DE10021475A1 - New opioid-type receptor-1 gene, OTR1, useful for diagnosis and treatment of OTR1-related diseases - Google Patents

Abstract

New human opioid-type receptor-1 (OTR1) gene (I) of 4980 base pairs, including 5' and 3'-untranslated regions, reproduced. Independent claims are also included for the following: (a) transcription factors, RNA polymerases, pharmaceuticals and chemicals that modify, positively or negatively, expression of (I); (b) mRNA transcribed from (I), including splice variants and isoforms; (c) cDNA derived from the mRNA, or the intronless version of (I); (d) protein (II), and its derived peptides, derived or produced from (I), its cDNA or mRNA; (e) (monoclonal) antibodies and antisera raised against (II) or one or more of its epitopes; (f) expression systems that produce natural or recombinant (II); (g) ligand-binding studies and screening assays on native or recombinant receptors, or cells or cell membranes that contain them; (h) transgenic and knockout animals which express (II), or their splice variants, at altered levels or not at all; (i) gene therapy methods (and their development or use) based on (II) and the corresponding gene, mRNA or cDNA; and (j) (anti)sense oligonucleotides derived from (I) and their use; and (k) diagnosis and treatment of diseases that are (in)directly associated with (II). In all cases, the protein, gene, mRNA or cDNA can be modified, e.g. by amino acid or base exchanges.

Description

Using homology searches in databases, part of a potential new gene, which encoded for a G protein-coupled receptor. The partial sequence became Oligonucleotide primers derived and used for a PCR amplification. By means of this Primer and the polymerase chain reaction, we were able to get the receptor gene from human amplify genomic DNA and with this method we were also able to cDNA which encoded for this receptor, amplify from a human colon cDNA library. It deals is an intronless gene, d. H. the genomic sequence and the cDNA are identical. We were also able to find 5 'and 3' untranslated regions of the Identify and sequence genes (using "genome walking").

The human gene for which we call "OTR1" (opioid type receptor 1) designated new G protein-coupled receptor, the cDNA, which the Receptor encoded and the amino acid sequence derived from the cDNA.

Based on the cDNA amplification from human colon cDNA, we also know that this new, previously unknown receptor is expressed in the colon. By comparing the gene sequence with an EST database, we were able to clearly identify the expression of the gene in the following tissues:

• - human colon
• - human kidney
• - human liver
• - human skin tumor (squamous cell carcinoma)

1. The gene including 5 'and 3' non-translated area, which we have for patenting register is 4980 bases in size. The coding area extends from base 1499 (start Codon ATG) to Base 2770 (stop codon TGA included). In the non-translated 5 'area (Base 1-1499) is the regulatory region of this gene (promoter) with a TATA Box in the area of base 1194-1998. In the non-translated 3 'region of the gene (base 2851 to 5460) there is a classic polyadenylation signal (AATAAA) in position 3157-3162.

2. The cDNA, which we were able to amplify from human colon cDNA, extends from position 1482 to 2798 of the gene and codes for a protein of 423 amino acids. The following primers for the polymerase chain reaction (PCR) were used for the amplification:
sense: 5 'CTGATGAAAACCCCAGGATG 3';
antisense: 5'CACAGCGCTGCAGCCCTG3 '.
PCR program 94 ° C 1 min; 56 ° C for 1 min; 72 ° C 3 min; 35 cycles.

By cloning the cDNA from human tissue it has been proven that this receptor exists and is expressed in the human colon.  

3. The amino acid sequence, which from the open reading frame of the cDNA and also the intronless gene can be derived, is 423 amino acids long. Homology comparison in Databases show that the protein has the highest homology to opioid receptors. The highest homologies became the human opioid receptor delta-1, but also too Purinoceptors (P2U and P2Y) found. Further high homologies exist Somatostatin, thrombin, angiotensin and bradykinin receptors. With the exception of Purinoceptors, the homologous receptors are all peptide- Receptors, so it is very likely that the new "opioid-type" receptor is also a Is peptide receptor.

Hydrophobicity analysis of the amino acid sequence with the TopPred-II program showed that the protein has the typical structure of G-protein coupled receptors (GPCRs) with seven transmembrane domains. The amino acid sequence has two potential N-glycosylation sites in positions 44 and 175. Potential phosphorylation sites for protein kinase C are located in positions 21, 157, 174, 239, 249, 278 and 398. If these phosphorylation sites are located intracellularly, they can be involved in the modulation of the receptor function by protein kinase C. At position 348, casein kinase II can potentially be phosphorylated. From amino acid 178 to 194 there is a sequence motif typical for G protein-coupled receptors:
STNRTASVVFLTAIALNRYLKVVQPHH. This is additional evidence that it is a typical G protein-coupled receptor.

4. Classification and potential functions of the receptor to be patented and its gene (or cDNA; mRNA):
The receptor belongs to the large gene amile of G protein-coupled receptors (GPCRs) and within this family to the opioid-like receptors. As such, it should - like a number of other opioid receptors - play a role as a presynaptic receptor on the one hand in regulating the release of neurotransmitters (especially in the CNS). On the other hand, it could play a role in pain sensation and transmission as a postsynaptic receptor. In both cases, it would be a target for therapeutically important pharmaceuticals.

MBHB-Recept-14 (OTR1; Opioid-type Receptor1): gene sequence

MBHB-Recept-14 (OTR1; Opioid-type Receptor1): cDNA sequence

MBHB-Recept-14 (OTR1; Opioid-type Receptor1): amino acid sequence

Claims (1)

This patent is intended to cover the following data, techniques and applications and developments:

• 1. The gene shown including the 5 'and 3' untranslated region.
• 2. Transcription factors, RNA polymerases and pharmaceuticals as well as chemicals that influence the expression of the gene in a positive or negative way.
• 3. The messenger RNA transcribed from the gene, including splice variants and isoforms derived from it.
• 4. The cDNA derived from the mRNA or from the intronless gene.
• 5. The protein derived or produced from the mRNA (or gene or cDNA).
• 6. Antibodies or antisera which are produced against one or more epitopes of the protein or against the whole protein.
• 7. Monoclonal antibodies or antisera which are produced against one or more epitopes of the protein or against the whole protein.
• 8. Expression systems (eukaryotic cell lines, yeast cells, Xenopus oocytes, baculovirus systems, insect cell systems, bacterial expression systems) which express said protein (native or recombinant).
• 9. Ligand binding studies and screening assays on native or recombinant receptors or cells or cell membranes which contain this receptor.
• 10. Transgenic animals and knock-out animals which express this receptor in modified density or not at all.
• 11. Methods of gene therapy which extend to this receptor or its gene or its mRNA (cDNA) and their development and application.
• 12. Sense and antisense oligonucleotides derived from this gene and their use.
• 13. The diagnosis and treatment of diseases that are directly or indirectly associated with this receptor.
• 14. Methods for diagnosing diseases which are directly or indirectly related to this receptor (or its gene, mRNA), such as, for. B. Hybridization techniques, sequencing, SSCP, RFLP, Northern blot, Southern blot, Western blot, expression arrays, antibodies, mutation analyzes.
• 15. The use of the information, or the receptor or cells that express it, to develop new pharmaceuticals, compounds and chemicals and to evaluate existing pharmaceuticals, compounds and chemicals as well as to develop new technologies or to evaluate existing technologies.
• 16. The patent is also intended to extend to points 1 to 15 for modified proteins and genes, cDNA and mRNA sequences (amino acid exchanges, base exchanges).