DD289560A5

DD289560A5 - METHOD FOR PRODUCING CREATINAMIDINE HYDROLASE

Info

Publication number: DD289560A5
Application number: DD88315632A
Authority: DD
Inventors: Guenther Schumacher; Peter Buckel
Original assignee: Boehringer Mannheim Gmbh,De
Priority date: 1987-05-12
Filing date: 1988-05-10
Publication date: 1991-05-02
Also published as: SU1731066A3; UA12993A; ZA883324B

Abstract

Die Erfindung betrifft ein Verfahren zur Herstellung einer neuen Creatinamidinohydrolase, bei der in Position 109 der Aminosaeuresequenz des Wildtypenzyms Alanin durch Valin ersetzt ist und gegebenenfalls zusaetzlich eine oder mehrere weitere Aminosaeuren des Wildtypenzyms mutiert sind, ist stabiler als das Wildtypenzym und daher fuer Reagentien besser geeignet. Zur ihrer Herstellung bringt man nach bekannten, gentechnologischen Methoden in einem geeigneten Expressionssystem eine rekombinante DNA zur Expression, welche ein Creatinamidinohydrolasegen enthaelt, das in Position 326 des natuerlichen Gens anstelle von C das Desoxyribonukleotid T enthaelt.{Herstellungsverfahren; neue Creatinamidinohydrolase; stabiler als Wildtypenzym; Expressionssystem}The invention relates to a process for the preparation of a novel creatinamidinohydrolase, in which position 109 of the amino acid sequence of the wild-type enzyme alanine is replaced by valine and, if appropriate, one or more further amino acids of the wild-type enzyme are mutated, is more stable than the wild-type enzyme and therefore more suitable for reagents. For their preparation, a recombinant DNA for expression, which contains a creatinamidinohydrolase gene which contains the deoxyribonucleotide T in position 326 of the natural gene instead of C, is prepared by known genetic engineering methods in a suitable expression system. new creatinamidinohydrolase; more stable than wild-type enzyme; Expression system}

Description

Anwendungsgebiet der ErfindungField of application of the invention

Die Erfindung betrifft ein Verfahren zur Herstellung von Creatinamidinohydrolase.The invention relates to a method for the production of Creatinamidinohydrolase.

Die Erfindung betrifft weiter Mutanten der Creatinamidinohydrolase, welche stabiler sind als das Wildtypenzym, und deshalb besser zur enzymatischen Bestimmung des Creatiningehalts im Serum, Plasma oder Harn geeignet sind.The invention further relates to mutants of creatinamidinohydrolase, which are more stable than the wild-type enzyme, and are therefore more suitable for the enzymatic determination of creatinine content in serum, plasma or urine.

Characteristic of the prior art 1er technology

Das Enzym Creatinamidinohydrolase EC 3.5.3.3. findet industriell Anwendung zur Creatininbestimmung. Es wird u. a. in der klinischen Analytik für die Diagnose von Nierenerkrankungen verwendet, bei welchen im Serum oder Urin Creatiningehalte auftreten, die von denen des gesunden Organismus abweichen. Es sind Mikroorganismen bekannt, wie beispielsweise Pseudomonas-Arten, welche unter Induktion durch Creatin in der Lage sind, Creatinamidinohydrolase in einer die Aufarbeitung lohnenden Menge herzustellen, jedoch stellen die erzielbaren Ausbeuten und die Kosten der Isolierung des Enzyms immer noch einen limitierenden Faktor für die industrielle Anwendung des Enzyms dar. Wie in der deutschen Offenlegungsschrift 3500184 beschrieben ist, ist es gelungen, das für die Creatinamidinohydrolase kodierende Gbn aus Pseudomonas putida zu isolieren und beispielsweise in das Plasmid pBR322 einzubringen. Nach Transformation jines Mikroorganismus der Gattung E. coli oder Pseudomonas putida ist es möglich, aus diesen konstitutiv Creatinamidinohydrolase zu gewinnen. Diese gentechnologische Herstellung der Creatinamidinohydrolase ist effektiver und leichter durchzuführen als die Isolierung aus einem induzierten, kein Plasmid enthaltenden Mikroorganismus. Dieses Verfahren hat jedoch den Nachteil, daß das daraus gewonnene Wildtypenzym nur beschränkte Detergenz- und thermische Stabilität aufweist und somit für den Einsatz im klinischen Testverfahren nicht optimal geeignet ist.The enzyme creatinamidinohydrolase EC 3.5.3.3. finds industrial application for creatinine determination. It is used, inter alia, in clinical analysis for the diagnosis of kidney disease, in which arise in the serum or urine creatinine levels that differ from those of the healthy organism. Microorganisms are known, such as Pseudomonas species, which, when induced by creatine, are capable of producing creatinamidinohydrolase in a workup-worthful amount, however, the recoverable yields and the cost of isolating the enzyme are still a limiting factor for the industrial Application of the enzyme. As described in German Offenlegungsschrift 3,500,184, it has been possible to isolate the Gbn from Pseudomonas putida coding for creatinamidinohydrolase and to introduce it, for example, into the plasmid pBR322. After transformation of the microorganism of the genus E. coli or Pseudomonas putida, it is possible to obtain constitutively creatinamidinohydrolase from these. This genetic engineering of Creatinamidinohydrolase is more effective and easier to carry out than the isolation from an induced, no plasmid-containing microorganism. However, this method has the disadvantage that the wild-type enzyme obtained therefrom has only limited detergent and thermal stability and is therefore not optimally suitable for use in the clinical test procedure.

Mit der Erfindung wird ein Verfahren zur Herstellung von Creatinamidinohydrolase bereitgestellt, die stabiler ist als das Wildtypenzym und daher für Reagentien lie&mr geeignet ist.The invention provides a method for the production of creatinamidinohydrolase that is more stable than the wild-type enzyme and therefore suitable for reagents.

Darlegung des Wesens der ErfindungExplanation of the essence of the invention

Aufgabe der vorliegenden Erfindung ist es, Creatinamidinohydrolase-Mutanten bereitzustellen, welche die geschilderten Nachteile des Standes der Technik nicht oder nur in geringerem Maße aufweisen. Erfindungsgemäß wird diese Aufgabe gelöst durch Creatinamidinohydrolase-Mutanten, welche die ReaktionThe object of the present invention is to provide creatinamidinohydrolase mutants which do not or only to a minor extent have the disadvantages of the prior art described. According to the invention, this object is achieved by Creatinamidinohydrolase mutants which the reaction

Creatin + H2O —»Sarcosin + HarnstoffCreatine + H2O - »sarcosine + urea

entsprechend dem Wildtypenzym katalysieren, und dadurch gekennzeichnet sind, daß gegenüber dem Wildtypenzym mindestens ein Aminosäureaustausch an der Position 109 stattgefunden hat. Dieser Austausch beuifft die Aminosäure Alanin, die durch Valin ersetzt wurde. Das so mutierte Enzym besitzt eine weit bessere Stabilität als das Wildtypenzym. Abgesehen von diesem Aminosäureaustausch können ohne Beeinträchtigung der enzymatischen Aktivität auch andere Mutationen auf Aminosäureebene vorliegen und dabei sogar eine noch höhere Stabilität erreicht werden. Ein bevorzugtes Enzym enthält außer dem Aminosäureaustausch an Position 109 einen weiteren Aminosäureaustausch. Weitere Gegenstände der Erfindung sind die Plasmide pBT109 und pBT119. Diese enthalten das Creatinamidinohydrolasegen des Wildtyps, wobei in beiden Plasmiden jedoch auf DNA-Ebene bereits der Aminosäureaustausch an der Position 109 des Enzyms und darüber hinaus bei pBT119 auch in einer weiteren Position, nämlich Position 355 in Form eines Wechsels von VaI nach Meth durch entsprechenden Austausch der im Wildtypgen diese Aminosäuren codierenden Tripletts festgelegt ist. Durch Sequenzierung von pBT119 wurde festgestellt, daß an Position 1063 der Sequenz im kodierenden Strang ein G durch A ersetzt ist (G —»A), so daß das Triplett GTG des Wildtyps in ATG umgewandelt ist. Ein bevorzugter Mikroorganismus der Gattung E. coli gemäß der Erfindung, E. coli, DSM 4105, enthält das Plasmid pBT109, ein weiterer bevorzugter Mikroorganismus E. coli, DSM 4106 enthält erfindungsgemäß das Plasmid pBT119. V. eitere bevorzugte Mikroorganismen sind erfindungsgemäß solche der Gattung E. coli oder Pseudomonas putida, welche konstitutiv eine Creatinamidinohydrolase, welche die genannten Mu'.ationen enthält, exprimieren.catalyze according to the wild-type enzyme, and characterized in that at least one amino acid substitution at position 109 has taken place relative to the wild-type enzyme. This replacement involves the amino acid alanine, which has been replaced by valine. The mutant enzyme has a much better stability than the wild-type enzyme. Apart from this amino acid exchange other mutations can be present at the amino acid level without affecting the enzymatic activity and thereby even an even higher stability can be achieved. A preferred enzyme contains, besides the amino acid substitution at position 109, a further amino acid exchange. Further objects of the invention are the plasmids pBT109 and pBT119. These contain the creatine amidinohydrolase gene of the wild type, but in both plasmids at the DNA level already the amino acid exchange at the position 109 of the enzyme and moreover at pBT119 in another position, namely position 355 in the form of a change from VaI to meth by appropriate exchange the triplets coding for these amino acids in the wild-type gene are fixed. By sequencing pBT119 it was found that at position 1063 of the sequence in the coding strand one G is replaced by A (G -> A), so that the wild-type triplet GTG is converted to ATG. A preferred microorganism of the genus E. coli according to the invention, E. coli, DSM 4105, contains the plasmid pBT109, another preferred microorganism E. coli, DSM 4106 contains according to the invention the plasmid pBT119. V. eitere preferred microorganisms according to the invention are those of the genus E. coli or Pseudomonas putida, which constitutively express a Creatinamidinohydrolase containing said Mu'.ationen.

Diu Herstellung der erfindungsgemäßen mutierten Enzyme erfolgt, indem man nach an sich bekannten gentechnologischen Methoden eine rekombinante DNA in einem «jeeigneten Expressionssyst ,m zur Expression bringt, welche ein Creatinamidinohydrolasegen enthält, welches die Sequenz des Wildtypgens im wesentlichen aufweist, aber mindestens in Position 326 des natürlichen Gens anstelle des Desoxyribonukleotids C ein T enthält. Vorzugsweise wird ein Gen exprimiort, bei dem außerdem an weiteren Positionen eine Base ausgetauscht wurde. Besonders bevorzugt liegt in Position 1063 anstelle von G ein A vor.The mutated enzymes according to the invention are prepared by expressing a recombinant DNA in a suitable expression system which contains a creatinamidinohydrolase gene which essentially has the sequence of the wild-type gene, but at least at position 326 of the art natural gene instead of the deoxyribonucleotide C contains a T. Preferably, a gene is expressed in which a base has also been exchanged at further positions. It is particularly preferable for position 1063 to have an A instead of G.

Bevorzugt wird als rekombinante DNA eines der Plasmide pBT109, DSM4108P oder pBT119, DSM4107P exprimiert. Als rekombinante DNA kann aber auch jegliche rekombinante DNA verwendet werden, welche die in der DE 35 00184 A1 offenbarte DNA-Sequenz für das Wildtypenzym, oder ein nach dem genetischen Code für die gleiche Aminosäuresequenz kodierendes Äquivalent davon enthält, wobei jedoch an der Position 326 des natürlichen Gens anstelle von C das Desoxyribonukleotid T enthalten ist. In einer solchen rekombinanten DNA kann zusätzlich ein weiterer Basenaustausch, der zu einer weiteren Aminosäuremutation im Enzym führt, enthalten sein. Vorzugsweise ist dabei in Position 1063G gegen A ausgetauscht. Als Expressionssystem wird ein Mikroorganismus der Gattung E. coii oder Pseudomonas putida bevorzugt. ^;itsonders bevorzugt verwendet man den Mikroorganismus E. coli ED 8654, DSM 2102 oder Pseudomonas putida, DSM 2106. Weitere erfindungsgemäße Herstellungsverfahren sind durch das Züchten der bevorzugten Mikroorganismen E. coli, DSM 4105 und C. coli, DSM 4106 gekennzeichnet.Preferably, one of the plasmids pBT109, DSM4108P or pBT119, DSM4107P is expressed as recombinant DNA. As recombinant DNA, however, any recombinant DNA can be used which contains the DNA sequence disclosed in DE 35 00184 A1 for the wild-type enzyme, or an equivalent thereof coding for the same amino acid sequence according to the genetic code, but at position 326 of the natural gene instead of C the deoxyribonucleotide T is included. In addition, such a recombinant DNA may contain a further base exchange which leads to a further amino acid mutation in the enzyme. Preferably, it is exchanged for A in position 1063G. As the expression system, a microorganism of the genus E. coli or Pseudomonas putida is preferred. ^; it is particularly preferred to use the microorganism E. coli ED 8654, DSM 2102 or Pseudomonas putida, DSM 2106. Further production methods according to the invention are characterized by the growth of the preferred microorganisms E. coli, DSM 4105 and C. coli, DSM 4106.

Ein weiterer Gegenstand der Erfindung ist die Verwendung der erfindungsgemäßen, mutierten Creatinamidinohydrolasen, welche stabiler als das Wildtypenzym sind, zur Bestimmung des Creatiningehalts im Serum, Plasma oder Harn. Untersuchungen der in der DE 3500184 A1 beschriebenen, klonierten Creatinamidinohydrolase haben ergeben, daß das Enzym den geschwindigkeitsbestirr menden Schritt in der ReaktionsabfolgeAnother object of the invention is the use of mutant Creatinamidinohydrolasen invention, which are more stable than the wild-type enzyme, for determining the Creatiningehalts in serum, plasma or urine. Investigations of the cloned creatine amidinohydrolase described in DE 3500184 A1 have shown that the enzyme is the rate-limiting step in the reaction sequence

Creatinamidino-Creatin + H₂O —— »Sarcosin + HarnstoffCreatinamidino-creatine + H ₂ O - »sarcosine + urea

katalysiert. Eine Steigerung der Geschwindigkeit des Substratumsatzes ist unter den als optimal erarbeiteten Bedingungen durch Erhöhung der Enzymmenge nicht zu erzielen. Unter Testbedingungen zur Bestimmung des Creatiningehalts im Serum, Plasma oder Harn bei 37⁰C weist das Enzym eine beschränkte Stabilität auf, was zu einer Verringerung des Substratumsatzes bei deroben erwähnten Temperaturführt. Die erfindungsgemäße Creatinamidinohydrolase, die eine Mutation der Aminosäure 109 des Wildtypenzyms von Alanin in Valin enthält, hat im Vergleich, unter verschiedenen Testbedingungen (Detergenzzusatz), bei ungefähr gleicher Ausgangsenzymaktivität bereits eine stark erhöhte Detergenzstabilitä», wie die in Tabelle I wiedergegebenen Vergleichsversuchsergebnisse zeigen. Das Temperaturverh'alten unter optimalen Bedingungen wird in Tab. Il dargestellt.catalyzed. An increase in the rate of substrate turnover can not be achieved under conditions which have been found to be optimal by increasing the amount of enzyme. Under test conditions for determining the Creatiningehalts in serum, plasma or urine at 37 ⁰ C, the enzyme has a limited stability, resulting in a reduction of the substrate conversion in the above-mentioned temperature results. The creatinamidinohydrolase according to the invention, which contains a mutation of the amino acid 109 of the wild-type enzyme of alanine in valine, already has a greatly increased detergent stability under comparable test conditions (detergent additive) with approximately the same starting enzyme activity, as the comparative test results reproduced in Table I show. The temperature behavior under optimal conditions is shown in Tab. II.

Table I Determining enzyme at 37 ⁰ C

ZeitTime Creatinpmidinohydrolase-Creatinpmidinohydrolase- Vergleichcomparison Wildtypwildtype Creatinamidinohydrolase-MutanteCreatineamidinohydrolase mutant gemäß Erfindungaccording to the invention 100%)100%) Testbedingungentest conditions (Minuten)(Minutes) (DE3500184A1)(DE3500184A1) (Aktivität(Activity (Aminosäure 109 = VaI)(Amino acid 109 = VaI) (Aktivität(Activity 100%)100%) (DSM 3143)(DSM 3143) (Restaktivität(Residual activity (DSM4105)(DSM4105) (Restaktivität =(Residual activity = 91%)91%) (Restaktivität(Residual activity (Restaktivität =(Residual activity = 83%)83%) OO 3,3 U/ml3.3 U / ml (Rostaktivität(Rust Activity = 100%)= 100%) 3,0 U/ml3.0 U / ml (Restaktivität =(Residual activity = 100%)100%) Testmixi ausTestmixi off II 1b1b 1,9 U/ml1.9 U / ml (Aktivität(Activity = 59%)= 59%) 3,0 U/ml3.0 U / ml (Aktivität(Activity 91 %)91%) Testkombinationtest combination 3030 0,6 U/ml0.6 U / ml (Restaktivität(Residual activity = 18%)= 18%) 2,7 U/ml2.7 U / ml (Restaktivität =(Residual activity = 91 %)91%) „Creatinin-PAP""Creatinine-PAP" 6060 0,2 U/ml0.2 U / ml (Rostaktivität(Rust Activity 6%)6%) 2,5 U/ml2.5 U / ml (Restaktivität =(Residual activity = 71 %)71%) (BMNr.839434)(BMNr.839434) 00 3,3 U/ml3.3 U / ml (Restaktivität(Residual activity = 100%)= 100%) 3,0 U/ml3.0 U / ml (Restaktivität =(Residual activity = in125mmol/lin125mmol / l IlIl 1515 0,7 U/ml0.7 U / ml = 21 %)= 21%) 2,7 U/ml2.7 U / ml Phosphatpufferphosphate buffer 3030 0,0 U/ml0.0 U / ml 0%)0%) 2,7 U/ml2.7 U / ml + Datergenz+ Datergence 6060 0,0 U/ml0.0 U / ml 0%)0%) 2,1 U/ml2.1 U / ml

Die Enzyme wurden unter den in der Tabelle angegebenen Bedingungen inkubiert und anschließend eine Enzymbestimmung unter Verwendung der Testkombination „Harnstoff (BM Best.-Nr. 124770) durchgeführt.The enzymes were incubated under the conditions given in the table and then enzyme determination was carried out using the test combination "urea (BM Order No. 124770).

tables

Enzymbestimmung unter optimalen Bedingungen bei verschiedenen Temperaturen Testbedingungen: 20mmol/l Phosphat-Puffer, pH 8,0Enzyme determination under optimal conditions at different temperatures Test conditions: 20 mmol / l phosphate buffer, pH 8.0

1. = Creatinamidinohydrolase-Wildtyp: 1,05mg Protein/ml (8,0U/mg)1. = Creatinamidinohydrolase wild type: 1.05 mg protein / ml (8.0 U / mg)

2. = Creatinamidinohydrolase-Mutar.te: 1,10 mg Protein/ml (8,7 U/mg) (Aminosäure 109 = VaI)2. = creatinamidinohydrolase mutant: 1.10 mg protein / ml (8.7 U / mg) (amino acid 109 = VaI)

Creatinasecreatinase Restaktivität in % (Inkubation in min) Residual activity in% (incubation in min) 6u6u 120120 2. (DSM 4105)2. (DSM 4105) 6060 120120 Temp.Temp. 1.(DSM 3143)1. (DSM 3143) 8686 8080 3434 9696 9090 3030 3636 1313 100100 7373 6363 37⁰C37 ⁰ C 100100 0,40.4 00 8484 22 00 42⁰C42 ⁰ C 5757 -- -- 4242 -- -- 47⁰C47 ⁰ C 11 33 52°C52 ° C 00

The enzymes are incubated under the specified test conditions and then subjected to an enzyme determination Use of the test combination "urea (BM Order No. 124770) performed. The creatine amidinohydrolase enzyme according to the invention, which in addition to this mutation yet another Amino acid mutation carries, with almost the same output enzyme activity even greater stability in comparison

zum Wildtypenzym (Beispiel 1, Tabelle III).to the wild-type enzyme (Example 1, Table III).

It is therefore possible with the Creatinamidinohydrolasemutanten invention, one by the detergent and Thermolability of the wild-type enzyme caused enzyme activity loss during Creatininbestimmung to avoid and such Provisions for longer periods than previously possible, reliably perform. Due to the improved Properties is also a reduction in the amount of enzyme in creatinine-to-stop possible. The following examples further illustrate the invention. embodiments example 1 Cells of E. coli DSM 4105, E. coli DSM 4106 and, for comparison, E. coli DSM 3143 (DE 3500184AI) were incubated overnight in Il fermenters dressed.

Mediummedium

Complete medium (yeast / peptone extract)

0,4% Glucose10")mmo!/l Phosphat-Puffer0.4% glucose10 ") mmo / l phosphate buffer

After centrifugation at 8.00 rpm for 15 minutes, the cells were disrupted in a French press and the Creatinamidinohydrolase purified by fractionation on a molecular sieve (Sephacryl S 200). The resulting enzymes were incubated under the conditions given in Tab. Ill and then a Enzyme determination using the test combination "urea" (BM Order No. 124770) performed. Table III gives the stability method of creatine amidinohydrolase mutants according to the invention in comparison to Wild-type enzyme (DE 3500184 A1 - E. coli DSM 3143) again. Stability at 37 ° C Test Conditions: Test Mix 1 from Test Combination "Creatinine-PAP" (BM Order No. 839434) Initial activity: 12 U / ml (= 100%) Creatinamidinohydrolase residual activity after

ausE.coli 15 30 45 60 minaus E.coli 15 30 45 60 min

(kodierendes Plasmid) (% der Ausgangsaktivität)(coding plasmid) (% of the starting activity)

'DSM 3143 (pBT2a-1 DSM 3148 P) 69 Ü 39 27'DSM 3143 (pBT2a-1 DSM 3148 P) 69 Ü 39 27

DSM 4105 (pBT 109 DSM 4108 P) 96 90 84 84 DSM4106 (pBT119DSM4107P) 102 102 102 102 Comparison of Michaelis constants (Km) at 37 ⁰ C Test conditions: 0.1 mol / l Tris-HCl, pH 8.0 (optimal test conditions) creatineamidinohydrolase

ausE.coliausE.coli

(kodierendes Plasmid) Km,mmol/I(encoding plasmid) Km, mmol / l

DSM3143 (pBT2a-1DSM3148P) 25 DSM 4105 (pBT 109 DSM 4108 P) 20 DSM 4106 (pBT 119 DSM 4107 P) 16 Example 2

Die stabile Creatinamidinohydrolasemutante aus dem Mikroorganismus E. coli, DSM 4105, der das Plasmid pBT 109 enthält, wurde aus einer 100-l-Fermentation, wie in der DE 3500184A1 beschrieben, isoliert. Es wurden 121g Protein mit einer spezifischen Aktivität von 10,4U/mg erhalten. Dies entspricht einer Ausbeute von 63%.The stable creatinamidinohydrolase mutant from the microorganism E. coli, DSM 4105, containing the plasmid pBT 109, was isolated from a 100 L fermentation as described in DE 3500184A1. 121g of protein with a specific activity of 10.4U / mg were obtained. This corresponds to a yield of 63%.

I0 30 50I0 30 50

ATGCAAATGCCCAAGACGCTCCGCATCCGTAACGGCGACAAGGTTCGCTCCACCTTCTCC MetGlnMetProLysThrLeiiArglleArgAsnGlyAspLysyalArgSerThrPheSerATGCAAATGCCCAAGACGCTCCGCATCCGTAACGGCGACAAGGTTCGCTCCACCTTCTCC MetGlnMetProLysThrLeiiArglleArgAsnGlyAspLysyalArgSerThrPheSer

70 90 II070 90 II0

6CCCAGGAATACGCCAATCGCCAAGCCAGGCTGCGCGCCCACCTGGCGGCGGAGAACATc AlaGlnGluTyrAlaAsnArgGlnAlaArgLeuArgAlaHisLeuAlaAlaGluAsnlIe6CCCAGGAATACGCCAATCGCCAAGCCAGGCTGCGCGCCCACCTGGCGGCGGAGAACATc AlaGlnGluTyrAlaAsnArgGlnAlaArgLeuArgAlaHisLeuAlaAlaGluAsnlIe

I30 I50 I70I30 I50 I70

GACGCCGCGATCTTCACCTCGTACCACAACATCAACTACTACTCCGACTTCCTCTACTGC AspAlaAlallePheThrSerTyrHisAsnlleAsnTyrTyrSerAspPheLeuTyrCysGACGCCGCGATCTTCACCTCGTACCACAACATCAACTACTACTCCGACTTCCTCTACTGC AspAlaAlallePheThrSerTyrHisAsnLAsAsnTyrTyrSerAspPheLeuTyrCys

I90 2I0 230I90 2I0 230

TCCTTCGGCCGCCCCTACGCGTTGGTGGTGACCCAGGACGACGTCATCAGCATCAGCGCC SerPheGlyArgProTyrAlaLeuValUalThrGlnAspAspVallleSerlleSerAlaTCCTTCGGCCGCCCCTACGCGTTGGTGGTGACCCAGGACGACGTCATCAGCATCAGCGCC SerPheGlyArgProTyrAlaLeuValUalThrGlnAspAspVallleSerlleSerAla

250 270 290250 270 290

AACATCGACGGCGGCCAGCCGTGGCGCCGCACCGTCGGCACCGACAACATCGTCTACACC AsnlleAspGlyGlyGlnProTrpArgArgThrValGlyThrAspAünlleyalTyrThrAACATCGACGGCGGCCAGCCGTGGCGCCGCACCGTCGGCACCGACAACATCGTCTACACC AsnlleAspGlyGlyGlnProTrpArgArgThrValGlyThrAspAünlleyalTyrThr

3I0 330 3503I0 330 350

gagtggcagcgcgataactacttcgtcgccatccagcaggcgttgccgaaggcccgccgc AspTrpGlnArgAspAsnTyrPheyalAlalleGlnGlnAlaLeuProLysAlaArgArggagtggcagcgcgataactacttcgtcgccatccagcaggcgttgccgaaggcccgccgc AspTrpGlnArgAspAsnTyrPheyalAlalleGlnGlnAlaLeuProLysAlaArgArg

370 390 4I0370 390 4I0

ATCGGCATCGAACATGACCACCTGAACCTGCAGAACCGCGACAAGCTGGCCGCGCGCTAT IIeGIyIIeGIuHisAspHisLeuAsnLeuGlnAsnArgAspLysLeuAlaAlaArgTyrATCGGCATCGAACATGACCACCTGAACCTGCAGAACCGCGACAAGCTGGCCGCGCGCTAT IIeGIyIIeGIuHisAspHisLeuAsnLeuGlnAsnArgAspLysLeuAlaAlaArgTyr

430 450 470430 450 470

CCGGACGCCGAGCTGGTGGACGTGGCCGCCGCCTGCATGCGTATGCGCATGATCAAATCC ProAspAlaGluLeuValAspUalAlaAlaAlaCysMetArgMetArgMetlleLysSerCCGGACGCCGAGCTGGTGGACGTGGCCGCCGCCTGCATGCGTATGCGCATGATCAAATCC ProAspAlaGluLeuValAspUalAlaAlaAlaCysMetArgMetArgMetLleSyser

490 5I0 530490 5I0 530

GCCGAAGAGCACGTGATGATCCGCCACGGCGCGCGCATCGCCGACATCGGTGGTGCGGCG AIaG)u&luHisUalMetIleArgHisGlyAlaArglleAlaAspIIeGIyGIyAIaAIaGCCGAAGAGCACGTGATGATCCGCCACGGCGCGCGCATCGCCGACATCGGTGGTGCGGCG AIaG) u & luHisUalMetIleArgHisGlyAlaArglleAlaAspIIeGIyAIaAIa

550 570 590550 570 590

GTGGTCGAAGCCCTGGGCGACCAGGTACCGGAATACGAAGTGGCGCTGCATGCCACCCAG ValUaiGluAlaLeuGlyAspGlnllalProGluTyrGluValAlaLeuHisAlaThrGlnGTGGTCGAAGCCCTGGGCGACCAGGTACCGGAATACGAAGTGGCGCTGCATGCCACCCAG ValUaiGluAlaLeuGlyAspGlnllalProGluTyrGluValAlaLeuHisAlaThrGln

610 630 650610 630 650

GCCATGGTCCGCGCCATTGCCGATACCTTCGAGGACGTGGAGCTGATGGATACCTGGACC AlaMetValArgAlalleAlaAspThrPheGluAspValGluLeuMetAspThrTrpThrGCCATGGTCCGCGCCATTGCCGATACCTTCGAGGACGTGGAGCTGATGGATACCTGGACC AlaMetValArgAlalleAlaAspThrPheGluAspValGluLeuMetAspThrTrpThr

670 690 710670 690 710

TGGTTCCAGTCCGGCATCAACACCGACGGCGCGCACAACCCGGTGACCACCCGCAAGGTG TrpPheGlnSerGlylleAsnThrAspGlyAlaHisAsnProValThrThrArgLysyalTGGTTCCAGTCCGGCATCAACACGACGGCGCGCACAACCCGGTGACCACCCGCAAGGTG TrpPheGlnSerGlylleAsnThrAspGlyAlaHisAsnProValThrThrArgLysyal

730 750 770730 750 770

AACAAGGGCGACATCCTCAGCCTCAACTGCTTCCCGATGATCGCCGGCTACTACACCGCG AsnLysGlyAspIleLeuSerLeuAsnCysPheProMetIIeAIaGlyTyrTyrThrAlaAACAAGGGCGACATCCTCAGCCTCAACTGCTTCCCGATGATCGCCGGCTACTACACCGCG AsnLysGlyAspIleLeuSerLeuAsnCysPheProMetIIeAIaGlyTyrTyrThrAla

790 810 830790 810 830

mGAGCGCACCCTGTTCCTCGACCACTGCTCGGACGACCACCTGCGTCTGTGGCAGGTC LeuGluArgThrLeuPheLeuAspHisCysSerAspAapHisLeuArgLeuTrpGlnValmGAGCGCACCCTGTTCCTCGACCACTGCTCGGACGACCACCTGCGTCTGTGGCAGGTC LeuGluArgThrLeuPheLeuAspHisCysSerAspAapHisLeuArgLeuTrpGlnVal

850 870 890850 870 890

AACGTCGAGGTGCATGAAGCCGGCCTGAAGCTGATCAAGCCCGGTGCGCGTTGCAGCGAT AsnValGluUalHisGluAlaGlyLeuLyaLeuIleLysProGlyAlaArgCysSerAspAACGTCGAGGTGCATGAAGCCGGCCTGAAGCTGATCAAGCCCGGTGCGCGTTGCAGCGAT AsnValGluUalHisGluAlaGlyLeuLyaLeuIleLysProGlyAlaArgCysSerAsp

910 930 950910 930 950

ATCGCCCGCGAGCTGAACGAGATCTTCCTCAAGCACGACGTGCTGCAGTACCGCACCTTC IleAlaArgGluLeuAsnGluIlePheLeuLysHisAspyalLeuGlnTyrArgThrPheATCGCCCGCGAGCTGAACGAGATCTTCCTCAAGCACGACGTGCTGCAGTACCGCACCTTC IleAlaArgGluLeuAsnGluIlePheLeuLysHisAspyalLeuGlnTyrArgThrPhe

970 990 1010970 990 1010

GGCTACGGCCACTCCTTCGGCACGCTCAGCCACTACTACGGCCGCGAGGCCGGGTTGGAA GlyTyrGlyHisSerPheGlyThrLeuSerHisTyrTyrGlyArgGluAlaGlyLeuGluGGCTACGGCCACTCCTTCGGCACGCTCAGCCACTACTACGGCCGCGAGGCCGGGTTGGAA GlyTyrGlyHisSerPheGlyThrLeuSerHisTyrTyrGlyArgGluAlaGlyLeuGlu

1030 1050 10701030 1050 1070

CTGCGCGAGGACATCGACACCGTGCTGGAGCCGGGCATGGTGGTGTCGATGGAGCCGATG LeuArgGluAsoIleAspThrUalLeuGluProGlyMetValValSerMetGluProMetCTGCGCGAGGACATCGACACCGTGCTGGAGCCGGGCATGGTGGTGTCGATGGAGCCGATG LeuArgGluAsoIleAspThrUalLeuGluProGlyMetValValSerMetGluProMet

1090 1110 11301090 1110 1130

ATCATGCTGCCGGAAGGCCTGCCGGGCGCCGGTGGCTATCGCGAGCACGACATCCTGATC IleMetLeuProGluGlyLeuProGlyAlaGlyGlyTyrArgGluHisAspIleLeuIleATCATGCTGCCGGAAGGCCTGCCGGGCGCCGGTGGCTATCGCGAGCACGACATCCTGATC IleMetLeuProGluGlyLeuProGlyAlaGlyGlyTyrArgGluHisAspIleLeuIle

1150 1170 11901150 1170 1190

6TCAACGAGAACGGTGCCGAGAACATCACCAAGTTCCCCTACGGCCCGGAGAAAaACATC ValAsnGluAsnGlyAlaGluAsnlleThrLysPheProTyrGlyProGluLysAsnlle6TCAACGAGAACGGTGCCGAGAACATCACCAAGTTCCCCTACGGCCCGGAGAAAaACATC ValAsnGluAsnGlyAlaGluAsnlleThrLysPheProTyrGlyProGluLysAsnlle

12101210

ATCCGCAAATGA IleArgLysEndATCCGCAAATGA IleArgLysEnd

Claims

A process for the preparation of a novel creatinamidinohydrolase which is the reaction

Crea'in + H ₂ O - »sarcosine + urea

catalysed, characterized in that one expresses a recombinant DNA according to known genetic engineering methods in a suitable expression systome containing a Creatinamidinohydrolasegen containing in position 326 of the natural gene instead of C, the Oesoxyribonukleotid T.

2. The method according to claim 1, characterized in that the recombinant DNA plasmid pBT109, DSM4108Pexpressed.

3. The method according to claim 1, characterized in that one contains a recombinant DNA which contains the sequence shown in Fig. 1 or an equivalent thereof coding for the same amino acid sequence according to the genetic code.

4. The method according to claim 1, characterized in that brings by known genetic engineering methods in a suitable expression system for expression of a recombinant DNA containing a Creatinamidinohydrolasegen, which in addition to the mutation of the base C in T at position 326 of the natural gene contains another mutation that causes a further amino acid exchange in the enzyme.

5. The method according to claim 4, characterized in that one expresses a recombinant creatinamidinohydrolase gene which contains in position 1063 a mutation of the base G in A.

6. The method according to claim 5, characterized in that the recombinant DNA as the plasmid pBT119, DSM 4107 P expressed.

7. The method according to any one of claims 1 to 6, characterized in that the expression system used is a microorganism of the genus E. colli or Pseudomonas putida.

8. The method according to claim 7, characterized in that one uses E. coli ED 8654, DSM 2102.

9. The method according to claim 7, characterized in that one uses Pseudomonas putida, DSM 2106.

10. The method according to claim 1 and 2, characterized in that E. coli, DSM 4105 is grown.

11. The method according to claims 4,5 and 6, characterized in that E. coli, DSM 4106 is grown.

12. Method of an enzyme; Prepared according to Claim 1, characterized in that it is used to determine the creatinine content in serum, plasma or urine.