DE19928417A1 - New gene encoding the G-protein coupled receptor hLPACR1, useful for diagnosis and gene therapy treatment of associated diseases - Google Patents

Abstract

A gene (I) encoding the human receptor (II) designated hLPACR1 (human lysophosphatidic acid (LPA)-like receptor-1), is new. Independent claims are also included for the following: (1) transcription factors, RNA polymerases, pharmaceuticals and chemicals that modulate expression of (I); (2) mRNA, including splice variants and isoforms, transcribed from (I); (3) cDNA derived from the mRNA of (2) or from intron-less genes; (4) a protein (IIa) derived/produced from (I), the cDNA of (3) or mRNA of (2); (5) antibodies and antisera raised against epitopes of (IIa), or against the whole protein; (6) expression systems that produce native or recombinant (IIa); (7) ligand-binding studies and screening assays using native or recombinant (II), or cells or cell membranes that contain (II); (8) transgenic or knockout animals that express (II) at altered levels or not at all; and (9) sense and antisense oligonucleotides derived from (I).

Description

With the help of the amino acid sequence of a G protein-coupled receptor Homology search in a publicly accessible database a potential gene for one identified a new G protein-coupled receptor on human chromosome 6. From the Gene sequences were used to amplify the potential receptor gene and oligonucleotides its derived cDNA (mRNA) sequence prepared and for the PCR amplification of the Gene and the cDNA used. By means of these primers, the intronless gene from human genomic DNA can be cloned and sequenced. Furthermore, with this primer cDNA for the full coding region of the gene from a human amygdala as well a human hippocampus cDNA bank. Sequencing the gene and of the cDNAs revealed the following properties of the gene: the gene (3438 base pairs) contains (like many genes of G protein-coupled receptors) no introns. The coding The area of the gene (items 717 to 1973) consists of an open reading frame of 1257 bases and thus encodes a protein of 419 amino acids. Hydrophobicity analysis of the Amino acid sequence reveals that it is a G protein-coupled receptor with seven transmembrane domains. The amino acid sequence is new and previously unknown and has the best homology (55% identity; 73% homology) to a Xenopus Laevis "growth factor like lipid mediator lysophosphatidic acid receptor" (receptor for the growth factor-like lipid mediator lysophosphatidic acid (LPAR)). The second highest Homology (52% identity; 71% homology) exists for a new human "orphan Receptor "(GPR45), which is expressed in the peripheral and central nervous system, however whose gene is located on another chromosome (Chr. 2q11.1-q12). Farther belong to the patented sequence 716 bases of the 5 'untranslated region of the Gene which presumably is the promoter (with typical TATA box and CAP signal) contain, as well as 1465 bases of the 3 'untranslated region of the gene which is a typical Contain polyadenylation signal in position 3190 to 3195.

The expression of this gene was determined by means of polymerase chain reaction (PCR) and primers (sense: 5 'CCATCCTACTGAAACCATGG 3'; antisense: 5 'GTCAGCCAGTTCCAATATTC 3) which flank the coding region of the gene proven. The following temperature program was used for the PCR: 94 ° C 1 min, 50 ° C 1 min, 72 ° C 3 min, 35 cycles. We were able to do the full coding cDNA (open reading frame) of this receptor from a human amygdala and a human Reproduce hippocampus cDNA bank. Hereby the expression of the mRNA is this Receptor clearly proven in these central nervous tissues. PCR with genomic DNA and these primers resulted in a band of identical size and by sequencing was clearly proven that the gene is intronless. Furthermore, through Homology search in databases of expressed sequence pieces of human genes (EST = expressed sequence tags) an expressed sequence of 460 base pairs with 100% Identity to a sequence piece of the untranslated 3 'area (items 2719 to 3179) of the Gene can be identified. This EST (AI 199 539) comes from a human anaplastic Oligodendroglioma. This also proves that this sequence area (2719-3179) is contained on the mRNA of the receptor. The end of this EST is 11 bases the polyadenylation signal we identified in pos. 3190-3195.  

The amino acid sequence of the receptor derived from the cDNA sequence is 419 Amino acids long. Hydrophobicity analysis of the amino acid sequence gives a putative Secondary structure of the protein as an integral membrane protein with 6 to 8 transmembrane Domains (depending on which software is used). The protein contains three potential N-glycosylation sites in the N-terminal region (amino acid positions 16, 28 and 62). Furthermore, there are four potential protein kinase C in the amino acid sequence Contain phosphorylation sites (amino acid positions 144, 268, 389 and 400), their optional phosphorylation (if they are located intracellularly) on the modulation of the Receptor function may be involved. Located at position 278 of the amino acid sequence a potential casein kinase II phosphorylation site. Potential N-myristoylation sites are in amino acid positions 13, 264 and 282.

Classification and potential functions of the receptor to be patented and its Gene (or cDNA; mRNA)

The receptor most likely belongs to the large gene amile of G protein-coupled Receptors (GPCRs). Within this large family it belongs to the sub-family of "Class A Rhodopsin-like "receptors. It has high homology to receptors for Lysophosphatidic acid (LPA), which is why we give this human receptor the short name Give "hLPALR1" (human lysophosphatidic acid like receptor 1).

Expression of hLPALR1 in human tissues

Using PCR and suitable cDNA banks, we were able to demonstrate that the "hLPALR1" in human hippocampus and amygdala. In addition, he is in human Oligodendroglioma expressed (sequence areas can be found in EST AI 199 539). The Occurrence in the central nervous system and CNS tumors suggests a presumably important one Role of "hLPALR1" in the regulation of neuronal growth and differentiation and / or glial cells. Since LPA also participates in the activation of platelets and Endothelial cells (where LPA can trigger increased synthesis of endothelin) is involved, the "hLPALR1" may also play a role in the pathogenesis of the Atherosclerosis too. The "hLPALR1" may also be more specific in the pathogenesis Kidney diseases involved (LPA-mediated effects on mesangial cells).

The "hLPALR1" may also have neuroprotective effects from LPA mediated.

"hLPALR1" could also play a role in the signal transduction of immunocompetent cells (LPA is a growth factor for human B lymphocytes and binds to neutrophils and T cells). Lysophosphatidic acid receptors and probably also the hLPALR1 are also involved in the neurotransmitter release. Previously known lysophosphatidic acid effects (which are mediated via LPA receptors) can be summarized as follows: participation in development and differentiation processes; Wound healing; Tissue regeneration; Growth stimulation; Suppression of apoptosis (programmed cell death); Contraction; Secretion; Adhesion; Chemotaxis; Cerebral microcirculation; Maturation of human egg cells and thus fertility.

Claims (16)

1. This patent is intended to cover the following data, techniques and applications and developments:
the gene shown including the 5 'and 3' untranslated region. 2. Transcription factors, RNA polymerases and pharmaceuticals as well as chemicals that Affect gene expression in a positive or negative manner. 3. The messenger RNA, including that derived from the gene, transcribed Splice variants and isoforms. 4. The cDNA derived from the mRNA or from the intronless gene. 5. The protein derived or produced from the mRNA (or gene or cDNA). 6. Antibodies or antisera which are directed against one or more epitopes of the protein or against the whole protein. 7. Monoclonal antibodies or antisera against one or more epitopes of the Protein or against the whole protein. 8. Expression systems (eukaryotic cell lines, yeast cells, Xenopus oocytes, Baculovirus systems, bacterial expression systems) which contain the protein mentioned express (native or recombinant). 9. Ligand binding studies and screening assays on native or recombinant receptors or cells or cell membranes that contain this receptor. 10. Transgenic animals and knock out animals which have this receptor in modified density or do not express at all. 11. Methods of gene therapy which relate to this receptor or its gene or its extend mRNA (cDNA) and their development and application. 12. Sense and antisense oligonucleotides derived from this gene as well their application. 13. The diagnosis and treatment of diseases related to this receptor in direct or communicating indirectly. 14. Methods for diagnosing diseases associated with this receptor (or its gene, mRNA) are connected in a direct or indirect manner such. B. Hybridization techniques, sequencing, SSCP, RFLP, Northern blot, Southern blot, Western blot, expression arrays, antibodies, mutation analyzes. 15. Use of information to develop new drugs, compounds and Chemicals and the evaluation of existing pharmaceuticals, compounds and chemicals as well as to develop new technologies or evaluate existing technologies. 16. The patent should also extend to points 1 to 15 for modified proteins, and gene, cDNA and mRNA sequences (amino acid changes, base changes).