CN108342478A - Circulating tumor cell is metabolized parting marker and its application - Google Patents
Circulating tumor cell is metabolized parting marker and its application Download PDFInfo
- Publication number
- CN108342478A CN108342478A CN201810047440.0A CN201810047440A CN108342478A CN 108342478 A CN108342478 A CN 108342478A CN 201810047440 A CN201810047440 A CN 201810047440A CN 108342478 A CN108342478 A CN 108342478A
- Authority
- CN
- China
- Prior art keywords
- g6pd
- pgk1
- ctcs
- circulating tumor
- tumor cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the applications that circulating tumor cell is metabolized parting marker, including phosphoglyceric kinase 1PGK1 and 6 glucose phosphate dehydrogenase G6PD.It is that function parting is carried out to circulating tumor cell (CTCs) from the angle of metabolic activity, can preferably reflects the variation tendency and biological behaviour of CTCs.Show compared with EMT partings in the verification result of prostate cancer sample, GM+CTCs hypotypes are more related to metastases, and can be used as the auxiliary diagnosis marker of metastases.Therefore, CTCs glycometabolisms parting is the important supplement to CTCs counting and EMT Phenotype typings, can be assessed for clinical disease and provide advantageous information, has good application prospect in diagnosis of metastasis and monitoring.
Description
Technical field
The invention belongs to field of biological detection, more particularly to a kind of application of circulating tumor cell metabolism parting marker.
Background technology
The molecular biological analysis of circulating tumor cell (CTCs) is mainly the expression and mutation to tomour specific marker
Detection and analysis, including cytomorphology phenotypic marker (such as EpCAM/CKs/Vimentin/Twist), tumor stem cell mark
Will object (such as CD44/CD133/ALDH1), organization type specific markers (such as ER/PSA/ERCC1) and drug targets (such as EGFR/
ALK/VEGF) etc..On the basis of CTCs is detached and counted, the signature analysis of CTCs can further provide for and source tumor development
Relevant information, it is significant to the clinic diagnosis of tumour.Recently of greatest concern is the epithelial-mesenchymal conversion of CTCs
(EMT) Phenotypic examination utilizes the relevant molecular markers of EMT to divide CTCs for three kinds of epitheliated type, mixed type and interstitial type Asias
Type.EMT refers to that epithelial cell is converted into the biological process with interstitial phenotype cells by specific program, is the tumour of canceration
Cell migration and the important link sent out, therefore compared with epitheliated type CTCs, mixed type and interstitial type CTCs is considered and tumour
Transfer it is more related to poor prognosis.But EMT is the process of a dynamic transition, and the CTCs in blood reaches conjunction
Mesenchymal-epithelial conversion (MET) can occur when suitable field planting position, thus increase the phenotype heterogeneity of CTCs, i.e., according to EMT
The same subtype C TCs of marker identification may have different variation tendencies and lapse to final result.It is this lapse to uncertainty to
The result deciphering of CTCs Subtypes brings challenge, to limit the clinical application of CTCs molecular Biological Detections.Therefore,
There is an urgent need for developing new CTCs molecular typing methods and marker, more specifically CTCs hypotypes and tumor development feature are established
Between association, with promote CTCs detect expansion application.
Metabolism reprogramming is one of important feature of tumour cell, and the generation and transfer with tumour are closely related.Tumour is thin
Born of the same parents' glycometabolism is mainly characterized by aerobic glycolysis Showed Very Brisk, and in addition there are pentose phosphate pathways and glutamine metabolism to enhance
Deng.On the one hand metabolism reprogramming is to the effect of tumour, it is required that energetic supersession provides for the growth of tumour cell and fast breeding
ATP and large biological molecule;On the other hand, vigorous energetic supersession and the activation of relevant cell signal and the migration of tumour and
Invasion is closely related.Abnormal adjust of glycometabolism has decisive role, the metabolism of up-regulation to the biological behaviour of tumour cell
Enzyme and active signal path can participate in inducing the proliferation of tumour cell, anoikis resistance, immunologic escape, angiogenesis
Deng to promote the transfer of tumour.Therefore, it detects the Feature of Glucose Metabolism of CTCs and metabolism hypotype may be implemented to be metabolized CTCs and live
Property analysis, help to judge the variation tendency of CTCs and lapse to and then assess the function of specific subtype CTCs, it is quiet to make up
The CTCs morphologic phenotypes of state analyze the deficiency in terms of clinical interpretation, promote CTCs Molecular injuries in diagnosis of metastasis
With the application in assessment.
Invention content
The primary purpose of the present invention is that providing the application of prostate cancer circulating tumor cell metabolism parting marker.
Another object of the present invention is to provide a kind of circulating tumor cell glycometabolism classifying method.
The technical solution used in the present invention is:
Phosphoglyceric kinase 1PGK1 and glucose-6-phosphate dehydrogenase G6PD is used as circulating tumor cell glycometabolism simultaneously
The application of parting marker.
Quantitatively application of the reagent of detection PGK1 and G6PD in preparing circulating tumor cell glycometabolism parting kit.
Further, the reagent of above-mentioned quantitatively detection PGK1 and G6PD is selected from the probe of detection PGK1 and G6PD, detection
At least one of the quantification PCR primer of PGK1 and G6PD.
A kind of circulating tumor cell glycometabolism parting marker is PGK1 and G6PD.
A kind of method of circulating tumor cell glycometabolism parting, includes the following steps:It is swollen that more parts of cycles are quantitatively detected respectively
The expression of reference gene TBP, TFRC, B2M in oncocyte sample, by the 2500th in all expression testing results
Quantile is denoted as P as criterion25;PGK1 and G6PD in circulating tumor cell is detected with identical quantitative detecting method
Expression, if total expression > P of PGK1 and G6PD25, which is denoted as GM+Hypotype;If PGK1 and G6PD
Total expression≤P25, which is denoted as GM-Hypotype.
Further, the quantitative detecting method includes RNA hybridization in situ technique, RT-qPCR, genechip detection, survey
Sequence.
Further, 8 parts are no less than for detecting the circulating tumor cell sample number of reference gene expression.
Quantitatively application of the reagent of detection PGK1 and G6PD in preparing metastases auxiliary diagnosis or diagnostic kit.
Further, the tumour is prostate tumor.
A kind of metastases auxiliary diagnostic box, containing the reagent with quantitative detection PGK1 and G6PD in the kit.
The beneficial effects of the invention are as follows:
The present invention is to carry out function parting to circulating tumor cell (CTCs) from the angle of metabolic activity, can preferably be reflected
The variation tendency and biological behaviour of CTCs.Show compared with EMT partings in the verification result of prostate cancer sample, GM+CTCs
Hypotype is more related to metastases, and can be used as the auxiliary diagnosis marker of metastases.Therefore, CTCs glycometabolisms parting can
Good value is provided for clinical disease assessment.
Description of the drawings
Fig. 1 is the result of function carbohydrate metabolism classification cDNA microarray PC-3M 2B4 and PC-3M 1E8 difference expression genes;
Fig. 2 is the mRNA expressions (* P < 0.05) of PGK1 and G6PD in 5 kinds of prostate gland cancer cells;
Fig. 3 is protein expression level (the * P < 0.05 of PGK1 and G6PD in 5 kinds of prostate gland cancer cells:PC-3M 2B4 and
PC-3M 1E8 comparison among groups;#P < 0.05:LNCAP, PC-3 and DU145 comparison among groups);
Fig. 4 is without the GM for shifting and having metastasized prostate cancer patient+CTCs and H-CTCs quantity;
Fig. 5 is using independent CTCs partings and joint tPSA and Gleason scoring diagnosis transfers and no metastasized prostate cancer
ROC curve.
Specific implementation mode
Phosphoglyceric kinase 1PGK1 and glucose-6-phosphate dehydrogenase G6PD is used as circulating tumor cell glycometabolism simultaneously
The application of parting marker.
Quantitatively application of the reagent of detection PGK1 and G6PD in preparing circulating tumor cell glycometabolism parting kit.
Preferably, the reagent of above-mentioned quantitatively detection PGK1 and G6PD is selected from the probe of detection PGK1 and G6PD, detection PGK1
At least one of with the quantification PCR primer of G6PD.
A kind of circulating tumor cell glycometabolism parting marker is phosphoglyceric kinase 1PGK1 and 6- phosphoric acid grape
Glucocorticoid dehydrogenase G6PD.
A kind of method of circulating tumor cell glycometabolism parting, includes the following steps:It is swollen that more parts of cycles are quantitatively detected respectively
The expression of reference gene TBP, TFRC, B2M in oncocyte sample, by the 2500th in all expression testing results
Quantile is denoted as P as criterion25;PGK1 and G6PD in circulating tumor cell is detected with identical quantitative detecting method
Expression, if total expression > P of PGK1 and G6PD25, which is denoted as GM+Hypotype;If PGK1 and G6PD
Total expression≤P25, which is denoted as GM-Hypotype.
Preferably, the quantitative detecting method includes RNA hybridization in situ technique, RT-qPCR, genechip detection, sequencing.
Preferably, 8 parts are no less than for detecting the circulating tumor cell sample number of reference gene expression.
Quantitatively application of the reagent of detection PGK1 and G6PD in preparing metastases auxiliary diagnosis or diagnostic kit.
Preferably, the reagent of above-mentioned quantitatively detection PGK1 and G6PD is selected from the probe of detection PGK1 and G6PD, detection PGK1
At least one of with the quantification PCR primer of G6PD.
Preferably, the tumour is prostate tumor.
A kind of metastases auxiliary diagnostic box, containing the reagent with quantitative detection PGK1 and G6PD in the kit.
Preferably, the reagent of above-mentioned quantitatively detection PGK1 and G6PD is selected from the probe of detection PGK1 and G6PD, detection PGK1
At least one of with the quantification PCR primer of G6PD.
With reference to specific embodiment, the present invention is further illustrated.
The screening and identification of 1 metastases associated sugars metabolic markers of embodiment
1. material and method:
(1) cell strain:PC-3M 2B4, PC-3M 1E8, LNCAP, PC-3, DU145 cells.Wherein PC-3M 2B4 and PC-
3M 1E8 are the low transfer of the homologous prostate cancer of one pair of genes background and high-transfer cell strain, are purchased from Chinese Academy of Medical Sciences's cell
Center;LNCAP, PC-3 and DU145 are three kinds of common Prostatic cancer cell lines, and transfer ability enhances successively, is purchased from middle section
Institute's classical collection cell bank.
(2) culture medium and fetal calf serum:It is purchased from the Guangzhou bio tech ltd Xin Bang (Gibco productions).Wherein DMEM
Culture medium is for cultivating prostate cancer PC-3M 2B4, PC-3M 1E8 and PC-3 cells;Before 1640 culture mediums of RPMI are for cultivating
Row gland cancer LNCAP and DU145 cell;10% fetal calf serum is added when culture.
(3) gene microarray analysis:For detecting prostate cancer low metastatic cells PC-3M 2B4 and high-transfer cell PC-3M
The glucose metabolism genes of 1E8 are composed to screen difference expression gene.Function carbohydrate metabolism classifies chip type for RT2ProfilerTM PCR
Array Human Glucose Metabolism (PAHS-006Z) are purchased from Haikang into biological Co., Ltd.Two kinds of cells are each
3 wares (totally 6 samples) extract the total serum IgE of 6 cell samples using classical Trizol methods, through chloroform extraction, isopropanol precipitating
Essence carries, after the washing of 75% ethyl alcohol, is dried to obtain RNA sample and with suitable DEPC water dissolutions.Then, it is digested using DNase I
Sample is to remove the genomic DNA that may wherein contain, and whether purifying RNA sample is qualified with the quality for detecting sample.Extraction
Qualified RNA sample after purification is detected with function classification chip again after reverse transcription synthesizes cDNA, according to standard specification
Operation.
(4) real time fluorescent quantitative poly chain amplification (qRT-PCR):For proofing chip screening-gene in 5 kinds of forefront
MRNA expressions in adenocarcinoma cell.RNA is extracted and amplification related kit is purchased from the Guangzhou bio tech ltd Rui Zhen
(Takara productions).The RNA of PC-3M 2B4, PC-3M 1E8, LNCAP, PC-3 and the DU145 cells of routine culture is extracted, it is pure
Expression through reverse transcription and qRT-PCR detection chip differential genes after change, with the expression of internal reference Gene A CTB to inspection
It surveys result and does standardization.The amplimer of PGK1, G6PD and ACTB are as follows:
PGK1-F:TGGACGTTAAAGGGAAGCGG(SEQ ID NO:1),
PGK1-R:GCTCATAAGGACTACCGACTTGG(SEQ ID NO:2);
G6PD-F:CGAGGCCGTCACCAAGAAC(SEQ ID NO:3),
G6PD-R:GTAGTGGTCGATGCGGTAGA(SEQ ID NO:4);
ACTB-F:CATGTACGTTGCTATCCAGGC(SEQ ID NO:5),
ACTB-R:CTCCTTAATGTCACGCACGAT(SEQ ID NO:6)。
(5) Western Immuno marking analysis (Western blot):For proofing chip screening-gene in 5 kinds of prostate cancers
Protein expression level in cell.Protein extraction, that quantitative and separation detection related reagent is purchased from the prosperous nation's biotechnology in Guangzhou is limited
Company (Kai Ji, Sigma are produced).It is prosperous that the specific primary antibody and label secondary antibody of PGK1, G6PD and internal reference albumin A CTB are purchased from Guangzhou
Bio tech ltd of nation (ABclonal productions).The total protein for extracting 5 kinds of cells takes 30ug albumen to use after quantitative detection
SDS-PAGE electrophoresis is detached, and is transferred to pvdf membrane.With change after the closing of 5% skimmed milk power, primary antibody are incubated, secondary antibody is incubated
It learns luminescence reagent box and detects protein band, Image J softwares is used in combination to analyze protein expression level.
2. result
(1) cDNA microarray of glycometabolism marker
As shown in Figure 1, gene microarray analysis screening prostate cancer high-transfer cell strain PC-3M 1E8 and low transfer cell strain
The glucose metabolism genes of differential expression totally 68 in PC-3M 2B4, wherein PC-3M 1E8 the cells table compared with PC-3M 2B4 cells
The gene 17 lowered up to the gene 51 of up-regulation, expression.Function is carried out to these difference expression genes using bioinformatics
Path analysis, the results showed that they are mainly and cell glycolysis, pentose phosphate pathway and the relevant enzyme of tricarboxylic acid cycle process
And regulatory molecule, table 1 list the part variation expressing gene of cDNA microarray, other difference expression genes are being related to other
The project research of progress, it is unlisted.
The part variation expressing gene of 1. cDNA microarray of table
Note:P<Difference is statistically significant when 0.05.
(2) cDNA microarray result verification
Chip results are verified using qRT-PCR and western blot, detect the gene of up-regulation in 5 kinds of cells
MRNA and protein expression level, as a result show it is similar to cDNA microarray result.Wherein gene PGK1 and G6PD are in transfer ability
Expression in stronger cell (PC-3M 1E8, DU145) be apparently higher than the weaker cell of transfer ability (PC-3M 2B4,
PC-3, LNCAP), as shown in Figures 2 and 3.
Embodiment 2CTCs glycometabolism partings
1. material and method
(1) CTCs separation and identification:CanPatrol CTCs separating kits are purchased from Guangzhou Yi Shan biotech companies.
Tumor patient 5mL anti-freezing venous blood is acquired, with microporous membrane filter techniques according to leucocyte and CTCs sizes after splitting erythrocyte
Difference carries out the separation and concentration of CTCs.Using DAPI dyestuffs nuclear targeting and CD45 detection probes to the CTCs that is enriched on filter membrane
Carry out fluorescent marker, atypia feature and CD45 expression the negative identification CTCs of combination cell core.
(2) CTCs glycometabolisms parting:
1) detection probe of the probe of synthesis detection PGK1 and G6PD, targeting PGK1 and G6PD is set by Invitrogen companies
Meter synthesis, sequence are as follows:
The probe of PGK1 is (using the mixture of these following probes to improve detection sensitivity when the present embodiment detects;
Can also actually there are other probes designs and combination):
PGK1-1:AGCTGAAGCTGCGGCTGAAG(SEQ ID NO:7),
PGK1-2:GAGAAGCGCGCGTAGAAGTC(SEQ ID NO:8),
PGK1-3:CAGGAACTGCTTCATGGAGA(SEQ ID NO:9),
PGK1-4:AACTCTTGCCGCAGAAACAT(SEQ ID NO:10),
PGK1-5:AATAGCTTTAGCATCCTCAG(SEQ ID NO:11),
PGK1-6:ATGTTCTTCTAGGCCTTTCA(SEQ ID NO:12),
PGK1-7:GCATAAACTAGAGACCTGCA(SEQ ID NO:13),
PGK1-8:TAAAGATCATCTTGCAGGCC(SEQ ID NO:14);
The probe of G6PD is (using the mixture of these following probes to improve detection sensitivity when the present embodiment detects;
Can also actually there are other probes designs and combination):
G6PD-1:GAAGTGTACGACCGTTTCCG(SEQ ID NO:15),
G6PD-2:AAAAGCTCTTCCCGCAGGAT(SEQ ID NO:16),
G6PD-3:CGACTGATGGAAGGCATCGC(SEQ ID NO:17),
G6PD-4:CACCAGATGGTGGGGTAGAT(SEQ ID NO:18),
G6PD-5:ACGATGAAGGTGTTTTCGGG(SEQ ID NO:19),
G6PD-6:AGGAGTTGCGGGCAAAGAAG(SEQ ID NO:20),
G6PD-7:TAGGAGGCTGCATCATCGTA(SEQ ID NO:21),
G6PD-8:CATTCATGTGGCTGTTGAGG(SEQ ID NO:22).
2) above-mentioned probe and RNA hybridization in situ technique are utilized, detection PGK1 and G6PD Mixed markers object is simultaneously in peripheral blood
Expression in CTCs.Concrete operations are:The CTCs of enrichment through fixation, permeabilization, digestion, hybridization, signal amplification and etc. after,
With the expression of fluorescence microscope scanning analysis metabolic markers, the glycometabolism hypotype of CTCs is distinguished according to fluorescence signal.It is first
First, using RNA hybridization in situ technique, to the fluorescence signal of reference gene TBP, TFRC and B2M in 100 parts of CTCs samples respectively into
The number of probes of row detection, detection reference gene TBP, TFRC and B2M is identical as the number of probes of PGK1 and G6PD, in the present embodiment
It is 8 probes (8 probes being not limited in practical operation, as long as RNA in situ hybridization detection results are met the requirements).With
After fluorescence microscope carries out fluorescence signal detection to reference gene TBP, TFRC and B2M in 100 parts of CTCs samples respectively, obtain
300 parts of fluorescence signal intensity values.Then, with wherein the 25th percentile (P25) as judging that metabolic gene PGK1 and G6PD express
Horizontal standard, P in this example25It is 5.When PGK1 and G6PD in fluorescence microscope scanning analysis sample total signal strength > 5 (i.e.
P25), it is denoted as GM+CTCs hypotypes;As the total signal strength≤5 (P of PGK1 and G6PD25), it is denoted as GM-CTCs hypotypes.
Level of known TBP, TFRC and the B2M gene in CTCs is respectively low expression, and moderate expression and height are expressed, therefore
Using them as with reference to gene.Other quantitative approach (such as RT-qPCR, genechip detection, sequencing quantitative detecting method)
As a result criterion can also and so on, i.e., with the P in corresponding method testing result of these genes25For reference, it is metabolized base
Because of testing result > P25Shi Jiwei GM+Hypotype.
2. result
The interpretation of CTCs testing results:First to detach according to present method and identify CTCs, specific method includes root
According to cell size and leucocyte mark CD45 judge judge it is not CTCs if cell is smaller or CD45 is positive;Secondly with thin
Karyon form judges that the non-uniform nucleus lines of the apparent depth is presented in CTCs nucleus after DAPI is dyed, and non-specific
Impurity in uniform blue.
It is GM to be divided CTCs according to the expression of glycometabolism marker+CTCs (the total signal strength > 5 of PGK1 and G6PD
(P25) be the positive) and GM-CTCs (total signal strength≤5 (P25) be feminine gender) two kinds of hypotypes, the glycometabolism parting of as CTCs.
The correlation of the glycometabolism parting and metastases of embodiment 3CTCs
1. material and method
(1) patient 48 that pathological diagnosis is prostate cancer is recruited, wherein the transferrer 26 that occurs together, no transferrer 22.
Through patient's informed consent, acquisition 5mL peripheral bloods utilize above method detection CTCs numbers and its glycometabolism hypotype.
(2) while the EMT Phenotype typing situations of CTCs are detected, utilizing classical EMT partings marker, (E indicates EpCAM/
CKs and M indicates Vimentin/Twist) CTCs is divided for epitheliated type (E-CTCs), mixed type (H-CTCs) and interstitial type (M-
CTCs), detection kit is purchased from Guangzhou Yi Shan biotech companies.
(3) compare the characteristics of transfer is with without patient's CTCs glycometabolisms parting and EMT hypotypes is shifted, with fitting subject's work
Clinical value of feature (ROC) the curve evaluation CTCs partings in differentiating prostate cancer transfer.
2. result
It is respectively 5/5mL (IQR 2-8) and 2 to have total CTCs medians of transfer and the patients with prostate cancer without transfer
A/5mL (IQR 0-3), P=0.001, two groups of GM+CTCs recall rates are 80.8% and 45.4%.
As shown in figure 4, there is the patient GM of transfer+CTCs medians are 2/5mL (IQR 1-4), are significantly higher than no transfer
The GM of patient+0/the 5mL of median (IQR 0-2) of CTCs, P=0.003;There is transfer and without position in the H-CTCs for shifting patient
Number is respectively 2/5mL (IQR 1-5) and 1/5mL (IQR 0-2), P=0.008;But have transfer and without transfer two groups in E-
The quantity of CTCs and M-CTCs is without significant difference (P > 0.05).These are the result shows that GM+The level of CTCs and H-CTCs and forefront
Gland cancer transfer is closely related.
Further differentiating there is transfer and the diagnostic value in no metastasized prostate cancer with ROC curve simulation CTCs hypotypes.
It is evaluated with area under the curve (AUC), indicates that there is moderate diagnostic accuracy when AUC is 0.7-0.9, AUC is more than 0.9
Indicate that there is higher accuracy.
TPSA, total prostate specific antigen are the preferred blood serum designated objects of prostate cancer diagnosis, also with tumour progression and art
Relapse and metastasis is closely related afterwards.Its existing detection method is:It is used after acquiring venous patient blood 4mL, 3500rpm centrifugation 10min
Siemens's Full-automatic chemiluminescence immunoassay analysis meter detects serum tPSA concentration.Testing principle is double antibody sandwich method, specific to walk
It is rapid that with reference to the 3rd edition national clinical examination operating instruction, (leaf answers lovely, Wang Yusan, Shen sub- fine jade whole nation clinical examination operating instructions the 3rd
Version Ministry of Health of the People's Republic of China doctor department .2006.).
Gleason scores, and is the method for existing adenocarcinoma of the prostate histological grade, passes through the gland to biopsy or operation acquirement
Cancerous tissue does slice pathological examination, judges that Gleason scorings and prognosis are classified according to Gland characters.Specific methods of marking reference
2016 editions WHO urinary systems and genital orgnas,male's staging (MochH, HumphreyPA, UlbrightTM, et al.WHO
classification of tumours of the urinary system and male genital organ[M]
.Lyon:IARC Press,2016.)。
As shown in figure 5, using individually H-CTCs and GM+AUC is respectively 0.721 and 0.745 when CTCs, is used in combination
TPSA and GM+AUC is 0.848 when CTCs is detected, and uses three marker tPSA-Gleason scorings-GM simultaneously+CTCs is detected
When AUC up to 0.922, three marker tPSA-Gleason scorings-GM+The sensitivity of CTCs and specificity are respectively 84.6%
With 90.9%.These are the result shows that GM+CTCs can be used as the auxiliary diagnosis marker of good prostate cancer transfer, and with
AUC has higher accuracy up to 0.922 when tPSA, Gleason scoring are used in combination.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, it is other it is any without departing from the spirit and principles of the present invention made by changes, modifications, substitutions, combinations, simplifications,
Equivalent substitute mode is should be, is included within the scope of the present invention.
SEQUENCE LISTING
<110>Hospital of Southern Medical University
<120>Circulating tumor cell is metabolized parting marker and its application
<130>
<160> 22
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
tggacgttaa agggaagcgg 20
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
gctcataagg actaccgact tgg 23
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<400> 3
cgaggccgtc accaagaac 19
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
gtagtggtcg atgcggtaga 20
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence
<400> 5
catgtacgtt gctatccagg c 21
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence
<400> 6
ctccttaatg tcacgcacga t 21
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence
<400> 7
agctgaagct gcggctgaag 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
gagaagcgcg cgtagaagtc 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
caggaactgc ttcatggaga 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence
<400> 10
aactcttgcc gcagaaacat 20
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence
<400> 11
aatagcttta gcatcctcag 20
<210> 12
<211> 20
<212> DNA
<213>Artificial sequence
<400> 12
atgttcttct aggcctttca 20
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence
<400> 13
gcataaacta gagacctgca 20
<210> 14
<211> 20
<212> DNA
<213>Artificial sequence
<400> 14
taaagatcat cttgcaggcc 20
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence
<400> 15
gaagtgtacg accgtttccg 20
<210> 16
<211> 20
<212> DNA
<213>Artificial sequence
<400> 16
aaaagctctt cccgcaggat 20
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence
<400> 17
cgactgatgg aaggcatcgc 20
<210> 18
<211> 20
<212> DNA
<213>Artificial sequence
<400> 18
caccagatgg tggggtagat 20
<210> 19
<211> 20
<212> DNA
<213>Artificial sequence
<400> 19
acgatgaagg tgttttcggg 20
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence
<400> 20
aggagttgcg ggcaaagaag 20
<210> 21
<211> 20
<212> DNA
<213>Artificial sequence
<400> 21
taggaggctg catcatcgta 20
<210> 22
<211> 20
<212> DNA
<213>Artificial sequence
<400> 22
cattcatgtg gctgttgagg 20
Claims (10)
1. phosphoglyceric kinase 1PGK1 and glucose-6-phosphate dehydrogenase G6PD is simultaneously as circulating tumor cell glycometabolism point
The application of type marker.
2. quantitatively application of the reagent of detection PGK1 and G6PD in preparing circulating tumor cell glycometabolism parting kit.
3. application according to claim 2, which is characterized in that the reagent for quantitatively detecting PGK1 and G6PD is selected from detection PGK1
With the probe of G6PD, detect at least one of the quantification PCR primer of PGK1 and G6PD.
4. a kind of circulating tumor cell glycometabolism parting marker is PGK1 and G6PD.
5. a kind of method of circulating tumor cell glycometabolism parting, which is characterized in that include the following steps:Quantitative detection is more respectively
The expression of reference gene TBP, TFRC, B2M in part circulating tumor cell sample, will be in all expression testing results
The 25th percentile as criterion, be denoted as P25;PGK1 in circulating tumor cell is detected with identical quantitative detecting method
With the expression of G6PD, if total expression > P of PGK1 and G6PD25, which is denoted as GM+Hypotype;If
Total expression≤P of PGK1 and G6PD25, which is denoted as GM-Hypotype.
6. according to the method described in claim 5, it is characterized in that, the quantitative detecting method include RNA hybridization in situ technique,
RT-qPCR, genechip detection, sequencing.
7. according to the method described in claim 5, it is characterized in that, the circulating tumor for detecting reference gene expression is thin
Born of the same parents' sample number is no less than 8 parts.
8. quantitatively application of the reagent of detection PGK1 and G6PD in preparing metastases auxiliary diagnosis or diagnostic kit.
9. application according to claim 8, which is characterized in that the tumour is prostate tumor.
10. a kind of metastases auxiliary diagnostic box, which is characterized in that contain in the kit with quantitatively detection PGK1 and G6PD
Reagent.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810047440.0A CN108342478B (en) | 2018-01-18 | 2018-01-18 | Circulating tumor cell metabolism typing marker and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810047440.0A CN108342478B (en) | 2018-01-18 | 2018-01-18 | Circulating tumor cell metabolism typing marker and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108342478A true CN108342478A (en) | 2018-07-31 |
CN108342478B CN108342478B (en) | 2021-08-03 |
Family
ID=62961440
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810047440.0A Active CN108342478B (en) | 2018-01-18 | 2018-01-18 | Circulating tumor cell metabolism typing marker and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108342478B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111487404A (en) * | 2019-01-28 | 2020-08-04 | 猎源(上海)生物医药科技有限公司 | Kit for extracting DNA of body fluid tumor cells |
CN112662774A (en) * | 2021-01-12 | 2021-04-16 | 南方医科大学南方医院 | Liver cancer circulating tumor cell marker and application thereof |
CN117269495A (en) * | 2023-09-19 | 2023-12-22 | 中山大学附属第一医院 | Marker protein combination for molecular typing of prostatic cancer proteins and application thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102146474A (en) * | 2011-03-21 | 2011-08-10 | 广东蓝岛生物技术有限公司 | T2DM (Type 2 Diabetes Mellitus) detection primer group, PCR (Polymerase Chain Reaction) chip and detection method for human and monkeys |
CN102586402A (en) * | 2011-01-05 | 2012-07-18 | 苏州科贝生物技术有限公司 | Kit for quantitative evaluation for long-term recurrent risk of colorectal cancer |
CN103025890A (en) * | 2010-04-06 | 2013-04-03 | 卡里斯生命科学卢森堡控股 | Circulating biomarkers for disease |
CN105063165A (en) * | 2015-07-31 | 2015-11-18 | 上海交通大学 | Method and device for detecting metabolic activity of circulating tumor cells |
-
2018
- 2018-01-18 CN CN201810047440.0A patent/CN108342478B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103025890A (en) * | 2010-04-06 | 2013-04-03 | 卡里斯生命科学卢森堡控股 | Circulating biomarkers for disease |
CN102586402A (en) * | 2011-01-05 | 2012-07-18 | 苏州科贝生物技术有限公司 | Kit for quantitative evaluation for long-term recurrent risk of colorectal cancer |
CN102146474A (en) * | 2011-03-21 | 2011-08-10 | 广东蓝岛生物技术有限公司 | T2DM (Type 2 Diabetes Mellitus) detection primer group, PCR (Polymerase Chain Reaction) chip and detection method for human and monkeys |
CN105063165A (en) * | 2015-07-31 | 2015-11-18 | 上海交通大学 | Method and device for detecting metabolic activity of circulating tumor cells |
Non-Patent Citations (5)
Title |
---|
BRIAN HU ET AL.: "Circulating Tumor Cells in Prostate Cancer", 《CANCERS》 * |
FRANCESCO MASSARI ET AL.: "Metabolic phenotype of bladder cancer", 《CANCER TREATMENT REVIEWS》 * |
JING CHEN ET AL.: "Metabolic reprogramming-based characterization of circulating tumor cells in prostate cancer", 《J EXP CLIN CANCER RES》 * |
XIUWEN GUAN,ET AL.: "Analysis of the hormone receptor status of circulating tumor cell subpopulations based on epithelial-mesenchymal transition: a proof-of-principle study on the heterogeneity of circulating tumor cells", 《ONCOTARGET》 * |
ZHAOYONG LI ET AL.: "Reprogramming of glucose, fatty acid and amino acid metabolism for cancer progression", 《CELL MOL LIFE SCI》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111487404A (en) * | 2019-01-28 | 2020-08-04 | 猎源(上海)生物医药科技有限公司 | Kit for extracting DNA of body fluid tumor cells |
CN111487404B (en) * | 2019-01-28 | 2024-01-05 | 猎源(上海)生物医药科技有限公司 | Body fluid tumor cell DNA extraction kit |
CN112662774A (en) * | 2021-01-12 | 2021-04-16 | 南方医科大学南方医院 | Liver cancer circulating tumor cell marker and application thereof |
CN117269495A (en) * | 2023-09-19 | 2023-12-22 | 中山大学附属第一医院 | Marker protein combination for molecular typing of prostatic cancer proteins and application thereof |
CN117269495B (en) * | 2023-09-19 | 2024-06-04 | 中山大学附属第一医院 | Marker protein combination for molecular typing of prostatic cancer proteins and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN108342478B (en) | 2021-08-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Cavrois et al. | Mass cytometric analysis of HIV entry, replication, and remodeling in tissue CD4+ T cells | |
CN103003442B (en) | A method of passing through microrna expression proficiency assessment people's allograft situation | |
Liu et al. | Blood-based liquid biopsy: Insights into early detection and clinical management of lung cancer | |
CN109478231A (en) | The method and composition of the obvious Lung neoplasm of benign and malignant radiograph is distinguished in help | |
CN101608240B (en) | Primers and probes for detecting human EGFR gene mutations as well as use method thereof | |
CN108504742A (en) | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology | |
CN105219844A (en) | A kind of compose examination 11 kinds of diseases gene marker combination, test kit and disease risks predictive model | |
CN107177683B (en) | Bladder cancer screening and detecting kit | |
CN108342478A (en) | Circulating tumor cell is metabolized parting marker and its application | |
CN108977529A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
CN109234394A (en) | A kind of diagnosing cancer of liver marker and its screening technique | |
Herranz et al. | Circulating cell-free DNA in liquid biopsies as potential biomarker for bladder cancer: a systematic review | |
Hu et al. | Enrichment and detection of circulating tumor cells by immunomagnetic beads and flow cytometry | |
CN105624166B (en) | A kind of aptamer for detecting Human Bladder Transitional Cell Carcinoma cell and its application in detection preparation is prepared | |
CN106319062A (en) | Minimally invasive kit for assistant diagnosis or efficacy prediction of efficacy prediction | |
CN108486221A (en) | The method for detecting telomere length | |
CN101988062A (en) | cervical cancer detection markers and detection method, kit and biochip thereof | |
CN108913770A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
CN107299129A (en) | Circle nucleic acid as breast cancer biomarker application | |
CN110846414A (en) | Ovarian cancer prognosis diagnosis marker combination and application thereof | |
CN108456730A (en) | Distant place risk of recurrence gene group and in-vitro diagnosis product and application in breast cancer parting | |
CN114990218A (en) | Kit for predicting lung cancer brain metastasis | |
CN107779503A (en) | The related difference expression gene of Alzheimer and its application | |
CN105603086B (en) | Epstein-Barr virus correlation nasopharyngeal carcinoma diagnosis kit based on CDH6 | |
CN110241186A (en) | Detect the binary channels real-time fluorescent quantitative RT-PCR method of GATA3 gene relative expression quantity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |