DE10142478A1

DE10142478A1 - New human gene P2Y34 and encoded G protein-coupled receptor, useful for treatment and diagnosis of receptor-associated diseases and for drug screening

Info

Publication number: DE10142478A1
Application number: DE2001142478
Authority: DE
Inventors: Michael Brues; Heinz Boenisch; Ivor Von Kuegelgen
Original assignee: Individual
Current assignee: Individual
Priority date: 2001-08-31
Filing date: 2001-08-31
Publication date: 2003-03-20

Abstract

A sequence (I) of 2580 bp, reproduced, that represents the human P2Y34 gene and its 5'- and 3'-untranslated regions, located on chromosome 1, is new. Independent claims are also included for the following: (1) Transcription factors, RNA polymerase, pharmaceuticals and chemcials that modulate expression of (I); (2) mRNA, including splice variants and isoforms, transcribed from (I); (3) cDNA derived from the mRNA of (2) or intronless genes; (4) Protein (II), derived or prepared from the mRNA, gene or cDNA, having a 336 amino acid (aa) sequence, reproduced; (5) Antibodies or antisera, optionally monoclonal, directed against one or more epitopes of (II) or the complete protein; (6) Expression system for producing native or recombinant (II); (7) Ligand-binding studies and screening assays using (II) or cells (or membranes) that contain (II); (8) Transgenic or knockout animals with altered levels of expression of (II), including no expression at all; (9) Methods of gene therapy based on (II), or its gene, mRNA or cDNA, including their development and use; (10) Sense and antisense oligonucleotides derived from (I) and their use; and (11) Diagnosis or therapy of diseases in which (II) is (in)directly implicated.

Description

Mit Hilfe der Aminosäuresequenz eines G Protein-gekoppelten Rezeptors wurde durch Homologiesuche in einer öffentlich zugänglichen Datenbank ein potentielles Gen für einen neuen G Protein-gekoppelten Rezeptor auf dem humanen Chromosom 1 identifiziert. Aus der Gensequenz wurden Oligonukleotide zur Amplifikation des potentiellen Rezeptorgens und dessen abgeleiteter cDNA (mRNA) Sequenz hergestellt und für die PCR-Amplifikation des Gens und der cDNA eingesetzt. Mittels dieser Primer konnte das intronlose Gen aus humaner genomischer DNA kloniert und sequenziert werden. Die cDNA konnte mit Primern welche die kodierende Region des Gens flankieren aus einer humanen Plazenta cDNA-Bank amplifiziert und kloniert werden. Wir haben dem neuen Rezeptor den Namen P2Y34 gegeben. Using the amino acid sequence of a G protein-coupled receptor, Homology search in a publicly accessible database a potential gene for one identified new G protein-coupled receptor on human chromosome 1. From the Gene sequences were used to amplify the potential receptor gene and oligonucleotides its derived cDNA (mRNA) sequence prepared and for the PCR amplification of the Gene and the cDNA used. By means of these primers, the intronless gene from human genomic DNA can be cloned and sequenced. The cDNA could with which primers the coding region of the gene flank from a human placenta cDNA library amplified and cloned. We have given the new receptor the name P2Y34.

Für die PCR wurden folgende Primer und Reaktionsbedingungen gewählt: 1. Amplifikation der cDNA aus einer humanen Plazenta cDNA-Bank sense Primer: 5' CAAGAAAACCTGACATAAATG 3'
antisense Primer: 5' GGGTTTTCCATTCAAAAGTC 3'
Temperaturprogramm: 94°C 1 min. 50°C 30 sec.; 72°C 2 min. 36 Zyklen; Gibco Taq- Polymerase und Gibco-Puffer mit 2 mM MgCl₂. 2. Für die Amplifikation des Gens aus humaner genomischer DNA sense Primer: 5' GCCTTGAACTCCTAGGCTCAAC 3'
antisense Primer: 5' TCAGCCTCCCAAAGTGCTGG 3'
Temperaturprogramm: 94°C 1 min. 60°C 30 sec.; 72°C 3 min; 32 Zyklen; Gibco Taq- Polymerase und Gibco-Puffer mit 2 mM MgCl₂.
The following primers and reaction conditions were selected for the PCR: 1. Amplification of the cDNA from a human placenta cDNA bank sense primer: 5 'CAAGAAAACCTGACATAAATG 3'
antisense primer: 5 'GGGTTTTCCATTCAAAAGTC 3'
Temperature program: 94 ° C 1 min. 50 ° C 30 sec .; 72 ° C 2 min. 36 cycles; Gibco Taq polymerase and Gibco buffer with 2 mM MgCl ₂ . 2. For the amplification of the gene from human genomic DNA sense primer: 5 'GCCTTGAACTCCTAGGCTCAAC 3'
antisense primer: 5 'TCAGCCTCCCAAAGTGCTGG 3'
Temperature program: 94 ° C 1 min. 60 ° C 30 sec .; 72 ° C 3 min; 32 cycles; Gibco Taq polymerase and Gibco buffer with 2 mM MgCl ₂ .

Das zu patentierende Gen erstreckt sich über 2580 Basen. Der kodierende Bereich des Gens (Pos. 1097 bis 2104) besteht aus einem offenem Leseraster von 1008 Basen und kodiert somit ein Protein von 336 Aminosäuren. Hydrophobizitätsanalyse der Aminosäuresequenz (Programm Tmpred: K. Hofmann & W. Stoffel (1993) TMbase - A database of membrane spanning proteins segments. Biol. Chem. Hoppe-Seyler 374, S. 166) ergibt, daß es sich um einen G Protein-gekoppelten Rezeptor mit sieben transmembranalen Domänen handelt, dessen N-Terminus höchstwahrscheinlich extrazellulär und dessen C-Terminus dann intrazellullär lokalisiert ist. Die Aminosäuresequenz des P2Y34 ist neu und bisher unbekannt und weist die beste Homologie (26% Identität; 43% Homologie) zum humanen P2-like G protein coupled receptor (Gi: 2695874) auf und er besitzt auch hohe Homologien zu anderen humanen P2Y, P2U und Nukleosid/Nukleotid-Rezeptoren, etwas schlechtere Homologien bestehen zu Somatostatin-, Opioid- und Thrombin-Rezeptoren. The gene to be patented extends over 2580 bases. The coding region of the gene (Pos. 1097 to 2104) consists of an open reading frame of 1008 bases and thus codes a protein of 336 amino acids. Hydrophobicity analysis of the amino acid sequence (Program Tmpred: K. Hofmann & W. Stoffel (1993) TMbase - A database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler 374, p. 166) shows that it is is a G protein-coupled receptor with seven transmembrane domains, its N-terminus is most likely extracellular and its C-terminus then is located intracellularly. The amino acid sequence of the P2Y34 is new and previously unknown and has the best homology (26% identity; 43% homology) to human P2-like G protein coupled receptor (Gi: 2695874) and it also has high homologies to others human P2Y, P2U and nucleoside / nucleotide receptors, somewhat poorer homologies exist to somatostatin, opioid and thrombin receptors.

Weiterhin gehören zu der zu patentierenden Sequenz 1096 Basen des 5' nichttranslatierten Bereichs des Gens, welche vermutlich den Promotor (mit typischen Promotorelementen wie TATA Box und CAP Signal und GC-Box im Bereich von Base 500-800) enthalten, sowie 476 Basen des 3' nichttranslatierten Bereichs des Gens, welche zwei typische Polyadenylierungssignale (AATAAA) (2× überlappend) in Position 2239 bis 2248 enthalten. Furthermore, the sequence to be patented includes 1096 bases of the 5 'untranslated Region of the gene which is believed to be the promoter (with typical promoter elements such as TATA box and CAP signal and GC box in the range of base 500-800) included, as well as 476 Bases of the 3 'untranslated region of the gene, which are two typical Polyadenylation signals (AATAAA) (2 × overlapping) included in position 2239 to 2248.

MBHBIK Recipe 1

2. Die Expression dieses Gens (bzw. des P2Y34-Rezeptors) wurde mittels Polymerasekettenreaktion (PCR) und Primern (siehe oben), welche die kodierende Region des Gens flankieren, nachgewiesen. Wir konnten so die volle kodierende cDNA (offenes Leseraster) dieses Rezeptors aus einer humanen Plazenta-cDNA Bank vervielfältigen. Hiermit ist die Expression der mRNA dieses Rezeptors in diesem humanen Gewebe eindeutig bewiesen. PCR mit genomischer DNA und diesen Primern ergab eine Bande von identischer Größe und durch Sequenzierung wurde eindeutig bewiesen, daß das Gen intronlos ist. Weiterhin konnte durch Homologiesuche in Datenbanken von exprimierten Sequenzstücken humaner Gene (EST = expressed sequence tags) ein EST (Acc. Nr. AA689585.1) mit 100%iger Identität zu einem Sequenzstück des nichttranslatierten 3' Bereichs (Pos. 2203 bis 2580) des Gens identifiziert werden. Dieser EST entstammt einer humanen B-Lymphozyten cDNA Bank. Hiermit ist weiterhin bewiesen, daß dieser Sequenzbereich (2127-2576) auf der mRNA des Rezeptors enthalten ist. Ein weiterer EST (Acc. Nr. BF335802.1) mit fast 100%iger Identität überlappt mit der kodierenden Region der P2Y34-Rezeptor mRNA(cDNA) und entspricht der Gensequenz von Pos. 1335 bis 1735. Dieser EST stammt aus einer humanen Colon cDNA-Bank. Somit ist bewiesen, dass der Rezeptor in Plazenta, in B- Lymphozyten und im Colon des Menschen exprimiert wird. Es ist natürlich möglich, dass der Rezeptor auch in anderen humanen Geweben vorkommt. 2. The expression of this gene (or the P2Y34 receptor) was determined using Polymerase chain reaction (PCR) and primers (see above), which encode the coding region of the Flanking gens, proven. We were able to use the full coding cDNA (open Reproduce the reading frame) of this receptor from a human placenta cDNA bank. Herewith the expression of the mRNA of this receptor is unique in this human tissue proven. PCR with genomic DNA and these primers resulted in a band of identical Size and sequencing clearly demonstrated that the gene is intronless. Furthermore, by homology search in databases of expressed sequence pieces human genes (EST = expressed sequence tags) with an EST (Acc. No. AA689585.1) 100% identity to a sequence piece of the untranslated 3 'area (item 2203 to 2580) of the gene. This EST comes from a human B lymphocyte cDNA bank. This also proves that this sequence area (2127-2576) on the mRNA of the receptor is contained. Another EST (Acc. No. BF335802.1) with almost 100% identity overlaps with the coding region of the P2Y34 receptor mRNA (cDNA) and corresponds to the gene sequence from pos. 1335 to 1735. This EST comes from a human colon cDNA library. It is thus proven that the receptor in placenta, in B- Lymphocytes and in the human colon is expressed. It is of course possible that the Receptor also occurs in other human tissues.

3. Die von der cDNA-Sequenz abgeleitete Aminosäuresequenz des Rezeptors ist 336 Aminosäuren lang. Hydrophobizitätsanalyse der Aminosäuresequenz ergibt eine putative Sekundärstruktur des Proteins als integrales Membranprotein mit wahrscheinlich sieben transmembranalen Domänen. Das Protein enthält zwei potentielle N-Glykosylierungstellen im N-terminalen Bereich (Aminosäure Positionen 3 und 4). Weiterhin sind in der Aminosäuresequenz drei potentielle Proteinkinase C Phosphorylierungsstellen (Aminosäure Positionen 246, 299, und 315) enthalten, deren fakultative Phosphorylierung (sofern sie intrazellulär lokalisiert sind) an der Modulation der Rezeptorfunktion beteiligt sein können. In den Positionen 126, 132, 175, 180, 236 und 302 der Aminosäuresequenz befinden sich sechs potentielle Caseinkinase II Phosphorylierungsstellen. 3. The receptor amino acid sequence derived from the cDNA sequence is 336 Amino acids long. Hydrophobicity analysis of the amino acid sequence gives a putative Secondary structure of the protein as an integral membrane protein with probably seven transmembrane domains. The protein contains two potential N-glycosylation sites in the N-terminal region (amino acid positions 3 and 4). Furthermore, in the Amino acid sequence three potential protein kinase C phosphorylation sites (amino acid Items 246, 299, and 315) contain their optional phosphorylation (if they are located intracellularly) can be involved in the modulation of the receptor function. In positions 126, 132, 175, 180, 236 and 302 of the amino acid sequence are six potential casein kinase II phosphorylation sites.

MBHBIK Recipe 1 4. Classification and potential functions of the receptor to be patented and its Gene (or cDNA; mRNA)

Der Rezeptor gehört zur großen Genfamile der G-Protein-gekoppelten Rezeptoren (GPCRs). Innerhalb dieser Großfamilie zählt er zur Sub-Famile der "Klasse A Rhodopsin-ähnlichen" Rezeptoren. Er besitzt hohe Homologie zu Purinozeptoren (insbesondere zu P2Y-artigen Rezeptoren), zu Somatostatin-Rezeporen, zu Opioid-Rezeptoren (besonders zum mu-Typ) und zu Thrombin-Rezeptoren. Aufgrund der Homologien, besonders in transmembranalen und funktionellen Domänen, ist es sehr wahrscheinlich, dass es sich um einen Nukleosid- /Nukleotid-Rezeptor handelt, der Wirkungen von Purin- und Pyrimidin-Nukleosiden- und Nukleotiden bzw. deren Zucker-Derivaten vermittelt. The receptor belongs to the large gene amile of G protein-coupled receptors (GPCRs). Within this extended family, he belongs to the sub-family of the "Class A rhodopsin-like" Receptors. It has high homology to purinoceptors (especially to P2Y-like ones Receptors), to somatostatin receptors, to opioid receptors (especially to the mu type) and to thrombin receptors. Because of the homologies, especially in transmembrane and functional domains, it is very likely that it is a nucleoside / Nucleotide receptor, the effects of purine and pyrimidine nucleosides and Nucleotides or their sugar derivatives mediated.

Die mRNA, welche den Rezeptor kodiert, wird zumindest in humaner Plazenta, in humanem Colon und in humanen B-Lymphozyten exprimiert. The mRNA encoding the receptor is at least in human placenta, in human Colon and expressed in human B lymphocytes.

Da alle bisher klonierten P2Y-Rezeptoren von Säugern ihre Zellantwort über G-Proteine an die Proteinkinase C (PKC) und/oder die Adenylatzyklase koppeln, dürfte dies auch auch auf den P2Y34-Rezeptor zutreffen. Weitere Signaltransduktionswege wie eine direkte Beeinflussung von Ionenkanal-Leitfähigkeiten sind wahrscheinlich. P2-Rezeptoren findet man auf vielen Zelltypen des Blutes, wo sie an multiplen Regulationen, welche noch nicht alle im Detail bekannt sind, beteiligt sind (Literatur: z. B. Di Virgilio et al. (2001), Blood 97: 587- 600). P2-Rezeptoren finden sich u. a. auf Monozyten, Makrophagen, Lymphozyten (B-Zellen und T-Zellen), dendritischen Zellen, Blutplättchen, Granulozyten, Erythrozyten und auf Vorläuferzellen der blutbildenden Knochenmarkszellen. P2-Rezeptoren sind hier beteiligt an Vorgängen der Aktivierung/Hemmung der Proliferation und Differenzierung, an Abwehrreaktionen, Entzündung, Immunität, Plättchenaggregation, Regulation der Membranpermeabilität, chemotaktischen Reaktionen und cytotoxischen Reaktionen. Weiterhin findet man P2-Rezeptoren auf Zellen der glatten Muskulatur, wo sie eine Kontraktion oder Dilatation bewirken können. Der P2Y34-Rezeptor welchen wir zumindest auf B-Lymphozyten, im Dickdarm und in der Plazenta identifizieren konnten, könnte somit eine Rolle bei den obengenannten Reaktionen wie z. B. Regulation/Differenzierung von Immunreaktionen und Zellen des Immunsystems; Beteiligung an der Regulation der Kontraktion der glatten Muskulatur von Blutgefässen und des Darms (z. B. durch NO- Freisetzung eine Dilatation), Durchblutung und Immunreaktionen in der Plazenta beteiligt sein. Since all mammalian P2Y receptors cloned to date, their cell response via G proteins the protein kinase C (PKC) and / or the adenylate cyclase couple, this should also on apply the P2Y34 receptor. More signal transduction pathways like a direct one Influencing ion channel conductivities is likely. P2 receptors are found on many cell types of the blood, where they are subject to multiple regulations, which are not yet all Are known in detail, are involved (literature: e.g. Di Virgilio et al. (2001), Blood 97: 587- 600). P2 receptors can be found. a. on monocytes, macrophages, lymphocytes (B cells and T cells), dendritic cells, platelets, granulocytes, erythrocytes and on Progenitor cells of the blood-forming bone marrow cells. P2 receptors are involved in this Processes of activation / inhibition of proliferation and differentiation Defense reactions, inflammation, immunity, platelet aggregation, regulation of Membrane permeability, chemotactic reactions and cytotoxic reactions. Furthermore, P2 receptors are found on smooth muscle cells, where they are Can cause contraction or dilation. The P2Y34 receptor which we at least on B lymphocytes, in the large intestine and in the placenta a role in the above reactions such. B. Regulation / differentiation of Immune responses and immune system cells; Participation in the regulation of Contraction of the smooth muscles of blood vessels and the intestine (e.g. through NO Release of a dilation), blood flow and immune reactions in the placenta are involved his.

Der P2Y34-Rezeptor dürfte daher eine physiologische und pathophysiologische Rolle bei der Regulation der Darmfunktion, des Blutdrucks, der Durchblutung von Organen oder Körperregionen (z. B. Herz, Niere, Darm, Corpus cavernosum) spielen. Das Vorkommen von P2Y-Rezeptoren auf dentritischen Zellen, T-Zellen und Thrombozyten und hämatopoetischen Zellen spricht dafür, daß dem P2Y34-Rezeptor auch bei der Funktion dieser Zellen eine Rolle zukommt (z. B. bei Blutgerinnung, Hämatopoese, Immunreaktionen). P2Y-Rezeptoren (und damit möglicherweise auch der P2Y34-Rezeptor) sind an der Freisetzung von Interleukinen (z. B. IL-6, IL-8) und Prostaglandinen beteiligt, d. h. der "P2Y34-Rezeptor könnte auch darüber an Entzündungsprozessen beteiligt sein. Auch an Zellen des Nervensystems (z. B. Schwann- Zellen) und ZNS wurden P2Y-Rezeptoren nachgewiesen, weshalb dem P2Y34-Rezeptor eine bisher noch nicht erkannte Rolle in der Modulation von Neuronenfunktionen zukommen dürfte. Darüberhinaus sind allgemein an vielen Zellsystemen Effekte auf Zellwachstum und Zelldifferenzierung zu erwarten. The P2Y34 receptor should therefore have a physiological and pathophysiological role in Regulation of bowel function, blood pressure, blood flow to organs or Play body regions (e.g. heart, kidney, intestine, corpus cavernosum). The occurrence of P2Y receptors on dentritic cells, T cells and platelets and hematopoietic Cells suggests that the P2Y34 receptor also plays a role in the function of these cells occurs (e.g. with blood clotting, hematopoiesis, immune reactions). P2Y receptors (and thus possibly also the P2Y34 receptor) are involved in the release of interleukins (e.g. IL-6, IL-8) and prostaglandins involved, i.e. H. the "P2Y34 receptor could also do this be involved in inflammatory processes. Also on cells of the nervous system (e.g. Schwann Cells) and CNS, P2Y receptors were detected, which is why the P2Y34 receptor not yet recognized role in the modulation of neuron functions likely. In addition, effects on cell growth and are common to many cell systems Cell differentiation to be expected.

MBHBIK Recipe 1 Applications of the invention

Die klonierte cDNA welche den P2Y34-Rezeptor kodiert, kann in einem geeigneten Expressionsvektor, (z. B. in einen eukaryotischen Expressionsvektor kloniert, oder durch ein virales Expressionssystem) in verschiedenen Zell-Systemen (z. B. eukaryotischen Zellen, Xenopus Oocyten, Hefen etc.) exprimiert werden, sodass der Rezeptor als integrales Membranprotein in der Plasmamembran vorhanden ist. Solche Zellmembranen oder auch ganze Zellen können genutzt werden um Liganden (Agonisten und Antagonisten) welche bekannte oder neu-entwickelte Verbindungen (potentielle neue Pharmaka) sein können, zu testen bzw. zu entwickeln (z. B. durch Bindungsstudien mit Radioliganden oder durch funktionelle Assays wie z. B. cAMP- und Inositolphosphat-Bestimmung, Messung der intrazellulären Ca²⁺ Konzentration (z. B. mit Fura-2 etc.) und andere Methoden (z. B. Methoden zum "high throughput screening"). The cloned cDNA encoding the P2Y34 receptor can be cloned in a suitable expression vector (e.g., cloned into a eukaryotic expression vector, or through a viral expression system) in various cell systems (e.g. eukaryotic cells, Xenopus oocytes, yeasts) etc.) are expressed so that the receptor is present as an integral membrane protein in the plasma membrane. Such cell membranes or whole cells can be used to test or develop ligands (agonists and antagonists) which may be known or newly developed compounds (potential new pharmaceuticals) (e.g. by binding studies with radioligands or by functional assays such as cAMP and inositol phosphate determination, measurement of the intracellular Ca ²⁺ concentration (e.g. with Fura-2 etc.) and other methods (e.g. methods for "high throughput screening").

Weiterhin kann die Aminosäuresequenz zur Generierung von 3-D Modellen und damit zur Computer-unterstützten Entwicklung von neuen Liganden, welche Pharmaka sein können, eingesetzt werden. Furthermore, the amino acid sequence can be used to generate 3-D models and thus Computer-aided development of new ligands, which can be pharmaceuticals be used.

Die Kenntnis der Gensequenz, cDNA (mRNA-)-Sequenz und der Aminosäuresequenz kann genutzt werden, um Krankheiten (durch genetische Mutation), welche mit einer erhöhten, verminderten oder fehlenden Expression des Rezeptors in Verbindung stehen, zu diagnostizieren und zu therapieren. Es können Antiseren oder monoklonale Antikörper gegen verschiedene Epitope des Rezeptorproteins bzw synthetische Peptide welche von der Aminosäuresequenz abgeleitet wurden hergestellt werden. Diese können zur Diagnose (z. B. durch ELISA an z. B. Blutzellen) und Therapie eingesetzt werden. Es können Antisense- Oligonukleotide von der mRNA-Sequenz abgeleitet werden, welche nach Applikation zu einer down-Regulation der Rezeptordichte führen. Diese down-Regulation kann z. B. im Tiermodell (z. B. Maus) zur Identifizierung von Krankheiten, welche mit einer verminderten oder fehlenden (knock out Maus) Expression des Rezeptors in Zusammenhang stehen, genutzt werden. DNA- oder RNA-Sonden können für in situ-Hybridisierungen, Northern-Blots, Southern-Blots abgeleitet und zu diagnostischen Zwecken (bei Krankheiten oder vor und nach einer Therapie) aber auch zur Identifizierung aller Gewebe/Zellen, welche diesen Rezeptor exprimieren genutzt werden. Knowledge of the gene sequence, cDNA (mRNA) sequence and the amino acid sequence can can be used to treat diseases (caused by genetic mutation) that reduced or absent expression of the receptor diagnose and treat. Antisera or monoclonal antibodies against different epitopes of the receptor protein or synthetic peptides derived from the Amino acid sequence derived were prepared. These can be used for diagnosis (e.g. by ELISA to e.g. B. blood cells) and therapy are used. Antisense Oligonucleotides are derived from the mRNA sequence, which after application lead to a down regulation of the receptor density. This down regulation can e.g. B. in Animal model (e.g. mouse) for the identification of diseases with a diminished or missing (knock out mouse) expression of the receptor are used become. DNA or RNA probes can be used for in situ hybridizations, Northern blots, Southern blots derived and for diagnostic purposes (for diseases or before and after therapy) but also for the identification of all tissues / cells which have this receptor express can be used.

Die Kenntnis der Promotorsequenz kann genutzt werden um (z. B. in Reportergen-assays) Substanzen zu identifizieren welche die Expression des Gens in positiver oder negativer Richtung beeinflussen. MBHBIK-Rezept-1 Aminosäuresequenz

MBHBIK-Rezept-1 P2Y34-Gensequenz

MBHBIK-Rezept-1 cDNA-Sequenz

Knowledge of the promoter sequence can be used to identify substances (e.g. in reporter gene assays) which influence the expression of the gene in a positive or negative direction. MBHBIK recipe-1 amino acid sequence

MBHBIK-Recipe-1 P2Y34 gene sequence

MBHBIK recipe-1 cDNA sequence

Claims

1. The gene shown including the 5 'and 3' untranslated region and its Localization on human chromosome 1.

2. The use of information for the development of new pharmaceuticals, compounds and Chemicals and the evaluation of existing pharmaceuticals, compounds and chemicals as well as to develop new technologies or evaluate existing technologies.

3. Transcription factors, RNA polymerases and pharmaceuticals as well as chemicals that Affect gene expression in a positive or negative manner.

4. The messenger RNA transcribed from the gene, including those derived from it Splice variants and isoforms.

5. The cDNA derived from the mRNA or from the intronless gene.

6. The protein derived or produced from the mRNA (or gene or cDNA) and its amino acid sequence.

7. Antibodies or antisera which are directed against one or more epitopes of the protein or against the whole protein.

8. Monoclonal antibodies or antisera against one or more epitopes of the Protein or against the whole protein.

9. Expression systems (eukaryotic cell lines, yeast cells, Xenopus oocytes, Baculovirus systems, bacterial expression systems) which contain the protein mentioned express (native or recombinant).

10. Ligand binding studies and screening assays on native or recombinant receptors or cells or cell membranes that contain this receptor.

11. Transgenic animals and knock out animals which have this receptor in modified density or do not express at all.

12. Methods of gene therapy which relate to this receptor or its gene or its extend mRNA (cDNA) and their development and application.

13. Sense and antisense oligonucleotides derived from this gene as well their application.

14. The diagnosis and treatment of diseases related to this receptor in direct or communicating indirectly.

15. Methods for diagnosing diseases associated with this receptor (or its gene, mRNA) are connected in a direct or indirect manner such. B. Hybridization techniques, sequencing, SSCP, RFLP, Northern blot, Southern blot, Western blot, expression arrays, antibodies, mutation analyzes.

16. The patent should also extend to points 1 to 15 for modified proteins, and gene, cDNA and mRNA sequences (amino acid changes, base changes).