CZ299418B6 - DNA construct, affecting expression of endogenous IFNA2 gene, isolated nucleic acid, homologous recombinant mammal cell, method of influencing expression of endogenous IFNA2 gene, and production process of IFNA2 - Google Patents
DNA construct, affecting expression of endogenous IFNA2 gene, isolated nucleic acid, homologous recombinant mammal cell, method of influencing expression of endogenous IFNA2 gene, and production process of IFNA2 Download PDFInfo
- Publication number
- CZ299418B6 CZ299418B6 CZ20003705A CZ20003705A CZ299418B6 CZ 299418 B6 CZ299418 B6 CZ 299418B6 CZ 20003705 A CZ20003705 A CZ 20003705A CZ 20003705 A CZ20003705 A CZ 20003705A CZ 299418 B6 CZ299418 B6 CZ 299418B6
- Authority
- CZ
- Czechia
- Prior art keywords
- seq
- sequence
- cells
- endogenous
- ifna2
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/44—Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Toxicology (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
DNA konstrukt, ovlivňující expresi endogenního IFNA2 genu, izolovaná nukleová kyselina, homologně rekombinantní savčí buňka, způsob ovlivnění exprese endogenního IFNA2 genu a způsob produkce IFNA2DNA construct affecting expression of endogenous IFNA2 gene, isolated nucleic acid, homologous recombinant mammalian cell, method of affecting expression of endogenous IFNA2 gene, and method of producing IFNA2
Oblast technikyTechnical field
Navrhovaný vynález se zabývá genomovou DNA.The present invention is concerned with genomic DNA.
Dosavadní stav technikyBACKGROUND OF THE INVENTION
Navrhované postupy léčby onemocnění s pomocí terapeutických proteinů zahrnují jak podání proteinů připravených in vitro, tak i genovou terapii. Příprava proteinu in vitro se obecně týká vnesení exogenní DNA kódující odpovídající protein do vhodné hostitelské buňky v buněčné kultuře. Metody genové terapie naopak představují podání buněk, plazmidů nebo virů s obsahem sekvence kódující odpovídající terapeutický protein pacientu.Proposed methods of treating diseases with the aid of therapeutic proteins include both the administration of proteins prepared in vitro and gene therapy. Generally, the preparation of a protein in vitro relates to the introduction of exogenous DNA encoding the corresponding protein into a suitable host cell in cell culture. Conversely, gene therapy methods involve administering to a patient cells, plasmids, or viruses containing a sequence encoding a corresponding therapeutic protein.
Některé terapeutické proteiny mohou být produkovány také vhodným ovlivněním exprese jejich endogenních genů s použitím cílených technik genového inženýrství. Viz například patenty US 5 641 670; US 5 733 761 a US 5 272 071; dále US patentová přihláška s pořadovým číslem 08/406,030 a dále WO 91/06 666, WO 91/06 667 a WO 90/11 354, které jsou zde všechny v celém rozsahu zahrnuty odkazem.Some therapeutic proteins may also be produced by appropriately influencing the expression of their endogenous genes using targeted genetic engineering techniques. See, for example, U.S. Patent Nos. 5,641,670; 5,733,761 and 5,272,071; further, U.S. Patent Application Serial No. 08 / 406,030; and WO 91/06 666, WO 91/06 667 and WO 90/11 354, all of which are hereby incorporated by reference in their entirety.
Podstata vynálezuSUMMARY OF THE INVENTION
Navrhovaný vynález je založen na identifikaci a sekvenaci genomové 5' DNA předcházející kódující sekvenci genu pro lidský interferon-a 2 („IFNA2“). Tato DNA může být použita napří30 klad v DNA konstruktu, který, po integraci do genomu buňky cestou homologní rekombinace, upravuje (například zvyšuje) expresi endogenního genu pro IFNA2 v savčích buňkách. Termínem „endogenní gen pro IFNA2“ označujeme genomový (tj. chromozomální) gen kódující IFNA2. Konstrukt obsahuje směrující sekvenci zahrnující nebo odvozenou od nově objevené nekódující 5' a dále sekvenci pro regulaci transkripce. Sekvence genové oblasti pro regulaci transkripce se s výhodou liší od transkripční regulační sekvence endogenního genu pro IFNA2. Směrující sekvence zajišťuje integraci regulační sekvence do oblasti proti směru transkripce endogenní IFNA2 kódující sekvence tak, aby byla regulační sekvence operativně připojena k endogenní kódující sekvenci. Termínem „operativně připojena“ označujeme skutečnost, že regulační sekvence může řídit expresi endogenní IFNA2 kódující sekvence. Konstrukt může dále obsahovat selekční znak, tj. genovou oblast usnadňující selekci buněk se stabilně integrovaným konstruktem a/nebo další kódující sekvenci připojenou k promotoru.The present invention is based on the identification and sequencing of genomic 5 'DNA preceding the coding sequence of the human interferon-α 2 gene ("IFNA2"). This DNA can be used, for example, in a DNA construct which, upon integration into the genome of a cell via homologous recombination, alters (for example, increases) expression of the endogenous IFNA2 gene in mammalian cells. The term "endogenous gene for IFNA2" refers to the genomic (ie chromosomal) gene encoding IFNA2. The construct comprises a targeting sequence comprising or derived from a newly discovered non-coding 5 'and a sequence for regulating transcription. Preferably, the transcriptional regulatory gene sequence differs from the transcriptional regulatory sequence of the endogenous IFNA2 gene. The targeting sequence ensures the integration of the regulatory sequence into the region upstream of the endogenous IFNA2 coding sequence so that the regulatory sequence is operably linked to the endogenous coding sequence. The term "operably linked" refers to the fact that a regulatory sequence can direct the expression of an endogenous IFNA2 coding sequence. The construct may further comprise a selection marker, i.e., a gene region facilitating the selection of cells with a stably integrated construct and / or an additional coding sequence linked to a promoter.
V jednom z provedení vynálezu DNA konstrukt zahrnuje: (a) směrující sekvenci, (b) regulační sekvenci, (c) exon, (d) donorové místo sestřihu, (e) intron a (f) akceptorové místo sestřihu, kde směrující sekvence zajišťuje integraci sebe sama a elementů (b) - (f), kde elementy (b) - (f) jsou integrovány do nebo proti směru transkripce endogenního genu. Regulační sekvence potom řídí produkci transkriptů, který zahrnuje nejen elementy (c) až (f), ale i endogenní IFNA2 kódující sekvenci. Nejraději jsou intron a akceptorové místo sestřihu umístěny v konstruktu po směru transkripce od donorového místa sestřihu.In one embodiment, the DNA construct comprises: (a) a targeting sequence, (b) a regulatory sequence, (c) an exon, (d) a splice donor site, (e) an intron, and (f) a splice acceptor site, wherein the targeting sequence provides integration and elements (b) - (f), wherein elements (b) - (f) are integrated into or upstream of the endogenous gene. The regulatory sequence then controls the production of transcripts that includes not only elements (c) to (f), but also endogenous IFNA2 coding sequence. Preferably, the intron and the splice acceptor site are located in the construct downstream of the splice donor site.
Směrující sekvence je homologní s předem zvolenou cílovou sekvencí v genomu. Mezi těmito dvěma homologními sekvencemi proběhne homologní rekombinace. Tato směrující sekvence obsahuje nejméně 20 (například nejméně 30, 50, 100 nebo 1000) po sobě následujících nukleotidů sekvence SEQ ID NO:11 a dále může obsahovat nejméně 20 (například nejméně 30, 50 neboThe targeting sequence is homologous to a preselected target sequence in the genome. Between these two homologous sequences, homologous recombination occurs. The targeting sequence comprises at least 20 (e.g., at least 30, 50, 100, or 1000) consecutive nucleotides of SEQ ID NO: 11, and may further comprise at least 20 (e.g., at least 30, 50, or
100) po sobě následujících nukleotidů sekvence SEQ ID NO:7, nejméně 20 (například nejméně100) consecutive nucleotides of SEQ ID NO: 7, at least 20 (for example at least
- 1 CZ 299418 B6 nebo 50) po sobě následujících nukleotidů sekvence SEQ ID NO:8, nebo nejméně 20 (například nejméně 30, 50, 100 nebo 1000) po sobě následujících nukleotidů sekvence SEQ ID NO: 12. Kromě toho může směrující sekvence dále obsahovat nejméně 20 (například nejméně 30, 50 nebo 100) po sobě následujících nukleotidů sekvence SEQ ID NO: 15, nejméně 20 po sobě následujících nukleotidů sekvence SEQ ID NO: 16, nejméně 20 (například nejméně 30 nebo 50) po sobě následujících nukleotidů sekvence SEQ ID NO: 17, nebo nejméně 20 (například nejméně 30, 50, 100 nebo 1000) po sobě následujících nukleotidů sekvence SEQ ID NO: 18. SEQ IDNO:7 odpovídá nukleotidům 1 až 278 SEQ ID NO:11, SEQ ID NO:8 odpovídá nukleotidům 3492 až 3564 SEQ ID NO:11 a SEQ ID NO:12 odpovídá nukleotidům 279 až 3491 SEQ ID NO:11. ío Termín „homologní“ znamená, že směrující sekvence je identická nebo dostatečně podobná svému cílovému místu v genomu, takže mezi směrující sekvencí a cílovým místem v lidské buňce může dojít k homologní rekombinaci. Malé procento párů bází, které spolu navzájem nepárují, je přijatelné, pokud k homologní rekombinaci dochází v dostatečné frekvenci. Pro usnadnění homologní rekombinace je s výhodou, pokud je směrující sekvence dlouhá nejméně 20 (např. nejméněOr 50) consecutive nucleotides of SEQ ID NO: 8, or at least 20 (e.g., at least 30, 50, 100 or 1000) consecutive nucleotides of SEQ ID NO: 12. contain at least 20 (for example at least 30, 50 or 100) consecutive nucleotides of SEQ ID NO: 15, at least 20 consecutive nucleotides of SEQ ID NO: 16, at least 20 (for example at least 30 or 50) consecutive nucleotides of the sequence SEQ ID NO: 17, or at least 20 (e.g., at least 30, 50, 100, or 1000) of consecutive nucleotides of SEQ ID NO: 18. SEQ ID NO: 7 corresponds to nucleotides 1 to 278 of SEQ ID NO: 11, SEQ ID NO: 8 corresponds to nucleotides 3492 to 3564 of SEQ ID NO: 11 and SEQ ID NO: 12 corresponds to nucleotides 279 to 3491 of SEQ ID NO: 11. The term "homologous" means that the targeting sequence is identical or sufficiently similar to its target site in the genome, so that homologous recombination can occur between the targeting sequence and the target site in a human cell. A small percentage of base pairs that do not pair with each other is acceptable if homologous recombination occurs at a sufficient frequency. To facilitate homologous recombination, it is preferred that the targeting sequence is at least 20 (e.g. at least
50, 100, 250, 400 nebo 1000) párů bází („bp“). Směrující sekvence může zahrnovat také genomové sekvence nacházející se vně oblasti zahrnuté v SEQ ID NO: 12, pokud kromě toho obsahuje nejméně 20 nukleotidů nacházejících se uvnitř zmíněné oblasti. Doplňující směrující sekvence může být například odvozena od sekvence ležící mezi SEQ ID NO:8 a endogenní transkripění iniciační sekvencí genu IFNA2.50, 100, 250, 400 or 1000) base pairs ("bp"). A targeting sequence may also include genomic sequences outside the region included in SEQ ID NO: 12 if it additionally comprises at least 20 nucleotides located within said region. For example, the complementary targeting sequence may be derived from a sequence lying between SEQ ID NO: 8 and endogenous transcription of the IFNA2 gene initiation sequence.
Vzhledem k polymorfismu genového lokusu IFNA2 může docházet k minoritním změnám v nukleotidovém složení kteréhokoliv daného cílového místa v genomu u kteréhokoliv existujícího savčího druhu. Navrhovaný vynález se vztahuje i na směrující sekvence, které odpovídají zmíněným polymorfním variantám SEQ ID NO:7, 8, 11, 12, 15, 16, 17 a 18 (především pak varian25 tám odpovídajícím polymorfismu lidského IFNA2 genu).Due to the polymorphism of the IFNA2 gene locus, there may be minor changes in the nucleotide composition of any given target site in the genome in any existing mammalian species. The present invention also relates to targeting sequences which correspond to said polymorphic variants of SEQ ID NOs: 7, 8, 11, 12, 15, 16, 17 and 18 (especially variants corresponding to the polymorphism of the human IFNA2 gene).
Homologní rekombinaci se regulační sekvence konstruktu integruje do chromozómu v předem vybrané oblasti proti směru transkripce od kódující sekvence genu IFNA2. Výsledná nová transkripční jednotka obsahující regulační sekvenci pocházející z konstruktu ovlivňuje expresi cílové30 ho genu IFNA2. Takto produkovaný protein IFNA2 může mít sekvenci identickou se sekvencí IFNA2 proteinu, který je kódován nezměněným endogenním genem, nebo může následkem záměn vnesených homologní rekombinaci obsahovat navíc oproti divokému typu IFNA2 proteinu doplňující, substituované nebo řídce se vyskytující aminokyselinové zbytky.By homologous recombination, the regulatory sequence of the construct integrates into the chromosome in a pre-selected region upstream of the coding sequence of the IFNA2 gene. The resulting novel transcriptional unit containing the regulatory sequence derived from the construct affects expression of the target30 IFNA2 gene. The IFNA2 protein thus produced may have a sequence identical to that of the IFNA2 protein that is encoded by the unaltered endogenous gene, or may contain additional, substituted or sparsely occurring amino acid residues, in addition to the wild-type IFNA2 protein, due to changes introduced by homologous recombination.
Ovlivnění genové exprese zahrnuje aktivaci (nebo zapříčinění exprese) genu, který je za normálního stavu v původní buňce tichý (tj. není exprimován), zvýšení nebo snížení úrovně exprese genu a změnu způsobu regulace genu tak, že je tento způsob odlišný od způsobu regulace v původní buňce. Termínem „původní buňka“ označujeme buňku před homologní rekombinaci.Effects on gene expression include activating (or causing expression) of a gene that is normally silent in the parent cell (i.e., not expressed), increasing or decreasing the level of gene expression, and changing the mode of gene regulation so that it is different from that of the original cell. The term "parent cell" refers to a cell prior to homologous recombination.
Předmětem navrhovaného vynálezu je dále způsob použití navrhovaného DNA konstruktu za účelem ovlivnění exprese endogenního IFNA2 genu v savčích buňkách. Tento způsob zahrnuje následující kroky: i) vnesení DNA konstruktu do savčích buněk, ii) udržování buněk v podmínkách, které umožňují homologní rekombinaci mezi konstruktem a cílovým místem v genomu (tj. místem v genomu, které je homologní ke směrující sekvenci DNA konstruktu), a tím také umož45 ňují vznik homologně rekombinantních buněk a iii) udržování homologně rekombinantních buněk v podmínkách, které umožňují expresi IFNA2 kódující sekvence, která je pod kontrolou regulační sekvence pocházející z DNA konstruktu. Alespoň část cílového místa v genomu je situována v pozici 5' vzhledem ke kódující sekvenci endogenního IFNA2 genu. To znamená, že cílové místo v genomu může obsahovat kódující sekvenci, stejně jako i 5' nekódující sekvenci.The present invention further provides a method of using the proposed DNA construct to effect expression of an endogenous IFNA2 gene in mammalian cells. The method comprises the steps of: i) introducing the DNA construct into mammalian cells, ii) maintaining the cells under conditions that allow homologous recombination between the construct and a target site in the genome (i.e., a site in the genome that is homologous to the targeting DNA sequence of the construct), and thereby also allow for the formation of homologously recombinant cells; and iii) maintaining homologously recombinant cells under conditions that allow expression of the IFNA2 coding sequence that is under the control of a regulatory sequence derived from the DNA construct. At least a portion of the target site in the genome is located 5 'to the coding sequence of the endogenous IFNA2 gene. That is, the target site in the genome may contain a coding sequence as well as a 5 'non-coding sequence.
Vynález dále zahrnuje také transfektované nebo infikované buňky, ve kterých proběhla homologní rekombinace mezi konstruktem a genomovou DNA v místě proti směru transkripce od endogenního ATG iniciačního kodonu, a to v jedné nebo v obou alelách endogenního IFNA2 genu. Takové transfektované nebo infikované buňky, nazývané také homologně rekombinantní buňky, mají pozměněný způsob exprese IFNA2 genu. Takové buňky jsou zvláště vhodné pro in vitroThe invention also encompasses transfected or infected cells in which homologous recombination has taken place between the construct and genomic DNA at an upstream site from the endogenous ATG initiation codon, in one or both alleles of the endogenous IFNA2 gene. Such transfected or infected cells, also called homologously recombinant cells, have an altered way of expressing the IFNA2 gene. Such cells are particularly suitable for in vitro
-7CZ 299418 B6 produkci IFNA2 a pro přenos IFNA2 metodou genové terapie. Způsoby přípravy a použití takových buněk jsou také předmětem navrhovaného vynálezu. Buňky bývají obratlovčího původu, nejčastěji se jedná o buňky savčího původu (například lidského, dále mohou být odvozeny od buněk primátů, buněk kravských, prasečích, koňských, kozích, ovčích, kočičích, psích, králičích, myších, morčecích, křečcích nebo krysích).The production of IFNA2 and for the transfer of IFNA2 by the gene therapy method. Methods for preparing and using such cells are also within the scope of the present invention. The cells are of vertebrate origin, most often cells of mammalian origin (for example human, and may be derived from primate cells, cow cells, pig cells, equine cells, goat cells, sheep cells, feline dogs, rabbits, mice, guinea pigs, hamsters or rats).
Vynález se dále týká způsobu produkce savčího proteinu IFNA2 in vitro nebo in vivo metodou vnesení výše zmíněného konstruktu do hostitelské buňky a inzerce tohoto konstruktu do genomu zmíněné buňky cestou homologní rekombinace. Homologně rekombinantní buňka je dále udržo10 vána v podmínkách, které umožňují transkripci, translaci a případně i sekreci proteinu IFNA2.The invention further relates to a method for producing mammalian IFNA2 protein in vitro or in vivo by the method of introducing the above construct into a host cell and inserting the construct into the genome of said cell via homologous recombination. Further, the homologously recombinant cell is maintained under conditions that allow transcription, translation and possibly IFNA2 protein secretion.
Předmětem vynálezu je dále izolovaná nukleová kyselina obsahující sekvenci nejméně 20 (například nejméně 30, 50, 100, 200 nebo 1000) po sobě jdoucích nukleotidů SEQ ID NO: 11 nebo odpovídající komplementární sekvence nebo sekvence identické se sekvencí SEQ ID NO: 11 s výjimkou polymorfních variací nebo dalších minoritních variací (například méně než 5 % sekvence), které nebrání homologní rekombinaci s cílovou sekvencí. Izolovaná DNA může například obsahovat nejméně 20 (například nejméně 30, 50 nebo 100) po sobě jdoucích nukleotidů SEQ ID NO:7 nebo odpovídající komplementární sekvence, nejméně 20 (například nejméně 30 nebo 50) po sobě jdoucích nukleotidů SEQ ID NO:8 nebo odpovídající komplementární sek20 vence, nejméně 20 (například nejméně 30, 50, 100 nebo 1000) po sobě jdoucích nukleotidů SEQ ID NO:12 nebo odpovídající komplementární sekvence, nejméně 20 (například nejméně 30, 50 nebo 100) po sobě jdoucích nukleotidů SEQ ID NO: 15 nebo odpovídající komplementární sekvence, nejméně 20 po sobě jdoucích nukleotidů SEQ ID NO: 16 nebo odpovídající komplementární sekvence, nejméně 20 (například nejméně 30 nebo 50) po sobě jdoucích nukleotidů SEQ IDThe invention further provides an isolated nucleic acid comprising a sequence of at least 20 (for example at least 30, 50, 100, 200 or 1000) of consecutive nucleotides of SEQ ID NO: 11 or the corresponding complementary sequence or sequence identical to SEQ ID NO: 11 except polymorphic. variations or other minor variations (e.g., less than 5% of the sequence) that do not prevent homologous recombination with the target sequence. For example, the isolated DNA may comprise at least 20 (e.g., at least 30, 50 or 100) consecutive nucleotides of SEQ ID NO: 7 or the corresponding complementary sequence, at least 20 (e.g., at least 30 or 50) consecutive nucleotides of SEQ ID NO: 8 or the corresponding a complementary sequence of at least 20 (e.g., at least 30, 50, 100 or 1000) of consecutive nucleotides of SEQ ID NO: 12 or a corresponding complementary sequence of at least 20 (e.g. of at least 30, 50 or 100) of consecutive nucleotides of SEQ ID NO: 15 or a corresponding complementary sequence of at least 20 contiguous nucleotides of SEQ ID NO: 16 or a corresponding complementary sequence of at least 20 (e.g. at least 30 or 50) of contiguous nucleotides of SEQ ID NO: 16;
NO: 17 nebo odpovídající komplementární sekvence nebo nejméně 20 (například nejméně 30, 50, 100 nebo 1000) po sobě jdoucích nukleotidů SEQ ID NO: 18 nebo odpovídající komplementární sekvence.NO: 17 or the corresponding complementary sequence or at least 20 (e.g., at least 30, 50, 100 or 1000) of consecutive nucleotides of SEQ ID NO: 18 or the corresponding complementary sequence.
V jednom z provedení navrhovaného vynálezu obsahuje nukleová kyselina podle vynálezu blokIn one embodiment of the present invention, the nucleic acid of the invention comprises a block
1 00 po sobě následujících párů bází SEQ ID NO: 11. Izolovaná DNA tedy může obsahovat například nukleotidy 1 až 100, 101 až 200, 201 až 300, 301 až 400, 401 až 500, 501 až 600, 601 až 700, 701 až 800, 801 až 900, 901 až 1000, 1001 až 1100, 1101 až 1200, 1201 až 1300, 1301 až 1400, 1401 až 1500, 1501 až 1600, 1601 až 1700, 1701 až 1800, 1801 až 1900, 1901 až 2000, 2001 až 2100, 2101 až 2200, 2201 až 2300, 2301 až 2400, 2401 až 2500, 2501 až 2600, 2601 ažThus, the isolated DNA may comprise, for example, nucleotides 1 to 100, 101 to 200, 201 to 300, 301 to 400, 401 to 500, 501 to 600, 601 to 700, 701 to 700, 800, 801 to 900, 901 to 1000, 1001 to 1100, 1101 to 1200, 1201 to 1300, 1301 to 1400, 1401 to 1500, 1501 to 1600, 1601 to 1700, 1701 to 1800, 1801 to 1900, 1901 to 2000, 2001 to 2100, 2101 to 2200, 2201 to 2300, 2301 to 2400, 2401 to 2500, 2501 to 2600, 2601 to
2 7 00, 2701 až 2800, 2801 až 2900, 2901 až 3000, 3001 až 3100, 3101 až 3200, 3201 až 3300,2700 to 2800, 2801 to 2900, 2901 to 3000, 3001 to 3100, 3101 to 3200, 3201 to 3300,
3301 až 3400, 3401 až 3500 nebo 3465 až 3564 SEQ ID NO:11 nebo odpovídající komplementární sekvence. Zmíněné bloky SEQ ID NO:11 nebo odpovídající komplementární sekvence jsou vhodné i jako směrující sekvence pro konstrukty podle vynálezu.3301 to 3400, 3401 to 3500 or 3465 to 3564 of SEQ ID NO: 11 or the corresponding complementary sequence. Said blocks of SEQ ID NO: 11 or corresponding complementary sequences are also suitable as targeting sequences for the constructs of the invention.
Jako izolovaná DNA, není sekvence odvozená od SEQ ID NO: 11 spojena se sekvencí kódující intaktní IFNA2, nebo přinejmenším není spojena ve stejné konfiguraci (tj. oddělena stejnou nekódující sekvencí) jako je tomu v genomu divokého typu. Termínem „izolovaná DNA“ tak, jak je použit zde tedy neoznačujeme chromozóm nebo velké části genomové DNA (které by mohly být zainkorporovány do kosmidu nebo umělého kvasničného chromozómu) zahrnující nejen částeč45 nou nebo celou SEQ ID NO:11, ale i intaktní sekvenci kódující IFNA2 a celou sekvenci ležící mezi sekvencí kódující IFNA2 a sekvencí odpovídající SEQ ID NO: 11 tak, jak se vyskytuje v genomu intaktní buňky. Tento termín zahrnuje (ale není omezen na) DNA, která i) je zainkorporována do plazmidů nebo viru, nebo ii) existuje jako samostatná molekula nezávisle na dalších sekvencích, například fragment připravený polymerázovou řetězovou reakcí (PCR) nebo frag50 ment připravený štěpením restrikčními endonukleázami. Izolovaná DNA nejraději neobsahuje sekvenci kódující prekurzor intaktního IFNA2 (tj. kompletní 1FNA2 spolu s endogenním signálním sekrečním peptidem).As isolated DNA, the sequence derived from SEQ ID NO: 11 is not linked to a sequence encoding intact IFNA2, or at least is not linked in the same configuration (i.e., separated by the same non-coding sequence) as in the wild-type genome. Thus, the term "isolated DNA" as used herein does not refer to a chromosome or large portions of genomic DNA (which could be incorporated into a cosmid or an artificial yeast chromosome) comprising not only a partial or all of SEQ ID NO: 11 but also an intact sequence encoding IFNA2. and the entire sequence lying between the IFNA2 coding sequence and the sequence corresponding to SEQ ID NO: 11 as it occurs in the intact cell genome. The term includes (but is not limited to) DNA which i) is incorporated into plasmids or virus, or ii) exists as a separate molecule independent of other sequences, for example a polymerase chain reaction (PCR) fragment or frag50 ment prepared by restriction endonuclease digestion. Preferably, the isolated DNA does not contain a sequence encoding an intact IFNA2 precursor (i.e., complete 1FNA2 together with an endogenous signaling secretory peptide).
Předmětem vynálezu je dále izolovaná DNA zahrnující řetězec, který obsahuje nejméně 100 (například nejméně 200, 400 nebo 1000) nukleotidů dlouhou sekvenci, hybridizující za mírněThe invention further provides an isolated DNA comprising a strand comprising at least 100 (e.g. at least 200, 400 or 1000) nucleotides long sequence,
-3CZ 299418 B6 nebo velmi přísných (stringentních) podmínek se SEQ ID NO:7, 8, 11, 12, 15, 16, 17 a/nebo 18 nebo se sekvencemi komplementárními k SEQ IDNO:7, 8, 11, 12, 15, 16, 17 a/nebo 18. Sekvence není spojena s IFNA2 kódující sekvencí, nebo přinejmenším není spojena ve stejné konfiguraci jako je tomu v genomu divokého typu. Mírně přísnými (stringentními) podmínkami označuje5 me hybridizaci při 50 °C v Churchově pufru (7% SDS, 0,5% NaHPO4, 1 M EDTA, 1% hovězí sérový albumin) a promývání při 50 °C v 2x SSC. Vysoce stringentní podmínky jsou definovány jako: hybridizace při 42 °C v přítomnosti 50 % formamidu; první promytí při 65 °C v 2x SSC s přídavkem 1% SDS a druhé promytí při 65 °C v 0,lx SSC.Or very stringent conditions with SEQ ID NOs: 7, 8, 11, 12, 15, 16, 17 and / or 18 or with sequences complementary to SEQ ID NOs: 7, 8, 11, 12, 15 , 16, 17 and / or 18. The sequence is not linked to the IFNA2 coding sequence, or at least is not linked in the same configuration as in the wild-type genome. Slightly stringent conditions indicate hybridization at 50 ° C in Church Buffer (7% SDS, 0.5% NaHPO 4, 1 M EDTA, 1% bovine serum albumin) and washing at 50 ° C in 2x SSC. High stringency conditions are defined as: hybridization at 42 ° C in the presence of 50% formamide; a first wash at 65 ° C in 2x SSC with the addition of 1% SDS and a second wash at 65 ° C in 0.1x SSC.
ío Dále je předmětem vynálezu izolovaná DNA zahrnující řetězec se sekvencí která (1) je nejméně 50 (například nejméně 70 nebo 100) nukleotidů dlouhá a (2) je nejméně z 80 % (například nejméně z 85 %, 90 %, 95 % nebo 98 %) identická se sekvencí fragmentu nebo celé SEQ ID NO: 11 nebo s odpovídající komplementární sekvencí. Tento fragment může zahrnovat například část nebo celou SEQ IDNO:7, 8, 12, 15, 16, 17, 18 nebo 19. Sekvence není spojena s intaktní IFNA2 kódující sekvencí, nebo přinejmenším není spojena ve stejné konfiguraci jako je tomu v genomu divokého typu.Further provided is an isolated DNA comprising a strand having a sequence of (1) at least 50 (e.g. at least 70 or 100) nucleotides in length and (2) at least 80% (e.g. at least 85%, 90%, 95% or 98 %) identical to the fragment or all of SEQ ID NO: 11 or the corresponding complementary sequence. The fragment may comprise, for example, part or all of SEQ ID NO: 7, 8, 12, 15, 16, 17, 18 or 19. The sequence is not linked to an intact IFNA2 coding sequence, or at least is not linked in the same configuration as in the wild-type genome. .
Hovoříme-li o určitém procentu identity nebo konzervovanosti konkrétního polypeptidu nebo molekuly nukleové kyseliny vzhledem k referenčnímu polypeptidu nebo nukleové kyselině, je toto procento identity nebo konzervovanosti stanoveno pomocí algoritmu, definovaného Myersem a Milllerem, CABIOS (1989), který je součástí programu ALIGN (verze 2.0), nebo ekvivalentním způsobem s použitím následujících parametrů (pokud jsou takové parametry vyžadovány): „gap length penalty“ (tj. postih za délku mezery) 12 a „gap penalty“ (tj. postih za existenci mezery) 4. U všech ostatních parametrů byly použity předvolené výchozí hodnoty. ProgramTalking about a certain percent identity or conservation of a particular polypeptide or nucleic acid molecule relative to a reference polypeptide or nucleic acid, this percent identity or conservation is determined using an algorithm defined by Myers and Milller, CABIOS (1989), which is part of the ALIGN program 2.0), or equivalent, using the following parameters (if required): “gap length penalty” (ie, gap penalty) 12 and “gap penalty” (ie, gap penalty) 4. For all other default values were used. Program
ALIGN je snadno přístupný. Viz. například internetová adresa: http://www2.igh.cnrs.fr/bin/align-quess.cgi.ALIGN is easily accessible. See. for example, the Internet address: http://www2.igh.cnrs.fr/bin/align-quess.cgi.
Vynález se dále zabývá způsobem doručení IFNA2 do těla živočicha (například savce jako jsou kupříkladu člověk, ostatní primáti, kráva, prase, kůň, koza, ovce, kočka, pes, králík, myš, morče, křeček nebo krysa), a to tak, že jsou předem připravené buňky, jejichž endogenní 1FNA2 gen byl aktivován tak, jak to bylo popsáno výše, implantovány do těla zmíněného živočicha. Takto implantované buňky potom v těle živočicha produkují a vylučují IFNA2. Předmětem vynálezu je také způsob produkce IFNA2 tak, že jsou předem připravené buňky, jejichž endogenní IFNA2 gen byl aktivován tak, jak to bylo popsáno výše, kultivovány in vitro v podmínkách, které umož35 ňují buňkám exprimovat a vylučovat IFNA2.The invention further relates to a method of delivering IFNA2 to the body of an animal (e.g., a mammal such as a human, other primate, cow, pig, horse, goat, sheep, cat, dog, rabbit, mouse, guinea pig, hamster or rat). that the pre-prepared cells whose endogenous 1FNA2 gene has been activated as described above are implanted in the body of said animal. The implanted cells then produce and secrete IFNA2 in the body of the animal. The present invention also provides a method of producing IFNA2 by pre-preparing cells whose endogenous IFNA2 gene has been activated as described above, cultured in vitro under conditions that allow the cells to express and secrete IFNA2.
Vynález dále zahrnuje izolovanou DNA, která je nejméně z 80 % (například nejméně 85 %, 90 % nebo 95 %) identická nebo hybridizuje za vysoce nebo mírně stringentních podmínek s částí (například nejméně 20, 50, 100, 400 nebo 1000 párů bází dlouhou) HindlII-BamHI inzertu plaz40 midu pA2HB (popsaného níže). 3' konec zmíněné části tohoto inzertu je lokalizován nejméně 511 pb proti směru transkripce od translačního iniciačního kodonu ATG kódující sekvence IFNA2, která je součástí zmíněného inzertu v plazmidů.The invention further includes isolated DNA that is at least 80% (for example at least 85%, 90% or 95%) identical or hybridizes under high or slightly stringent conditions to a portion (for example at least 20, 50, 100, 400 or 1000 base pairs long) The HindIII-BamHI insert of the plasmid pA2HB plasmid (described below). The 3 'end of said portion of this insert is located at least 511 bp upstream of the translation initiation codon of the ATG coding sequence of IFNA2 that is part of said insert in the plasmids.
Izolovaná DNA podle vynálezu může být použita například jako zdroj PCR primerů proti směru transkripce. Tyto primery mohou být použity (v kombinaci s vhodnými primery po směru transkripce) pro získání sekvence regulační oblasti a/nebo kompletní kódující sekvence endogenního IFNA2 genu. Dále může být tato DNA použita jako hybridizační sonda pro důkaz přítomnosti chromozómu 9 ve vzorku lidských chromozómů, nebo, jak je to popsáno v dalším textu, může být použita pro ovlivnění exprese endogenního IFNA2 genu v buňkách obratlovců.The isolated DNA of the invention can be used, for example, as a source of upstream PCR primers. These primers can be used (in combination with suitable downstream primers) to obtain the regulatory region sequence and / or the complete coding sequence of the endogenous IFNA2 gene. Further, this DNA can be used as a hybridization probe to detect the presence of chromosome 9 in a human chromosome sample, or as described below, to affect expression of endogenous IFNA2 gene in vertebrate cells.
Pokud není definováno jinak, mají všechny technické a vědecké termíny, použité v textu, stejný význam, v jakém jsou používány odborníky z odpovídajících oborů. Příklady použitých způsobů a materiálů jsou uvedeny níže, avšak způsoby a materiály podobné nebo ekvivalentní těm popsaným mohou být při praktickém použití vynálezu nebo jeho testování použity také. Všechny publi55 kace, patentové přihlášky, patenty a další uvedené odkazy jsou zde v celém svém rozsahu zahmu-4CZ 299418 B6 ty pouze formou odkazu. V případě konfliktu je rozhodujícím prvkem specifikace navrhovaného vynálezu včetně definic. Materiály, metody a příklady jsou pouze ilustrativní a v žádném případě rozsah vynálezu nikterak nelimitují.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Examples of methods and materials used are given below, but methods and materials similar or equivalent to those described may also be used in the practice of the invention or its testing. All publications, patent applications, patents, and other references cited herein are hereby incorporated by reference in their entirety. In case of conflict, the specification of the present invention, including definitions, is critical. The materials, methods and examples are illustrative only and in no way limit the scope of the invention.
Další vlastnosti a výhody navrhovaného vynálezu vyplývají z následujícího detailního popisu vynálezu a z patentových nároků.Other features and advantages of the present invention will appear from the following detailed description of the invention and from the claims.
Navrhovaný vynález je založen na objevu nukleotidového složení sekvence proti směru transkripce vzhledem ke kódující sekvenci lidského IFNA2 genu.The present invention is based on the discovery of the nucleotide composition of the sequence upstream of the coding sequence of the human IFNA2 gene.
Interferon-α tvoří komplexní genovou rodinu tvořenou shlukem 14 genů na krátkém rameni 9. chromozómu. Žádný z těchto genů, včetně genu IFNA2, neobsahuje introny. Interferon-α je produkován makrofágy, B a T buňkami a celou řadou dalších buněk. Interferon-α má významné protivirové účinky a bylo prokázáno, že je účinný při léčbě infekcí způsobených papilloma virem, viry hepatitidy B a C a vakcinie, virem herpes simplex, virem herpes zoster varicellosus a rhinovirem.Interferon-α forms a complex gene family consisting of a cluster of 14 genes on the short arm of the 9th chromosome. None of these genes, including the IFNA2 gene, contain introns. Interferon-α is produced by macrophages, B and T cells and a variety of other cells. Interferon-α has significant antiviral effects and has been shown to be effective in the treatment of infections caused by papilloma virus, hepatitis B and C viruses and vaccinia, herpes simplex virus, herpes zoster varicellosus virus and rhinovirus.
Lidský 1FNA2 gen kóduje 188 aminokyselin dlouhý prekurzorový protein (SEQ ID NO:2) obsahující 23 aminokyselin dlouhý signální peptid. Genomová mapa lidského IFNA2 genu je znázor20 něna na obrázku 1. Mapa je zkonstruována na základě publikované 1733 pb dlouhé sekvence (HUMIFNAA, GenBank, přístupové číslo J00207 a V00544; SEQ ID NO:1), která začíná v pozici -510 vzhledem k translačnímu startu (pokud není uvedeno jinak, všechny pozice uváděné zde, jsou číslovány vzhledem k místu translačního startu) a končí v pozici +1223. CAP místo je lokalizováno v pozici -67.The human 1FNA2 gene encodes a 188 amino acid long precursor protein (SEQ ID NO: 2) containing a 23 amino acid long signal peptide. The genomic map of the human IFNA2 gene is shown in Figure 1. The map is constructed based on the published 1733 bp long sequence (HUMIFNAA, GenBank, accession numbers J00207 and V00544; SEQ ID NO: 1) starting at position -510 relative to the translational start (unless otherwise stated, all positions listed herein are numbered relative to the translation start site) and terminate at position +1223. The CAP site is located at position -67.
Specifické sekvence lokalizované ve směru 5' vzhledem k IFNA2 genu a jejich použití pro ovlivnění exprese endogenního IFNA2 genu.Specific sequences located 5 'to the IFNA2 gene and their use to influence the expression of endogenous IFNA2 gene.
Genomová DNA obsahující sekvenci proti směru transkripce vzhledem k IFNA2 genu byla získána následujícím způsobem: lidská leukocytová genomová knihovna v lambda EMBL3 (Clontech katalog #HL1006d) byla testována s pomocí 332 pb dlouhé sondy připravené PCR. Tato sonda odpovídá genomové oblasti -263 až +69 a byla amplifikována z lidské genomové DNA s použitím oligonukleotidových primerů IFN7 a IFN6. Oba zmíněné primery byly navrženy na základě dostupné sekvence IFNA2 genomové DNA (obr. 1). 5' konec primeru IFN7 odpovídá pozici -263 a sekvence tohoto primeru je 5-AGTTTCTAAAAAGGCTCTGGGGTA-3' (SEQ ID NO:3). 5' konec primeru IFN6 odpovídá pozici +69 a sekvence tohoto primeru je 5'-GCCCACAGAGCAGCTTGAC-3' (SEQ IDNO:4).Genomic DNA containing the upstream sequence with respect to the IFNA2 gene was obtained as follows: The human leukocyte genomic library in lambda EMBL3 (Clontech catalog # HL1006d) was tested using a 332 bp long probe prepared by PCR. This probe corresponds to the genomic region of -263 to +69 and was amplified from human genomic DNA using the oligonucleotide primers IFN7 and IFN6. Both primers were designed based on the available IFNA2 genomic DNA sequence (Fig. 1). The 5 'end of primer IFN7 corresponds to position -263 and the sequence of this primer is 5-AGTTTCTAAAAAGGCTCTGGGGTA-3' (SEQ ID NO: 3). The 5 'end of primer IFN6 corresponds to position +69 and the sequence of this primer is 5'-GCCCACAGAGCAGCTTGAC-3' (SEQ ID NO: 4).
Přibližně jeden milion rekombinantních fágů byl testován s pomocí radioaktivně značené 322 pb dlouhé sondy. Z primárních testovacích misek bylo izolováno 60 pozitivních plaků. DNA fága lambda byla vyizolována ze třiceti z těchto pozitivních plaků. Vyizolována DNA byla templátem v PCR reakci s oligonukleotidovými primery IFN1 a IFN2. Oba primery IFN1 i IFN21 jsou odvozeny od 3' nepřekládané oblasti IFNA2 genu; jejich sekvence lze najít na internetové adrese „http://www.ncbi.nlm.nih.gov/dbSTS podle identifikačního kódu „NCBIID: 42433. 5' konec primeru IFN1 odpovídá pozici +639 a sekvence primeru je 5-AAAGACTCATGTTTCTGCTATGAC-3' (SEQ ID NO:5). 5' konec primeru IFN2 odpovídá pozici +853 a sekvence primeru je 5-GGTGCACATGACATAATATGAACA-3' (SEQ ID NO:6). Ze třiceti testovaných fágových klonů dva tvořili očekávaný PCR produkt o velikosti 215 pb. Jeden z těchto dvou fágových plaků byl dále purifikován v dalších dvou kolech hybridizačních pokusů. Takto byl získán fágový klon 4-4-1. 8,3 kb dlouhý HindlII-BamHI fragment fága 4—4—1 byl subklonován do plazmidů pBluescript II SK+ (Stratagene, La Jolla, CA) za vzniku pA2HB. Konstrukt pA2HB nese přibližně 4,3 kb dlouhou část netranskribované sekvence proti směru transkripce, oblast kódující protein (1,1 kb) a přibližně 2,8 kb dlouhý úsek sekvence po směru transkripce od IFNA2 genu. Restrikční mapa 8,3 kb dlouhého HindlII-BamHI fragmentu je znázorněna na obrázku 2.Approximately one million recombinant phages were tested using a radiolabeled 322 bp probe. 60 positive plaques were isolated from the primary test plates. The lambda phage DNA was isolated from thirty of these positive plaques. DNA was isolated by a template in a PCR reaction with oligonucleotide primers IFN1 and IFN2. Both primers IFN1 and IFN21 are derived from the 3 'untranslated region of the IFNA2 gene; their sequences can be found at "http://www.ncbi.nlm.nih.gov/dbSTS" under the identification code "NCBIID: 42433". The 5 'end of primer IFN1 corresponds to position +639 and the sequence of the primer is 5-AAAGACTCATGTTTCTGCTATGAC-3' (SEQ ID NO: 5). The 5 'end of primer IFN2 corresponds to position +853 and the sequence of the primer is 5-GGTGCACATGACATAATATGAACA-3' (SEQ ID NO: 6). Of the thirty phage clones tested, two were the expected PCR product of 215 bp. One of these two phage plaques was further purified in the other two rounds of hybridization experiments. Thus, a 4-4-1 phage clone was obtained. An 8.3 kb HindIII-BamHI phage fragment 4-4-1 was subcloned into plasmids pBluescript II SK + (Stratagene, La Jolla, CA) to give pA2HB. The pA2HB construct carries an approximately 4.3 kb portion of the untranscribed sequence upstream, a protein coding region (1.1 kb), and an approximately 2.8 kb portion of the downstream sequence of the IFNA2 gene. A restriction map of the 8.3 kb HindIII-BamHI fragment is shown in Figure 2.
-5CZ 299418 B6-5GB 299418 B6
Plazmid pA2HB byl sekvenován Sangerovou metodou. 278 pb dlouhá sekvence, jejíž 5' konec je zároveň 5' konec HindlII restrikčního místa je znázorněna níže (viz také obr. 3): AAGCTTTTATAGTTGTAAATTTTCCACTTAGTACTGCTTTTGTAATGTTGTCTT TTTATTTTCATTTATCTCAAGATGTTTTCTAATTTCTCTTGACTTCCTTCTTAA ATTCTTACCTCATGTAGACATACATTTTTGGCCCTATGCATTGGGATGCAAAA CCAGACTAATTTACTTTGTACAAAAAGAAAAATGAGAAAGAAATATATTTGG TCTTGTGAGCACTATATGGAAATACTTTATATTCCATTTGTTTCATCATATTCA TATATCCCTTT (SEQ ID NO:7)Plasmid pA2HB was sequenced by the Sanger method. 278 bp long sequence whose 5 'end is also the 5' end of the Hind III restriction site is shown below (see also FIG. 3) AAGCTTTTATAGTTGTAAATTTTCCACTTAGTACTGCTTTTGTAATGTTGTCTT TTTATTTTCATTTATCTCAAGATGTTTTCTAATTTCTCTTGACTTCCTTCTTAA ATTCTTACCTCATGTAGACATACATTTTTGGCCCTATGCATTGGGATGCAAAA CCAGACTAATTTACTTTGTACAAAAAGAAAAATGAGAAAGAAATATATTTGG TCTTGTGAGCACTATATGGAAATACTTTATATTCCATTTGTTTCATCATATTCA TATATCCCTTT (SEQ ID NO: 7)
HindlII místo je lokalizováno v pozici 4,073. Dříve nepublikovaná sekvence mezi pozicemi 583 a -511 byla určena také a je znázorněna níže a dále je zvýrazněna podtržením na obrázku 4.The HindIII site is located at position 4,073. The previously unpublished sequence between positions 583 and -511 was also determined and is shown below, and is further highlighted by the underline in Figure 4.
CATTGGATACTCCATCACCTGCTGTGATATTATGAATGTCTGCCTATATAAAT ATTCACTATTCCATAACACA (SEQ ID NO:8) ío Sekvence (SEQ ID NO:12) nacházející se mezi oblastmi SEQ ID NO:7 a SEQ ID NO:8 byla určena také.CATTGGATACTCCATCACCTGCTGTGATATTATGAATGTCTGCCTATATAAAT ATTCACTATTCCATAACACA (SEQ ID NO: 8) 10 The sequence (SEQ ID NO: 12) located between regions of SEQ ID NO: 7 and SEQ ID NO: 8 was also determined.
Genomová sekvence, nacházející se v pozici -4,074 až -511 (SEQ ID NO:11) je ta sekvence, která na obrázku 6 není podtržena. Sekvence SEQ ID NO:7 a SEQ ID NO:8 odpovídají nukleotidům 1-278 a 3492-3564 SEQ ID NO: 11 resp.The genomic sequence found at positions -4,074 to -511 (SEQ ID NO: 11) is that which is not underlined in Figure 6. SEQ ID NO: 7 and SEQ ID NO: 8 correspond to nucleotides 1-278 and 3492-3564 of SEQ ID NO: 11, respectively.
Za účelem ovlivnění exprese endogenního IFNA2 genu byl DNA fragment obsahující nukleotidy 279-3311 SEQ ID NO: 12 nakloňován do plazmidu za vzniku směrujícího konstruktu pGA402. Nukleotidová sekvence 279-3311 SEQ ID NO:11 byla nazvána SEQ ID NO: 13. Fragment byl do vektoru vložen v místě proti směru transkripce od CM V promotoru a genu kódujícího rezistenci vůči neomycinu (viz schéma na obr. 5). Druhá směrující sekvence (viz obr. 5), obsahující DNA fragment genu 1FNA2 -68 až 69 (viz obr. 1), byla klonována do plazmidu v místě po směru transkripce od CMV promotoru a genu kódujícího rezistenci vůči neomycinu.In order to influence the expression of the endogenous IFNA2 gene, the DNA fragment containing nucleotides 279-3311 of SEQ ID NO: 12 was cloned into a plasmid to produce the targeting construct pGA402. The nucleotide sequence 279-3311 of SEQ ID NO: 11 was named SEQ ID NO: 13. The fragment was inserted into the vector at a site upstream of the CM V promoter and neomycin resistance gene (see scheme in Figure 5). The second targeting sequence (see Figure 5), containing the DNA fragment of the 1FNA2 -68 to 69 gene (see Figure 1), was cloned into a plasmid downstream of the CMV promoter and neomycin resistance encoding gene.
Část nukleotidové sekvence genu IFNA2 vymezená nukleotidy -68 až 69 byla nazvána SEQ ID NO: 14. Plazmid pGA402 byl vnesen do lidských fibroblastových buněk, vykazujících nízkou nebo žádnou expresi genu IFNA2, tak aby byla umožněna homologní rekombinace s endogenním IFNA2 genem. Buňky, které byly po transformaci plazmidem rezistentní vůči G418, byly dále testovány za účelem identifikace buněk se zvýšenou expresí IFNA2 genu. Tato zvýšená exprese byla očekávána v případě, že proběhla homologní rekombinace mezi pGA402 a genomovou DNA v těsné blízkosti endogenního IFNA2 genu.The portion of the nucleotide sequence of the IFNA2 gene delimited by nucleotides -68 to 69 was named SEQ ID NO: 14. Plasmid pGA402 was introduced into human fibroblast cells displaying little or no expression of the IFNA2 gene to allow homologous recombination with the endogenous IFNA2 gene. Cells that were resistant to G418 after transformation with a plasmid were further tested to identify cells overexpressing the IFNA2 gene. This overexpression was expected when homologous recombination occurred between pGA402 and genomic DNA in close proximity to the endogenous IFNA2 gene.
Obecná metodologie:General methodology:
Ovlivnění endogenní exprese IFNA2 genuEffect on endogenous expression of IFNA2 gene
S použitím výše popsaných sekvencí proti směru transkripce od IFNA2 genu je možné ovlivňovat expresi endogenního lidského IFNA2 genu způsobem, kteiý je popsán v patentu US 5 641 670. Jedna ze strategií je znázorněna na obr. 5. V tomto případě je směrující konstrukt navržen tak aby obsahoval první směrující sekvenci homologní k prvnímu cílovému místu lokalizovanému proti směru transkripce genu, gen pro amplifikovatelný znak, gen pro selekční znak, regulační oblast, CAP místo, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu a druhou směrující sekvenci homologní ke druhému cílovému místu lokalizovanému po směru transkripce od prvního cílového místa a končící buď v, nebo proti směru transkripce od IFNA2 kódující sekvence. V souladu s touto strategií je 5' konec druhého cílového místa nejraději umís-6CZ 299418 B6 těn proti směru transkripce méně než 107 pb daleko od normálního ranslačního iniciačního místa IFNA2. Tak se lze vyhnout nežádoucím ATG startovacím kodonům uvnitř transkribované sekvence. Transkript lokusu, připraveného popsanou homologní rekombinaci, obsahuje exon, donorové místo sestřihu, intron, akceptorové místo sestřihu (vše původem z konstruktu), dále jakouko5 liv sekvenci mezi těmito elementy a dále sekvenci od akceptorového místa sestřihu přes celou endogenní kódující sekvenci až po transkripční terminační místo IFNA2 genu. Sestřihem takových transkriptů vzniká mRNA, která je překládána za vzniku prekurzoru lidského IFNA2, obsahujícího, v závislosti na charakteristice konstruktem kódovaného exonu, buď normální sekreční signální sekvenci, nebo geneticky upravenou sekreční signální sekvenci. Velikost exogenního ío intronu a tudíž i pozice exogenní regulační oblasti vzhledem ke kódující oblasti genu je variabilní a jejími změnami lze optimalizovat funkci regulační oblasti.Using the above-described upstream sequences from the IFNA2 gene, it is possible to influence the expression of an endogenous human IFNA2 gene as described in U.S. Patent No. 5,641,670. One of the strategies is shown in Figure 5. In this case, the targeting construct is designed to comprising a first targeting sequence homologous to a first target site located upstream of the gene, an amplifiable trait gene, a selectable marker gene, a regulatory region, a CAP site, an exon, a splice donor site, an intron, a splice acceptor site, and a second targeting sequence homologous to a second target a site located downstream of the first target site and terminating either in or upstream of the IFNA2 coding sequence. In accordance with this strategy, the 5 'end of the second target site is preferably positioned upstream of the transcription direction less than 107 bp away from the normal IFNA2 initiation initiation site. Thus, unwanted ATG start codons within the transcribed sequence can be avoided. The locus transcript prepared by the described homologous recombination comprises an exon, splice donor site, intron, splice acceptor site (all originating from the construct), any sequence between these elements, and a sequence from the splice acceptor site through the entire endogenous coding sequence to transcriptional termination site of the IFNA2 gene. Splicing of such transcripts results in an mRNA that is translated to produce a precursor of human IFNA2 containing, depending on the characteristics of the construct-encoded exon, either a normal secretion signal sequence or a genetically engineered secretion signal sequence. The size of the exogenous β intron and hence the position of the exogenous regulatory region relative to the coding region of the gene is variable and its changes can be used to optimize the function of the regulatory region.
Pro kteroukoliv aktivační strategii není nutné, aby byla obě cílová místa těsně přilehlá nebo blízce sousedící. Pokud spolu tato místa těsně nesousedí, je část oblasti proti směru transkripce normálního IFNA2 genu a/nebo část kódující oblasti homologní rekombinaci odstraněna.For any activation strategy, it is not necessary for both target sites to be closely adjacent or closely adjacent. If these sites are not closely adjacent, a portion of the upstream region of the normal IFNA2 gene and / or a portion of the coding region is removed by homologous recombination.
Metodou homologní rekombinace mohou být do chromozómové DNA vneseny mutace usnadňující ovlivnění exprese endogenního IFNA2. Například může být žádoucí zrušit nevhodný a nežádoucí ATG iniciační kodon umístěný proti směru transkripce od správného ATG iniciační20 ho kodonu a mezi exogenní regulační oblastí a endogenní IFNA2 kódující oblastí v homologně rekombinantním lokusu. Za tímto účelem lze využít směrující konstrukt mající směrující sekvenci homologní s místem v genomu, které zahrnuje i nežádoucí ATG iniciační kodon. Tato směrující sekvence obsahuje nukleotidy, které nesou požadovanou mutaci, například ATT místo ATG. Směrující konstrukt může obsahovat jeden nebo více selekčních znaků pro usnadnění selekce homologně rekombinantních buněk. Exogenní regulační oblast může být poté vnesena do homologně rekombinantních buněk proti směru transkripce vzhledem k pozměněným místům s použitím metody ovlivnění exprese podle vynálezu.By the method of homologous recombination, mutations can be introduced into the chromosome DNA to facilitate the expression of endogenous IFNA2. For example, it may be desirable to abolish an inappropriate and unwanted ATG initiation codon located upstream of the correct ATG initiation codon and between the exogenous regulatory region and the endogenous IFNA2 coding region at the homologously recombinant locus. For this purpose, a targeting construct having a targeting sequence homologous to a site in the genome that includes an undesired ATG initiation codon may be utilized. This targeting sequence comprises nucleotides that carry the desired mutation, for example an ATT site of the ATG. The targeting construct may comprise one or more selection traits to facilitate selection of homologously recombinant cells. The exogenous regulatory region can then be introduced into homologously recombinant cells upstream of the altered sites using the expression control method of the invention.
Alternativně mohou být exogenní regulační oblast a požadovaná(é) mutovaná(é) sekvence vne30 seny do genomu v jediném kroku. DNA konstrukt použitý pro tento typ aplikace obsahuje jak exogenní regulační oblast, tak i směrující sekvenci, která obsahuje požadovanou mutaci (mutace). Dalším způsobem je kotransfekce nebo koinfekce cílových buněk dvěma různými konstrukty, kde jeden konstrukt obsahuje regulační oblast a druhý konstrukt nese požadovanou mutaci.Alternatively, the exogenous regulatory region and the desired mutated sequence (s) may be inserted into the genome in a single step. The DNA construct used for this type of application contains both an exogenous regulatory region and a targeting sequence that contains the desired mutation (s). Another way is to co-transfect or co-infect target cells with two different constructs, where one construct contains a regulatory region and the other construct carries the desired mutation.
Pokud je to žádoucí, může být podobným způsobem do genomu vneseno také savčí akceptorové místo sestřihu, například do oblasti mezi nežádoucí ATG iniciační kodon a správný ATG iniciační kodon. DNA konstrukt pro tento účel obsahuje směrující sekvenci homologní s genomovou oblastí proti směru transkripce od správného IFNA2 iniciačního kodonu a dále sekvenci odpovídající požadovanému akceptorovému místu sestřihu, která je přímo součástí homologní oblasti, nebo která je k ní přilehlá. Buňky obsahující správný rekombinovaný IFNA2 lokus jsou poté transfektovány nebo infikovány druhým konstruktem, který obsahuje exogenní regulační oblast a exon s nespárovaným donorovým místem sestřihu na svém 3' konci spolu se směrující sekvencí (nebo sekvencemi), jež směrují druhý konstrukt do genomové oblasti proti směru transkripce vzhledem k předem vnesenému akceptorovému místu sestřihu. Primární transkript, produkovaný pod kontrolou exogenní regulační oblasti, zahrnuje exogenní exon, exogenní donorové místo sestřihu, exogenní akceptorové místo sestřihu, jakoukoliv sekvenci mezi těmito elementy, a dále sekvenci mezi exogenním akceptorovým místem sestřihu a transkripčním terminačním místem endogenního IFNA2 genu. Sestřihem se donorové místo sestřihu v transkriptů a akceptorové místo sestřihu přiblíží a mezi nimi ležící intronová RNA, která může obsahovat nežádoucí AUG iniciační kodony, bude vystřižena. Všechny problémy, spojené s existencí nežádoucích AUG translačních iniciačních kodonu v transkriptů v oblasti mezi transkripčním startem a IFNA2 kódující sekvencí jsou takto odstraněny. Samozřejmě mohou být regulační oblast, exon, donorové místo sestřihu i akceptorové místo sestřihu vneseny do genomu v jediném kroku. DNA konstrukt, použitý pro tuto aplikaci, obsahuje regulační oblast, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu, směrující sekvenci homologní s genomovou oblastí mezi správnýmIf desired, a mammalian splice acceptor site can also be introduced into the genome in a similar manner, for example, into the region between the undesired ATG initiation codon and the correct ATG initiation codon. For this purpose, the DNA construct comprises a targeting sequence homologous to the genomic region upstream of the correct IFNA2 initiation codon and a sequence corresponding to the desired splice acceptor site that is directly part of or adjacent to the homologous region. Cells containing the correct recombined IFNA2 locus are then transfected or infected with a second construct comprising an exogenous regulatory region and an exon with an unpaired splice donor site at its 3 'end together with a targeting sequence (or sequences) that direct the second construct to the genomic region upstream relative to the previously introduced splice acceptor site. The primary transcript produced under the control of the exogenous regulatory region includes an exogenous exon, an exogenous splice donor site, an exogenous splice acceptor site, any sequence between these elements, and a sequence between the exogenous splice acceptor site and the transcription termination site of the endogenous IFNA2 gene. By splicing, the splice donor site in the transcripts and the splice acceptor site approach and the intron RNA lying between them, which may contain unwanted AUG initiation codons, will be excised. All problems associated with the existence of undesirable AUG translation initiation codons in transcripts in the region between the transcriptional start and the IFNA2 coding sequence are thus eliminated. Of course, the regulatory region, exon, splice donor site, and splice acceptor site can be introduced into the genome in a single step. The DNA construct used for this application comprises a regulatory region, exon, splice donor site, intron, splice acceptor site directing a sequence homologous to the genomic region between the correct
-7 CZ 299418 B6-7 GB 299418 B6
IFNA2 iniciačním kodonem a nežádoucím ATG kodonem a volitelně také jeden nebo více selekčních znaků. Alternativně mohou být vhodné i dva nezávislé směrující konstrukty, kde jeden obsahuje regulační oblast, exon a donorové místem sestřihu a druhý obsahuje akceptorové místo sestřihu. Oba konstrukty mohou být vneseny do cílových buněk v jediném kroku.IFNA2 is an initiation codon and an undesired ATG codon, and optionally also one or more selection markers. Alternatively, two independent targeting constructs may be suitable, one containing the regulatory region, the exon and the splice donor site, and the other comprising the splice acceptor site. Both constructs can be introduced into target cells in a single step.
DNA konstrukt.DNA construct.
DNA konstrukt podle vynálezu obsahuje přinejmenším směrující sekvenci a regulační sekvenci. Kromě toho může volitelně obsahovat exon; nebo exon a donorové místo sestřihu; nebo exon, donorové místo sestřihu, intron a akceptorové místo sestřihu. Je-li součástí konstruktu exon, je umístěn na 3' konci regulační oblasti a je-li součástí konstruktu donorové místo sestřihu, je lokalizováno na 3' konci exonu. Intron a akceptorové místo sestřihu jsou, pokud jsou v konstruktu přítomny, lokalizovány na 3' konci donorového místa sestřihu. Dále může konstrukt obsahovat více exonů a intronů (s odpovídajícími donorovými a akceptorovými místy sestřihu). DNA v konstruktu je označována jako exogenní, neboť tato DNA není originální součástí genomu hostitelské buňky. Exogenní DNA může obsahovat sekvence identické nebo odlišné od endogenní genomové DNA, přítomné v buňce před transfekci nebo infekcí virovým vektorem. Tak, jak je použit zde, termín „transfekce“ označuje vnesení plazmidů do buňky nevirovou (tj. chemickou nebo fyzikální) metodou jako je například koprecipitace s fosforečnanem vápenatým nebo chlori20 dem vápenatým, transfekce zprostředkovaná DEAE-dextranem, lipofekce, elektroporace, mikroinjekce, mikroprojektily a podobně. Termínem „infekce“ označujeme vnesení virového vektoru do buňky metodou virové infekce. Nejrůznější elementy, které jsou součástí DNA konstruktu podle vynálezu, jsou detailněji popsány v následujícím textu.The DNA construct of the invention comprises at least a targeting sequence and a regulatory sequence. In addition, it may optionally contain an exon; or an exon and a splice donor site; or an exon, splice donor site, intron, and splice acceptor site. If the construct is an exon, it is located at the 3 'end of the regulatory region, and if the construct is a splice donor site, it is located at the 3' end of the exon. The intron and the splice acceptor site, if present in the construct, are located at the 3 'end of the splice donor site. Further, the construct may contain multiple exons and introns (with corresponding splice donor and acceptor sites). The DNA in the construct is referred to as exogenous, since this DNA is not an original part of the host cell genome. The exogenous DNA may comprise sequences identical or different to the endogenous genomic DNA present in the cell prior to transfection or infection with the viral vector. As used herein, the term "transfection" refers to the introduction of plasmids into a cell by a non-viral (ie, chemical or physical) method such as calcium phosphate or calcium chloride coprecipitation, DEAE-dextran mediated transfection, lipofection, electroporation, microinjection, microprojectiles etc. The term "infection" refers to the introduction of a viral vector into a cell by a viral infection method. The various elements that are part of the DNA construct of the invention are described in more detail below.
DNA konstrukt může dále obsahovat cis- nebo /ra«5-působící virové sekvence (například obalovací signály), umožňující dopravení konstruktu do jádra buňky metodou infekce virovým vektorem. Pokud je to nutné, může být DNA konstrukt odpřažen od některých částí virového životního cyklu, jako je například integrace retroviru do genomu s pomocí integrázy nebo udržování epizómu v buňce. Tohoto odpřažení může být dosaženo odpovídajícími delecemi nebo mutacemi viro30 vých sekvencí, například delecí oblasti kódující integrázu u retrovirových vektorů. Další detaily týkající se konstrukce a použití virových vektorů jsou uvedeny například v Robbins et al., Pharmacol. Ther. 80: 35-47, 1998 a Gunzburg et al., Mol. Med. Today 1: 410—417, 1995, které jsou zde zahrnuty odkazem.The DNA construct may further comprise cis- and / or β-acting viral sequences (e.g., envelope signals) allowing delivery of the construct to the cell nucleus by a viral vector infection. If necessary, the DNA construct can be detached from some parts of the viral life cycle, such as integrating a retrovirus into the genome by integrase or maintaining an episome in the cell. This excision can be achieved by corresponding deletions or mutations of the viral 30 sequences, for example, deletion of the integrase coding region in retroviral vectors. Further details regarding the construction and use of viral vectors are given, for example, in Robbins et al., Pharmacol. Ther. 80: 35-47, 1998 and Gunzburg et al., Mol. Copper. Today 1: 410-417, 1995, which are incorporated herein by reference.
Směrující sekvence.Routing sequence.
Směrující sekvence umožňují homologní rekombinaci požadované sekvence do vybrané oblasti hostitelského genomu. Směrující sekvence jsou homologní (tj. schopné homologní rekombinace) s jejich odpovídajícími cílovými místy v hostitelském genomu.The targeting sequences allow homologous recombination of the desired sequence into a selected region of the host genome. The targeting sequences are homologous (ie capable of homologous recombination) with their corresponding target sites in the host genome.
Cirkulární DNA konstrukt může obsahovat jedinou směrující sekvenci, nebo dvě či více oddělených směrujících sekvencí. Lineární DNA konstrukt může obsahovat dvě nebo více oddělených směrujících sekvencí. Cílové místo, se kterým je daná směrující sekvence homologní, se může nacházet uvnitř kódující oblasti IFNA2 genu, proti směru transkripce a těsně přilehlé ke kódující oblasti nebo proti směru transkripce ale vzdálené od kódující oblasti.The circular DNA construct may comprise a single targeting sequence, or two or more separate targeting sequences. The linear DNA construct may comprise two or more separate targeting sequences. The target site with which a given targeting sequence is homologous can be located within the coding region of the IFNA2 gene, upstream of and closely adjacent to the coding region or upstream but remote from the coding region.
První ze dvou směrujících sekvencí v konstruktu (nebo celá směrující sekvence, pokud konstrukt obsahuje jen jednu směrující sekvenci) je odvozena od nově popsaných genomových oblastí proti směru transkripce od IFNA2 kódující oblasti. Tato směrující sekvence obsahuje část (napříkladThe first of the two targeting sequences in the construct (or the entire targeting sequence if the construct contains only one targeting sequence) is derived from the newly described genomic regions upstream of the IFNA2 coding region. This routing sequence comprises a portion (e.g.
20 nebo více po sobě následujících nukleotidů) SEQ ID NO:11, například část SEQ ID NO:7, 8 nebo 12. Druhá ze dvou směrujících sekvencí v konstruktu může být namířena proti genomové oblasti proti směru transkripce vzhledem ke kódující sekvenci, nebo může být namířena proti části nebo proti celé kódující sekvenci. Například může druhá směrující sekvence obsahovat na svém 3' konci „exogenní“ kódující oblast identickou s několika prvními kodony IFNA2 kódující sekvence. Homologní rekombinaci rekombinuje exogenní kódující oblast s částí endogenní20 or more consecutive nucleotides) of SEQ ID NO: 11, for example a portion of SEQ ID NO: 7, 8 or 12. The second of the two targeting sequences in the construct may be directed against the genomic region upstream of the coding sequence, or may be directed against part or all of the coding sequence. For example, the second targeting sequence may comprise at its 3 'end an "exogenous" coding region identical to the first few codons of the IFNA2 coding sequence. Homologous recombination recombines the exogenous coding region with an endogenous portion
-8CZ 299418 B6-8EN 299418 B6
IFNA2 kódující sekvence. Pokud je to žádoucí, může exogenní kódující oblast kódovat heterologní aminokyselinovou sekvenci, pokud zůstává tato exogenní kódující oblast dostatečně homologní s endogenní kódující sekvencí, kterou nahrazuje, aby mezi nimi mohla proběhnout homologní rekombinace.IFNA2 coding sequence. If desired, the exogenous coding region may encode a heterologous amino acid sequence as long as the exogenous coding region remains sufficiently homologous to the endogenous coding sequence it replaces to allow homologous recombination between them.
Směrující sekvence může kromě toho zahrnovat také sekvence odvozené od dříve popsané oblasti IFNA2 genu včetně těch, které jsou popsány zde, stejně jako od oblasti lokalizované ještě dále proti směru transkripce, jejíž struktura dosud nebula popsána, ale která může být zkušenými odborníky charakterizována.The targeting sequence may additionally include sequences derived from the previously described region of the IFNA2 gene, including those described herein, as well as from a region located even further upstream, whose structure has not yet been described, but which can be characterized by those skilled in the art.
Genomové fragmenty, vhodné pro použití ve funkci směrujících sekvencí, mohou být identifikovány na základě jejich schopnosti hybridizovat se sondou obsahující celou nebo část sekvence SEQ ID NO:11. Taková sonda může být připravena metodou PCR s použitím primerů odvozených od SEQ ID NO: 11.Genomic fragments suitable for use in the function of targeting sequences may be identified by their ability to hybridize to a probe comprising all or part of the sequence of SEQ ID NO: 11. Such a probe may be prepared by PCR using primers derived from SEQ ID NO: 11.
Regulační sekvence.Regulatory sequence.
Regulační sekvence DNA konstruktu může obsahovat jeden nebo více promotorů (například konstitutivní, tkáňově specifický nebo inducibilní promotor), zesilovače, oblasti zajišťující vazbu na smyčkovité struktury chromozomální DNA (tzv. „scaffold-attachment regions“) nebo matrixvazebná místa, elementy negativní regulace, vazebná místa pro transkripční faktory nebo kombinaci těchto elementů.The regulatory sequence of a DNA construct may comprise one or more promoters (e.g., a constitutive, tissue-specific or inducible promoter), enhancers, scaffold-attachment regions or matrix-binding sites, negative-regulatory elements, binding sites for transcription factors or a combination of these elements.
Regulační sekvence může být odvozena od eukaryotického (například savčího) nebo virového genomu. Mezi vhodné regulační sekvence patří například (ale nikoliv výhradně) sekvence, které regulují expresi SV40časných nebo pozdních genů, genů cytomegaloviru a hlavních pozdních genů adenovirů. Do této skupiny patří také regulační oblasti odvozené od genů kódujících myší metalothionein-1, elongační faktor-ία, kolagen (například kolagen Ial, kolagen Ia2 a kolagen IV), aktin (například γ-aktin), imunoglobulin, HMG-CoA reduktázu, glyceraldehyd fosfát dehydrogenázu, 3-fosfoglycerátkinázu, kolagenázu, stromelyzin, fibronektin, vimentin, inhibitor aktivátoru plazminogenu I, thymosin B4, tkáňové inhibitory metaloproteinázy, ribozomální proteiny, molekuly hlavního histokompatibilitního komplexu a lidské leukocytámí antigeny.The regulatory sequence may be derived from a eukaryotic (e.g., mammalian) or viral genome. Suitable regulatory sequences include, but are not limited to, sequences that regulate SV40 expression of early or late genes, cytomegalovirus genes, and major late adenovirus genes. This group also includes regulatory regions derived from genes encoding mouse metallothionein-1, elongation factor-ία, collagen (e.g., collagen Ia1, collagen Ia2 and collagen IV), actin (e.g., γ-actin), immunoglobulin, HMG-CoA reductase, glyceraldehyde phosphate dehydrogenase, 3-phosphoglycerate kinase, collagenase, stromelysin, fibronectin, vimentin, plasminogen I activator inhibitor, thymosin B4, tissue metalloproteinase inhibitors, ribosomal proteins, major histocompatibility complex molecules, and human leukocyte antigens.
Regulační sekvence s výhodou obsahují vazebné místo pro transkripční faktory jako napříkladThe regulatory sequences preferably comprise a binding site for transcription factors such as
TATA box, CCAAT box, API, Spi nebo NF-κΒ vazebné místo.TATA box, CCAAT box, API, Spi or NF-κΒ binding site.
Indikátorové geny.Indicator genes.
Pokud je to žádoucí, může konstrukt obsahovat sekvenci kódující požadovaný polypeptid, opera40 tivně spojenou se svým vlastním promotorem. Příkladem může být gen pro selekční znak, který se používá pro usnadnění identifikace spojení směrující sekvence s její cílovou sekvencí. Gen pro amplifikovatelný znak může být také součástí konstruktu a používá se pro usnadnění selekce buněk s koamplifikovanými přilehlými DNA sekvencemi. Buňky obsahující amplifikované kopie amplifikovatelného znaku jsou rozpoznány na základě růstu v přítomnosti látky, která odlišuje buňky exprimující amplifikovatelný gen. Aktivovaný endogenní IFNA2 gen je amplifikován v tandemu spolu s amplifikovatelným selekčním znakem. Buňky obsahující více kopií aktivovaného endogenního genu mohou produkovat velmi vysoké koncentrace IFNA2 a jsou tudíž vhodné pro in vitro produkci proteinu nebo genovou terapii.If desired, the construct may comprise a sequence encoding a polypeptide of interest, operably linked to its own promoter. An example may be a selectable marker gene that is used to facilitate identification of a linker targeting sequence with its target sequence. The amplifiable trait gene may also be part of the construct and is used to facilitate selection of cells with co-amplified adjacent DNA sequences. Cells containing amplified copies of the amplifiable trait are recognized by growth in the presence of a substance that differentiates cells expressing the amplifiable gene. The activated endogenous IFNA2 gene is amplified in tandem along with an amplifiable selection marker. Cells containing multiple copies of an activated endogenous gene can produce very high concentrations of IFNA2 and are therefore suitable for in vitro protein production or gene therapy.
Geny pro selekční a amplifikovatelný znak nemusí nutně ležet v těsné blízkosti. Gen pro selekční znak může být shodný s genem pro amplifikovatelný znak. Jeden nebo oba identifikační geny mohou být součástí intronu DNA konstruktu. Vhodné identifikační geny obou typů jsou popsány v patentu US 5 641 670.The genes for the selectable and amplifiable trait do not necessarily lie in close proximity. The selectable marker gene may be identical to the amplifiable marker gene. One or both of the identifying genes may be part of an intron of the DNA construct. Suitable identifying genes of both types are described in U.S. Patent No. 5,641,670.
-9CZ 299418 B6-9EN 299418 B6
Donorové místo sestřihu a akceptorové místo sestřihu.Donor splice site and acceptor splice site.
DNA konstrukt může dále obsahovat exon, donorové místo sestřihu na 3' konci exonu, intron a akceptorové místo sestřihu.The DNA construct may further comprise an exon, a splice donor site at the 3 'end of the exon, an intron, and a splice acceptor site.
Donorové místo sestřihu je sekvence, která řídí sestřih jednoho exonu RNA transkriptu k akceptorovému místu dalšího exonu transkriptu. Výsledkem sestřihu je odstranění intronu mezi těmito dvěma místy. Typicky leží první exon ve směru 5' vzhledem ke druhému exonu a donorové místo ío sestřihu, lokalizované na 3' konci prvního exonu, se páruje s akceptorovým místem sestřihu, ležícím těsně vedle druhého exonu na jeho 5' konci. Donorová místa sestřihu mají charakteristickou konzervovanou sekvenci (A/C)AGGURAGU (kde R představuje purinový nukleotid), kdeThe splice donor site is a sequence that directs splicing of one exon of the RNA transcript to the acceptor site of another exon of the transcript. The result of splicing is the removal of the intron between the two sites. Typically, the first exon lies 5 'with respect to the second exon and the splice donor site located at the 3' end of the first exon is paired with the acceptor splice site adjacent to the second exon at its 5 'end. The splice donor sites have a characteristic conserved sequence (A / C) of AGGURAG (where R represents a purine nucleotide), wherein
GU v pozici 4 a 5 jsou nezbytná (Jackson, Nucleic Acids Research 19: 3715-3798, 1991). První tři nukleotidy konzervovaného donorového místa sestřihu jsou zároveň poslední tři nukleotidy exonu: tj. nejsou odstřiženy. Donorová místa sestřihu jsou funkčně definována na základě své schopnosti uskutečnit odpovídající reakci v rámci mRNA sestřihové dráhy.GUs at positions 4 and 5 are necessary (Jackson, Nucleic Acids Research 19: 3715-3798, 1991). The first three nucleotides of the conserved splice donor site are also the last three nucleotides of the exon: i.e., they are not cut. The splice donor sites are functionally defined based on their ability to carry out a corresponding reaction within the mRNA splice pathway.
Akceptorové místo sestřihu v konstruktu podle vynálezu zajišťuje spolu s donorovým místem sestřihu sestřih intronu mezi dvěma exony. Akceptorové místo sestřihu má charakteristickou sekvenci (Y)]0NYAG (SEQ ID NO: 19) kde Y představuje jakýkoliv pyrimidin a N představuje jakýkoliv nukleotid (Jackson, Nucleic Acids Research 19: 3715-3798, 1991).The splice acceptor site in the construct of the invention provides, together with the splice donor site, splicing of the intron between two exons. The splice acceptor site has the characteristic sequence (Y) 10 NYAG (SEQ ID NO: 19) wherein Y represents any pyrimidine and N represents any nucleotide (Jackson, Nucleic Acids Research 19: 3715-3798, 1991).
CAP místo.CAP instead.
DNA konstrukt může volitelně obsahovat také CAP místo. CAP místo je specifický transkripční start, který je asociovaný s a využívaný regulační oblastí. CAP místo je v konstruktu lokalizováno vzhledem k regulační sekvenci tak, že po proběhlé homologní rekombinaci řídí regulační sekvence syntézu transkriptu, který začíná v CAP místě. Alternativně nemusí být CAP místo součástí konstruktu a pak transkripční aparát implicitně lokalizuje odpovídající místo v cílovém genu, a to je pak použito jako CAP místo.The DNA construct may optionally also contain a CAP site. The CAP site is a specific transcriptional start that is associated with and utilized by the regulatory region. The CAP site is located in the construct with respect to the regulatory sequence such that after homologous recombination, the regulatory sequence directs the synthesis of a transcript that begins at the CAP site. Alternatively, the CAP site may not be part of the construct, and then the transcriptional machinery implicitly locates the corresponding site in the target gene, and this is then used as the CAP site.
Další DNA elementy.Other DNA elements.
Konstrukt může dále obsahovat sekvence, které ovlivňují strukturu nebo stabilitu RNA nebo proteinu, připraveného homologní rekombinací.The construct may further comprise sequences that affect the structure or stability of the RNA or protein prepared by homologous recombination.
Volitelně může DNA konstrukt obsahovat bakteriální počátek replikace oři a některý bakteriální selekční znak, například gen nesoucí rezistenci vůči antibiotiku. To umožňuje množení plazmidů v bakteriích nebo jiném vhodném klonovacím/hostitelském systému ve velkém měřítku.Optionally, the DNA construct may comprise a bacterial origin of replication and some bacterial selection marker, for example an antibiotic resistance gene. This allows the plasmids to multiply in bacteria or other suitable large-scale cloning / host system.
Všechny výše popsané elementy DNA konstruktu jsou operativně spojeny nebo funkčně umístěny v konstruktu s ohledem na vzájemné vazby. To znamená, že následkem homologní rekombinace mezi konstruktem a cílovým místem v genomu, může regulační sekvence řídit produkci primárního RNA transkriptu, který začíná v CAP místě (volitelně může být CAP místo součástí konstruktu) a zahrnuje sekvenci ležící mezi CAP místem a endogenním STOP-kodonem IFNA2 genu.All of the above-described elements of the DNA construct are operably linked or functionally positioned within the construct with respect to each other. That is, due to homologous recombination between the construct and the target site in the genome, the regulatory sequence can direct the production of a primary RNA transcript that begins at the CAP site (optionally, the CAP site may be part of the construct) and includes a sequence lying between the CAP site and endogenous STOP-codon. IFNA2 gene.
V závislosti na lokalizaci CAP místa může tato sekvence zahrnovat i část endogenní regulační oblasti IFNA2 genu, stejně jako sekvence, které s touto oblastí sousedí a normálně nejsou přepi50 sovány. Pokud konstrukt obsahuje exon a donorové a akceptorové místo sestřihu, pak i primární transkript obsahuje exon, dvě místa sestřihu a intron ležící mezi těmito dvěma místy.Depending on the location of the CAP site, this sequence may include a portion of the endogenous regulatory region of the IFNA2 gene, as well as sequences that are adjacent to this region and are not normally transcribed. If the construct contains an exon and a donor and acceptor splice site, then the primary transcript also includes an exon, two splice sites, and an intron lying between the two sites.
Pořadí jednotlivých elementů v DNA konstruktu může být variabilní. Pokud je konstruktem cirkulární plazmid nebo virový vektor, je relativní pořadí jednotlivých elementů ve výsledné struktuře například: směrující sekvence, plazmidová DNA (obsahující sekvence použité proThe order of the individual elements in the DNA construct may be variable. If the construct is a circular plasmid or a viral vector, the relative order of the individual elements in the resulting structure is, for example: the targeting sequence, the plasmid DNA (containing the sequences used for
-10CZ 299418 B6 selekci a/nebo replikaci směrujícího plazmidů v mikrobiálním nebo jiném vhodném hostiteli), sekvence usnadňující selekci (tzv. selekční znak), regulační sekvence, exon, donorové místo sestřihu, intron a akceptorové místo sestřihu.Selection and / or replication of targeting plasmids in a microbial or other suitable host), a selection facilitating sequence (a so-called selection marker), a regulatory sequence, an exon, a splice donor site, an intron, and an acceptor splice site.
Je-li konstrukt lineární, je pořadí jednotlivých elementů například následující: první směrující sekvence, selekční znak, regulační sekvence, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu a druhá směrující sekvence, nebo, alternativně, první směrující sekvence, regulační sekvence, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu, selekční znak, případně interní ribozom-vazebné místo a nakonec druhá směrující sekvence.For example, if the construct is linear, the sequence of the individual elements is as follows: first targeting sequence, selection marker, regulatory sequence, exon, splice donor site, intron, splice acceptor site, and second targeting sequence, or, alternatively, first targeting sequence, regulatory sequence, exon, splice donor site, intron, splice acceptor site, selection marker, optionally internal ribosome-binding site, and finally a second targeting sequence.
Alternativně může být pořadí následující: první směrující sekvence, první selekční znak, regulační sekvence, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu, druhá směrující sekvence a druhý selekční znak; nebo první směrující sekvence, regulační sekvence, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu, první selekční znak, druhá směrující sek15 vence a druhý selekční znak.Alternatively, the sequence may be as follows: first targeting sequence, first selection marker, regulatory sequence, exon, splice donor site, intron, splice acceptor site, second targeting sequence, and second selection feature; or a first targeting sequence, a regulatory sequence, an exon, a splice donor site, an intron, a splice acceptor site, a first selection marker, a second targeting strand cleavage, and a second selection marker.
Rekombinace mezi směrujícími sekvencemi sousedícími s prvním selekčním znakem a homologními sekvencemi v hostitelském genomu má za následek směrovanou intergraci prvního selekčního znaku, zatímco druhý selekční znak není integrován. Žádoucí transfektované nebo infikované buňky jsou takové, které jsou stabilně transfektovány nebo infikovány prvním, ale nikoliv druhým selekčním znakem. Takové buňky mohou být selektovány na základě růstu v médiu s obsahem látky, která zvýhodňuje buňky exprimující první selekční znak a druhé látky, která selektuje pro buňky exprimující druhý selekční znak. Transfektované nebo infikované buňky s nesprávně integrovaným směrujícím konstruktem (tj. buňky u nichž došlo k integraci konstruktu jiným mechanizmem než homologní rekombinací) budou exprimovat i druhý selekční znak a tudíž budou v selekčním médiu zabity.Recombination between targeting sequences adjacent to the first selection marker and homologous sequences in the host genome results in a directed integration of the first selection marker, while the second selection marker is not integrated. Desirable transfected or infected cells are those that are stably transfected or infected with a first but not a second selection marker. Such cells may be selected by growth in a medium containing a substance that favors cells expressing the first selection marker and a second substance that selects for cells expressing the second selection marker. Transfected or infected cells with an improperly integrated targeting construct (i.e., cells that have been integrating the construct by a mechanism other than homologous recombination) will also express a second selection trait and thus be killed in the selection medium.
V některých případech je součástí konstruktu i znak umožňující pozitivní selekci, tj. takový, který umožňuje selekci buněk obsahujících amplifikované kopie tohoto znaku. V takovém případě je pořadí jednotlivých elementů v konstruktu například následující: první směrující sekvence, amplifikovatelný znak pro pozitivní selekci, (volitelně) druhý selekční znak, regulační sekvence, exon, donorové místo sestřihu, intron, akceptorové místo sestřihu a druhá směrující sekvence.In some instances, a construct for positive selection is included in the construct, that is, one that allows the selection of cells containing amplified copies of the trait. In such a case, the order of the elements in the construct is, for example, as follows: first targeting sequence, amplifiable positive selection marker, (optionally) second selection marker, regulatory sequence, exon, splice donor site, intron, splice acceptor site and second targeting sequence.
Jednotlivé elementy DNA konstruktu mohou být získány buď z přirozených zdrojů (např. geno35 mová DNA), nebo mohou být získány metodami genového inženýrství a nebo mohou být připraveny synteticky. Regulační oblast, CAP místo, donorové místo sestřihu, intron a akceptorové místo sestřihu mohou být izolovány ve formě kompletní jednotky například z genu pro lidský elongační faktor-ία (Genbank, sekvence HUMEF1A) nebo z oblasti velmi časných genů cytomegaloviru (Genbank, sekvence HEHCMVP1). Tyto komponenty ovšem mohou být izolo40 vány i z jednotlivých genů.Individual elements of the DNA construct may be obtained either from natural sources (eg, genomic DNA), or may be obtained by genetic engineering methods, or may be synthetically prepared. The regulatory region, CAP site, splice donor site, intron, and splice acceptor site can be isolated as a complete unit, for example, from the human elongation factor-ία gene (Genbank, sequence HUMEF1A) or from the region of the very early cytomegalovirus genes (Genbank, HEHCMVP1) . However, these components can also be isolated from individual genes.
Transfekce nebo infekce a homologní rekombinace.Transfection or infection and homologous recombination.
DNA konstrukt podle vynálezu může být vnesen do buňky, například primární, sekundární nebo nesmrtelné buněčné linie, jako jediný DNA konstrukt nebo ve formě oddělených DNA sekvencí, které se inkorporují do chromozomální nebo jaderné DNA transfektované nebo infikované buňky. Termínem „transfektovaná buňka“ označujeme buňku, do které (nebo do jejíhož předka) byla vnesena molekula DNA nebo RNA jiným způsobem než s použitím virového vektoru. Termínem „infikovaná buňka“ označujeme buňku, do které (nebo do jejíhož předka) byla vnesena molekulaThe DNA construct of the invention can be introduced into a cell, for example a primary, secondary or immortalized cell line, as a single DNA construct or in the form of separate DNA sequences that are incorporated into the chromosomal or nuclear DNA of the transfected or infected cell. The term "transfected cell" refers to a cell into (or whose ancestor) a DNA or RNA molecule has been introduced in a manner other than using a viral vector. The term "infected cell" refers to a cell into which (or to whose ancestor) a molecule has been introduced
DNA nebo RNA s použitím virového vektoru. Mezi viry, vhodné pro použití ve funkci vektorů, patří adenoviry, adeno-asociované viry, Herpes virus, virus příušnic, poliovirus, lentivirus, retroviry, Sindbis virus a viry vakcinie jako například virus ptačích neštovic. DNA může být do buněk vnesena ve formě lineární, dvouřetězcové (s nebo bez jednořetězcových oblastí na obou koncích), jednořetězcové nebo cirkulámí molekuly. Je-li konstrukt vnesen do hostitelských buněk ve formě dvou oddělených DNA fragmentů, pak oba tyto fragmenty sdílejí určitou sekvenční homologiiDNA or RNA using a viral vector. Viruses suitable for use in the function of vectors include adenoviruses, adeno-associated viruses, Herpes virus, mumps virus, poliovirus, lentivirus, retroviruses, Sindbis virus, and vaccinia viruses such as avian pox virus. The DNA can be introduced into cells in the form of a linear, double stranded (with or without single stranded regions at both ends), single stranded or circular molecules. When the construct is introduced into host cells in the form of two separate DNA fragments, both fragments share some sequence homology
-11 CZ 299418 B6 (překryv) na 3' konci jednoho fragmentu a na 5' konci fragmenty druhého, přičemž jeden z fragmentů nese první směrující sekvenci zatímco druhý fragment nese druhou směrující sekvenci. Po vnesení do buňky může mezi oběma fragmenty proběhnout homologní rekombinace za vzniku jediné molekuly nesoucí první i druhou směrující sekvenci, které ohraničují oblast překryvu mezi dvěma původními fragmenty. Výsledná molekula se potom nachází ve formě, schopné homologní rekombinace s cílovými místy v buněčném genomu. Může být použito i více fragmentů než zmíněné dva, přičemž každý z fragmentů je navržen tak, že mezi jednotlivými fragmenty dochází k homologní rekombinaci, jejímž produktem může být jedině DNA fragment schopný homologní rekombinace s cílovými místy v buňce tak, jak to bylo popsáno výše.(Overlapping) at the 3 'end of one fragment and at the 5' end the fragments of the other, wherein one of the fragments carries the first targeting sequence while the other fragment carries the other targeting sequence. Upon introduction into the cell, homologous recombination can take place between the two fragments to form a single molecule carrying both the first and second targeting sequences, which delimit the overlap region between the two original fragments. The resulting molecule is then in a form capable of homologous recombination with target sites in the cellular genome. More fragments than the two can be used, each of which is designed such that homologous recombination occurs between the fragments, the only product being a DNA fragment capable of homologous recombination with the target sites in the cell as described above.
Pokud DNA konstrukt podle vynálezu nenese selekční znak sám o sobě, může být ko-transfektován nebo ko-infikován společně s jiným konstruktem, který takový znak nese. Směrující plazmid může být před transfekci nebo infekcí štěpen restrikčním enzymem na jednom nebo více místech za vzniku lineární nebo přerušené molekuly. Takto vzniklé volné konce DNA zvyšují frekvenci vzniku požadované homologní rekombinace. Kromě toho mohou být volné konce DNA opracovány exonukleázou za vzniku přesahujících 3' nebo 5' jednořetězcových DNA konců (dlouhých například nejméně 30 nukleotidů, nejraději pak dlouhých 100 až 1000 nukleotidů. Takové konce opět zvyšují frekvenci vzniku požadované homologní rekombinace. V tomto případě vznikají následkem homologní rekombinace mezi směrující sekvencí a její cílovou sekvencí v genomu dvě kopie směrujících sekvencí, které ohraničují elementy obsažené v vneseném plazmidů.If the DNA construct of the invention does not carry a selection marker per se, it may be co-transfected or co-infected with another construct carrying such a trait. The targeting plasmid may be cleaved with a restriction enzyme at one or more sites prior to transfection or infection to form a linear or disrupted molecule. The resulting free DNA ends increase the frequency of homologous recombination. In addition, the free ends of the DNA can be treated with exonuclease to produce overlapping 3 'or 5' single-stranded DNA ends (e.g. at least 30 nucleotides in length, preferably 100-1000 nucleotides in length). These ends again increase the frequency of homologous recombination desired. homologous recombination between the targeting sequence and its target sequence in the genome two copies of the targeting sequences that flank the elements contained in the introduced plasmids.
Buňky mohou být transfektovány DNA konstrukty (nejraději in vitro) celou řadou fyzikálních nebo chemických metod včetně například elektroporace, mikroinjekce, bombardování mikroprojektily, precipitace fosforečnanem vápenatým, transfekce pomocí lipozómů, nebo transfekce zprostředkované DEAE-dextranem.Cells can be transfected with DNA constructs (preferably in vitro) by a variety of physical or chemical methods including, for example, electroporation, microinjection, microprojectile bombardment, calcium phosphate precipitation, liposome transfection, or DEAE-dextran mediated transfection.
Transfektované nebo infikované buňky jsou kultivovány za podmínek, které umožňují proběhnutí homologní rekombinace, tak jak je to popsáno v odborné literatuře (viz např. Capecchi, Science 24: 1288-1292, 1989). Pokud jsou homologně rekombinantní buňky kultivovány za podmínek umožňujících transkripci DNA, regulační oblast vnesená DNA konstruktem ovlivní transkripci IFNA2 genu.Transfected or infected cells are cultured under conditions that allow homologous recombination to occur as described in the literature (see, eg, Capecchi, Science 24: 1288-1292, 1989). When homologously recombinant cells are cultured under conditions permitting transcription of DNA, the regulatory region introduced by the DNA construct affects transcription of the IFNA2 gene.
Homologně rekombinantní buňky (tj. buňky ve kterých proběhla požadovaná homologní rekombinace) mohou být identifikovány na základě posouzení jejich fenotypu nebo analýzou superna35 tantu z buněčné kultury, kde je metodou ELISA (enzymová imunanalýza) stanovena přítomnost IFNA2 v médiu. Komerční ELISA soupravy pro stanovení IFNA2 jsou dostupné od firmy Biosource International (CAmarillo, CA). Homologně rekombinantní buňky mohou být identifikovány také Southern nebo Northern analýzou nebo metodou PCR (polymerázová řetězová reakce).Homologously recombinant cells (i.e., cells in which the desired homologous recombination has taken place) can be identified by assessing their phenotype or by analyzing the supernatant of cell culture, where the presence of IFNA2 in the medium is determined by ELISA (enzyme immunoassay). Commercial ELISA kits for the IFNA2 assay are available from Biosource International (CAmarillo, CA). Homologously recombinant cells can also be identified by Southern or Northern analysis or by PCR (polymerase chain reaction) method.
Tak, jak je použit zde, termín „primární buňky“ označuje i) buňky přítomné v suspenzi buněk izolovaných přímo z tkáně obratlovců (před jejich vysetím, tj. před jejich navázáním na substrát pro tkáňové kultury jako je například Petriho miska nebo kultivační láhev), ii) buňky přítomné v kultuře přímo odvozené od tkáně, iii) buňky vyseté v kultuře poprvé a iv) buněčné suspenze odvozené těchto vysetých buněk. Primárními buňkami mohou být také buňky tak jak se přirozeně vyskytují v lidském nebo živočišném těle.As used herein, the term "primary cells" refers to (i) cells present in a suspension of cells isolated directly from vertebrate tissue (prior to sowing, i.e. before binding to a tissue culture substrate such as a petri dish or culture flask); ii) cells present in the culture directly derived from the tissue, iii) cells seeded in the culture for the first time, and iv) cell suspensions derived from these seeded cells. The primary cells may also be cells as naturally occurring in the human or animal body.
Sekundární buňky jsou buňky ve všech následujících krocích kultivace. To znamená, že od okamžiku kdy jsou vyseté primární buňky poprvé odloučeny z kultivačního substrátu a znovu vysety (pasážovány), jsou v tomto textu označovány jako buňky sekundární. Stejně tak jsou jako sekundární označovány všechny následující pasáže. Kmeny sekundárních buněk se sestávají ze sekundárních buněk, které byly pasážovány jednou nebo vícekrát. Sekundární buňky typicky vykazují konečný počet průměrných počtů zdvojení v kultuře a kontaktní inhibici růstu a růst závislý na přichycení k substrátu (růst závislý na přichycení k substrátu se nevyskytuje u buněk, které se kultivují v suspenzní kultuře). Primární ani sekundární buňky nejsou nesmrtelné.Secondary cells are cells in all subsequent cultivation steps. That is, since the seeded primary cells are first separated from the culture substrate and replanted (passaged), they are referred to herein as secondary cells. Likewise, all subsequent passages are referred to as secondary. Secondary cell strains consist of secondary cells that have been passaged one or more times. Secondary cells typically exhibit a finite number of average culture doublings and contact inhibition of growth and substrate-dependent growth (substrate-dependent growth does not occur in cells that are cultured in suspension culture). Neither primary nor secondary cells are immortal.
- 12CZ 299418 B6- 12GB 299418 B6
Nesmrtelné buňky jsou buněčné linie (v protikladu k buněčným kmenům, kde je název „kmen rezervován pro primární a sekundární buňky), které podle všeho vykazují v kultuře nelimitovaný růst.Immortal cells are cell lines (as opposed to cell strains where the term "strain is reserved for primary and secondary cells") that appear to exhibit unrestricted growth in culture.
Buňky vybrané pro transfekci nebo infekci mohou spadat do čtyř typů nebo kategorií: (i) buňky které samy o sobě netvoří nebo neobsahují více než stopové množství IFNA2 proteinu, (ii) buňky které tvoří nebo obsahují protein, ale v jiném než požadovaném množství (například v množství menším než je fyziologická hranice pro daný typ buněk), (iii) buňky které tvoří protein v množství, které je pro daný typ buněk fyziologicky normální, ale u kterých je žádoucí produkci protei10 nu rozšířit nebo zvýšit a (iv) buňky, u kterých je žádoucí změnit charakter produkce proteinu nebo regulaci indukce genu kódujícího protein.Cells selected for transfection or infection can fall into four types or categories: (i) cells that do not, or do not contain more than a trace amount of IFNA2 protein, (ii) cells that make or contain a protein, but in a quantity other than desired (e.g. (iii) cells that make up the protein in an amount that is physiologically normal for that cell type, but for which it is desirable to extend or increase protein production, and (iv) cells, which are desirable to alter the nature of protein production or to regulate the induction of the gene encoding the protein.
Primární, sekundární i nesmrtelné buňky, vybrané pro transfekci nebo infekci navrhovanými způsoby mohou být získány z nejrůznějších tkání a zahrnují všechny příslušné buněčné typy, které lze pěstovat v kultuře. Mezi vhodné primární a sekundární buňky patří například fibroblasty, keratinocyty, epiteliální buňky (například epiteliální buňky mléčné žlázy, buňky střevního epitelu), endoteliální buňky, gliové buňky, nervové buňky, krevní elementy (například lymfocyty, buňky kostní dřeně), svalové buňky a prekurzory těchto somatických buněčných typů. Pokud zamýšlíme použít homologně rekombinantní buňky v genové terapii, jsou primární buňky nejra20 ději získány z jedince, kterému budou transfektované nebo infikované primární nebo sekundární buňky aplikovány. Ovšem primární buňky mohou být získány i z donora (tj. jedince různého od recipienta) stejného druhu.Primary, secondary and immortal cells selected for transfection or infection by the proposed methods can be obtained from a variety of tissues and include all relevant cell types that can be grown in culture. Suitable primary and secondary cells include, for example, fibroblasts, keratinocytes, epithelial cells (e.g., mammary epithelial cells, intestinal epithelial cells), endothelial cells, glial cells, nerve cells, blood elements (e.g., lymphocytes, bone marrow cells), muscle cells and precursors of these somatic cell types. If we intend to use homologously recombinant cells in gene therapy, the primary cells of the most recent 20 are obtained from an individual to which the transfected or infected primary or secondary cells will be administered. However, primary cells can also be obtained from a donor (i.e., a non-recipient individual) of the same species.
Mezi vhodné příklady nesmrtelných buněčných linií, vhodných pro produkci proteinu nebo geno25 vou terapii patří například (ale nikoliv výhradně) buňky karcinomu vaječníků 2780AD (Van der Blick et al., Cancer. Res. 48: 5927-5932, 1988), A549 (American Type Culture Collection („ATCC“) CCL 185), BeWo (ATCC CCL 98), buňku Bowesova melanomu (ATCC CRL 9607), CCRF-CEM (ATCC CCL 119), CCRF-HSB-2 (ATCC CCL 120.1), COLO201 (ATCC CCL 224), COLO205 (ATCC CCL 222), COLO 320DM (ATCC CCL 220), COLO 320HSR (ATCCSuitable examples of immortalized cell lines suitable for protein production or gene therapy include, but are not limited to, ovarian cancer cells 2780AD (Van der Blick et al., Cancer. Res. 48: 5927-5932, 1988), A549 (American). Type Culture Collection ("ATCC") CCL 185), BeWo (ATCC CCL 98), Bowes melanoma cell (ATCC CRL 9607), CCRF-CEM (ATCC CCL 119), CCRF-HSB-2 (ATCC CCL 120.1), COLO201 ( COLCC20L (ATCC CCL 222), COLO 320DM (ATCC CCL 220), COLO 320HSR (ATCC)
CCL 220.1), Daudi buňky (ATCC CCL 213), Detroit 562 (ATCC CCL 138), HeLa buňky ajejich deriváty (ATCC CCL 2, 2.1 a 2.2), HTC 116 (ATCC CCL 247), HL-60 (ATCC CCL 240), HT 1080 (ATCC CCL 121), 1MR-32 (ATCC CCL 127). buňky Jurkat (ATCC TIB 152), leukemické buňky K-562 (ATCC CCL 243), buňky karcinomu KB (ATCC CCL 17), KG-1 (ATCC CCL 246), KG-la (ATCC CCL 246.1), LSI23 (ATCC CCL 255), LS174T (ATCC CCLCCL 220.1), Daudi cells (ATCC CCL 213), Detroit 562 (ATCC CCL 138), HeLa cells and their derivatives (ATCC CCL 2, 2.1 and 2.2), HTC 116 (ATCC CCL 247), HL-60 (ATCC CCL 240) HT 1080 (ATCC CCL 121), 1MR-32 (ATCC CCL 127). Jurkat cells (ATCC TIB 152), K-562 leukemia cells (ATCC CCL 243), KB carcinoma cells (ATCC CCL 17), KG-1 (ATCC CCL 246), KG-1α (ATCC CCL 246.1), LSI23 (ATCC CCL) 255), LS174T (ATCC CCL
CL—188), LSI80 (ATCC CCL CL-187), buňky karcinomu prsu MCF-7 (ATCC BTH 22), buňky MOLT-4 (ATCC CRL 1582), buňky Namalwa (ATCC CRL 1432), NCI-H498 (ATCC CCL 254), NCI-H508 (ATCC CCL 253), NCI-H548 (ATCC CCL 249), NCI-H716 (ATCC CCL 251), NCI-H747 (ATCC CCL 252), NCI-H1688 (ATCC CCL 257), NCI-H2126 (ATCC CCL 256), buňky Ráji (ATCC CCL 86), RD (ATCC CCL 136), RPMI 2650 (ATCC CCL 30), RPMICL-188), LSI80 (ATCC CCL CL-187), MCF-7 breast cancer cells (ATCC BTH 22), MOLT-4 cells (ATCC CRL 1582), Namalwa cells (ATCC CRL 1432), NCI-H498 (ATCC CCL) 254); NCI-H508 (ATCC CCL 253); NCI-H548 (ATCC CCL 249); NCI-H716 (ATCC CCL 251); NCI-H747 (ATCC CCL 252); NCI-H1688 (ATCC CCL 257); H2126 (ATCC CCL 256), Paradise cells (ATCC CCL 86), RD (ATCC CCL 136), RPMI 2650 (ATCC CCL 30), RPMI
8226 (ATCC CCL 155), SNU-C2A (ATCC CCL 250.1), SNU-C2B (ATCC CCL 250), SW-13 (ATCC CCL 105), SW48 (ATCC CCL 231), SW403 (ATCC CCL230), SW480 (ATCC CCL 227), SW620 (ATCC CCL 227), SW837 (ATCC CCL 235), SW948 (ATCC CCL 237), SW1116 (ATCC CCL 233), SW1417 (ATCC CCL 238), SW1463 (ATCC CCL 234), T84 (ATCC CCL 248), buňky U-937 (ATCC CRL 1593), WiDr (ATCC CCL 218), WI- 38VA13 odvozená linie8226 (ATCC CCL 155), SNU-C2B (ATCC CCL 250.1), SNU-C2B (ATCC CCL 250), SW-13 (ATCC CCL 105), SW48 (ATCC CCL 231), SW403 (ATCC CCL230), SW480 (ATCC) CCL 227), SW637 (ATCC CCL 235), SW937 (ATCC CCL 237), SW1417 (ATCC CCL 238), SW1463 (ATCC CCL 234), T84 (ATCC CCL 234) 248), U-937 cells (ATCC CRL 1593), WiDr (ATCC CCL 218), WI-38VA13 derived line
2R4 (ATCC CCL 75.1), dále heterohybridomové buňky připravené fúzí lidských buněk a buněk jiných druhů. Dále mohou být použity sekundární lidské fibroblastové buňky jako WI-38 (ATCC CCL 75) a MRC-5 (ATCC CCL 171). Pro in vitro produkci proteinu stejně jako genovou terapii mohou být kromě toho použity i další primární, sekundární nebo nesmrtelné buňky lidské nebo jiných živočišných druhů.2R4 (ATCC CCL 75.1); heterohybridoma cells prepared by fusion of human cells and cells of other species. In addition, secondary human fibroblast cells such as WI-38 (ATCC CCL 75) and MRC-5 (ATCC CCL 171) may be used. In addition, other primary, secondary or immortal cells of human or other animal species may be used for in vitro protein production as well as gene therapy.
Buňky exprimující IFNA2.Cells expressing IFNA2.
Homologně rekombinantní buňky podle navrhovaného vynálezu exprimují IFNA2 v požadovaném množství ajsou vhodné jak pro produkci IFNA2 in vitro tak pro genovou terapii.Homologously recombinant cells of the present invention express IFNA2 in the desired amount and are suitable for both in vitro and gene therapy IFNA2 production.
- 13 CZ 299418 B6- 13 GB 299418 B6
Produkce proteinu.Protein production.
Homologně rekombinantní buňky podle navrhovaného vynálezu mohou být použity pro produkci IFNA2 in vitro. Buňky jsou kultivovány v podmínkách, které, tak jak je to popsáno v odborné literatuře, mají za následek expresi proteinů. Protein IFNA2 může být poté purifikován buď z buněčných lyzátů, nebo z buněčných supematantů. Farmaceutický prostředek obsahující protein IFNA2 může být dopraven do lidského nebo zvířecího organizmu způsoby běžnými ve farmacii a známými v oboru (například orálně, intravenózně, intramuskulámě, intranazálně, pulmonámě, transmukózní cestou, intradermálně, rektálně, intratekálně, transdermálně, subkutánně, intraperi10 toneálně nebo intralézní cestou). Orální podání může vyžadovat použití strategie na ochranu proteinu před jeho degradací v gastrointestinálním traktu, například zapouzdřením v polymemích mikrokapslích.Homologously recombinant cells of the present invention can be used to produce IFNA2 in vitro. The cells are cultured under conditions that, as described in the literature, result in protein expression. The IFNA2 protein may then be purified from either cell lysates or cell supernatants. A pharmaceutical composition comprising the IFNA2 protein can be delivered to a human or animal organism by methods conventional in pharmacy and known in the art (e.g., orally, intravenously, intramuscularly, intranasally, pulmonary, transmucosal, intradermally, rectally, intrathecally, transdermally, subcutaneously, intraperi10 tonal or intralesional). way). Oral administration may require the use of a strategy to protect the protein from its degradation in the gastrointestinal tract, for example by encapsulation in polymeric microcapsules.
Genová terapie.Gene therapy.
Homologně rekombinantní buňky podle navrhovaného vynálezu jsou vhodné pro použití jako populace homologně rekombinantních buněčných linií, jako populace homologně rekombinantních primárních nebo sekundárních buněk, jako populace homologně rekombinantních buněčných klonů nebo linií, jako homologně rekombinantní heterogenní buněčné kmeny nebo linie a jako buněčné směsi ve kterých je přítomna nejméně jedna reprezentativní buňka jedné ze čtyř předchozích kategorií homologně rekombinantních buněk. Takové buňky mohou být použity ve vhodném systému a při vhodném způsobu podání k léčbě (i) infekcí způsobených viry jako jsou například papiloma virus, viry hepatitidy B a C, virus vakcinie, virus herpes simplex, virus herpes zoster varicellosus a rhinovirus a (ii) jakýchkoliv jiných stavů, které lze léčit pomocí IFNA2.The homologously recombinant cells of the present invention are suitable for use as a population of homologously recombinant cell lines, as a population of homologously recombinant primary or secondary cells, as a population of homologously recombinant cell clones or lines, as homologously recombinant heterogeneous cell strains or lines and as cell mixtures in which at least one representative cell of one of the four preceding categories of homologously recombinant cells present. Such cells may be used in a suitable system and administration route to treat (i) infections caused by viruses such as papilloma virus, hepatitis B and C viruses, vaccinia virus, herpes simplex virus, herpes zoster varicellosus virus and rhinovirus, and (ii) any other conditions that can be treated with IFNA2.
Homologně rekombinantní primární buňky, klonální buněčné kmeny nebo heterologní buněčné kmeny jsou podány jedinci, jehož nenormální nebo nežádoucí stav vyžaduje pro léčbu nebo prevenci v dostatečném množství a odpovídajícím způsobem podaný exprimovaný nebo jinak tělu zpřístupněný protein nebo exogenní DNA ve fyziologicky relevantním množství. Fyziologicky relevantní množství je takové množství, které se buď blíží běžné úrovni produkce proteinu v těle, nebo je zvýšeno v důsledku abnormálního nebo nežádoucího stavu. Jsou-li buňky vzhledem k imunokompetentnímu recipientu syngenní, mohou být podány nebo implantovány intravenózně, intraarteriálně, subkutánně, intraperitoneálně, intraomentálně, subrenálně kapsulámě, intratekálně, intrakraniálně nebo intramuskulámě.Homologously recombinant primary cells, clonal cell strains, or heterologous cell strains are administered to an individual whose abnormal or undesirable condition requires sufficient treatment and prevention and adequately administered expressed or otherwise accessed protein or exogenous DNA in a physiologically relevant amount. A physiologically relevant amount is one that either approaches the normal level of protein production in the body or is increased due to an abnormal or undesirable condition. If the cells are syngeneic to the immunocompetent recipient, they may be administered or implanted intravenously, intraarterially, subcutaneously, intraperitoneally, intraomentally, subrenally capsular, intrathecal, intracranial, or intramuscular.
Pokud buňky nejsou syngenní a recipient je imunokompetentní, lze homologně rekombinantní buňky před podáním uzavřít v prostředku s jednou nebo více polopropustnými bariérami. Propustnost daného prostředkuje taková, že buňky nemohou po implantaci do subjektu prostředek ve kterém jsou podány opustit, ale pro terapeutický protein je bariéra volně propustná a pro40 tein tudíž může difundovat do prostoru obklopujícího implantát nebo může vstoupit do systémového oběhu. Viz například patent US 5 641 670; US 5 470 731; US 5 620 883; US 5 487 737 a společně vlastněná US patentová přihláška nazvaná „Delivery of Therapeutic Proteins“ (navrhovatelé: Justin C. Lamsa a Douglas A Treco), 16. dubna 1999; které jsou zde všechny zahrnuty odkazem. Prostředek opatřený bariérou může být implantován do jakéhokoliv vhodného místa:If the cells are not syngeneic and the recipient is immunocompetent, the homologously recombinant cells may be enclosed in a composition with one or more semipermeable barriers prior to administration. The permeability of the composition is such that the cells cannot leave the composition in which they are administered after implantation, but for the therapeutic protein the barrier is freely permeable and the pro40 tein may diffuse into the space surrounding the implant or enter the systemic circulation. See, for example, U.S. Patent No. 5,641,670; 5,470,731; 5,620,883; U.S. Pat. No. 5,487,737 and co-owned US patent application entitled "Delivery of Therapeutic Proteins" (Applicants: Justin C. Lamsa and Douglas A Treco), April 16, 1999; all of which are incorporated herein by reference. The barrier device may be implanted at any suitable location:
například intraperitoneálně, intratekálně, subkutánně, intramuskulámě, v ledvinové kapsli nebo v omentu.for example, intraperitoneally, intrathecally, subcutaneously, intramuscularly, in a renal capsule or in the omentum.
Prostředky opatřené bariérou jsou zvláště vhodné a umožňují implantaci homologně rekombinantních nesmrtelných buněk, homologně rekombinantních buněk z jiných druhů (homologně rekombinantních xenogenních buněk), nebo buněk pocházejících z donora který není s akceptorem histokompatibilitní (homologně rekombinantních allogenních buněk) za účelem léčby daného subjektu. Tyto prostředky udržují buňky in vivo ve fixované pozici a chrání tyto buňky před hostitelským imunitním systémem. Prostředky opatřené bariérou také umožňují výhodnou krátkodobou (přechodnou) terapii, neboť umožňují rychlé odstranění buněk v případě, kdy je z něja55 kého důvodu nutné léčebný režim přerušit. Transfektované nebo infikované xenogenní a alogenníBarrier formulations are particularly useful and allow the implantation of homologously recombinant immortal cells, homologously recombinant cells from other species (homologously recombinant xenogeneic cells), or cells derived from a donor that is not histocompatible with the acceptor (homologously recombinant allogeneic cells) for treatment of the subject. These compositions maintain the cells in a fixed position in vivo and protect the cells from the host immune system. Barrier formulations also allow for convenient short-term (transient) therapy, as they allow rapid cell removal when, for some reason, the treatment regimen needs to be discontinued. Transfected or infected xenogenic and allogeneic
- 14CZ 299418 B6 buňky mohou být pro krátkodobou genovou terapii použity i bez prostředku opatřeného bariérou. V takovém případě je IFNA2 produkovaný buňkami uvolňován in vivo dokud nejsou buňky hostitelským imunitním systémem odvrhnuty.- 14GB 299418 B6 cells may be used for short-term gene therapy without a barrier device. In such a case, IFNA2 produced by the cells is released in vivo until the cells are rejected by the host immune system.
Pro tento účel může být použita celá řada syntetických, semisyntetických nebo přirozených filtračních membrán včetně (ale nikoliv výhradně) celulózy, acetátu celulózy, nitrocelulózy, polysulfonu, polyvinylidendifluoridu, polyvinylchloridových polymerů a polymerů derivátů polyvinylchloridu. Prostředky opatřené bariérou umožňují využití primárních, sekundárních nebo nesmrtelných buněk v genové terapii u člověka.A variety of synthetic, semisynthetic or natural filter membranes may be used for this purpose including, but not limited to, cellulose, cellulose acetate, nitrocellulose, polysulfone, polyvinylidene difluoride, polyvinyl chloride polymers and polyvinyl chloride derivative polymers. Barrier compositions allow the use of primary, secondary, or immortal cells in gene therapy in humans.
Dalším typem prostředku pro použití v genové terapii podle vynálezu je implantovatelná kolagenová matrice ve které jsou buňky ukotveny. Takový prostředek, který může obsahovat kuličky ke kterým jsou buňky navázány, je popsán v WO 97/15 195, který je zde zahrnut odkazem, tento prostředek může být implantován tak, jak bylo popsáno výše.Another type of device for use in the gene therapy of the invention is an implantable collagen matrix in which the cells are anchored. Such a composition, which may comprise beads to which cells are bound, is described in WO 97/15 195, which is incorporated herein by reference, which composition may be implanted as described above.
Množství buněk, nezbytné pro odpovídající dávku nebo implantaci závisí na množství faktorů včetně úrovně exprese proteinu, velikosti a stavu hostitelského živočicha a nejrůznějších omezení spojených s procesem implantace. Obvykle je množství buněk, implantované dospělému člověku nebo jinému podobně velkému živočichu je v rozmezí od 1 x 104 do 5 x ÍO10, nejraději pak 1 xThe amount of cells required for appropriate dose or implantation depends on a number of factors including the level of protein expression, the size and condition of the host animal, and the various limitations associated with the implantation process. Typically, the amount of cells implanted in an adult human or other similar sized animal is in the range of 1 x 10 4 to 5 x 10 10 , preferably 1 x 10 4.
108 až 1 x 109. Je-li to nutné, mohou být buňky pacientu implantovány na více místech, a to buď jedenkrát, nebo opakovaně v průběhu měsíců nebo let. Dávka může být podle potřeby opakována.10 8 to 1 x 10 9 . If necessary, patient cells may be implanted at multiple sites, either once or repeatedly over months or years. The dose may be repeated as necessary.
Depozit.Deposit.
Podle pravidel Budapešťské dohody o mezinárodním uznání depozitu mikroorganizmů pro účely patentového řízení byl plazmid pH2AB uložen v American Type Culture Collection (ATCC), Rockville, MD, USA dne 12. května 1998. Plazmid je k dispozici pod přístupovým kódem 209872.According to the Budapest Agreement on the International Recognition of Deposits of Microorganisms for Patent Purposes, plasmid pH2AB was deposited with the American Type Culture Collection (ATCC), Rockville, MD, May 12, 1998. The plasmid is available under Accession Code 209872.
Zástupce přihlašovatele, Transkaryotic Therapies, lne. garantuje, že ATCC je depozitář, zajišťující konstantnost depozitu a v případě udělení patentu jeho snadnou dostupnost veřejnosti. Veškerá omezení dostupnosti daného materiálu pro veřejnost budou neodvolatelně zrušena v okamžiku udělení patentu. Materiál bude během patentového řízení dostupný osobám oprávně35 ným k tomuto členem komise podle 37 CFR 1.14 a 35 U.S.C. §122. Uložený materiál je udržován s veškerou péčí, nezbytnou pro zachování životnosti materiálu a zabránění jeho kontaminaci po dobu nejméně pěti let od poslední žádosti o dodání vzorku uloženého materiálu a v každém případě po dobu nejméně třiceti (30) let od data uložení nebo po dobu vynutitelné existence patentu (podle toho, který časový údaj je nejdelší). Zástupce přihlašovatele uznává svou povin40 nost nahradit depozit v případě, kdy depozitář (ATCC) není schopen díky stavu depozitu na vyžádání poskytnout vzorek.Applicant's representative, Transkaryotic Therapies, Inc. guarantees that the ATCC is a depositary, ensuring the consistency of the deposit and, in the case of granting a patent, its easy accessibility to the public. Any restrictions on the availability of the material to the public will be irrevocably lifted when the patent is granted. The material will be available during the patent procedure to persons entitled to this member of the Commission under 37 CFR 1.14 and 35 U.S.C. §122. The deposited material shall be maintained with all due care necessary to maintain the durability of the material and to prevent its contamination for at least five years from the last request for a sample of the deposited material and in any event for at least thirty (30) years from the date of deposit or patent (whichever is the longest). The representative of the applicant acknowledges his obligation40 to replace the deposit in the event that the depositary (ATCC) is unable to provide a sample due to the on-demand deposit status.
Další provedení.Other embodiments.
Je nutné zde uvést, že přestože byl vynález vysvětlen a doložen detailním popisem, je tento předcházející popis vynálezu pouze ilustrativní a v žádném případě nelimituje rozsah navrhovaného vynálezu. Ten je vymezen rozsahem následujících patentových nároků.It should be noted that although the invention has been explained and exemplified by the detailed description, the foregoing description of the invention is illustrative only and in no way limits the scope of the present invention. This is defined by the scope of the following claims.
Další aspekty, výhody a modifikace jsou obsaženy v následujících patentových nárocích.Other aspects, advantages and modifications are set forth in the following claims.
- 15CZ 299418 B6- 15GB 299418 B6
Přehled obrázků na výkresechBRIEF DESCRIPTION OF THE DRAWINGS
Na obrázku 1 je uvedena publikovaná sekvence (SEQ ID NO:1) kódující oblasti lidského IFNA2 genu a přilehlých 5' a 3' nekódujících sekvencí (GenBank HUMIFNAA). Sekvence PCR primerůFigure 1 shows the published sequence (SEQ ID NO: 1) coding regions of the human IFNA2 gene and adjacent 5 'and 3' non-coding sequences (GenBank HUMIFNAA). Sequence of PCR primers
IFN1, IFN2, IFN6 a IFN7 jsou označeny šipkami.IFN1, IFN2, IFN6 and IFN7 are indicated by arrows.
Na obrázku 2 je schematický diagram znázorňující lidskou genomovou oblast IFNA2, jako inzert v plazmidu pA2HB.Figure 2 is a schematic diagram depicting the human genomic region of IFNA2 as an insert in plasmid pA2HB.
io Na obrázku 3 je znázorněna nukleotidová sekvence (SEQ ID NO:7) oblasti proti směru transkripce od kódující sekvence lidského IFNA2 genu. Tato nukleotidová sekvence nebyla dříve publikována.Figure 3 shows the nucleotide sequence (SEQ ID NO: 7) of the region upstream of the coding sequence of the human IFNA2 gene. This nucleotide sequence has not been previously published.
Na obrázku 4 je znázorněna nukleotidová sekvence (SEQ ID NO:9) kódující oblasti lidskéhoFigure 4 shows the nucleotide sequence (SEQ ID NO: 9) of the coding region of human
IFNA2 genu a přilehlých 5' a 3' nekódujících sekvencí. Podtržená sekvence (SEQ ID NO:8) dosud nebyla publikována. Dále je znázorněna polypeptidová sekvence (SEQ ID NO:2), kódovaná zmíněným genem. N-konec maturovaného polypeptidu je označen jako „Maturovaný“.IFNA2 gene and adjacent 5 'and 3' non-coding sequences. The underlined sequence (SEQ ID NO: 8) has not been published yet. Further shown is a polypeptide sequence (SEQ ID NO: 2) encoded by said gene. The N-terminus of the mature polypeptide is designated "mature".
Na obrázku 5 je znázorněn schematický diagram konstruktu podle vynálezu. Konstrukt obsahuje první směrující sekvenci (1); amplifikovatelný znak (AM); selekční znak (SM); regulační sekvenci; CAP místo; exon; donorové místo sestřihu (SD); intron; akceptorové místo sestřihu (SA) a druhou směrující sekvenci (2). Černými obdélníky je označena kódující DNA a tečkovanými obdélníky jsou označeny transkribované, ale nepřekládané oblasti.Figure 5 is a schematic diagram of a construct of the invention. The construct comprises a first targeting sequence (1); an amplifiable feature (AM); a selectable character (SM); a regulatory sequence; CAP instead; exon; splice donor site (SD); intron; a splice acceptor site (SA) and a second targeting sequence (2). The black rectangles indicate the coding DNA and the dotted rectangles indicate the transcribed but non-translated regions.
Na obrázku 6 je znázorněna sekvence (SEQ ID NO: 10) ve směru 5' vzhledem ke kódující sekvenci lidského IFNA2 genu včetně části kódující sekvence. Podtržená sekvence již byla dříve publikována, zatímco ostatní sekvence ( 4074 až -511 SEQ ID NO:11) je nová. Orámována je sekvence SEQ ID NO: 12. Sekvence v pozici 5' vzhledem k sekvenci SEQ ID NO: 12 je SEQ ID NO:7. Sekvence mezi orámovanou oblastí a podtrženou sekvencí je SEQ ID NO:8. NukleotidyFigure 6 shows the sequence (SEQ ID NO: 10) in the 5 'direction of the coding sequence of the human IFNA2 gene, including part of the coding sequence. The underlined sequence has been previously published, while the other sequences (4074 to -511 of SEQ ID NO: 11) are new. The sequence at SEQ ID NO: 12 is framed. The sequence at position 5 'to SEQ ID NO: 12 is SEQ ID NO: 7. The sequence between the boxed region and the underlined sequence is SEQ ID NO: 8. Nucleotides
-4074 až -3270 označujeme jako SEQ ID NO: 15. Nukleotidy -3267 až -3239 označujeme jako-4074 to -3270 is designated as SEQ ID NO: 15. Nucleotides -3267 to -3239 are referred to as
SEQ ID NO: 16. Nukleotidy-3241 až-3137 označujeme jako SEQ ID NO: 17. Nukleotidy-3139 až -511 označujeme jako SEQ ID NO: 18.SEQ ID NO: 16. Nucleotides-3241 to 3137 are referred to as SEQ ID NO: 17. Nucleotides-3139 to -511 are referred to as SEQ ID NO: 18.
Na obrázku 7 je znázorněna první směrující sekvence (SEQ ID NO: 13) použitá v konstruktu podle vynálezu.Figure 7 shows the first targeting sequence (SEQ ID NO: 13) used in the construct of the invention.
Na obrázku 8 je znázorněna druhá směrující sekvence (SEQ ID NO: 14) použitá v konstruktu podle vynálezu.Figure 8 shows the second targeting sequence (SEQ ID NO: 14) used in the construct of the invention.
Příklady provedení vynálezuDETAILED DESCRIPTION OF THE INVENTION
Příklad 1: Produkce proteinu.Example 1: Protein production.
Homologně rekombinantní buňky podle navrhovaného vynálezu mohou být použity pro produkci IFNA2 in vitro. Buňky jsou kultivovány v podmínkách, které, tak jak je to popsáno v odborné literatuře, mají za následek expresi proteinů. Protein IFNA2 může být poté purifikován buď z buněčných lyzátů, nebo z buněčných supematantů. Farmaceutický prostředek obsahující proteinHomologously recombinant cells of the present invention can be used to produce IFNA2 in vitro. The cells are cultured under conditions that, as described in the literature, result in protein expression. The IFNA2 protein may then be purified from either cell lysates or cell supernatants. A pharmaceutical composition comprising a protein
IFNA2 může být dopraven do lidského nebo zvířecího organizmu způsoby běžnými ve farmacii a známými v oboru (například orálně, intravenózně, intramuskulámě, intranazálně, pulmonámě, transmukózní cestou, intradermálně, rektálně, intratekálně, transdermálně, subkutánně, intraperitoneálně nebo intralézní cestou). Orální podání může vyžadovat použití strategie na ochranu proteinu před jeho degradací v gastrointestinálním traktu, například zapouzdřením v polymemích mikrokapslích.IFNA2 can be delivered to a human or animal organism by methods conventional in pharmacy and known in the art (for example, orally, intravenously, intramuscularly, intranasally, pulmonary, transmucosal, intradermally, rectally, intrathecally, transdermally, subcutaneously, intraperitoneally or intralesionally). Oral administration may require the use of a strategy to protect the protein from its degradation in the gastrointestinal tract, for example by encapsulation in polymeric microcapsules.
-16CZ 299418 B6-16GB 299418 B6
Příklad 2: Genová terapie.Example 2: Gene Therapy.
Homologně rekombinantní buňky podle navrhovaného vynálezu jsou vhodné pro použití jako populace homologně rekombinantních buněčných linií, jako populace homologně rekombinant5 nich primárních nebo sekundárních buněk, jako populace homologně rekombinantních buněčných klonů nebo linií, jako homologně rekombinantní heterogenní buněčné kmeny nebo linie a jako buněčné směsi ve kterých je přítomna nejméně jedna reprezentativní buňka jedné ze čtyř předchozích kategorií homologně rekombinantních buněk. Takové buňky mohou být použity ve vhodném systému a při vhodném způsobu podání k léčbě (i) infekcí způsobených viry jako jsou ío například papiloma virus, viry hepatitidy B a C, virus vakcinie, virus herpes simplex, virus herpes zoster varicellosus a rhinovirus a (ii) jakýchkoliv jiných stavů, které lze léčit pomocí IFNA2.The homologously recombinant cells of the present invention are suitable for use as a population of homologously recombinant cell lines, as a population of homologously recombinant primary or secondary cells, as a population of homologously recombinant cell clones or lines, as homologously recombinant heterogeneous cell strains or lines and as cell mixtures in which at least one representative cell of one of the four preceding categories of homologously recombinant cells is present. Such cells may be used in a suitable system and administration route to treat (i) infections caused by viruses such as papilloma virus, hepatitis B and C viruses, vaccinia virus, herpes simplex virus, herpes zoster varicellosus virus and rhinovirus and (ii) ) any other conditions that can be treated with IFNA2.
Příklad 3:Example 3:
Dalším typem prostředku pro použití v genové terapii podle vynálezu je implantovatelná kolagenová matrice ve které jsou buňky ukotveny. Takový prostředek, který může obsahovat kuličky ke kterým jsou buňky navázány, je popsán v WO 97/15 195, který je zde zahrnut odkazem, tento prostředek může být implantován tak, jak bylo popsáno výše.Another type of device for use in the gene therapy of the invention is an implantable collagen matrix in which the cells are anchored. Such a composition, which may comprise beads to which cells are bound, is described in WO 97/15 195, which is incorporated herein by reference, which composition may be implanted as described above.
Množství buněk, nezbytné pro odpovídající dávku nebo implantaci závisí na množství faktorů včetně úrovně exprese proteinu, velikosti a stavu hostitelského živočicha a nejrůznějších omezení spojených s procesem implantace. Obvykle je množství buněk, implantované dospělému člověku nebo jinému podobně velkému živočichu je v rozmezí od 1 x 104 do 5 x ÍO10, nejraději pak 1 xThe amount of cells required for appropriate dose or implantation depends on a number of factors including the level of protein expression, the size and condition of the host animal, and the various limitations associated with the implantation process. Typically, the amount of cells implanted in an adult human or other similar sized animal is in the range of 1 x 10 4 to 5 x 10 10 , preferably 1 x 10 4.
108 až 1 x 109. Je-li to nutné, mohou být buňky pacientu implantovány na více místech, a to buď jedenkrát, nebo opakovaně v průběhu měsíců nebo let. Dávka může být podle potřeby opaková-10 8 to 1 x 10 9 . If necessary, patient cells may be implanted at multiple sites, either once or repeatedly over months or years. The dose may be repeated as needed.
Claims (38)
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US8464898P | 1998-05-07 | 1998-05-07 | |
US8655598P | 1998-05-21 | 1998-05-21 |
Publications (2)
Publication Number | Publication Date |
---|---|
CZ20003705A3 CZ20003705A3 (en) | 2001-04-11 |
CZ299418B6 true CZ299418B6 (en) | 2008-07-16 |
Family
ID=26771248
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CZ20003705A CZ299418B6 (en) | 1998-05-07 | 1999-05-05 | DNA construct, affecting expression of endogenous IFNA2 gene, isolated nucleic acid, homologous recombinant mammal cell, method of influencing expression of endogenous IFNA2 gene, and production process of IFNA2 |
Country Status (14)
Country | Link |
---|---|
EP (1) | EP1075531A1 (en) |
JP (1) | JP2002513580A (en) |
KR (1) | KR20010052278A (en) |
CN (1) | CN1309710A (en) |
AR (1) | AR016264A1 (en) |
AU (1) | AU3788899A (en) |
CA (1) | CA2328459A1 (en) |
CZ (1) | CZ299418B6 (en) |
HU (1) | HUP0102517A3 (en) |
IL (1) | IL139433A0 (en) |
NO (1) | NO20005585L (en) |
PL (1) | PL344517A1 (en) |
TR (1) | TR200003271T2 (en) |
WO (1) | WO1999057292A1 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU1647501A (en) | 1999-12-10 | 2001-06-18 | Cytos Biotechnology Ag | Replicon based activation of endogenous genes |
FR2817559B1 (en) * | 2000-12-06 | 2003-12-12 | Genodyssee | METHOD FOR DETERMINING ONE OR MORE FUNCTIONAL POLYMORPHISM (S) IN THE NUCLEIC SEQUENCE OF A PRESELECTED FUNCTIONAL "CANDIDATE" GENE AND ITS APPLICATIONS |
CN103620034B (en) * | 2011-04-13 | 2016-12-14 | 加拿大国家研究委员会 | There is the expression system of the SAR element from IFN α 2 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995031560A1 (en) * | 1994-05-13 | 1995-11-23 | Transkaryotic Therapies, Inc. | Dna construct for effecting homologous recombination and uses thereof |
-
1999
- 1999-05-05 JP JP2000547246A patent/JP2002513580A/en active Pending
- 1999-05-05 CN CN99808195A patent/CN1309710A/en active Pending
- 1999-05-05 HU HU0102517A patent/HUP0102517A3/en unknown
- 1999-05-05 PL PL99344517A patent/PL344517A1/en not_active Application Discontinuation
- 1999-05-05 TR TR2000/03271T patent/TR200003271T2/en unknown
- 1999-05-05 KR KR1020007012066A patent/KR20010052278A/en not_active Application Discontinuation
- 1999-05-05 CZ CZ20003705A patent/CZ299418B6/en not_active IP Right Cessation
- 1999-05-05 CA CA002328459A patent/CA2328459A1/en not_active Abandoned
- 1999-05-05 IL IL13943399A patent/IL139433A0/en unknown
- 1999-05-05 WO PCT/US1999/009925 patent/WO1999057292A1/en not_active Application Discontinuation
- 1999-05-05 AU AU37888/99A patent/AU3788899A/en not_active Abandoned
- 1999-05-05 EP EP99920375A patent/EP1075531A1/en not_active Withdrawn
- 1999-05-06 AR ARP990102133A patent/AR016264A1/en not_active Application Discontinuation
-
2000
- 2000-11-06 NO NO20005585A patent/NO20005585L/en not_active Application Discontinuation
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995031560A1 (en) * | 1994-05-13 | 1995-11-23 | Transkaryotic Therapies, Inc. | Dna construct for effecting homologous recombination and uses thereof |
Non-Patent Citations (2)
Title |
---|
Geisel C. et al. : "The sequence of Homo sapiens PAC clone DJ0320J15", " EMBL Database AC004081", 3.2.1998 * |
Strong C. et al.: "The sequence of H. sapiens BAC clone GS009G13", EMBL database AC002479, 26.8.1997 * |
Also Published As
Publication number | Publication date |
---|---|
IL139433A0 (en) | 2001-11-25 |
HUP0102517A2 (en) | 2001-11-28 |
NO20005585D0 (en) | 2000-11-06 |
PL344517A1 (en) | 2001-11-05 |
CN1309710A (en) | 2001-08-22 |
CA2328459A1 (en) | 1999-11-11 |
WO1999057292A9 (en) | 1999-12-16 |
EP1075531A1 (en) | 2001-02-14 |
KR20010052278A (en) | 2001-06-25 |
CZ20003705A3 (en) | 2001-04-11 |
TR200003271T2 (en) | 2001-03-21 |
WO1999057292A1 (en) | 1999-11-11 |
JP2002513580A (en) | 2002-05-14 |
NO20005585L (en) | 2001-01-05 |
HUP0102517A3 (en) | 2004-06-28 |
AU3788899A (en) | 1999-11-23 |
AR016264A1 (en) | 2001-06-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR20150027752A (en) | Humanized il-7 rodents | |
JPH11502122A (en) | Protein production and transport | |
JPH10500570A (en) | DNA construct effective for homologous recombination and use thereof | |
NZ507451A (en) | Genomic sequences upstream of the coding region of the g-csf gene for protein production and delivery and enhancement of g-csf transcription and translation trasfection and infection into mamalian cell | |
CN113544257A (en) | Characterization and inactivation of endogenous retroviruses in chinese hamster ovary cells | |
RU2229309C2 (en) | MODIFYING EXPRESSION OF FSHβ GENE USING HOMOLOGOUS RECOMBINATION | |
CZ299418B6 (en) | DNA construct, affecting expression of endogenous IFNA2 gene, isolated nucleic acid, homologous recombinant mammal cell, method of influencing expression of endogenous IFNA2 gene, and production process of IFNA2 | |
LU501908B1 (en) | Preparation Method of Adeno-associated Virus with Epigenetic Modification Function and Application Thereof | |
JPH0568560A (en) | Gene of bovin myogenic factor | |
CN1297910A (en) | New human guanylic acid release factor and its code sequence | |
CN1297943A (en) | Human brain expressed X chromosome linkage protein and its code sequence | |
WO2004033493A1 (en) | Human protein for promoting transformation of 3t3 cell and its coding sequence | |
WO1999058556A2 (en) | Protein associated to hereditary spastic paraplegia | |
CN1303929A (en) | Novel polypeptide-robosomal protein 18 and polynucleotide coding said polypeptide | |
CN1303938A (en) | Novel polypeptide-human MATH37 and polynucleotide coding said polypeptide | |
CN1292386A (en) | New polypeptide-HRMT 35 and polynucleotide coding this polypeptide | |
CN1510045A (en) | Polypepetide-human Kringle protein 8 and polynucleotide for encoding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MM4A | Patent lapsed due to non-payment of fee |
Effective date: 20090505 |