WO2004033493A1 - Human protein for promoting transformation of 3t3 cell and its coding sequence - Google Patents

Abstract

The present invention discloses a novel human protein with the function of promoting 3T3 cell transformation, the polynucleotide for coding the peptide, the process for preparing the polypeptidc by recombination, the antagon of the polypeptide and its medical action, and the application of the polynucleotide encoding the novel human protein with function of promoting 3T3 cell transformation are disclosed.

Description

 Novel human protein with function of promoting transformation of mouse NIH / 3T3 cells and its coding sequence TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention relates to a novel polynucleotide encoding a human protein having a function of promoting 3T3 cell transformation, and a polypeptide encoded by the polynucleotide. The invention also relates to the use and preparation of such polynucleotides and peptides. Background technique

 Human genomics research is currently an international hot spot. In addition to methods for large-scale sequencing of human chromosomal DNA and sequencing of expressed sequences (EST), there is also a lack of high-throughput methods for screening functional genes from the start of function.

 Cancer is one of the main diseases that endanger human health. In order to effectively treat and prevent tumors, people have paid more and more attention to gene therapy of tumors. Therefore, there is an urgent need in the art to develop human proteins and their agonists / inhibitors related to the growth of cancer cells. Summary of the Invention

 The object of the present invention is to provide a new class of human protein polypeptides with the function of promoting 3T3 cell transformation, as well as fragments, analogs and derivatives thereof.

 Another object of the invention is to provide polynucleotides encoding these polypeptides.

 Another object of the present invention is to provide a method for producing these polypeptides and the use of the polypeptides and coding sequences. In a first aspect of the present invention, there is provided a novel and isolated protein polypeptide having a function of promoting 3T3 cell transformation, which comprises a polypeptide having an amino acid sequence selected from the group consisting of: SEQ ID NO: 2, 4, 6, 8, 10 , 12, 14, 16, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102 Or 104; or a conservative variant polypeptide thereof, or an active fragment thereof, or an active derivative thereof.

 Preferably, the polypeptide is a polypeptide having an amino acid sequence selected from the group consisting of: SEQ ID NO: 2, 4, 6, 8,

10, 12, 14, 16, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104.

In a second aspect of the present invention, an isolated polynucleotide is provided, which comprises a nucleotide sequence that is at least 85% identical to a nucleotide sequence selected from the group consisting of: (A) a polynucleotide encoding the above-mentioned protein polypeptide having a function of promoting transformation of 3T3 cells; (b) a polynucleotide complementary to the polynucleotide (a). Preferably, the polypeptide encoded by the polynucleotide has an amino acid sequence selected from the group consisting of: SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 34, 36, 38, 40, 42 ,, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104. More preferably, the sequence of the polynucleotide is selected from the group consisting of: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 33, 35, 37, 39, 41, 43, 45, 47 , 49, 51, 53, 55, 57, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103 or full-length sequences. Confirm this In a third aspect of the present invention, there are provided a vector containing the above polynucleotide, and a host cell transformed or transduced by the vector or a host cell directly transformed or transduced by the above polynucleotide.

 In a fourth aspect of the present invention, there is provided a method for preparing a polypeptide having a function of promoting the transformation of 3T3 cells, the method comprising: (a) culturing the above under conditions suitable for expressing a protein having the function of promoting transformation of 3T3 cells; Transformed or transduced host cells; (b) isolating a polypeptide having a protein activity that promotes 3T3 cell transformation from the culture.

 In a fifth aspect of the present invention, there is provided an antibody that specifically binds to the above-mentioned protein polypeptide having a function of promoting 3T3 cell transformation. A nucleic acid molecule for detection is also provided, which contains 10 consecutive nucleotides to the full-length nucleotides in the above-mentioned polynucleotide, preferably it contains about 15-1000 nucleotides consecutively.

 In a sixth aspect of the present invention, a pharmaceutical composition is provided, which contains a safe and effective amount of the protein polypeptide of the present invention having a function of promoting 3T3 cell transformation and a pharmaceutically acceptable carrier. These pharmaceutical compositions are useful for promoting cell growth. The present invention also provides a pharmaceutical composition, which contains a safe and effective amount of an antagonist (such as an antibody) against a protein polypeptide of the present invention that has the function of promoting 3T3 cell transformation, and a pharmaceutically acceptable carrier. The pharmaceutical composition can treat diseases such as cancer and abnormal cell proliferation.

 Other aspects of the invention will be apparent to those skilled in the art from the technical disclosure herein. detailed description

 3T3 cells are a mouse fibroblast (J. Cell. Biol., 17: 299, 1963) (also known as NIH / 3T3 cells). In the field of cancer research, foreign genes (especially human genes) are often introduced into 3T3 cells and their effects on the growth of 3T3 cells are observed. It is generally believed that the genes that affect the growth (or malignant transformation or transfection) of 3T3 cells are cancer-related genes, among which the genes that inhibit the growth or transformation of 3T3 cells are mostly tumor suppressor genes, while the genes that affect the growth or transformation of 3T3 cells Promoting genes are mostly (pro) oncogenes.

 According to the present invention, large-scale cDNA clones are used to transfect mouse embryonic fibroblasts 3T3. On the basis of obtaining growth-promoting effects, sequencing proves that they are new genes, and further obtains full-length cDNA clones. The DNA transfection test confirmed that the protein having the function of promoting the transformation of 3T3 cells of the present invention has the effect of promoting the formation of clones in 3T3 cells, and the promotion rate is 50%.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not separated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated protein or polypeptide having the function of promoting 3T3 cell transformation" means that the protein polypeptide having the function of promoting 3T3 cell transformation is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can use standard protein purification techniques to purify proteins with the function of promoting 3T3 fine transformation. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The present invention Peptides can be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the starting methionine residue.

 The present invention also includes fragments, derivatives and analogs of human proteins having the function of promoting the transformation of 3T3 cells. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the natural human protein of the present invention that has the function of promoting 3T3 cell transformation. A polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues It may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a mature polypeptide with another compound (such as a compound that extends the half-life of a polypeptide, such as (Polyethylene glycol), a polypeptide formed by fusion, or (iv) a polypeptide formed by fusing an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a proteinogen sequence). In accordance with the teachings herein, these fragments, derivatives, and analogs are within the scope of those skilled in the art.

 The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. Taking the FP17659 protein (in this application, the protein is named by its clone number) as an example, the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, "degenerate variant" means to FP17659 a nucleic acid sequence that encodes a protein having SEQ ID NO: 2 but differs from the coding region sequence shown in SEQ ID NO: 1. Taking the FP17720 protein as an example, the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 3 or a degenerate variant. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding a protein having SEQ ID NO: 4 but different from the coding region sequence shown in SEQ ID NO: 3 for FP17720. For other proteins of the present invention having the function of promoting 3T3 cell transformation, and so on.

 Polynucleotides encoding mature polypeptides include: coding sequences that only encode mature polypeptides; coding sequences for mature polypeptides and various additional coding sequences; coding sequences for mature polypeptides (and optional additional coding sequences) and non-coding sequences.

 The term "polynucleotide encoding a polypeptide" may include a polynucleotide that encodes the polypeptide, or a polynucleotide that also includes additional coding and / or non-coding sequences.

 The present invention also relates to a variant of the above-mentioned polynucleotide, which encodes a polypeptide having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptide. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is a replacement form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The present invention also relates to a polynucleotide that hybridizes to the sequence described above and has at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. In particular, the present invention relates to the use of a polynucleotide according to the present invention under stringent conditions. Hybridized polynucleotide. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 X SSC, 0.1% SDS, 60 V; or (2 ) A denaturant is added during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) only between two sequences Crosses occur when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 (taking the FP17659 protein as an example).

 The invention also relates to a nucleic acid fragment that hybridizes to the sequence described above. As used herein, a "nucleic acid fragment" contains at least 15 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. Nucleic acid fragments can be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides that encode proteins with functions that promote 3T3 cell transformation.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.

 The DNA sequence of the present invention can be obtained by several methods. For example, DNA is isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous nucleotide sequences, and 2) antibody screening of expression libraries to detect cloned DNA fragments with common structural characteristics .

 The specific DNA fragment sequence encoding a protein having a function of promoting the transformation of 3T3 cells can also be obtained by: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the desired polypeptide.

 When the entire amino acid sequence of the desired polypeptide product is known, direct chemical synthesis of the DNA sequence is often the method of choice. If the entire sequence of the desired amino acid is unclear, direct chemical synthesis of the DNA sequence is not possible, and the method of choice is the isolation of the cDNA sequence. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to):

(l) DNA-DNA or DNA-RNA hybridization; (2) the appearance or loss of the function of a marker gene; (3) the determination of the level of a transcript of a protein having the function of promoting the transformation of 3T3 cells; (4) the use of immunological techniques or determination Biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.

 A method for amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein. And can be synthesized by conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The nucleotide sequence of the gene of the present invention obtained as described above, or various DNA fragments can be determined by a conventional method such as dideoxy chain termination method (Sanger et al, PNAS, 1977, 74: 5463-5467). Nucleotides For sequencing, a commercial sequencing kit or the like can also be used. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or a protein coding sequence having the function of promoting 3T3 cell transformation, and a method for producing the polypeptide of the present invention by recombinant technology .

 By conventional recombinant DNA technology (Science, 1984; 224: 1431), the polynucleotide sequence of the present invention can be used to express or produce recombinant protein polypeptides with the function of promoting the transformation of 3T3 cells. Generally there are the following steps-

(1) using the polynucleotide (or variant) of the present invention encoding a human protein having the function of promoting 3T3 cell transformation, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) host cells cultured in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In the present invention, a human protein polynucleotide sequence having a function of promoting 3T3 cell transformation can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, any plasmid and vector can be used as long as it can be replicated and stabilized in the host. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes and translation control elements.

Methods well known to those skilled in the art can be used to construct an expression vector containing a human protein-encoding DNA sequence having the function of promoting transformation of 3T3 cells and a suitable transcription / translation control signal. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al) _a DNA sequence can be effectively linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the lambda phage _PL promoter; eukaryotic promoters including the CMV immediate early promoter, early and late SV40 promoters, and some other known controllable A promoter in which a gene is expressed in a prokaryotic or eukaryotic cell or its virus. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 A vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell to enable it to express a protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells of Drosophila S2 or Sf9; CH0, COS or Bowes melanoma cells and other animal cells.

Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 The obtained transformants can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 The recombinant polypeptide in the above method can be coated intracellularly, extracellularly, or expressed on the cell membrane or secreted extracellularly. If necessary, the physical, chemical, and other properties can be used to separate and purify the recombinant protein by various separation methods. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmosis, ultratreatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 Recombinant human proteins or polypeptides capable of promoting the transformation of 3T3 cells have many uses. These uses include (but are not limited to): direct use as a drug to treat diseases caused by low or loss of protein function to promote 3T3 cell transformation, and to screen antibodies that promote or fight protein function that promote 3T3 cell transformation, Polypeptide or other ligand. For example, the antibody can be used to treat cancer or abnormal cell proliferation. The recombinantly-expressed protein sieve selection peptide library of the present invention can be used to find therapeutically valuable polypeptide molecules capable of inhibiting or stimulating human protein functions capable of promoting 3T3 cell transformation.

 The present invention also provides a method for screening a drug to identify an agent that increases (agonist) or suppresses (antagonist) a human protein having a function of promoting 3T3 cell transformation. Agonists increase biological functions such as human protein stimulation of cell proliferation that promotes the transformation of 3T3 cells, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.

 Antagonists of human proteins having the function of promoting 3T3 cell transformation include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human proteins with the function of promoting 3T3 cell transformation can bind to and eliminate human proteins with the function of promoting 3T3 cell transformation, or inhibit the production of human proteins with the function of promoting 3T3 cell transformation, or with peptides The active site binding prevents the polypeptide from performing its biological function. Antagonists of human proteins having the function of promoting the transformation of 3T3 cells are useful for therapeutic use.

 When screening compounds as antagonists, proteins with a function to promote 3T3 cell transformation can be added to the bioanalytical assay, and whether the compound affects the interaction between the protein with 3T3 cell transformation function and its receptor can be determined to determine whether the compound Is an antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.

The antagonists of the protein of the present invention can be directly used in the treatment of diseases, such as various malignant tumors, and abnormal cell proliferation. Wait.

 The polypeptides of the present invention, and fragments, derivatives, analogs or their cells can be used as antigens to produce antibodies. These antibodies can be polyclonal or monoclonal antibodies. Polyclonal antibodies can be obtained by injecting the polypeptide directly into an animal. Techniques for preparing monoclonal antibodies include hybridoma technology, triple tumor technology, human B-cell hybridoma technology, and EBV-hybridoma technology.

 The polypeptides and antagonists of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of a polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that produce, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as via a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. The protein or its specific antibody having the function of promoting 3T3 cell transformation can be administered in an amount effective to treat and / or prevent a specific indication. The amount and dosage range of a protein that promotes the transformation of 3T3 cells into a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

 Polynucleotides of human proteins that promote the transformation of 3T3 cells can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell development or metabolism caused by the lack of expression or abnormality / inactivity of a protein that promotes 3T3 cell transformation.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human protein mRNA with the function of promoting 3T3 cell transformation are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes to a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in various ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell via a vector (such as a virus, phage, or plasmid) in vitro Then, the cells are transplanted into the body. Since the protein of the present invention has the function of promoting the transformation of 3T3 cells, the antisense sequence of the protein coding sequence of the present invention can be introduced into cells to inhibit abnormal proliferation of the cells (such as canceration). ·

The invention also provides antibodies against human protein antigenic determinants with the function of promoting 3T3 cell transformation. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries. Antibodies against human proteins with the function of promoting 3T3 cell transformation can be used in immunohistochemical techniques to detect human proteins with the function of promoting 3T3 cell transformation in biopsy specimens.

 Monoclonal antibodies that bind to human proteins that promote the transformation of 3T3 cells can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 The antibodies of the present invention can be used to treat or prevent diseases related to human proteins having the function of promoting 3T3 cell transformation. Administration of an appropriate dose of the antibody can block the production or activity of a human protein that has the function of promoting 3T3 cell transformation, thereby inhibiting the growth of cancer cells and / or abnormal proliferation of cells.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, monoclonal antibodies with high affinity for human proteins that promote 3T3 cell transformation can be covalently bound to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill related positive cells (such as cancer cells). .

 Polyclonal antibodies can be produced by immunizing animals, such as rabbits, mice, and rats, with human proteins or peptides capable of promoting 3T3 cell transformation. A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant and the like.

 Human protein monoclonal antibodies with the ability to promote 3T3 cell transformation can be produced using hybridoma technology (Kohler and

Milstein. Nature, 1975, 256: 495-497). Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human proteins that promote the transformation of 3T3 cells.

 Polypeptide molecules capable of binding to a human protein having the function of promoting 3T3 cell transformation can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, human protein molecules with the function of promoting 3T3 cell transformation must be labeled.

 The present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human protein having the function of promoting 3T3 cell transformation. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of the protein having the function of promoting 3T3 cell transformation detected in the test can be used to explain the importance of the protein having the function of promoting 3T3 cell transformation in various diseases and to diagnose the role of the protein having the function of promoting 3T3 cell transformation disease.

Polynucleotides with a protein having a function of promoting the transformation of 3T3 cells can be used for the diagnosis and treatment of protein-related diseases having a function of promoting the transformation of 3T3 cells. In terms of diagnosis, a polynucleotide having a protein capable of promoting 3T3 cell transformation can be used to detect the expression of a protein having a function to promote 3T3 cell transformation or an abnormal expression of a protein having a function to promote 3T3 cell transformation in a disease state. For example, the protein DNA sequence with the function of promoting the transformation of 3T3 cells can be used for hybridization of biopsy specimens to determine the abnormal expression of the protein with the function of promoting the transformation of 3T3 cells. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (ie, a gene chip), and used to analyze differential expression analysis and gene diagnosis of genes in tissues. RNA-polymerase with protein-specific primers that promote transformation of 3T3 cells The in vitro amplification of strand reaction (RT-PCR) can also detect the transcription products of proteins with the function of promoting the transformation of 3T3 cells.

 Detection of mutations in a protein gene capable of promoting 3T3 cell transformation can also be used to diagnose a protein-related disease having a function of promoting 3T3 cell transformation. The forms of protein mutations having the function of promoting the transformation of 3T3 cells include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type protein DNA sequence of the functions of promoting 3T3 cells transformation. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. These sequences are specific to a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. However, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. In order to associate these sequences with disease-related genes. The first step is to locate the DNA sequence of the invention on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic

Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the gene's map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the cDNA or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR.

 The full-length protein nucleotide sequence or fragment thereof of the present invention having the function of promoting the transformation of 3T3 cells can be used

Obtained by PCR amplification method, recombinant method or artificial synthesis method. For the PCR amplification method, primers can be designed according to the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, and a commercially available cDNA library or cDNA prepared according to conventional methods known to those skilled in the art can be used. The library is used as a template and the relevant sequences are amplified. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then stitch the amplified fragments together in the correct order.

Once the relevant sequences are obtained, the recombination method can be used to obtain the relevant sequences in large quantities. This is usually the The vector is cloned into a vector, and then transferred into a cell, and then the relevant sequence is isolated from the proliferated host cell by a conventional method. In addition, synthetic methods can also be used to synthesize related sequences, especially when the fragment length is short. In general, long fragments can be obtained by first synthesizing multiple small fragments and then concatenating them.

 At present, DNA sequences encoding proteins (or fragments, or derivatives thereof) of the present invention can be completely chemically synthesized. This DNA sequence can then be introduced into various DNA molecules (such as vectors) and cells in the art. In addition, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

 In addition, since the protein having the function of promoting 3T3 cell transformation of the present invention has a natural amino acid sequence derived from humans, it is expected to have higher activity and / Or lower side effects (such as less or no immunogenicity in the human body). The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions. Note that in the combined nucleotide and amino acid sequence, (1) gives the positions of the first nucleotide of the start and stop coders, and (2) the molecular weight unit is Dalton.

 Example 1: Obtaining of cDNA Gene and Its Effect on Promoting the Formation of Mouse NIH / 3T3 Cells

 FP17659, FP17720, FP17859, FP17889, FP17926, FP18346, FP18407 and FP18717 are derived from human fetal cDNA libraries constructed using conventional methods.

 FP17548, FP17581 and FP17780 are from human fetal cDNA libraries constructed by conventional methods;

LP2254, LP2261, LP2477, LP2537, LP2561, LP2642, LP2698, LP2709, LP3663 and LP3727 are derived from normal liver cDNA libraries constructed by conventional methods.

 FP18315 is derived from a human fetal cDNA library constructed using conventional methods; LP2209, LP2570, LP3317, LP3428, LP4947, LP5553, LP6347, LP8067, and LP8151 are derived from normal liver cDNA libraries constructed using conventional methods. '

The method is as follows: take fetal tissue (FP clone) or normal liver tissue (LP clone), use Trizol reagent (GIBC0 BRL company) to extract total RNA according to the manufacturer's instructions, and use mRNA purification kit (Pharmacia company) to extract mRNA. The pCMV-script TMXR cDNA library construction kit (Stratagene) was used to construct a cDNA library of the above-mentioned mRNA. The reverse transcriptase was changed to MMLV-RT- Superscript II (GIBC0 BRL), and the reverse transcription reaction was performed at 42 ° C. XL 10-Gold receptor cells were transformed and a 1 × 10 ^β cfu / μ titer cDNA library was obtained. In the first round, cDNA clones were randomly selected, and thereafter, high-abundance cDNA clones and cDNA clones that had been shown to inhibit the growth of cancer cells were used as probes to screen the cDNA library by hybridization, and weakly positive and negative clones were selected. Use the Qiageri 96-well plate plasmid extraction kit to perform plasmid DNA extraction according to the manufacturer's instructions. Plasmid DNA and empty vector were transfected into mouse NIH / 3T3 cells simultaneously. After 100ng of DNA was dried by ethanol precipitation, add 6μ10 to dissolve and wait for transfection. To each DMA sample, 0.74 μl of liposomes and 9.3 μl of serum-free culture solution were added. After mixing, the mixture was left at room temperature for 10 minutes. Add 150μ1 serum-free culture solution to each tube and add 3 wells. In mouse NIH / 3T3 cells longer than 96-well plates, place at 37 ° C for 2 hours, add 50 μ1 serum-free culture solution to each well, and 37 ° C for 24 hours. Replace 100 μl of whole culture solution in each well at 37 ° C for 24 hours, and replace 100 μl of whole culture solution with G418 at 37 V for 24-48 hours. While observing, change the culture solution of varying concentrations of G418. After about 2-3 times, count until the colony is formed on the microscopy cells. The above clones were found to promote cell clone formation, and the results are shown in the following table.

 Formation of cDNA clone-transfected cells (3T3)

The dideoxy termination method was used for the cDNA clone, and the nucleotide sequence of one end of the cDNA clone was determined to be approximately 500bp on an ABI377 DNA automatic sequencer. After analysis, it was determined to be a new gene clone, and the other end was sequenced. The full-length cDNA sequence was still not obtained. Primers were designed and sequenced again until the full-length sequence was obtained (SEQ ID NO: 1, 3, 5, 7, 9, 11). , (13, 15, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103) . Example 2: PCR to obtain full-length genes from placental or fetal cDNA:

 The fetal tissue was taken, and total RNA was extracted with Trizol reagent (GIBCO BRL) according to the manufacturer's instructions, and mRNA was extracted with an mRNA purification kit (Pharmacia). MMLV-RT-Superscript II (GIBCO BRL) and reverse transcriptase were used to perform reverse transcription reaction at 42 ° C to obtain placental or fetal cDNA. Using specific primers for each gene (as shown in the table below), 3 '1 cycle at 97 ° C. 94 V 30〃 60 V 30〃 72 V 1 '35 cycles and 72 V 10' 1 cycle for PCR amplification to obtain the amplified product of each protein gene containing a complete open reading frame sequence. The amplified product was verified by sequencing and was consistent with the sequence measured in Example 1. Subsequently, the amplified product was transferred into the host cell using conventional techniques to obtain a recombinant protein (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104 ).

 Gene specific primers

 Clone name Specific primer 1 SEQ ID Specific primer 2 SEQ ID

 (5, ― 3,) NO: (3, → 5 ,,) NO:

FP17659 (3) GTCAACGGAGGCGGAACG 17 GTGACGACCAACATACTGGAAC (1797) 18

FP17720 (150) CAGGCTTGCCCTAATGTTTG 19 AGTTTGGTTCCAGTAATAGGTT (3174) 20

FP17859 (77) GGCGCAATCACGGCTCAC 21 AGGAGGACAAGGTTTACTATCG (2220) 22

FP17889 (119) CGCTCCACTGTCCCACTCC 23 GCACTCTTGTAATCCGGGG (1937) 24

FP17926 (106) GCTTGGGCGACAGAACGA 25 GGTTCTGACACGGTGACGT (2476) 26

FP18346 (272) CTGCCTCCTTTCCAGTGTCTC 27 CTCCCCTCCCTATCGTAATCC (1002) 28

FP18407 (81) AGAAGAAAACCCAGCCACAGT 29 CCTCCGACTCCGTCCTCT (2131) 30

FP18717 (210) CGGCGGAAGGAGTTTGGA 31 CGGAGGTGGTAAAGGGCT (1673) 32

FP17548 (46) ACCCGAGCCAAGGACACC 59 AGAAGGGAGGGGACACGA (2584) 60

FP17581 (151) CATTTGAAAAGCATGGTCCTAG 61 GGAACGACGCCTCTTACT (1716) 62

FP17780 (158) AATCTTCCCGTTGCTGTATGTG 63 TTCACGGAGCCTACCACC (2199) 64

LP2254 (63) TTTAGTGCCTCCCACCCAG 65 TGACCCAGAAGTGAAGAACCC (1507) 66

LP2261 (281) CAGGGGCAAGGCACCATC 67 CAAGCGGGTCACGGTGCA (1096) 68

LP2477 (81) CTAGAAGTGGAACTGCTGGGTC 69 TGTTTTGTTTACGGGGTCC (1585) 70

LP2537 (16) GCGGCTCCTGTTGCTCCT 71 CATCCTGGGCGTCCCTGGT (993) 72

LP2561 (117) ACCAGAGGTTGGGAGGCA 73 GCTTGACCTTGTAGACCAGG (146) 74

LP2642 (14) TGGCAAGAAAGAGTGGAAGC 75 TGATAGGTTTAGGAGGTGACCA (1040) 76

LP2698 (1) GCCAGGTACAGCAAGTGGG 77 CAAAAGAGCGTAAAAGGTGG (1218) 78

LP2709 (8) GCCAGGCATCCTCAAATCC 79 TCACTCGGCTCTAACACCG (1174) 80 LP3663 (24) GGCTCTGAGGAGGCGTTGA 81 AAGTTGGGTCCACGGGGA (1211) 82

LP3727 (137) ACGTAGCGCAACGGACAG 83 TTATTTCAGCTCTGAGACGGCG (1186) 84

FP18315 (73) GGCCAGCTCATGGTATCTCC 105 ATGAACCCTCTGACTCCGTCC (1884) 106

LP2209 (101) CAGAAACCTGGGGTAAGCAA 107 TACAAATCACGGGAAAAGTACG (812) 108

LP2570 (33) GATGATGCTGCCAAGTTATTCA 109 ATCCCCATAGACATCCTTACCG (1729) 110

LP3317 (57) CTGGAGGGAGATCACAAAACA 111 ATGAAGCACTGGTGGGTGATAC (1102) 112

LP3428 (33) CCCGTCTGGGATGTGAGG 113 GCTCTTTGTGGGTTCTTACTAG (1222) 114

LP4947 (22) TTCATACTTGGTGCGCTGTG 115 GAGGGAACAAAGCTAACGG (2058) 116

LP5553 (94) GATTCTGCCCATGTGCTCC 117 TCCTTTATTTCGTCTTCCTTGC (1901) 118

LP6347 (138) TAGCTGGTTGCTAGAGTTACGG 119 TTTCCTTTATTCGGCACGTT (1899) 120

LP8067 (19) CGGCAGACTGGGGTTGGT 121 TTTATTTCGCGGTCGCGT (1548) 122

LP8151 (27) GGGTGTTGCTGTCATCTCCA 123 TTCTCCAAACCTCCCTCACC (1629) 124 Note: The brackets show the corresponding positions of the primers in the DNA sequence of each gene. Example 3: cDNA clone sequence analysis

 1. FP17659

A: Nucleotide sequence (SEQIDN0: 1) Length: 1974 bases

 B: amino acid sequence (SEQIDN0: 2) length: 354 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDN0: 1) Clone number and protein name: FP17659 Start code: 193 ATG stop code: 1255 TGA Protein molecular weight: 37674.30KDa

2. FP 17720

A: Nucleotide sequence (SEQ ID NO: 3) Length: 3190 bases

 B: amino acid sequence (SEQIDNO: 4) length: 127 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: 3) Clone number and protein name: FP17720 Start code: 1815 ATG stop code: 2196 TAA Protein molecular weight: 13775.99KDa

3. FP17859

 A: Nucleotide sequence (SEQIDNO: 5) Length: 2267 bases

 B: amino acid sequence (SEQIDNO: 6) length: 95 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: 5) Cloning number and protein name: FP17859 Start code: 1453 ATG stop code: 1738 TAA Protein molecular weight: 10530.73KDa

4. FP17889

A: Nucleotide sequence (SEQ ID NO: 7) Length: ² 017 bases

 B: amino acid sequence (SEQIDNO: 8) length: 109 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: 7) Cloning number and protein name: FP17889 Start code: 376 ATG stop code: 703 TGA Protein molecular weight: 12667.10KDa

5. FP17926

A: Nucleotide sequence (SEQIDNO: 9) Length: 2531 bases B: amino acid sequence (SEQ ID NO: 10) length: 84 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: 9) Cloning number and protein name: FP17926 Start code: 203 ATG stop code: 455 TGA Protein molecular weight: 9422.75KDa

6. FP18346

A: Nucleotide sequence (SEQ ID NO: 11) Length: 1205 bases

 B: amino acid sequence (SEQIDNO: 12) length: 78 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: ll) Clone number and protein name: HP18346 Start code: 392ATG Stop code: 626 TGA Protein molecular weight: 8871.80KDa

7. FP 18407

A: Nucleotide sequence (SEQ ID NO: 13) Length: 2239 bases

 B: Amino acid sequence (SEQIDNO: l4) Length: 123 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: 13) Cloning number and protein name: FP18407 Start code: 1594 ATG stop code: 1963 TGA Protein molecular weight: 14052.62KDa

8. FP18717

A: Nucleotide sequence (SEQ ID NO: 15) Length: 1906 bases

 B: amino acid sequence (SEQIDNO: 16) length: 303 amino acids

 C. Nucleotide and amino acid combination sequence (SEQIDNO: 15) Cloning number and protein name: FP18717 Start code: 643 ATG stop code: 1552 TAG Protein molecular weight: 31448.24KDa

9. FP17548

A: Nucleotide sequence (SEQ ID NO: 33) Length: 2748 bases

B: amino acid sequence (SEQ ID NO: 34) length: 216 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 33) Clone number and protein name: FP17548 Start code: 1856 ATG stop code: 2504 TGA Protein molecular weight: 23817.56

10. FP17581

A: Nucleotide sequence (SEQ ID NO: 35) Length: 2070 bases

B: amino acid sequence (SEQ ID NO: 36) length: 113 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 35) Clone number and protein name: FP17581 Start code: 676 ATG stop code: 1015 TGA protein molecular weight: 12295.65

 11. FP17780

A: Nucleotide sequence (SEQ ID NO: 37) Length: 2392 bases

B: amino acid sequence (SEQ ID NO: 38) length: 140 amino acids

 C Nucleotide and amino acid combination sequence (SEQ ID NO: 37) Clone number and protein name: FP17780 Start code: 1073 ATG stop code: 1493 TGA Protein molecular weight: 15107,42

12. LP2254

A: Nucleotide sequence (SEQ ID NO: 39) Length: 1551 bases B: amino acid sequence (SEQ ID NO: 40) length: 229 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 39) Clone number and protein name: LP2254 Start code: 640 ATG stop code: 1327 TAA Protein molecular weight: 25646.89

13. LP2261

A: Nucleotide sequence (SEQ ID NO: 41) Length: 1309 bases

B: amino acid sequence (SEQ ID NO: 42) length: 314 amino acids

C Nucleotide and amino acid combination sequence (SEQ ID NO: 41) Clone number and protein name: LP2261 Start code: 35 ATG stop code: 977 TAA protein Molecular weight: 33765.42

14. LP2477

A: Nucleotide sequence (SEQ ID NO: 43) Length: 1708 bases

B: amino acid sequence (SEQ ID NO: 44) length: 125 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 43) Cloning number and protein name: LP2477 Start code: 523 ATG Stop code: 898 TAA protein Molecular weight: 13538.77

15. LP2537

A: Nucleotide sequence (SEQ ID NO: 45) Length: 1191 bases

B: amino acid sequence (SEQ ID NO: 46) length: 279 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 45) Clone number and protein name: LP2537 Start code: 77 ATG stop code: 914 TGA Protein molecular weight: 31629.09

16. LP2561

A: Nucleotide sequence (SEQ ID NO: 47) Length: 1493 bases

B: amino acid sequence (SEQ ID NO: 48) length: 317 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 47) Clone number and protein name: LP2561 Start code: 390 ATG Stop code: 1341 TAG Protein molecular weight: 32576.68

17. LP2642

A: Nucleotide sequence (SEQ ID NO: 49) Length: 1284 bases

B: amino acid sequence (SEQ ID NO: 50) length: 224 amino acids

C. Nucleotide and amino acid combination sequence (SEQ ID NO: 49) Clone number and protein name: LP2642 Start code: 54 ATG stop code: 726 TGA Protein molecular weight: 25970.40

18. LP2698

A: Nucleotide sequence (SEQ ID NO: 51) Length: 1299 bases

B: amino acid sequence (SEQ ID NO: 52) length: 253 amino acids

C Nucleotide and amino acid combination sequence (SEQ ID NO: 51) Clone number and protein name: LP2698 Start code: 339 ATG stop code: 1098 TAA protein Molecular weight: 27953.79

19. LP2709

A: Nucleotide sequence (SEQ ID NO: 53) Length: 1237 bases B: amino acid sequence (SEQ ID NO: 54) length: 212 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 53) Clone number and protein name: LP2709 start code: 353 ATG stop code: 989 TAG protein molecular weight: 22099.74

 20. LP3663

A: Nucleotide sequence (SEQ ID NO: 55) Length: 1320 bases

B: amino acid sequence (SEQ ID NO: 56) length: 184 amino acids

C. Nucleotide and amino acid combination sequence (SEQ ID NO: 55) Clone number and protein name: LP3663 Start code: 459 ATG Stop code: 1011 TGA protein molecular weight: 21098.00

21. LP3727

A: Nucleotide sequence (SEQ ID NO: 57) Length: 1205 bases

B: amino acid sequence (SEQ ID NO: 58) length: 198 amino acids

C. Nucleotide and amino acid combination sequence (SEQ ID NO: 57) Clone number and protein name: LP3727 Start code: 181 ATG Stop code: 775 TGA Protein molecular weight: 21481.24

 22. FP18315

 A: Nucleotide sequence (SEQ ID NO: 85) Length: 2032 bases

 B: amino acid sequence (SEQ ID NO: 86) length: 117 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 85) Clone number and protein name: FP18315 Start code: 898 ATG stop code: 1249 TAG Protein molecular weight: 12585.84

23. LP2209

 A: Nucleotide sequence (SEQ ID NO: 87) Length: 926 bases

 B: amino acid sequence (SEQ ID NO: 88) length: 70 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 87) Clone number and protein name: LP2209 Start code: 430 ATG stop code: 640 TGA Protein molecular weight: 7837.38

24. LP2570

 A: Nucleotide sequence (SEQ ID NO: 89) Length: 1814 bases

 B: amino acid sequence (SEQ ID NO: 90) length: 117 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 89) Clone number and protein name: LP2570 Start code: 1001 ATG stop code: 1352 TAA Protein molecular weight: 12882.88

25. LP3317

 A: Nucleotide sequence (SEQ ID NO: 91) Length: 1199 bases

 B: amino acid sequence (SEQ ID NO: 92) length: 103 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 91) Clone number and protein name: LP3317 Start code: 217 ATG Stop code: 526 TAA Protein molecular weight: 11308.46

26. LP3428

A: Nucleotide sequence (SEQ ID NO: 93) Length: 1269 bases B: amino acid sequence (SEQ ID NO: 94) length: 80 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 93) Clone number and protein name: LP3428 Start code: 978 ATG Stop code: 1218 TGA Protein molecular weight: 8987.08

27. LP4947

 A: Nucleotide sequence (SEQ ID NO: 95) Length: 2471 bases

 B: amino acid sequence (SEQ ID NO: 96) length: 146 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 95) Clone number and protein name: LP4947 Start code: 108 ATG Stop code: 546 TGA Protein molecular weight: 16017.98

28. LP5553

 A: Nucleotide sequence (SEQ ID NO: 97) Length: 1934 bases

 B: amino acid sequence (SEQ ID NO: 98) length:% amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 97) Clone number and protein name: LP5553 Start code: 837 ATG Stop code: 1125 TAG Protein molecular weight: 10235.89

29. LP6347

 A: Nucleotide sequence (SEQ ID NO: 99) Length: 1915 bases

 B: amino acid sequence (SEQ ID NO: 100) length: 91 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 99) Clone number and protein name: LP6347 Start code: 343 ATG Stop code: 616 TGA Protein molecular weight: 9540.07

 30. LP8067

 A: Nucleotide sequence (SEQ ID NO: 101) Length: 1575 bases

 B: amino acid sequence (SEQ ID NO: 102) length: 200 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 101) Clone number and protein name: LP8067 Start code: 754 ATG Stop code: 1354 TGA Protein molecular weight: 20839.38

31. LP8151

 A: Nucleotide sequence (SEQ ID NO: 103) Length: 1800 bases

 B: amino acid sequence (SEQ ID NO: 104) length: 168 amino acids

 C. Nucleotide and amino acid combination sequence (SEQ ID NO: 103) Clone number and protein name: LP8151 start code: 409 ATG stop code: 913 TGA protein molecular weight: 18356.29 This application is incorporated by reference as if each document were individually incorporated by reference. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims appended to this application.

Claims

 Request for Rights

An isolated human protein having the function of promoting 3T3 cell transformation, characterized in that it contains an amino acid sequence selected from the group consisting of: SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104.

 The polypeptide according to claim 1, wherein the amino acid sequence of the polypeptide is selected from the group consisting of: SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 34, 36, 38 , 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104.

 3. An isolated polynucleotide, characterized in that it comprises a nucleotide sequence which is selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide according to claims 1 and 2;

 (b) A polynucleotide complementary to the polynucleotide (a).

 The polynucleotide according to claim 3, wherein the amino acid sequence of the polypeptide encoded by the polynucleotide is selected from the group consisting of: SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 , 16, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104.

 The polynucleotide according to claim 3, wherein the sequence of the polynucleotide is selected from the group consisting of: SEQ ID NO: 1, 3, 5, 7, 9, 11, 11, 13, 15, 33, 35, 37, 39, 41, 43, 45, 47,

49, 51, 53, 55, 57, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103 or full-length sequences.

 6. A vector comprising the polynucleotide according to claim 3.

 7. A genetically engineered host cell, characterized in that it is a host cell selected from the group consisting of-

(a) a host cell transformed or transduced with the vector of claim 6;

 (b) a host cell transformed or transduced with the polynucleotide of claim 3.

 8. A method for preparing a human protein having the function of promoting 3T3 cell transformation, characterized in that the method comprises:

 (a) culturing the host cell of claim 7 under conditions suitable for expression;

 (b) Isolating a human protein having 3T3 cell transformation function from the culture.

 An antibody capable of specifically binding to a human protein having a function of promoting 3T3 cell transformation according to claim 1.