DE10020073A1 - New human platelet-activating factor (PAF) receptor-3 gene, useful for diagnosis and treatment of PAF-related diseases - Google Patents

Abstract

The human platelet-activating factor (PAF) receptor-3 (PAFR-3) gene (I) with a fully defined sequence of 2245 base pairs as given in the specification, including 5' and 3'-untranslated regions, is new. Independent claims are also included for the following: (1) transcription factors, RNA polymerases, pharmaceuticals and chemicals that modify, positively or negatively, expression of (I); (2) mRNA transcribed from (I), including splice variants and isoforms; (3) cDNA derived from the mRNA, or the intronless version of (I); (4) protein (II), and its derived peptides, derived or produced from (I), its cDNA or mRNA; (5) (monoclonal) antibodies and antisera raised against (II) or one or more of its epitopes; (6) expression systems that produce natural or recombinant (II); (7) ligand-binding studies and screening assays on native or recombinant receptors, or cells or cell membranes that contain them; (8) transgenic and knockout animals which express (II), or their splice variants, at altered levels or not at all; (9) gene therapy methods (and their development or use) based on (II) and the corresponding gene, mRNA or cDNA; (10) (anti)sense oligonucleotides derived from (I) and their use; and (11) diagnosis and treatment of diseases that are (in)directly associated with (II). In all cases, the protein, gene, mRNA or cDNA can be modified, e.g., by amino acid or base exchanges.

Description

Using the amino acid sequence of a G protein-coupled receptor, Homology search in a database for a gene for a new G protein-coupled receptor identified on human chromosome 3. The gene sequence became oligonucleotides for amplification of the receptor gene and its derived cDNA (mRNA) sequence prepared and for the PCR amplification of the gene (coding region) and the cDNA used. Using this primer, the intronless gene could be made from human genomic DNA cloned and sequenced and the cDNA could be extracted from a human brain cDNA Bank cloned, which demonstrates the expression of the gene in human brain.

The gene to be patented spans 2245 bases. The coding area of the gene (Pos. 467 to 1492) consists of an open reading frame of 1026 bases and thus codes a protein of 342 amino acids. Hydrophobicity analysis of the amino acid sequence reveals that it is a G protein-coupled receptor with seven transmembrane domains acts. The amino acid sequence is new and previously unknown and shows the best homology to the "leukocyte platelet activating factor receptor" (PAFR), which is based on chromosome 1 is located on (see e.g. Kunz et al. 1992; J. Biol. Chem. 267, 9101-9106, 1992). PAFR3 has a 50% amino acid homology to PAFR.

Furthermore, the sequence to be patented includes 466 bases of the 5 'untranslated Area of the gene which is believed to be involved in the regulation of gene expression (Promoter), as well as 753 bases of the 3 'untranslated region of the gene which is a typical Contain polyadenylation signals at the 3 'end.

We have given the receptor the name "PAFR3".

2. The expression of this gene was determined by means of polymerase chain reaction (PCR) and primers (sense: 5 'CTAGGTAACCAACAAGAAATG 3'; antisense: 5 ' GCTTTAACGAGTTCTGAACAC 3 '), which is the coding region of the PAFR3 gene flank, proven. The following temperature program for the PCR was used used: 94 ° C 1 min. 54 ° C 1 min. 72 ° C 3 min. 35 cycles. We were able to do the full coding cDNA (open reading frame) of the PAFR2 receptor from a human brain Duplicate cDNA Bank. This is the expression of the mRNA of this receptor in this Fabric clearly proven. PCR with genomic DNA and these primers resulted in a band of identical size and by sequencing, it was clearly demonstrated that the gene is intronless. Furthermore, homology searches in databases of expressed Sequence pieces of human genes (EST = expressed sequence tags) with expressed sequences almost 100% homology from human embryonic brain and from spleen and brain of Mouse to be identified.  

3. The amino acid sequence of the PAFR3 receptor derived from the cDNA sequence is 342 Amino acids long. Hydrophobicity analysis of the amino acid sequence gives a putative Secondary structure of the protein as an integral membrane protein with seven transmembrane Domains. The protein contains two potential N-glycosylation sites in the amino acid position 6 and 13. Furthermore, there are three potential protein kinase C in the amino acid sequence Phosphorylation sites (amino acid positions 126, 163 and 304) and one Phosphorylation site for the cAMP = and cGMP-dependent protein kinase (Amino acid position 176), the optional phosphorylation of which modulates the Receptor function may be involved.

4. Classification and potential functions of the patented PAFR3 receptor and its gene (or cDNA; mRNA):
The receptor belongs to the large gene family of the G protein-coupled receptors (GPCRs). Within this extended family it belongs to the sub-family of the "class A rhodopsin-like" receptors. It has the highest homology to the platelet activating factor receptor (PAFR) and homology to the angiotensin II receptor (AT 1). It is most likely that the receptor is a new platelet activating factor (PAF) receptor, a potent phospholipid mediator that is released by a variety of different cells (including basophilic leukocytes, macrophages, platelets and endothelial cells) and mediates its physiological effects via G protein-coupled receptors. PAF is involved in a variety of physiological and pathophysiological processes, only a few of which are mentioned here: platelet activation, drop in blood pressure, increased vascular permeability, bronchoconstriction, development of thrombosis, inflammatory and immunological reactions, heart disease (coronary artery constriction), in the CNS: long-term -Potentiation (long-term memory) and neuronal differentiation; post-ischemic vasospasm; Reduction of gastric mucosal blood flow in Helicobacter pylori infection; endothelial cell motility and neoangiogenesis, anaphylactic shock and septic shock. Antagonists at the well-known PAF receptor (PAFR) are currently in clinical studies on shock therapy and pancreatitis. There are numerous references from the literature that the physiological effects of PAF must be mediated via more than one receptor. The PAFR3 to be patented here represents a new PAF receptor, which presumably can mediate some of the previously lacking physiological / pathophysiological effects of PAF. New antagonists (or agonists) that specifically attack the PAFR should be valuable new drugs. PAFR antagonists that are already available probably have affinity for the new PAFR2 due to the very high amino acid identity of the two receptors. Due to the homologies, the PAFR3 could also have affinity for angiotensin-II and therapeutically used angiotensin-II receptor antagonists (AT1 receptor antagonists), which are used for the treatment of high blood pressure.

MBHB Recipe-12: PAFR3 gene sequence

MBHB Recipe-12: PAFR3 cDNA

MBHB Recipe-12: PAFR3 amino acid sequence

Claims (17)

This patent is intended to cover the following data, techniques and applications Developments: 1. The gene shown including the 5 'and 3' untranslated region and the finding, that the PAFR3 receptor gene is located on chromosome 3. Procedure for Identification and therapy of genetic diseases associated with this gene are connected. 2. Transcription factors, RNA polymerases and pharmaceuticals as well as chemicals that Affect expression of the gene in a positive or negative manner. 3. The messenger RNA transcribed from the gene, including that derived from it Splice variants and isoforms. 4. The cDNA derived from the mRNA or from the intronless gene. 5. The protein derived or produced from the mRNA (or the gene or the cDNA), and peptides derived therefrom. 6. Antibodies or antisera which act against one or more epitopes of the protein or against the whole protein. 7. Monoclonal antibodies or antisera against single or multiple epitopes of the Protein or against the whole protein. 8. Expression systems (eukaryotic cell lines, yeast cells, Xenopus oocytes, insect cells, Baculovirus systems, bacterial expression systems) which contain the protein mentioned express (native or recombinant). 9. Ligand binding studies and screening assays on native or recombinant receptors or cells or cell membranes that contain this receptor. 10. Transgenic animals and knock-out animals, which these (or the corresponding Species variant) Express receptor in changed density or not at all. 11. Methods of gene therapy which relate to this receptor or its gene or its extend mRNA (cDNA) and their development and application. 12. Sense and antisense oligonucleotides derived from this gene as well their application. 13. The diagnosis and treatment of diseases (using pharmaceuticals or other methods) that are directly or indirectly associated with this receptor. 14. Methods for diagnosing diseases associated with this receptor (or its gene, mRNA) are connected in a direct or indirect manner such. B. Hybridization techniques, sequencing, SSCP, RFLP, Northern blot, Southern blot, Western blot, expression arrays, antibodies, mutation analyzes. 15. The use of the information or the expressed receptor to develop new ones Pharmaceuticals, compounds and chemicals and the evaluation of existing ones Pharmaceuticals, compounds and chemicals as well as for the development of new technologies or evaluation of existing technologies. 16. The patent should also extend to points 1 to 15 for modified proteins, and genes, cDNA and mRNA sequences (amino acid changes, base changes).