTCs), mixed types (H-CTCs) and interstitial types (M-CTCs) by using classical EMT typing markers (E marker EpCAM/CKs and M marker Vimentin/Twist), and purchasing the detection kit from Guangzhou Yishan biotechnology company.
(3) And (3) comparing the characteristics of the CTCs carbohydrate metabolism typing and the EMT subtype of the metastatic and non-metastatic patients, and evaluating the clinical value of the CTCs typing in the discrimination of the prostate cancer metastasis by using a fitted subject operating characteristic (ROC) curve.
2. Results
Median total CTCs for prostate cancer patients with and without metastasis were 5/5 mL (IQR 2-8) and 2/5 mL (IQR 0-3), respectively, P ═ 0.001, GM in both groups+The detection rate of CTCs is 80.8 percent and 45.4 percent.
As shown in FIG. 4, patient GM with metastasis+The median number of CTCs was 2/5 mL (IQR 1-4), significantly higher than GM in patients without metastasis+Median 0/5 mL of CTCs (IQR 0-2), P ═ 0.003; median H-CTCs of patients with and without metastasis were 2/5 mL (IQR 1-5) and 1/5 mL (IQR 0-2), respectively, with P ═ 0.008; however, there was no significant difference in the number of E-CTCs and M-CTCs between the metastatic and non-metastatic groups (P > 0.05). These results show that GM+The levels of CTCs and H-CTCs are closely related to prostate cancer metastases.
Further, the diagnostic value of the CTCs subtype in distinguishing metastatic prostate cancer from non-metastatic prostate cancer is simulated by using the ROC curve. The area under the curve (AUC) evaluation shows that the diagnosis accuracy is moderate when the AUC is 0.7-0.9, and the accuracy is higher when the AUC is more than 0.9.
tPSA, the total prostate specific antigen, is the first serum marker for prostate cancer diagnosis and is also closely related to tumor progression and postoperative recurrence and metastasis. The existing detection method comprises the following steps: collecting 4mL of venous blood of a patient, centrifuging at 3500rpm for 10min, and detecting the concentration of the serum tPSA by using a Siemens full-automatic chemiluminescence immunoassay analyzer. The detection principle is a double-antibody sandwich method, and the specific steps refer to 3 rd version national clinical test operation procedure (charming, royal three, Shenzi yog. national clinical test operation procedure. 3 rd version. Ministry of health of people's republic of China doctor. 2006.).
The Gleason score is a method for histologically grading prostate adenocarcinoma, and is determined by performing section pathology examination on adenocarcinoma tissues obtained by biopsy or operation and judging the Gleason score and prognosis grade according to gland characteristics. Specific scoring methods are referenced to the 2016 version of the WHO urinary and male reproductive organ tumor classification (MochH, HumphreyPA, Ulberght TM, et al. WHO classification of tumors of the urinary system and male genetic organ [ M ] Lyon: IARC Press, 2016.).
As shown in FIG. 5, H-CTCs and GM were used separately+AUC of CTCs is 0.721 and 0.745, respectively, and tPSA and GM are used in combination+AUC was 0.848 on CTCs detection, while GM-GM scored using the triple marker tPSA-Gleason+The AUC can reach 0.922 when CTCs are detected, and the triple marker tPSA-Gleason score-GM+The sensitivity and specificity of CTCs were 84.6% and 90.9%, respectively. These results show that GM+CTCs can be used as good auxiliary diagnostic markers of prostate cancer metastasis, and AUC can reach 0.922 when the CTCs are used together with tPSA and Gleason scores, so that the CTCs have high accuracy.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> southern hospital of southern medical university
<120> circulating tumor cell metabolism typing marker and application thereof
<130>
<160> 22
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
tggacgttaa agggaagcgg 20
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence
<400> 2
gctcataagg actaccgact tgg 23
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence
<400> 3
cgaggccgtc accaagaac 19
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
gtagtggtcg atgcggtaga 20
<210> 5
<211> 21
<212> DNA
<213> Artificial sequence
<400> 5
catgtacgtt gctatccagg c 21
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<400> 6
ctccttaatg tcacgcacga t 21
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
agctgaagct gcggctgaag 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
gagaagcgcg cgtagaagtc 20
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
caggaactgc ttcatggaga 20
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
aactcttgcc gcagaaacat 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
aatagcttta gcatcctcag 20
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
atgttcttct aggcctttca 20
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence
<400> 13
gcataaacta gagacctgca 20
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence
<400> 14
taaagatcat cttgcaggcc 20
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence
<400> 15
gaagtgtacg accgtttccg 20
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<400> 16
aaaagctctt cccgcaggat 20
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence
<400> 17
cgactgatgg aaggcatcgc 20
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence
<400> 18
caccagatgg tggggtagat 20
<210> 19
<211> 20
<212> DNA
<213> Artificial sequence
<400> 19
acgatgaagg tgttttcggg 20
<210> 20
<211> 20
<212> DNA
<213> Artificial sequence
<400> 20
aggagttgcg ggcaaagaag 20
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence
<400> 21
taggaggctg catcatcgta 20
<210> 22
<211> 20
<212> DNA
<213> Artificial sequence
<400> 22
cattcatgtg gctgttgagg 20
Claims (5)
1. Application of reagents for detecting phosphoglycerate kinase 1PGK1 and 6-phosphoglucose dehydrogenase G6PD in preparing products for predicting sugar metabolism of circulating tumor cells, wherein the tumor is prostate cancer.
2. The application of the reagent for quantitatively detecting PGK1 and G6PD in preparing a circulating tumor cell glycometabolism typing kit, wherein the tumor is prostate cancer.
3. The use according to claim 2, wherein the reagent for quantitative detection of PGK1 and G6PD is selected from at least one of a probe for detection of PGK1 and G6PD, and a quantitative PCR primer for detection of PGK1 and G6 PD.
4. A method for typing sugar metabolism of circulating tumor cells for non-diagnostic or therapeutic purposes, comprising the steps of: respectively and quantitatively detecting the expression levels of reference genes TBP, TFRC and B2M in a plurality of circulating tumor cell samples, and taking the 25 th percentile in all the detection results of the expression levels as a judgment standard and marking as P25; detecting the expression levels of PGK1 and G6PD in the circulating tumor cells by using the same quantitative detection method, and if the total expression level of PGK1 and G6PD is more than P25, the circulating tumor cells are marked as GM + subtype; if the total expression level of PGK1 and G6PD is less than or equal to P25, the circulating tumor cells are marked as GM-subtype; the tumor is prostate cancer; the sample part of the circulating tumor cells for detecting the expression level of the reference gene is not less than 8 parts.
5. The method of claim 4, wherein the quantitative detection method comprises RNA in situ hybridization technology, RT-qPCR, gene chip detection, and sequencing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810047440.0A CN108342478B (en) | 2018-01-18 | 2018-01-18 | Circulating tumor cell metabolism typing marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810047440.0A CN108342478B (en) | 2018-01-18 | 2018-01-18 | Circulating tumor cell metabolism typing marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108342478A CN108342478A (en) | 2018-07-31 |
| CN108342478B true CN108342478B (en) | 2021-08-03 |
Family
ID=62961440
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810047440.0A Active CN108342478B (en) | 2018-01-18 | 2018-01-18 | Circulating tumor cell metabolism typing marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108342478B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111487404B (en) * | 2019-01-28 | 2024-01-05 | 猎源（上海）生物医药科技有限公司 | Body fluid tumor cell DNA extraction kit |
| CN112662774A (en) * | 2021-01-12 | 2021-04-16 | 南方医科大学南方医院 | Liver cancer circulating tumor cell marker and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146474A (en) * | 2011-03-21 | 2011-08-10 | 广东蓝岛生物技术有限公司 | T2DM (Type 2 Diabetes Mellitus) detection primer group, PCR (Polymerase Chain Reaction) chip and detection method for human and monkeys |
| CN102586402A (en) * | 2011-01-05 | 2012-07-18 | 苏州科贝生物技术有限公司 | Kit for quantitative evaluation for long-term recurrent risk of colorectal cancer |
| CN103025890A (en) * | 2010-04-06 | 2013-04-03 | 卡里斯生命科学卢森堡控股 | Circulating biomarkers for disease |
| CN105063165A (en) * | 2015-07-31 | 2015-11-18 | 上海交通大学 | Method and device for detecting metabolic activity of circulating tumor cells |
-
2018
- 2018-01-18 CN CN201810047440.0A patent/CN108342478B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103025890A (en) * | 2010-04-06 | 2013-04-03 | 卡里斯生命科学卢森堡控股 | Circulating biomarkers for disease |
| CN102586402A (en) * | 2011-01-05 | 2012-07-18 | 苏州科贝生物技术有限公司 | Kit for quantitative evaluation for long-term recurrent risk of colorectal cancer |
| CN102146474A (en) * | 2011-03-21 | 2011-08-10 | 广东蓝岛生物技术有限公司 | T2DM (Type 2 Diabetes Mellitus) detection primer group, PCR (Polymerase Chain Reaction) chip and detection method for human and monkeys |
| CN105063165A (en) * | 2015-07-31 | 2015-11-18 | 上海交通大学 | Method and device for detecting metabolic activity of circulating tumor cells |
Non-Patent Citations (5)
| Title |
|---|
| Analysis of the hormone receptor status of circulating tumor cell subpopulations based on epithelial-mesenchymal transition: a proof-of-principle study on the heterogeneity of circulating tumor cells;Xiuwen Guan,et al.;《Oncotarget》;20161004;65993–66002 * |
| Circulating Tumor Cells in Prostate Cancer;Brian Hu et al.;《Cancers》;20131204;1676-1690 * |
| Metabolic phenotype of bladder cancer;Francesco Massari et al.;《Cancer Treatment Reviews》;20160430;46-48 * |
| Metabolic reprogramming-based characterization of circulating tumor cells in prostate cancer;Jing Chen et al.;《J Exp Clin Cancer Res》;20180628;127 * |
| Reprogramming of glucose, fatty acid and amino acid metabolism for cancer progression;Zhaoyong Li et al.;《Cell Mol Life Sci》;20151023;377-392 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108342478A (en) | 2018-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190293632A1 (en) | Method for identification, selection and analysis of tumour cells | |
| Liu et al. | Blood-based liquid biopsy: Insights into early detection and clinical management of lung cancer | |
| CN105349654B (en) | A kind of probe for detecting EGFR genetic mutation, primer, detection architecture and kit | |
| CN108179134B (en) | EpCAM/PSMA-based double-antibody functionalized microfluidic chip and preparation method and application thereof | |
| CN108504742A (en) | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology | |
| CN109825586A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| WO2020048518A1 (en) | Group of genes for molecular typing of medulloblastoma and use thereof | |
| CN109504780A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| WO2020034583A1 (en) | Set of genes for bladder cancer detection and application thereof | |
| CN108342478B (en) | Circulating tumor cell metabolism typing marker and application thereof | |
| CN109234394A (en) | A kind of diagnosing cancer of liver marker and its screening technique | |
| CN110541030B (en) | Bladder cancer detection kit and application thereof | |
| CN108866064B (en) | Aptamer of targeted metastatic human breast cancer cells and application thereof | |
| US20220127681A1 (en) | Sorting cell-type specific extracellular vesicles | |
| Chen et al. | cDNA microarray analysis and immunohistochemistry reveal a distinct molecular phenotype in serous endometrial cancer compared to endometrioid endometrial cancer | |
| CN115261476A (en) | Method for screening serum exosome LncRNA HULC as liver cancer early marker and application of kit prepared by method | |
| CN113999914A (en) | Novel combined marker for early detection of multi-target hepatocellular carcinoma and application thereof | |
| Xu et al. | A potential panel of five mRNAs in urinary extracellular vesicles for the detection of bladder cancer | |
| CN110157806A (en) | A kind of kit detecting EML4-ALK and its detection method and application | |
| CN116656811B (en) | Pancreatic duct adenocarcinoma prognosis detection kit and application thereof | |
| CN114908171B (en) | Application of human HHIPL2mRNA in targeted therapy and prognosis evaluation of non-small cell lung cancer and kit | |
| CN117604110B (en) | Biomarker for breast cancer diagnosis and prognosis and application thereof | |
| CN111909999B (en) | MiRNA combination and application thereof in preparation of marker for DLBCL prognosis | |
| JP2020512813A (en) | Uses of giant cell nucleic acid characterization in cancer screening, diagnosis, treatment, and recurrence | |
| CN113403395B (en) | Method and kit for extracting cfDNA of aqueous humor and application of kit in PVRL clinical auxiliary examination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |