DE10019120A1 - New human platelet-activating factor (PAF) receptor-2 gene, useful for diagnosis and treatment of PAF-related diseases - Google Patents

Abstract

Novel human platelet-activating factor (PAF) receptor-2 (PAFR-2) gene (I) of 5521 base pairs (bp), including 5' and 3'-untranslated regions, reproduced. Independent claims are also included for the following: (a) transcription factors, RNA polymerases, pharmaceuticals and chemicals that modify, positively or negatively, expression of (I); (b) mRNA transcribed from (I), including splice variants and isoforms; (c) cDNA derived from the mRNA, or the intronless version of (I); (d) protein (II), and its derived peptides, derived or produced from (I), its cDNA or mRNA; (e) (monoclonal) antibodies and antisera raised against (II) or one or more of its epitopes; (f) expression systems that produce natural or recombinant (II); (g) ligand-binding studies and screening assays on native or recombinant receptors, or cells or cell membranes that contain them; (h) transgenic and knockout animals which express (II), or their splice variants, at altered levels or not at all; (i) gene therapy methods (and their development or use) based on (II) and the corresponding gene, mRNA or cDNA; (j) (anti)sense oligonucleotides derived from (I) and their use; and (k) diagnosis and treatment of diseases that are (in)directly associated with (II). In all cases, the protein, gene, mRNA or cDNA can be modified, e.g. by amino acid or base exchanges.

Description

Invention description: PAFR2

Using the amino acid sequence of a G protein-coupled receptor, Homology search in a database for a potential gene for a new G protein coupled receptor identified on human chromosome 14. From the gene sequence were oligonucleotides for the amplification of the potential receptor gene and its derived cDNA (mRNA) sequence prepared and for the PCR amplification of the gene (coding region) and the cDNA used. Using this primer, the intronless Gene from human genomic DNA can be cloned and sequenced.

The gene to be patented spans 5521 bases. The coding area of the gene (Item 1525 to 3006) consists of an open reading frame of 1482 bases and thus codes a protein of 494 amino acids. Hydrophobicity analysis of the amino acid sequence reveals that it is a G protein-coupled receptor with seven transmembrane domains acts. The amino acid sequence is new and previously unknown and shows the best homology to the "leukocyte platelet activating receptor" (PAFR), which localizes on chromosome 1 (see, e.g., Kunz et al. 1992; J. Biol. Chem. 267, 9101-9106, 1992). PAFR2 owns a 91% amino acid identity to PAFR (over 309 amino acids). PAFR2 is however with 494 amino acids significantly larger (in the C-terminal region) than PAFR with 322 Amino acids and the PAFR2 gene are located on chromosome 14, in contrast to PAFR gene located on chromosome 1.

Furthermore, the sequence to be patented includes 1524 bases of the 5 'untranslated Region of the gene which presumably contains the promoter and 2515 bases of the 3 ' untranslated region of the gene, which has three typical polyadenylation signals (AATAAA) included in heading 5005-5010, 5103-5108 and 5119-5124.

We have given the receptor the name "PAFR2".

The expression of this gene was determined by means of polymerase chain reaction (PCR) and primers (sense: 5 'CACTGGGCCCCATGGAGGAG 3'; antisense: 5 ' CATAAGCTGGCCATTCCAACCG 3 ') which is the coding region of the PAFR2 gene flank proven. The following temperature program was used for the PCR: 94 ° C 1 min, 62 ° C 1 min, 72 ° C 3 min, 35 cycles. We were able to do the full coding cDNA (open reading frame) of the PAFR2 receptor from a human testicular cDNA bank reproduce. This is the expression of the mRNA of this receptor in this tissue clearly proven. PCR with genomic DNA and these primers resulted in a band of of identical size and by sequencing, it was clearly demonstrated that the gene was intronless is. Furthermore, homology searches in databases of expressed Sequence pieces of human genes (EST = expressed sequence tags) with expressed sequences 100% homology from human gastric adenocarcinoma, test, cervix, B- Lymphocytes and spermatocytes can be found.  

Character: MBHB-RECIPE-11 (continued description)

The amino acid sequence of the PAFR2 receptor derived from the cDNA sequence is 494 Amino acids long. Hydrophobicity analysis of the amino acid sequence gives a putative Secondary structure of the protein as an integral membrane protein with probably seven (or even nine) transmembrane domains. The protein contains a potential N- Glycosylation site in amino acid position 393. There is also a in the amino acid sequence contain potential protein kinase C phosphorylation sites (amino acid positions 303), their optional phosphorylation may be involved in the modulation of the receptor function can. There are two potential positions 146 and 266 of the amino acid sequence Casein kinase II phosphorylation sites. One finds in the range from amino acid 143 to 164 a typical leucine zipper motif, which may be responsible for an oligomerization of the Receptor is important. A typical motif can be found from amino acid 197 to 213, which is common to most G protein-coupled receptors.

Classification and potential functions of the patented PAFR2 receptor and of his gene (or cDNA; mRNA)

The receptor belongs to the large gene amile of G protein-coupled receptors (GPCRs). Within this large family he belongs to the sub-family of the "Class A rhodopsin-like" Receptors. It has the highest homology to the platelet activating factor receptor (PAFR) and homology to the Galaninl receptor as well as to histamine H2 receptors and somatostatin and dopamine receptors. It is most likely that the receptor is a new receptor for the "platelet activating factor" (PAF), a potent phospholipid mediator, which from a variety of different cells (including basophilic leukocytes, macrophages, Platelets and endothelial cells) is released, and its physiological effects mediated via G protein-coupled receptors. PAF is at a variety of physiological and pathophysiological processes involved, of which only a few the following may be mentioned: platelet activation, drop in blood pressure, increase in vascular permeability, Bronchoconstriction, development of thrombosis, inflammatory and immunological Reactions, heart disease (coronary artery constriction); in the CNS: long-term Potentiation (long-term memory) and neuronal differentiation; post-chemical Vasospasm; Reduction of gastric mucosal blood flow in Helicobacter pylori Infection; endothelial cell motility and neoangiogenesis, anaphylactic shock and septic shock. Antagonists on the known PAF receptor (PAFR) are currently in clinical studies on shock therapy and pancreatitis. There are numerous references from the Literature that mediates the physiological effects of PAF via more than one receptor Need to become. The PAFR2 to be patented here represents a new PAF receptor, which probably some of the previously lacking physiological / pathophysiological effects of FAF can mediate. New antagonists (or agonists) that specifically target the PAFR2 attack should be valuable new drugs. PAFR already available Antagonists are likely to have affinity for the new PAFR2 due to the very high level Amino acid identity of the two receptors.  

MBHB recipe-11

PAFR2 receptor amino acid sequence

MBHB recipe-11

PAFR2 cDNA, numbering refers to the gene, start codon (ATG) at 1525 stop codon (TAA) at 3007

MBHB recipe-11

PAFR2 receptor gene

Claims (16)

1. The gene shown including the 5 'and 3' untranslated region and the finding, that the PAFR2 receptor gene is located on chromosome 14. Procedure for Identification and therapy of genetic diseases associated with this gene are connected. 2. Transcription factors, RNA polymerases and pharmaceuticals as well as chemicals that make up the Affect gene expression in a positive or negative manner. 3. The messenger RNA transcribed from the gene, including that derived from it Splice variants and isoforms. 4. The cDNA derived from the mRNA or from the intronless gene. 5. The protein derived or produced from the mRNA (or the gene or the cDNA), and peptides derived therefrom. 6. Antibodies or antisera which act against one or more epitopes of the protein or against the whole protein. 7. Monoclonal antibodies or antisera against single or multiple epitopes of the Protein or against the whole protein. 8. Expression systems (eukaryotic cell lines, yeast cells, Xenopus oocytes, Baculovirus systems, bacterial expression systems) which contain the protein mentioned express (native or recombinant). 9. Ligand binding studies and screening assays on native or recombinant receptors or cells or cell membranes that contain this receptor. 10. Transgenic animals and knock-out animals, which these (or the corresponding Species variant) Express receptor in changed density or not at all. 11. Methods of gene therapy which relate to this receptor or its gene or its extend mRNA (cDNA) and their development and application. 12. Sense and antisense oligonucleotides derived from this gene as well their application. 13. The diagnosis and treatment of diseases (using pharmaceuticals or other methods), that are directly or indirectly associated with this receptor. 14. Methods for diagnosing diseases associated with this receptor (or its gene, mRNA) are connected in a direct or indirect manner such. B. Hybridization techniques, sequencing, SSCP, RFLP, Northern blot, Southern blot, Western blot, expression arrays, antibodies, mutation analyzes. 15. The use of the information or the expressed receptor to develop new ones Pharmaceuticals, compounds and chemicals and the evaluation of existing ones Pharmaceuticals, compounds and chemicals as well as for the development of new technologies or evaluation of existing technologies. 16. The patent should also extend to points 1 to 15 for modified proteins, and genes, cDNA and mRNA sequences (amino acid changes, base changes).