CN1292386A - New polypeptide-HRMT 35 and polynucleotide coding this polypeptide - Google Patents

New polypeptide-HRMT 35 and polynucleotide coding this polypeptide Download PDF

Info

Publication number
CN1292386A
CN1292386A CN 99116951 CN99116951A CN1292386A CN 1292386 A CN1292386 A CN 1292386A CN 99116951 CN99116951 CN 99116951 CN 99116951 A CN99116951 A CN 99116951A CN 1292386 A CN1292386 A CN 1292386A
Authority
CN
China
Prior art keywords
polypeptide
polynucleotide
hrmt35
sequence
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 99116951
Other languages
Chinese (zh)
Inventor
毛裕民
谢毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Bodao Gene Technology Co Ltd
Original Assignee
Shanghai Bodao Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Bodao Gene Technology Co Ltd filed Critical Shanghai Bodao Gene Technology Co Ltd
Priority to CN 99116951 priority Critical patent/CN1292386A/en
Publication of CN1292386A publication Critical patent/CN1292386A/en
Pending legal-status Critical Current

Links

Abstract

The present invention discloses a new polypeptide-HRMT 35, polynucleotide coding said polypeptide and method for producing this polypeptide by means of recombination DNA technology. Said invention also discloses the method for curing several diseases, such as carcinomatosis of immune system, carcinomatosis of brain and nervous tissue and various cancers of secretory of absorption tissue, gland body and organs and some diseases related to abnormal differentiation, proliferation and degradation of cell by using said polypeptide. Said invention also discloses an antagonist for resisting said polypeptide and its therapeutic effect. Said invention also discloses the application of polynucleotide for coding said new HRMT 35.

Description

The polynucleotide of a kind of new polypeptide--HRMT35 and this peptide species of coding
The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide--HRMT35, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.
For most of eukaryotes, though the regulation and control of transcriptional level are the main modes of mRNA kind and quantity in the decision tenuigenin, but the processing of eukaryote mRNA precursor comprises that modification processing, selectivity splicing and the transportation of mRNA precursor also is the important step of gene expression regulation.The original transcription product of eucaryotic RNA polymerase II, the precursor that is called as hnRNA or mRNA is after hnRNA is transcribed, through processing and selectivity splicing, generation has the ripe mRNA of function and is discharged in the tenuigenin, and sophisticated mRNA bears a series of important biological functions in vivo.In nucleus, the mRNA precursor is that hnRNA combines formation hnRNP particle usually with the nucleus factor, and these nucleus factors comprise: heterogeneity ribose nf (hnRNPs) and micronuclear ribonucleoprotein particle (snRNP) in the nuclear.Discover that the formation of hnRNP particulate is that hnRNA shears, the prerequisite of processing, the nucleus factor that wherein participates in the formation mixture may comprise the receptor protein of processing and transporting the enzyme system of each step needs and accept adjustment signal (as hormone).All there is the N that transcribes arginine site, back in many hnRNP albumen G, N GThe modification of-dimethyl.This methylation reaction is finished by arginine methyltransferase mediation, and the arginine site that methylates may be the effect recognition site of enzyme, is essential for the generation of mature rna.Thereby, the expression imbalance of arginine methyltransferase can directly influence the not normal of interior each protein expression of organism, thereby cause various relevant diseases, as (Hamish S.Scott such as minute subclass diseases, StylianosE.Antonarakis et a1., Genomics, 1998,48:330-340).
Arginine methyltransferase has been proved the moiety of conducting as signal in eukaryotic cell growth and viral reaction process.People have cloned a plurality of members (HamishS.Scott that obtains in zymic hnRNP methyltransgerase (HMT1) and the Methyl transporters enzyme families such as people's arginine methyltransferase HRMT1L1, HRMT1L2, Stylianos E.Antonarakis et al., Genomics, 1998,48:330-340).Protein-arginine methyltransferase can be divided into I type and II type two classes again, and the I type arginine N-methyltransgerase proteic arginine site that methylates forms asymmetric N G, N G-dimethyl arginine residues; II type arginine N-methyltransgerase then forms symmetric N G, N G-dimethyl arginine residues.Member in the Methyl transporters enzyme family has higher homology, especially they all contain three distinctive Methyl transporters enzyme catalysis zones, these three zones are the catalysis arginine methyltransferase, and the Methyl transporters in the S-adenosylmethionine to arginine guanidine radicals nitrogen-atoms, is formed N G, N GThe important regulation domain of-diethylarginine (JieTang, Jonathan D.Gary et al., The Journal of Biological Chemistry1998,273:16935-16945).The insertion of methyl will be disturbed the formation of hydrogen bond between arginine guanidine radicals nitrogen and the RNA phosphate, and (Amino Acids 1998,15 (4): 291-306) for Kim S, park GH et al. thereby weaken the interaction of the nucleus factor and mRNA precursor.Thereby arginine methyltransferase is vital for the formation of the selectivity shearing of premessenger RNA and splicing, ripe mRNA.It is regulating the amount that various ripe mRNA form effectively, thereby has controlled the amount of various protein expressions.This expression of enzymes is not normal will to cause the not normal of protein in body expression, thereby cause various associated diseases.
People's of the present invention gene and people's protein arginine N-methyltransgerase HRMT1L1 have 39% identity and 54% similarity on protein level; With yeastex propylhomoserin N-methyltransgerase HMT1 35% identity and 54% similarity are also arranged on protein level.And to last both are similar, its aminoacid sequence also contains three arginine of arginine methyltransferase height homologous zone that methylates.Based on above each point, so think that new gene of the present invention is new people's arginine methyltransferase, called after HRMT35.And infer that with this it is similar to HRMT1L1 and HMT1, be all arginine methyltransferase, and have similar biological function.
An object of the present invention is to provide isolating new polypeptide--HRMT35 with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of this polypeptide of coding.
Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the HRMT35 that encodes.
Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the HRMT35 that encodes.
Another object of the present invention provides the method for producing HRMT35.
Another object of the present invention provides at polypeptide of the present invention--the antibody of HRMT35.
Another object of the present invention has provided at polypeptide of the present invention--the simulated compound of HRMT35, antagonist, agonist, inhibitor.
Another object of the present invention provides the method for the diagnoses and treatment disease relevant unusually with HRMT35.
In a first aspect of the present invention, novel isolated HRMT35 is provided, this polypeptide is the people source, it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned HRMT35 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 128-1078 position among the SEQ ID NO:1; (b) has the sequence of 1-2272 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the amino acid sequence homology comparison diagram of HRMT35 of the present invention and people HRMT1L1.The top sequence is HRMT35, and the below sequence is people HRMT1L1.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating HRMT35.34.8KDa be proteinic molecular weight.The arrow indication is isolated protein band.
As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating HRMT35 " is meant that HRMT35 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying HRMT35 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of HRMT35 polypeptide can be used amino acid sequence analysis.
The invention provides a kind of new polypeptide--HRMT35, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of HRMT35.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of HRMT35 of the present invention or active polypeptide basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.
The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 2272 bases, its open reading frame (128-1078) 316 amino acid of having encoded.Find relatively that according to amino acid sequence homologous this polypeptide and people HRMT1L1 have 39% homology, deducibility goes out this new similar 26S Proteasome Structure and Function of people PKI tool people HRMT1L1.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, the length of " nucleic acid fragment " contain 10 Nucleotide at least, better are 20-30 Nucleotide at least, are more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding HRMT35.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding HRMT35 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration HRMT35; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of HRMT35 genetic expression and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and with carrier of the present invention or directly with the host cell of HRMT35 encoding sequence through the genetically engineered generation, and the method that produces polypeptide of the present invention through recombinant technology.
Among the present invention, the polynucleotide sequence of coding HRMT35 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the HRMT35 that encodes and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989).Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The PL promotor of lambda particles phage; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding HRMT35 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Alternative is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce HRMT35 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people HRMT35, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example immune cancer, the cancer of brain and nervous tissue, the various cancers of secretion or absorptive tissue, body of gland and organ, and some diseases relevant with cellular abnormality differentiation, propagation and degraded etc.
Discover arginine methyltransferase moiety as the signal conduction in eukaryotic cell growth and viral reaction process, it is by regulating combining of the nucleus factor and RNA precursor to arginic methylating, thus the cliping and pasting and the course of processing of control RNA precursor.Thereby, arginine methyltransferase is mainly being regulated the expression of range gene in vivo, cells whose development and differentiation, they can control the level that range gene is transcribed in vivo effectively, its abnormal expression may cause cellular abnormality differentiation and propagation, as the infinite multiplication of cell, thereby cause various diseases, comprise cancer.
In vivo, arginine methyltransferase is mainly to the albumen that contains the RGG motif modification that methylates, the methylate correct location of regulating somatomedin in vivo and bring into play its function (Lin WJ in vivo of proteic arginine, Gary JD et al., J Biol Chem 1996,271 (25): 15034-44).The abnormal expression of this enzyme will cause cell growth factor correctly to locate, thereby influence the expression of some relevant cells and tissue.
Specifically with regard to HRMT35 albumen of the present invention, its protein product can be used to prevent and treats the various diseases relevant with its expression.These diseases include but not limited to following kind: immune cancer comprises leukemia, lymphoma, lymphosarcoma, myelomatosis etc.; The cancer of brain and nervous tissue comprises neuroma, neurospongioma, meningioma, neurofibroma and astrocytoma etc.; The various cancers of secretion or absorptive tissue, body of gland and organ comprise: suprarenal gland, Tiroidina, lung, pancreas, liver, prostate gland, uterus, bladder, kidney, testis and gi tract (small intestine, colon, rectum and stomach); Also have some and cellular abnormality differentiation, propagation and the relevant disease of degraded, comprise diseases such as hyperthyroidism, hypothyroidism, gastritis, polyp of colon, gastro-duodenal ulcer.
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) HRMT35.Agonist improves HRMT35 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can be in the presence of medicine, the HRMT35 with mark cultivates with mammalian cell or the film preparation of expressing HRMT35.Measure the medicine raising then or check this interactional ability.
The antagonist of HRMT35 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of HRMT35 can combine and eliminate its function with HRMT35, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, HRMT35 can be added during bioanalysis measures, by measuring compound interactional influence between HRMT35 and its acceptor is determined whether compound is antagonist.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with HRMT35 bonded peptide molecule obtains.During screening, generally tackle the HRMT35 molecule and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at the HRMT35 antigenic determinant.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
The method of the available HRMT35 direct injection of the production of polyclonal antibody immune animal (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of monoclonal antibody of preparation HRMT35 include but not limited to hybridoma technology (Kohler and Mistein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.PatNo.4946778) also can be used for producing the single-chain antibody of anti-HRMT35.
The antibody of anti-HRMT35 can be used in the immunohistochemistry technology, detects the HRMT35 in the biopsy specimen.
With the also available labelled with radioisotope of HRMT35 bonded monoclonal antibody, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of HRMT35 high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the HRMT35 positive cells.
The disease that antibody among the present invention can be used for treating or prevention is relevant with HRMT35.The antibody that gives suitable dosage can stimulate or block generation or the activity of HRMT35.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization HRMT35 level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The HRMT35 level that is detected in the test can be with laying down a definition the importance of HRMT35 in various diseases and be used to the disease of diagnosing HRMT35 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding HRMT35 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of HRMT35 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the HRMT35 that expresses variation, to suppress endogenic HRMT35 activity.For example, a kind of HRMT35 of variation can be the HRMT35 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of HRMT35 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding HRMT35 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding HRMT35 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding HRMT35 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of HRMT35 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding HRMT35 can be used for the diagnosis with the relative disease of HRMT35.The unconventionality expression of the expression that the polynucleotide of coding HRMT35 can be used for detecting HRMT35 HRMT35 whether or under morbid state.As the dna sequence dna of the HRMT35 that encodes can be used for biopsy specimen is hybridized to judge the expression situation of HRMT35.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect HRMT35 with the special primer of HRMT35.
The sudden change that detects the HRMT35 gene also can be used for the disease of diagnosing HRMT35 relevant.The form of HRMT35 sudden change comprises that the point mutation compared with normal wild type HRMT35 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.HRMT35 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's HRMT35 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.The clone of embodiment 1:HRMT35
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms cDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α; Bacterium forms the cDNA library.Measure the sequence of all clones' 5 ' and 3 ' end with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0051B11 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0051B11 clone is 2272bp (shown in Seq ID NO:1), from 128-1078bp the open reading frame (ORF) of a 950bp, the new protein (shown in Seq IDNO:2) of encoding arranged.We are with this clone's called after pBS-0051B11, encoded protein matter called after HRMT35.Embodiment 2:cDNA clone's homology retrieval
With sequence and the encoded protein sequence thereof of HRMT35 of the present invention, with Blast program (Basic localAlignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with HRMT35 homology of the present invention is a kind of known people HRMT1L1, and its encoded protein number is U80213 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 39%; Similarity is 55%.Embodiment 3: with RT-PCR method clone HRMT35 gene
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1:5’-GGGGGAGGGAACTGAAGAGGAAGAT-3’(SEQ?ID?N0.3)
Primer2:5’-TCATCTATAAAACGTGAGAATGTG-3’(SEQ?IDNO.4)
Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;
Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl 2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃, 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-2272bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting is analyzed the HRMT35 expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) advances ground homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49:1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α- 32P dATP prepares by random priming 32The dna probe of P-mark.Used dna probe is the HRMT35 coding region sequence (128bp to 1078bp) of pcr amplification shown in Figure 1.Will 32The probe of P-mark (about 2 * 10 6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH 2PO 4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with PhosphorImager.Embodiment 5: vivoexpression, separation and the purifying of reorganization HRMT35
According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:5’-CCCGAATTCATGATCGCGGACCGCGTCCG-3’(Seq?ID?No?5)
Primer4:5’-GGATCCTCAGTCCTCCATGGCAAAGTC-3’(Seq?ID?No?6)
5 ' end of these two sections primers contains EcoRI and BamHI restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, EcoRI and BamHI restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0051B11 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0051B11 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2 min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with EcoRI and BamHI, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connecting product transforms with the big enterobacterial Dh5 of Calcium Chloride Method α; , after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order.Select the correct positive colony of sequence (pET-0490B02) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0490B02) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein HRBP-3 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 34.8kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-HRMT35 production of antibodies
With the synthetic specific polypeptide of following HRBP-3: the NH of Peptide synthesizer (PE company product) 2-Met-Ile-Ala-Asp-Arg-Val-Arg-Thr-Asp-Ala-Tyr-Arg-Leu-Gly-Ile-OH (SEQ ID NO:7).Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with HRMT35 specifically.
Sequence table
(1) general information:
(i) denomination of invention: new HRMT35
(ii) sequence number: 7
(1) information of SEQ ID NO:1:
(i) sequence signature:
(A) length: 2272bp
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(ii) molecule type: cDNA
( xi ) :SEQ ID NO:1:1 GGGGGAGGGAACTGAAGAGGAAGATGGCGCGGAGCGGGAGGCGGCCCTGGAGCGACCCCG61 GAGGACTAAGCGGGAACGGGACCAGCTGTACTACGAGTGCTACTCGGACGTTTCGGTCCA121 CGAGGAGATGATCGCGGACCGCGTCCGCACCGATGCCTACCGCCTGGGTATCCTTCGGAA181 CTGGGCAGCACTGCGAGGCAAGACGGTACTGGACGTGGGCGCGGGCACCGGCATTCTGAG241 CATCTTCTGTGCCCAGGCCGGGGCCCGGCGCGTGTACGCGGTAGAGGCCAGCGCCATCTG301 GCAACAGGCCCGGGAGGTGGTGCGGTTCAACGGGCTGGAGGACCGGGTGCACGTCCTGCC361 GGGACCAGTGGAGACTGTAGAGTTGCCGGAACAGGTGGATGCCATCGTGAGCGAGTGGAT421 GGGCTACGGACTCCTGCACGAGTCCATGCTGAGCTCCGTCCTCCACGCGCGAACCAAGTG481 GCTGAAGGAGGGCGGTCTTCTCCTGCCGGCCTCCGCCGAGCTCTTCATAGCCCCCATCAG541 CGACCAGATGCTGGAATGGCGCCTGGGCTTCTGGAGCCAGGTGAAGCAGCACTATGGTGT601 GGACATGAGCTGCCTGGAGGGCTTCGCCACGCGCTGTCTCATGGGCCACTCGGAGATCGT661 TGTGCAGGGATTGTCCGGCGAGGACGTGCTGGCCCGGCCGCAGCGCTTTGCTCAGCTAGA721 GCTCTCCCGCGCCGGCTTGGAGCAGGAGCTGGAGGCCGGAGTGGGCGGGCGCTTCCGCTG781 CAGCTGCTGTGGCTCGGCGCCCATGCATGGCTTTGCCATCTGGTTCCAGGTGACCTTCCC841 TGGAGGGGAGTCGGAGAAACCCCTGGTGCTGTCCACCTCGCCTTTTCACCCGGCCACTCA901 CTGGAAACAGGCGCTCCTCTACCTGAACGAGCCGGTGCAAGTGGAGCAAGACACGGACGT961 TTCAGGAGAGATCACGCTGCTGCCCTCCCGGGACAACCCCCGTCGCCTGCGCGTGCTGCT1021 GCGCTACAAAGTGGGGGACCAGGAGGAGAAGACCAAAGACTTTGCCATGGAGGACTGAGC1081 GTTGCCTTTTCTCCCAGCTACCTCCCAAAGCAGCCTGACCTGCGTGGGAGAGGCGTAGCG1141 AGGTCGGAGGGGAAAGGGAGATCCCACGTGCAAGTAGGGGGAATATCTCCCCCTTTTCCC1201 TCATAGCCTCTAGGGAGGGAGAGTGACTTCATTCTCCATTTGAAGAGATTCTTCTGGTGA1261 TGTTTACTTAAAAAGTGATCCCCCTCAACAACGGATACAGCGTGCTTATTATTGGGCATT1321 TAGCCTCAAAAGCATGTAGTACCAAGCACTTGTATTTCCGTATATTTTGTTTCGCGGGGG1381 AGTGAGGGGGAAGAACACGGATGAAAATGTCAGTTTTTGAAGGGCCATGCACATCCCTGA1441 CACCTCACACCTTATCTAAGTCTGAAGCTGGGGAGAAAGGAGTTCATTTAGACTTCATAC1501 ATTTCCAGTACGACTTTAGTATCTCTCCAGAGCCATATTTTCTCAGTCCGAATTAATTCC1561 CCCTCCCTAGGTGCCTGTAGGCTATGGTACTTCTTCCTCATTGTTTTCTAGGTAAACTTC1621 ACTACTGGTAATTAAGGGGAAGGATATGAGGAAGCAGTTTAAATAGCCCTGTTCTCATTA1681 CTCTGACCACATACATCATAGGGTGCTAAAGTTGATGAACACATTAATCCGTTAAGTAAA1741 ATGGACTTTGTAATTGTACAGCATACCTAAGAAACTCAGAAGGTGCATTTAAGAGAGAGA1801 CCTGAAAGAAATAGTATGGATTTTTAAAAATTCTTGTCTCTACTATTATAACCAAAAAAT1861 ATTTCTTGTATGTCCCATAAAAATATTTGTGTAATTCTTATGAAACAGGCTGGTAGAGGA1921 GGTTTCTGAGCCTAGCCCAAGGGCTTATTCATCACCATGGGTAAATTATTTAAACTCACT1981 TAATTAAGGAAAATATTTTCCCAGCTAGAAAAGTATACTCATTCTCATTTAAACTCTCTC2041 ATTTGGAGGGATCATGTGAGTTGGCCTACTTACAAGTAGTGAAAGTTCCCTTTTCAGTTT2101 TGTTTTGTTTTGTTTTGTTTTTCTCTTTCACTCAGCCAAATTTGAAAGTTGTGAATTTAG2161 GAAAATCACTTGTAATGAAGTGTGAATCTTGTTATCAAATTTATTTCTCTGATGTTTCCT2221 TCCTTATCCTTGTAGCCAATAAAACATTGACATTCTCACGTTTTATAGATGA
(2) information of SEQ ID NO:2:
(i) sequence signature:
(A) length: 316 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ii) molecule type: polypeptide
( xi ) :SEQ ID NO:2: 1 Met Ile Ala Asp Arg Val Arg Thr Asp Ala Tyr Arg Leu Gly Ile 16 Leu Arg Asn Trp Ala Ala Leu Arg Gly Lys Thr Val Leu Asp Val 31 Gly Ala Gly Thr Gly Ile Leu Ser Ile Phe Cys Ala Gln Ala Gly 46 Ala Arg Arg Val Tyr Ala Val Glu Ala Ser Ala Ile Trp Gln Gln 61 Ala Arg Glu Val Val Arg Phe Asn Gly Leu Glu Asp Arg Val His 76 Val Leu Pro Gly Pro Val Glu Thr Val Glu Leu Pro Glu Gln Val 91 Asp Ala Ile Val Ser Glu Trp Met Gly Tyr Gly Leu Leu His Glu106 Ser Met Leu Ser Ser Val Leu His Ala Arg Thr Lys Trp Leu Lys121 Glu Gly Gly Leu Leu Leu Pro Ala Ser Ala Glu Leu Phe Ile Ala136 Pro Ile Ser Asp Gln Met Leu Glu Trp Arg Leu Gly Phe Trp Ser151 Gln Val Lys Gln His Tyr Gly Val Asp Met Ser Cys Leu Glu Gly166 Phe Ala Thr Arg Cys Leu Met Gly His Ser Glu Ile Val Val Gln181 Gly Leu Ser Gly Glu Asp Val Leu Ala Arg Pro Gln Arg Phe Ala196 Gln Leu Glu Leu Ser Arg Ala Gly Leu Glu Gln Glu Leu Glu Ala211 Gly Val Gly Gly Arg Phe Arg Cys Ser Cys Cys Gly Ser Ala Pro226 Met His Gly Phe Ala Ile Trp Phe Gln Val Thr Phe Pro Gly Gly241 Glu Ser Glu Lys Pro Leu Val Leu Ser Thr Ser Pro Phe His Pro256 Ala Thr His Trp Lys Gln Ala Leu Leu Tyr Leu Asn Glu Pro Val271 Gln Val Glu Gln Asp Thr Asp Val Ser Gly Glu Ile Thr Leu Leu286 Pro Ser Arg Asp Asn Pro Arg Arg Leu Arg Val Leu Leu Arg Tyr301 Lys Val Gly Asp Gln Glu Glu Lys Thr Lys Asp Phe Ala Met Glu316 Asp
(3) information of SEQ ID NO:3
(i) sequence signature
(A) length: 25 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:3:
5’-GGGGGAGGGAACTGAAGAGGAAGAT-3’
(4) information of SEQ ID NO:4
(i) sequence signature
(A) length: 24 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:4:
5’-TCATCTATAAAACGTGAGAATGTG-3’
(5) information of SEQ ID NO:5
(i) sequence signature
(A) length: 29 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:5:
5’-CCCGAATTCATGATCGCGGACCGCGTCCG-3’
(6) information of SEQ ID NO:6
(i) sequence signature
(A) length: 27 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: oligonucleotide
(xi) sequence description: SEQ ID NO:6:
5’-GGATCCTCAGTCCTCCATGGCAAAGTC-3’
8) information of SEQ ID NO:7:
(i) sequence signature:
(A) length: 15 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ii) molecule type: polypeptide (xi) sequence description: SEQ ID NO:7:NH 2-Met-Ile-Ala-Asp-Arg-Val-Arg-Thr-Asp-Ala-Tyr-Arg-Leu-Gly-Ile-OH

Claims (18)

1, a kind of isolated polypeptide-HRMT35 is characterized in that it includes: the polypeptide of the aminoacid sequence shown in the SEQ ID NO:2 or active fragments, analogue or the derivative of its polypeptide.
2, polypeptide as claimed in claim 1, the aminoacid sequence that it is characterized in that described polypeptide, analogue or derivative has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.
3, polypeptide as claimed in claim 2 is characterized in that it comprises the polypeptide with the aminoacid sequence shown in the SEQ ID NO:2.
4, a kind of isolating polynucleotide is characterized in that described polynucleotide comprise to be selected from a kind of of one of following group:
(a) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in the SEQ ID NO:2 or its fragment, analogue, derivative;
(b) with polynucleotide (a) complementary polynucleotide; Or
(c) with (a) or the polynucleotide of at least 70% homogeny (b) are arranged.
5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise the polynucleotide that coding has aminoacid sequence shown in the SEQ IDNO:2.
6, polynucleotide as claimed in claim 4, the sequence that it is characterized in that described polynucleotide include the sequence of 1-2272 position among the sequence of 128-1078 position among the SEQ IDNO:1 or the SEQ ID NO:1.
7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is by the recombinant vectors that requires described polynucleotide of arbitrary claim among the 4-6 and plasmid, virus or vehicle expression vector establishment to form.
8, a kind of genetically engineered host cell that contains exogenous polynucleotide is characterized in that it is to be selected from following a kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7;
(b) host cell that transforms or transduce with the described polynucleotide of arbitrary claim that require among the 4-66.
9, a kind of preparation method with the active polypeptide of HRMT35 is characterized in that described method comprises:
(a) expressing under the HRMT35 condition, cultivate the described through engineering approaches host cell of claim 8;
(b) from culture, isolate and have the active polypeptide of HRMT35.
10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with HRMT35 specificity bonded antibody.
11, the compound of an analoglike or adjusting polypeptide active or expression is characterized in that they are simulation, promotion, antagonism or the active compound that suppresses HRMT35.
12, compound as claimed in claim 11 is characterized in that it is the polynucleotide sequence shown in the SEQ ID NO.1 or its segmental antisense sequences.
13, the described application of compound of a kind of claim 11, it is characterized in that described compound be used to regulate HRMT35 in vivo, the method for external activity.
14, a kind of disease relevant or method of disease susceptibility of detecting with the described polypeptide of arbitrary claim among the claim 1-3, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide, perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.
15, as the application of polypeptide as described in the arbitrary claim among the claim 1-3, it is characterized in that it is applied to screen the stand-in of HRMT35, agonist, antagonist or inhibitor; Perhaps be used for the peptide finger print identification.
16, as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6, it is characterized in that it is used for nucleic acid amplification reaction as primer, perhaps be used for hybridization, perhaps be used to make gene chip or microarray as probe.
17,, it is characterized in that forming pharmaceutical composition with safe and effective dosage and pharmaceutically acceptable carrier as diagnosis or the treatment disease relevant unusually with HRMT35 with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 or 11.
18, as the described polypeptide of arbitrary claim, polynucleotide or application of compound in claim 1-6 or 11, it is characterized in that being used for the treatment of immune cancer the cancer of brain and nervous tissue with described polypeptide, polynucleotide or compound; The various cancers of secretion or absorptive tissue, body of gland and organ, the medicine of some diseases relevant in addition with cellular abnormality differentiation, propagation and degraded.
CN 99116951 1999-10-10 1999-10-10 New polypeptide-HRMT 35 and polynucleotide coding this polypeptide Pending CN1292386A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 99116951 CN1292386A (en) 1999-10-10 1999-10-10 New polypeptide-HRMT 35 and polynucleotide coding this polypeptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 99116951 CN1292386A (en) 1999-10-10 1999-10-10 New polypeptide-HRMT 35 and polynucleotide coding this polypeptide

Publications (1)

Publication Number Publication Date
CN1292386A true CN1292386A (en) 2001-04-25

Family

ID=5279613

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 99116951 Pending CN1292386A (en) 1999-10-10 1999-10-10 New polypeptide-HRMT 35 and polynucleotide coding this polypeptide

Country Status (1)

Country Link
CN (1) CN1292386A (en)

Similar Documents

Publication Publication Date Title
CN1302868A (en) Polypeptide-human F1F0 ATP synthetase subunit 15 and polynucleotide for coding it
CN1292386A (en) New polypeptide-HRMT 35 and polynucleotide coding this polypeptide
CN1303930A (en) Novel polypeptide-zinc finger protein 57 and polynucleotide coding said polypeptide
CN1303944A (en) Novel polypeptide-threonine synthetase 71 and polynucleotide coding said polypeptide
CN1303933A (en) Novel polypeptide-human muscle BOP protein 41 and polynucleotide coding said polypeptide
CN1293204A (en) Polypeptide-human bromo-functional protein 72 and polynucleotide for coding this polypeptide
CN1302881A (en) Polypeptide-human beta-galactoside binding protein and polynucleotide for coding it
CN1303937A (en) Novel polypeptide-human tissue anion transport polypeptide 41 and polynucleotide coding said polypeptide
CN1303939A (en) Novel polypeptide-transcription factor 43 and polynucleotide coding said polypeptide
CN1470524A (en) Polypeptide-human transcriptional elongation factor IIS51 and polynucleotide encoding this polypeptide
CN1302877A (en) Polypeptide-human nuclein II precursor protein 25 and polynucleotide for coding it
CN1302817A (en) Polypeptide-human S4 ribosomal protein 20 and polynucleotide for coding it
CN1297917A (en) Human zinc-finger protein 38 as one new kind of polypeptide and polynucleotides encoding this polypeptide
CN1303925A (en) Novel polypeptide-arginyl tRNA synthetase 44 and polynucleotide coding said polypeptide
CN1302871A (en) Polypeptide-human vacuolus proton-adenosine triphosphatase C subunit 42 and polynucleotide for coding it
CN1303945A (en) Novel polypeptide-serine/threonine kinase 39 and polynucleotide coding said polypeptide
CN1303929A (en) Novel polypeptide-robosomal protein 18 and polynucleotide coding said polypeptide
CN1302882A (en) Polypeptide-human ankyrin 27 and polynucleotide for coding it
CN1292419A (en) New human III type ethanol dehydrogenase and its code sequence
CN1302898A (en) Polypeptide-human phosphatidase 14 and polynucleotide for coding it
CN1303863A (en) Novel polypeptide-human transcriptional elongation factor IIS51 and polynucleotide for coding this polypeptide
CN1302887A (en) Polypeptide-dyein light-medium chain 58 and polynucleotide for coding it
CN1303866A (en) Novel polypeptide-zinc finger protein 36 and polynucleotide for coding this polypeptide
CN1302867A (en) Polypeptide-human transposase 105 and polynucleotide for coding it
CN1302894A (en) Polypeptide-human dehydrogenase 35 and polynucleotide for coding it

Legal Events

Date Code Title Description
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C06 Publication
PB01 Publication
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication