CZ20013219A3 - Isolated molecules of nucleic acid, chimeric genes in which they are comprised and method of enhancing resistance to plants to diseases - Google Patents

Abstract

Homologues of the <i>Arabidopsis NIM1</i> gene, which is involved in the signal transduction cascade leading to systemic acquired resistance (SAR), are isolated from <i>Nicotiana tabacum</i> (tobacco), <i>Lycopersicon esculentum</i> (tomato), <i>Brassica napus</i> (oilseed rape), <i>Arabidopsis thaliana</i>, <i>Beta vulgaris</i> (sugarbeet), <i>Helianthus annuus</i> (sunflower), and <i>Solanum tuberosum</i> (potato). The invention further concerns transformation vectors and processes for expressing the <i>NIM1</i> homologues in transgenic plants to increase SAR gene expression and enhance broad spectrum disease resistance.

Description

Technical field

The present invention relates to the resistance of plants to a wide variety of diseases, including systemic acquired resistance (SAR). In particular, the invention relates to the identification, isolation and characterization of gene homologs

NIMI from Arabidopsis, which is part of a signal transduction cascade leading to systemic acquired resistance in plants.

BACKGROUND OF THE INVENTION

Plants are constantly attacked by a variety of pathogenic organisms such as viruses, bacteria, fungi and nematodes. Utility plants are particularly susceptible to infections, as they are usually grown in genetically uniform monoculture, and when the disease breaks out, losses are considerable. However, most plants have their own natural mechanisms of defense against pathogenic organisms. The natural variability in pathogen resistance has been identified by plant breeders and pathologists and has been introduced into many crops. These natural disease resistance genes often provide a high level of resistance or immunity to pathogens.

Systemic acquired resistance (SAR) is one component of a complex plant defense system against pathogens (Hunt and Ryals,

1996; Ryals et al. , 1996). See also U.S. Pat. 5,614,395.

• · · · · · · · · · · · · · · · · · · · · · ·

SAR is a particularly important aspect of plant response to a pathogen, as it is a phenomenon of pathogen-induced, systemic resistance to a wide range of infectious agents such as viruses, bacteria and fungi. When the SAR signal transduction pathway is blocked, the plant becomes susceptible to pathogens that normally cause disease, and becomes susceptible to some pathogens that do not normally cause disease (Gaffney et al., 1993;

Delaney et al. , 1994; Delaney et al., 1995; Delaney, 1997; Bi et al. , 1995; Mauch-Mani and Slusarenko, 1996). These observations show that the SAR signal transduction pathway is critical to maintaining plant health.

Conceptually, the SAR response can be divided into two phases. In the initiation phase, the pathogen is recognized and a signal is transmitted that is transmitted by the phloem to distant tissues. The systemic signal is received by target cells that respond by expression of SAR genes and disease resistance. The SAR maintenance phase is a period of long weeks up to the life of a plant in which the plant is in a quasi steady state while maintaining disease resistance (Ryals et al., 1996).

The accumulation of salicylic acid (SA) appears to be necessary for SAR signal transduction. Plants that cannot accumulate SA, even after treatment with a specific inhibitor, due to epigenetic repression of phenylalanine ammonium lyase, or transgenic expression of salicylate thydroxylase that specifically degrades SA, cannot induce SAR gene expression or disease resistance (Gaffney et al., 1993; Delaney et al., 1993; 1994 Mauch-Mani et al

Slusarenko 1996; Maher et al., 1994; Pallas et al., 1996).

Although it was assumed that SA could serve as a system signal, this view is now quite controversial and the only thing we know for sure is that if there is no accumulation

SA, then SAR signal transduction is blocked (Pallas et al.,

1996; Shulaev et al., 1995; Vernooij et al. , 1994).

Arabidopsis has recently emerged as a model system for SAR research (Uknes et al., 1992; Uknes et al., 1993; Cameron et al., 1994; Mauch-Mani and Slusarenko, 1994; Dempsey and Klessig,

1995). It has been shown that SAR in Arabidopsis can be activated by both a pathogen and a chemical such as SA, 2,6-dichloroisonicotinic acid (INA) and benzo (1,2,3) thiadiazole-7-carbothioic acid S-methyl ester (BTH) (Uknes et al., 1992; Vernooij et al., 1995; Lawton et al., 1996). After treatment with either INA or BTH or after a pathogenic infection, while developing resistance, at least three genes of pathogenesis-related proteins (PR), namely PR-1, PR-2 and PR-5, are co-ordinated expressed (Uknes et al., 1992 , 1993). In tobacco, the best characterized plant species, pathogen treatment or chemical treatment induces the expression of at least nine sets of genes (Ward et al., 1991). Disease resistant transgenic plants were prepared by transforming plants with various SAR genes (U.S. Patent 5,614,395).

A number of Arabidopsis mutants with modified SAR signal transduction have been isolated (Delaney, 1997). The first of these mutants were lesions simulating disease (lsd) mutants and acd2 (accelerated cell death) (Dietrich et al., 1994; Greenberg et al., 1994). To some extent, these plants showed spontaneous formation of necrotic lesions on the leaves, increased SA levels, accumulation of mRNAs for SAR genes, and significantly increased disease resistance. At least seven different lsd mutants have been isolated and characterized (Dietrich et al., 1994; Weymann et al., 1995). Another interesting class of mutants are the cim mutants

(constitutive immunity) (Lawton et al.,

1993). See also U.S. Pat. Patent 5,792,904 and International (PCT) application WO 94/16077. Like the lsd and acd2 mutants, the mutants have increased SA levels, SAR gene expression, and resistance, but unlike the lsd and acd2 mutants do not have detectable leaf lesions. The cprl mutant (constitutive expression of PR gens) may be one of the types of the cim mutant; however, due to the presence of microscopic lesions on the leaves, it was not excluded that cprl was a type of lsd mutant (Bowling et al.,

1994).

Mutants that block SAR signaling have also been isolated. The ndrl (non-race-specific disease resistance) mutant is a mutant that allows growth of both Pseudomonas syringae containing various avirulence genes and normally avirulent isolates of Peronospora parasitica (Century et al., 1995). Apparently this mutant is blocked in the early phase of SAR signaling. The nprl mutant (non-expression of PR genes) is a mutant incapable of inducing SAR signaling after INA treatment (Cao et al., 1994). The eds (enhanced disease susceptibility) mutant was isolated based on its ability to support bacterial infection after inoculation with low concentration bacteria (Glazebrook et al., 1996; Parker et al., 1996).

Certain eds mutants are phenotypically very similar to nprl, and it has recently been shown that eds5 and eds53 are alleles of nprl (Glazebrook et al., 1996). A mutant by them (noninducible immunity) promotes an increase in infection

P. parasitica (a plant rotting infectious agent) after INA treatment (Delaney et al., 1995; U.S. Patent 5,792,904).

Although a mutant may accumulate SA upon infection with a pathogen, it cannot induce SAR expression or resistance, so it is likely that this mutation blocks the metabolic signaling pathway beyond SA. The mutant has also impaired the ability to respond to INA or BTH, so that the block appears to exist somewhere beyond the site of action (Delaney et al., 1995; Lawton et al.,

1996).

Allelic genes from Arabidopsis whose mutations are responsible for phenotypes by them and nprl have been isolated and characterized (Ryals et al., 1997; Cao et al., 1997). The wild-type NIMI gene product is involved in the signal transduction cascade leading to both SAR and gene-for-gene resistance in Arabidopsis (Ryals et al., 1997). Ryals et al. , 1997 also described the isolation of five other alleles by them, which exhibit a range of phenotypes ranging from poorly damaged chemical induction of PR-1 gene expression and fungal resistance to severe blockage. Transformation of the wild-type NPR1 gene into the nprl mutant not only complements the mutation, restores the responsiveness of SAR induction in PR gene expression and resistance, but also increases the resistance of transgenic plants to P. syringae in the absence of SAR induction (Cao et al.,

1997). WO 98/06748 describes the isolation of NPR1 from Arabidopsis and a homolog from Nicotiana glutinosa. See also WO 97/49822, WO 98/26082 and WO 98/29537.

Despite extensive research and the use of very complex and intensive plant protection measures, including plant genetic transformation, plant disease losses amount to billions of dollars per year. Thus, there is a continuing need to develop new plant protection means based on increasing knowledge of the genetic basis of plant resistance to diseases.

In particular, homologues of the Arabidopsis NIMI gene need to be identified, isolated and characterized from other plant species.

SUMMARY OF THE INVENTION

In describing the present invention, the following terms are used, the meaning of which is explained in the following definitions.

Associated / Operationally Connected: Refers to two DNA sequences that are physically or functionally linked. For example, a promoter or regulator sequence is associated with a DNA sequence that encodes an RNA or protein when the two sequences are operably linked, or situated such that the regulator sequence affects the expression of the coding or structural DNA sequence.

Chimeric Gene: A recombinant DNA sequence in which a promoter or regulatory sequence is operably linked or associated with a DNA sequence that encodes RNA or that is expressed as a protein, so that the regulatory sequence is capable of regulating the transcription or expression of the associated sequence

DNA. Regulátorová

The DNA sequence of the chimeric gene is not normally operably linked to the associated DNA sequence as it occurs in nature.

Coding sequence: a nucleic acid sequence that is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably, the RNA in the organism is translated into a protein.

Complementary: Refers to two nucleic acid sequences that contain antiparallel nucleotide sequences capable of pairing with each other by forming hydrogen bonds between residues of complementary bases in antiparallel nucleotide sequences.

Expression: Refers to the transcription and / or translation of an endogenous gene or transgene in plants.

In the case of an antisense construct, the term expression refers only to the transcription of antisense DNA.

Expression cassette: a nucleic acid sequence capable of directly epxrimating a particular nucleotide sequence in a suitable host cell comprising a promoter operably linked to a desired nucleotide sequence that is operably linked to a termination signal. Typically, it also contains the sequences necessary for proper translation of the nucleotide sequence. The expression cassette containing the desired nucleotide sequence may be chimeric, meaning that at least one of its components is heterologous with respect to at least one other component. The expression cassette may be identical to that found in nature, but has been obtained in recombinant form and is suitable for heterologous expression.

Typically, the expression cassette is heterologous to the host; Special nucleic acid sequences do not naturally occur in the host cell and must be introduced into the host cell or its predecessor by a transformation process. Expression of the nucleotide sequence in the expression cassette is under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to a particular external stimulus.

In the case of multicellular organisms such as e.g.

of a plant, the promoter may be specific for a particular tissue, organ or developmental stage.

Gene: A defined region that is located in the genome and contains, in addition to the aforementioned nucleic acid coding sequence, other, mainly regulatory nucleic acid sequences responsible for expression control, i. transcription and translation of the coding region. The gene may also contain additional 5 'and 3' untranslated sequences and termination sequences. Other elements that may be present are, for example, introns.

Heterologous DNA Sequence: The terms of a heterologous DNA sequence, an exogenous DNA segment, or a heterologous nucleic acid refer to a sequence that originates from a foreign source relative to a given host cell, or, if derived from the same source, is modified relative to its original form. Thus, heterologous genes in a host cell include a gene that is endogenous to the host cell, but has been modified, for example, by using DNA shuffling. The term also encompasses non-natural multiple copies of DNA sequences that otherwise occur in nature. The term refers to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell, but is at the nucleic acid position of the host cell where it does not normally occur in the natural state. Exogenous DNA segments are expressed to provide exogenous polypeptides.

Homologous DNA Sequence: A DNA sequence naturally associated with the host cell into which it has been introduced.

Isocoding: The nucleic acid sequence is isocoding with respect to the nucleic acid sequence when the nucleic acid sequence encodes a polypeptide having the same amino acid sequence as the polypeptide encoded by the reference nucleic acid sequence.

Isolated: In the context of the present invention, an isolated nucleic acid molecule or isolated enzyme is a nucleic acid molecule or enzyme which, by human intervention, exists outside its natural environment and is therefore not a natural product. Isolated nucleic acid or enzyme molecules exist in purified form or occur in a non-natural environment, e.g., in a recombinant host cell.

Minimal promoter: promoter elements, particularly a TATA element, that are inactive or have reduced promoter activity in the absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter functions to allow transcription.

Native: refers to a gene that is present in the genome of a untransformed cell.

Naturally occurring: the term naturally occurring is used to describe an object that is found in nature in a different state than when produced by man. For example, a protein or nucleotide sequence present in an organism (including a virus) that can be isolated from a natural source that has not been intentionally modified by man in the laboratory is termed naturally occurring.

NIMI: The gene described in Ryals et al., 1997, which participates in the transduction cascade of SAR signal transduction.

NIMI: A protein encoded by the NIMI gene.

Nucleic Acid: Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof, either in single-stranded or double-stranded form. Unless specifically defined, the term includes nucleic acids containing known analogs of natural nucleotides that are metabolized similarly to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence implicitly includes its conservatively modified variant (e.g., degenerate codon substitution) and complementary. sequence as well as the sequences explicitly disclosed herein. Specifically, degenerate codon substitutions can be achieved by preparing a sequence wherein the third position of one or more (e.g. all) codons is not replaced by a mixture of bases or a deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al. J. Biol Chem 260: 2605-2608 (1985); Rossolini et al., Mol Cell Probes 8: 91-98 (1994)).

The terms nucleic acid or nucleic acid sequence are used interchangeably with the terms gene, cDNA, or mRNA encoded by the gene. In the context of the present invention, the nucleic acid molecules are preferably DNA segments.

Nucleotides are referred to by their following standard labels: adenine (A), cytosine (C), thymine (T) and guanine (G).

ORF: Open reading frame)

Reading

Frame).

Plant: Any whole plant.

Plant cell: A structural and physiological unit of a plant containing a protoplast and a cellular network.

The plant cell is in the form of an isolated single cell or cell in culture, or as part of a higher organized unit such as a plant tissue, organ, or whole plant.

Plant cell culture: Culture of plant units such as protoplasts, cells, tissue cells, pollen, pollen tubes, ova, embryonic sacs, zygotes and embryos in different developmental phases.

Plant material: refers to leaves, roots, flowers or parts of flowers, fruits, pollen, egg cells, cuttings, cells or plants.

cell cultures or any other parts or products ♦ 9 • 9

9 99

Plant organ: Distinguishable and visibly structured and differentiated part of the plant such as e.g.

root, stem, leaf, flower, bud or embryo.

Plant tissue / tissue:

A group of plant cells organized into a structural functional unit.

These include any tissue in the plant (in planta) or in the culture (in vitro).

This term also includes, without limitation, whole plants, plant organs, plant seeds, tissue culture, and any group of plant cells organized into structural and / or without and with or without the aforementioned functional units. The term used by any specific type of mesh, as in any way, does not exclude any other type of mesh.

Promotor:

an untranslated DNA sequence lying upstream of the coding region that contains the RNA polymerase II binding site and initiates DNA transcription. The promoter region may contain additional elements that act as regulators of gene expression.

Protoplast:

Plant cell with or without a cell wall.

purified, used interchangeably

Purified:

Date

with the term clean, if concerns tag e nuclear acid or next cellular Ingredients se natural condition. They are preferably

the nucleic proteins in which in the dry state may be acid or pr?, substantially de-liberated are associated in a homogeneous state, although or in aqueous solution. Purity and homogeneity are typically determined by analytical chemistry methods such as polyacrylamide gel electrophoresis or being the major species present in the preparation is substantially pure.

The purified nucleic acid or purified protein is subjected to high performance liquid chromatography (HPLC). Protein that «« »· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

0 in single electrophoretic gel analysis. Especially it

I means that the nucleic acid or protein is at least 50% pure, preferably 85%, and most preferably 99% pure.

Recombinant DNA molecule: A combination of DNA molecules that are linked by recombinant DNA (genetic engineering) methods.

Regulator Elements: A sequence involved in controlling expression of a nucleotide sequence. The regulatory elements comprise a promoter operably linked to the desired nucleotide sequence and termination signal. They typically also contain the sequence required for proper translation of the nucleotide sequence.

Selection marker gene: a gene whose expression in a plant gives the plant a selective advantage. The selective advantage of a cell transformed with a selectable marker gene may be that it has the ability to grow in the presence of a negative selection agent, such as an antibiotic or herbicide, as opposed to a non-transformed cell. The selective advantage of a cell transformed with a selectable marker gene, as opposed to a non-transformed cell, may be that it has an increased or completely new ability to metabolically utilize an added substance, such as a nutrient, growth factor or energy source. A selection marker is also referred to as a gene or combination of genes whose expression in a plant gives the cell an advantage for both negative and positive selection.

Significant increase: An increase in enzymatic activity that is greater than the error range determined by the measurement technique is preferably a two or more increase in activity compared to the wild-type enzyme activity in the presence of an inhibitor, more preferably five or more, and most preferably ten or more.

• φ * φ • ··· φ φ φφφ φ φ φ φ · φ φ φφφφ φ φ ΦΦ

ΦΦ ΦΦ φ · ♦ · ·· φ

The terms identical or percent identity, in relation to two or more nucleic acid sequences by protein sequences, refer to two or more sequences or subsections that are either identical or have a specific percentage of identical amino acid or nucleotide residues, aligning the sequences so as to achieve maximum match when using one of the sequence comparison algorithms or visual evaluation.

Substantially identical: the term substantially identical, in relation to two or more nucleic acid sequences by protein sequences, refers to two or more sequences or subsections having at least 60%, preferably 80%, more preferably 90 to 95%, and most preferably at least 99% the identity of the nucleotides or amino acid residues, by aligning the sequences so as to achieve maximum match by using one of the sequence comparison algorithms or by visual evaluation. Preferably, substantial identity exists in a sequence of at least 50 residues long, more preferably the sequences are substantially identical in the residue region 100, and most preferably the sequences are substantially identical in the residue region 150. In a most preferred embodiment, the coding sequence is substantially identical over the entire length of the coding region. In addition, substantially similar nucleic acid or protein sequences also perform substantially identical functions.

In sequence comparison, typically one sequence serves as a reference sequence to which the test sequence is compared. When using sequence comparison algorithms, the test and reference sequences are used as input to the computer program and the subsection coordinate is selected, if necessary, as well as the sequence comparison program parameters. The sequence comparison programs then perform sequence comparison with calculating the percent sequence identity between the test and reference sequences, depending on the program parameters.

Optimal alignment of sequences for comparison can be performed using the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), the homology assignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Naťl. Acad. Sci. USA 85: 2444 (1988), and computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA, which are part of the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or visual by comparison (see Ausubel et al., infra).

One example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215: 403-410 (1990). BLAST analysis software is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). According to this algorithm, the highest score (HSP) sequence pairs are first identified by identifying words of length W in the candidate sequence that meet the positively valued threshold T when assigned to words of the same length in the sequence database. T is referred to as neighborhood word score threshold (Altschul et al., 1990). The neighboring words thus found serve as seeds for initiating a search for longer words containing them. The found words are then bi-directionally extended along both sequences until the cumulative score increases. The cumulative score is calculated, for nucleotide sequences, using the parameters M (positive score for a pair of identical residues, always> 0) and N (negative score for mismatched residues, always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Prolongation of found words in both directions is stopped when the cumulative score is reduced by X value against the maximum achieved value, its value is zero or lower due to the accumulation of one or more negative score assignments or after reaching the end of both sequences. The BLAST algorithm's W, T, and X parameters determine its sensitivity and matching speed. The BLASTN nucleotide sequence comparison program uses word length (W) of 11, exposure (E) of 10, boundary 100, M = 5, N = -4, and aligns both strands. The BLASTP protein sequence comparison program uses word length (W) 3, expection (E) 10, and BLOSUM62 scoring matrix as set parameters (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)).

In addition to calculating percent identity, the BLAST program also performs a statistical analysis of the similarity of the two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90: 5873-5787 (1993)). One criterion of similarity produced by the BLAST algorithm is smallest sum probability, (P (N)), which provides an indication of the probability of a random match of two nucleotide or amino acid sequences. For example, a test nucleic acid sequence is considered to be similar to a reference sequence if the smallest sum probability when comparing the test and reference nucleic acid sequences is less than 0.1, more preferably less than 0.01 and most preferably less than 0.001.

Another indication that the two nucleic acid sequences are substantially identical is that the two molecules are mutually identical to each other. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · To to • · «« to «« «« «« «« «

····· hybridize under stringent conditions. The term "specifically hybridize" refers to the binding, duplexing, or hybridization of a molecule with only a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture of (e.g., total cellular) DNA or RNA. Essentially, it means complementary hybridization between a nucleic acid probe and a target nucleic acid sequence and involves minor mismatches that are overcome by reducing the stringency of the hybridization conditions to achieve detection of the target nucleic acid sequence.

Stringent hybridization conditions and stringent hybridization wash conditions in the context of the hybridization experiments in the present invention, such as Southern and Northern hybridizations, are sequence dependent and vary under different external conditions. Longer sequences specifically hybridize at higher temperatures. Comprehensive guidelines for nucleic acid hybridization can be found in Tijssen (1993) Laboratory Technigues in Biochemistry and Molecular BiologyHybridization with Nucleic Acid Probes, Part I, Chapter 2. In general, hybridization and high stringency wash conditions are selected about 5 ° C below the melting point (T _m ) of the specific sequence at a given ionic strength and pH. Typically, under stringent conditions, the probe hybridizes only to its target subsequence and to no other sequence.

T _m is the temperature (at a defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are chosen such that they are identical to T _r for a given probe. An example of complementary nucleic acid hybridization

* · w « 4 « • • 1 »· • • • • * ·· « • • • · • • • • • · • · • • · • • • • · • • • • • • · and·

acid under stringent conditions, when the nucleic acid contains more than 100 nucleotides, on a Southern or Northern blot filter, is 50% formamide with 1 mg heparin at 42 ° C when hybridization is performed overnight. An example of a highly stringent wash is 0.1 5M NaCl at 72 ° C for 15 minutes. An example of a stringent wash is a 0.2x SSC wash at 65 ° C for 15 minutes (see Sambrook, infra for composition of SSC buffer). Often, high stringency washes precede low stringency washes to remove non-specific background. An example of a medium stringency wash for duplexes, e.g., greater than 100 nucleotides, is 1x SSC at 45 ° C for 15 minutes. An example of a low stringency wash for duplexes, e.g., greater than 100 nucleotides, 4-6x SSC at 40 ° C for 15 minutes. For short probes (eg, 10 to 50 nucleotides), stringent conditions mean a salt concentration of less than 1.0 M Na, typically 0.01 to 1.0 M Na (or other salts) at pH 7.0 to 8.3 and at a temperature of at least 30 ° C. Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. Generally, a signal to background ratio of 2 or greater when using an unrelated probe in a particular hybridization assay indicates the detection of specific hybridization. Nevertheless, nucleic acids that do not hybridize under stringent conditions are still substantially identical if the proteins encoded by them are substantially identical. This occurs, for example, when a copy of a nucleic acid is prepared using the maximum allowed degeneracy of the genetic code.

The following are examples of different hybridization / wash conditions that can be used to clone homologous nucleotide sequences that are substantially identical to the reference sequence of the invention: the test nucleotide sequence preferably hybridizes to the reference sequence under the conditions: 5 M NaPO ₄ , mM EDTA at 50 ° C, washing in 2X SSC, 0.1% SDS at 50 ° C, more preferably 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50 ° C with washing in 1X SSC, 0.1% SDS at 50 ° C, more preferably 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50 ° C with washing in 0.5X SSC, 0, 1% SDS at 50 ° C, preferably 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50 ° C with a wash in 0.1X SSC, 0.1% SDS at 50 ° C, still more preferably 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , 1 mM EDTA at 50 ° C with a wash in 0.1X SSC, 0.1% SDS at 65 ° C.

Another indication that the two nucleic acid or protein sequences are identical is that the protein encoded by the first nucleic acid is immunologically cross-reactive or specifically binds to the protein encoded by the second nucleic acid. The two proteins are typically substantially identical when they differ only by conservative substitutions.

The term specifically (or selectively) to bind an antibody or specifically (or selectively) immunoreactive to proteins or peptides refers to a binding reaction that determines the presence of a protein in the presence of a heterogeneous population of proteins and other biologically active agents. Thus, under the conditions of a given immunoassay, specific antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the same sample. Specific binding to an antibody under such conditions requires the selection of antibodies for their specificity for a particular protein. For example, antibodies prepared against a protein having an amino acid sequence encoded by any of the nucleic acid sequences of the invention may be selected such that antibodies specifically obtainable are obtained.

immunoreactive with a given protein and not reacting with any other protein, except for polymorphic variants. A variety of immunoassay formats can be used to select antibodies specifically immunoreactive with a given protein. For example, a solid phase ELISA, Western blot or immunohistochemistry assays are routinely used to select specific antibodies. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York Harlow and Lane) for various immunoassay formats and conditions for determining specific immunoreactivity. A typical specific or selective reaction at least twice exceeds the signal corresponding to the baseline level or noise, more preferably greater than 10 to 100x.

Conservatively modified variations of a particular nucleic acid sequence indicate those nucleic acid sequences that encode identical or substantially identical amino acid sequences, or, as regards the nucleic acid sequences of non-coding amino acid sequences, necessarily refer to identical sequences. Since the genetic code is degenerate, a large number of functionally identical nucleic acids can encode a given polypeptide. For example, the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at any position where the codon is to be specific for arginine, the bull codon may alternatively be any of the above without altering the encoded protein. Such nucleic acid variations are termed silenced variations, which is one of the kinds of conservatively modified variations, each protein-encoding nucleic acid sequence described herein simultaneously describes each of all possible silenced variations unless specifically stated otherwise.

The skilled artisan will appreciate that each nucleic acid codon (except

ATG, which is normally the only codon for methionine), can be modified by an identical method, an identical molecule.

Thus, any acid that encodes a protein in each of the sequences described herein.

In addition, substitutions, deletions, or additions remove one amino acid of amino acids (typically less than 5 amino acids).

%) in the encoded sequence are

while providing a silenced variation, it is implicitly known that functionally the nucleus contained is one that alters, adds, or only a small percentage of%, more typically less than 1 conservatively modified variations, where the change results in a similar amino acid.

to amino acid substitution chemically

Conservative substitution tables providing an overview of functionally similar amino acids are known to those of skill in the art. Each of the following five amino acid groups contains interchangeable amino acids: Aliphatic: Glycine (G), Alanine (A), Valine (V), Leucine (L),

Isoleucine (I); Aromatic: Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Sulfur-containing: Methionine (Μ), Cysteine (C);

Basic: Arginine (R), Lysine (K), Histidine (H); Acid: Aspartic acid (D), glutamic acid (E), Asparagine (Ν), Glutamine (Q). See also Creighton (1984) Proteins, W.H. Freeman and Company. In addition, substitutions, deletions, or additions that alter, add, or remove a single amino acid or only a small percentage of amino acids in the encoded sequence are also conservatively modified variations.

The term "subsequence" refers to nucleic acid or amino acid sequences that are part of a longer nucleic acid or amino acid sequence, respectively. protein

Nucleic acids are elongated when other nucleotides (or analogous molecules) are incorporated.

Typically, the elongation is carried out with the aid of a polymerase (e.g. DNA polymerase), e.g.

'' - end of sequence

Two nucleic acid sequences in another acid polymerase that nucleic acid.

each generation • *

The attached nucleic acid sequences are recombined, these two nucleic acid nucleic acids. Two sequences are directly recombined when both molecules serve as a substrate for recombination. Two when a nucleic acid nucleic acid sequence is included are indirectly recombined when they are recombined through an intermediate, cross-over oligonucleotide. For an indirect true substrate only one sequence, such as e.g.

and in some cases none of the sequences is a substrate for recombination.

Specific binding affinity between two molecules, eg, a ligand and a receptor, means preferential binding of one molecule to another in a mixture of different molecules. Binding molecules are considered specific if the binding affinity and is about 1 x 10 ^-4 M ^_1 to 1 x 10 ⁶ M ¹ or higher.

The term transformation refers to the process of introducing heterologous DNA into a host cell or organism.

The terms transformed, transgenic, and recombinant refer to a host organism, such as a bacterium or plant, into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule is stably integrated into the genome of the host cell or is present as an extrachromosomal molecule. Such an extrachromosomal molecule can self-replicate (self-replicating molecule).

Transformed cells, tissues or plants include not only the end product of transformation, but also their transgenic progeny. The terms untransformed, non-transgenic, or non-recombinant host refer to a wild-type organism.

which do not contain a heterologous, e.g., bacterial or plant, nucleic acid molecule.

The present invention responds to the aforementioned needs by providing several homologs of the Arabidopsis NIMI gene from other plant species. In particular, homologues of the NIMI gene isolated from plants such as Nicotiana tabacum (tobacco), Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Beta vulgaris (sugar beet), Helianthus annuus (sunflower) and Solanum tuberosum (potato) ) which encode proteins involved in the signal transduction cascade corresponding to biological and chemical inducers that lead to systemic acquired resistance in plants.

Thus, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes the sequence of id. C.

2, 4, 6, 8, 16, 18

20,

30, 32, 34, 36

38, 40, 42, 44, 46, 48

50, 52, 54, 56, 58

62,

64, 66, 68, 70

72 or 74.

In another embodiment, the invention relates to a nucleic acid molecule comprising the nucleotide sequence id.

1, 3, 5

7, 15, 17, 19, 29, 31

33,

35, 37, 39, 41, 43, 45, 47

49,

51,

53, 55, 57, 61, 63, 65

67,

69, 71, or 73.

In another embodiment, the invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that comprises at least 20, 25, 30, 35, 40, 45, or 50 (preferably 20) consecutive pairs, coinciding with a sequence identical to a region of at least 20, 25, 30, 35, 40, 45, or 50 (preferably 20) consecutive pairs in sequence id. No. 1, 3, 5, 7, 15, 17, 19

29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61

63, 65, 67, 69, 71, or 73.

The invention relates to a nucleotide

In yet another embodiment, the present isolated nucleic acid molecules comprising a sequence that can be amplified from a Lycopersicon esculentum DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers listed herein as SEQ ID NO: 1. 9 and 10, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. 25 and 28, SEQ ID NO. 26 and 28 or SEQ ID NO. No. 59 and 60.

In another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Beta vulgaris DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers listed herein as SEQ ID NO: 2. 22 and 24 or SEQ ID NO. No. 26 and 28.

In yet another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Helianthus annuus DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers set forth herein as SEQ ID NO. No. 26 and 28.

In another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Solanum tuberosum DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers set forth herein as SEQ ID NO. 21 and 24, SEQ ID NO. 21 and 23, SEQ ID NO. 22 and 24, SEQ ID NO. Nos. 25 and 28, or SEQ ID NO. No. 26 and 28.

In yet another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Brassica napus DNA library using a polymerase chain reaction (PCR) ) using a set of two oligonucleotide primers listed herein as SEQ ID NO. 9 and 10, or SEQ ID NO. No. 26 and 28.

In another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Arabidopsis thaliana DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers set forth herein as SEQ ID NO. 13 and 14, SEQ ID NO. 21 and 24, or SEQ ID NO. No. 22 and 24.

In yet another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Nicotiana tabacum DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers set forth herein as SEQ ID NO. 9 and 10, SEQ ID NO. 11 and 12, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. Nos. 25 and 28, or SEQ ID NO. No. 26 and 28.

In another embodiment, the invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a plant DNA library using a polymerase chain reaction (PCR) using a set of two oligonucleotide primers containing the first 20 nucleotides

and reverse complement first 20 nucleotides of the following coding sequences (CD) id. C. 1, 3, 5, 7, 15, 17, 19, 29, 31 33, 35, 37 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63 67 69 69 or 73.

The present invention also relates to a chimeric gene comprising a plant active promoter operably linked to the NIMI homologous sequence of the present invention,

a recombinant vector comprising such a chimeric gene, wherein the vector is capable of stably transforming the host, and also relates to a host stably transformed with the vector. The host is preferably a plant belonging to the group of the following agronomically important plants: rice, wheat, barley, rye, canola, sugarcane, corn, potato, carrot, Jerusalem artichoke, sugar beet, bean, peas, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, pumpkin, gourd, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, vine, raspberry, blackberry , pineapple, avocado, papaya, mango, banana, soy, tobacco, tomato and sorghum. The invention also includes seeds from these plants.

Furthermore, the present invention relates to a method for increasing expression of SAR genes in plants, comprising expressing in a plant a chimeric gene comprising a promoter active in a plant operably linked to a coding sequence homologous to the NIMI of the invention, wherein the encoded protein is in expressed at a higher level than in a wild-type plant.

Furthermore, the invention also relates to a method of increasing plant resistance to diseases by expressing in a plant a chimeric gene comprising a promoter active in a plant operably linked to a coding sequence homologous to the NIMI of the invention, wherein the encoded protein is expressed at a higher level than in a wild-type plant.

Further, the invention relates to PCR primers selected from the group consisting of SEQ ID NOs. Nos. 9 to 14, 21 to 28, 59, and 60.

The present invention also encompasses a method for isolating NIMI homologues involved in signal transduction resulting in systemic acquired plant resistance, which method comprises amplifying a DNA molecule from a DNA library from a plant using a polymerase chain reaction (PCR) with a pair of primers corresponding to the first nucleotides and reverse complement of the first 20 nucleotide coding sequences (CDs) set forth herein as SEQ ID NO: 2.

13,

5, 7, 15

17,

19, 29,

31, 33, 35

37, 39,

41,

43, 45, 47, 49, 51, 53, 55

57,

61, 63,

65, 67, 69, or

73, or by the pair of primers set forth herein as SEQ ID NO.

10, SEQ ID NO. No. 11 a

12, SEQ ID NO. 13 and 14, SEQ ID NO.

21 and 24, SEQ ID NO.

and 24, SEQ ID NO. No. 21 a

23, SEQ ID NO. C.

and 28, SEQ ID NO. 26 and 28, or SEQ ID NO.

60. In a preferred embodiment of the invention, the DNA library is from a plant such as Nicotiana tabacum (tobacco),

Lycopersicon

Arabidopsis thaliana, Beta vulgaris (sugar beet), Helianthus annuus (sunflower) and Solanum tuberosum (potato).

Data from Northern analyzes of several NIMI homologs described herein indicate constitutive expression or inducibility of BTH. The NIMI gene homologues described herein predict encoding proteins involved in a signal transduction cascade responsive to chemical and biological inducers that result in acquired systemic plant resistance. The present invention also relates to transgenic expression of these NIMI homologs to increase expression of SAR genes to increase plant resistance to diseases.

The DNA sequences of the invention can be isolated by the methods described in the following examples or by polymerase chain reaction (PCR) using the sequences described in the sequence listing for the construction of oligonucleotide primers. So e.g.

oligonucleotides having a sequence of first and last approximately 25 consecutive nucleotides in sequence id. No 7 ♦

• 9 • ♦ «9 • * <<<<<

7) directly

Other (eg, nucleotides 1 to 20 and 1742 to 1761 of SEQ ID NO) may be used for PCR amplification of SEQ ID NO: 1.

from the source plant cDNA library (Arabidopsis thaliana)

Similarly, the DNA sequences of the invention can be amplified by PCR from a cDNA library or genomic DNA of a given plant using the ends of the sequences set forth in the Sequence Listing for PCR primer design.

Transgenic expression of NIMI homologues of the invention in plants will result in immunity to a wide range of plant pathogens including, but not limited to, viruses and viroids, e.g., tobacco or cucumber mosaic virus, blotch or necrosis virus, geranium leaf wavy virus, virus clover spots, tomato shrubby virus and similar viruses, fungi, e.g. oomycetes such as Phythophthora parasitica and Peronospora tabacina; bacteria such as Pseudomonas syringae and Pseudomonas tabaci; insects such as aphids such as Myzus persicae; butterflies such as Heliothus spp., nematodes such as Meloidogyne incognita. The vectors and methods of the invention are useful against a number of pathogenic maize organisms such as, but not limited to: fungi such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosererclorora, Peronosererosclerosora; rust such as Puccinia sorphi, Puccinia polysora and Physopella zeae; other fungi such as Cercospora zeae-maydis, Collet trichum graminicola, Fusarium monoliforme, Gibberella zeae, Exserohilum turcicum, Kabatiellu zeae, Erysiphe graminis, Septoria and Bipolaris maydis; and bacteria such as Erwinia stewartii.

The methods of the invention can be used to transfer disease resistance to a wide range of angiosperms, both dicotyledons and monocotyledons. Although resistance can thus be transferred to any plant from these broadly defined groups, agronomically important plants such as rice, wheat, barley, rye, canola, cane, corn, potato, carrot, Jerusalem artichoke, sugar beet, bean, peas are particularly preferred. , chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, pumpkin, gourd, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine , apricot, strawberry, grapevine, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soy, tobacco, tomato and sorghum. The invention also includes seeds from these plants.

The coding homologous sequence of the NIMI of the invention can be inserted into an expression cassette suitable for plants to construct the chimeric gene of the invention by known genetic engineering techniques. Selection of specific regulator sequences such as the promoter, signal sequences, 5 'and 3'-untranslated sequences and enhancer suitable to achieve the desired expression profile in the selected plant host is well within the skill of the art. The resulting molecule comprising individual elements linked in a suitable reading frame can be inserted into a vector capable of transforming a plant host cell.

Examples of promoters functional in plants or plant cells (i.e., promoters capable of directing the expression of associated coding sequences such as NIMI homologs in a plant) include the ubiquitin promoter from Arabidopsis and the 9 maize, 19S and 35S promoters from cauliflower mosaic virus (CaMV). and the CaMV double promoter, rice actin promoters, tobacco PR-1 promoter, Arabidopsis and corn promoter, nopaline synthase promoter, ribulose monophosphate carboxylase small subunit promoter (ssuRUBISCO), and similar promoters. The ubiquitin promoter from Arabidopsis is particularly preferred. The promoters themselves may be modified in any way to adjust their potency in order to increase the expression of the associated coding sequence by methods known to those skilled in the art. Preferred promoters for use in the present invention are those providing a high level of constitutive expression.

Sequences for signal or transit peptides can be fused to the coding sequence of NIMI homologs in the chimeric DNA constructs of the invention for direct transport of the expressed protein to the desired site of action. Examples of signal peptides include naturally associated with pathogenesis-related protein genes such as PR-1, PR-2, and the like, see, e.g., Payne et al. Examples of transit peptides include, for example, chloroplast transit peptides, such as those described by Von Heijne et al. (1991), Mazur et al. (1987), and Vorst et al. (1988); mitochondrial transit peptides such as described by Boutry et al. (1987). Also included are sequences leading to the location of the encoded protein in various cellular compartments, such as vacuole. See, e.g., Neuhaus et al. (1991) and Chrispeels (1991).

The chimeric DNA constructs of the invention may comprise multiple copies of the promoter or multiple copies of the sequences encoding an NIMI homolog of the invention. In addition, the constructs may further comprise marker-coding sequences or sequences encoding other peptides, e.g., signal or transit peptides, in each case in a suitable reading frame with other functional elements of the DNA molecule. Methods for preparing such constructs are known to those skilled in the art.

Useful markers include peptides conferring herbicide, antibiotic or drug resistance, eg resistance to protoporphyrinogen oxidase, hygromycin, kanamycin, G418, gentamycin, lincomycin, methotrexate, glyphosate, phosphinothricin and the like. of the invention from untransformed cells. Other useful markers include peptide enzymes that can be readily detected by a visible reaction, eg, a color reaction such as luciferase, β-glucuronidase, and β-galactosidase.

The chimeric genes of the invention can be introduced into plant cells by a variety of methods known in the art. The person skilled in the art is aware that the choice of a suitable method depends on the type of plant (monocotyledon or dicotyledonous) and / or the type of organelle selected for transformation (eg, nucleus, chloroplast, mitochondria). Suitable methods for plant cell transformation include microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrrobacterium-mediated transformation (Hinchee et al., 1988; Ishida et al., 1996), direct gene transfer ( Paszkowski et al., 1984; Hayashimoto et al., 1990), ballistic particle acceleration using devices from Agracetus, Inc., Madison, Wisconsin or Dupont, Inc. , Wilmington, Delaware (also see, e.g., U.S. Patent 4,945,050; and McCabe et al., 1988). See further, Weissinger et al. (1988); Sanford et al. (1987) (onion); Christou et al. (1988) (soybean); McCabe et al. (1988) (soybean); Datta et al. (1990) (rice); Klein et al. (1988) (maize); Klein et al. (1988) (maize); Klein et al. (1988) (maize); Fromm et al. (1990); and Gordon-Kamm et al. (1990) (maize); Svab et al. (1990) (tobacco chloroplasts); Gordon-Kamm et al. (1993) (maize); Shimamoto et al.

(1989) (rice); Christou et al. (1991) (rice); Datta et al. (1990) (rice); European Patent Application EP 0 332 581

(Pooideae); Vasil et al. (1993) (wheat); Weeks et al. (1993) (wheat); Wan et al. (1994) (barley); Jahne et al. (1994) (barley); Umbeck et al. (1987) (cotton); Casas et al. (1993) (sorghum); Somers et al. (1992) (oat); Torbert et al. (1995)

(oat); Weeks et al., (1993) (wheat); WO 94/13822 (wheat); and Nehra et al. (1994) (wheat). A particularly preferred arrangement for introducing recombinant DNA molecules into maize by microprojectile bombardment can be found in Koziel et al. (1993); Hill et al. (1995) and Koziel et al. (1996). A further preferred embodiment of the transformation of maize protoplasts is described in EP 0 292 435.

Once a chimeric gene containing a coding sequence homologous to the NIMI gene has been transformed into a particular plant species, it can be further propagated in that species or transferred to another variety of the same biological species, particularly a commercially preferred variety, by classical breeding methods. Particularly preferred plants of the invention include the agronomically important crops listed above. The genetic properties introduced by genetic engineering into the transgenic seeds and plants described above are further transmitted by sexual reproduction, and thus can be maintained and propagated in subsequent generations of plants.

• · · ··

DETAILED DESCRIPTION OF THE INVENTION

The invention is further illustrated by the following detailed procedures, isolations and examples. The examples are for illustration only and are not intended to limit the scope of the present invention in any way. Standard recombinant DNA and molecular cloning techniques used are well known in the art and have been described in Sambrook, et al. , 1989; I.E. Šilhavý, M.L. Berman, and L.W. Enquist, 1984; and Ausubel, F.M. et al., 1987.

I. Isolation of Arabidopsis NIMI gene homologs

Example 1

Isolation of NIMI homologs from Nicotiana tabacum

Plasmid DNA from bulk phage excision from the tobacco cDNA library was used as a template for PCR using the following primer pairs:

5'-AGATTATTGTCAAGTCTAATG-3 '(SEQ ID NO: 9) +

5'-TTCCATGTACCTTTGCTTC-3 '(SEQ ID NO: 10), and

5'-GCGGATCCATGGATAATAGTAGG-3 '(SEQ ID NO: 11) +

5'-GCGGATCCTATTTCCTAAAAGGG-3 '(SEQ ID NO: 12).

The cycling conditions were preferably 94 degrees (understand ° C) for one minute, 40 degrees for one minute, and 72 degrees for 1.5 minutes, and the reaction was preferably performed for 40 cycles. The PCR products were analyzed on agarose gels, excised and cloned into pCRII-TOPO (Invitrogen).

• ·

9 ·· 99 9999

9

9 9 99 9 9 9 9 9 99 99

9

9

The complete cDNA sequence of this NIMI tobacco homolog is shown in SEQ ID NO. No. 1 and the protein encoded by this cDNA sequence is shown in SEQ ID NO. NIMI tobacco homologue comprising the sequence of SEQ ID NO. No. 1 was deposited as pNOV1206 in the NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A.) Aug. 17, 1998, assigned NRRL accession number B-30051.

Example 2

Isolation of the NIMI homologue from Lycopersicon esculentum

Phagemids were excised from the λ ZAPII tomato cDNA libraries using a protocol from Stratagene. The phagemids (plasmids) were bulk transformed into E. coli XL1-Blue in 10 pools of approximately 80,000 clones each and DNA was extracted from these groups. PCR groups were screened for NIMI homologs using the following primers: 5'-AGATTATTGTCAAGTCTAATG-3 '(SEQ ID NO: 9) and 5'-TTCCATGTACCTTTGCTTC-3' (SEQ ID NO: 10). It was confirmed that the sequences amplified from these groups contained NIMI homologs by cloning the PCR amplified DNA fragment and sequencing. Groups were sequentially shrunk and screened by PCR using the same primers listed above for the presence of NIMI homologs until one clone containing the homolog was obtained. If the cDNA clone contained a partial gene without the 5 'end, the 5' RACE (Rapid Amplification of cDNA Ends) method was used to obtain the complete gene sequence.

• ♦ φφ φφ • φ · φ φφφφ φ

φ φ · φ

φ φ

The complete cDNA sequence of this tomato NIMI homolog is shown in SEQ ID NO. No. 3 and the protein encoded by this cDNA sequence is shown in SEQ ID NO. 4. A tomato homologue of NIMI comprising the sequence of SEQ ID NO. No. 3 was deposited as pNOV12 04 by the NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, USA) Aug. 17, 1998, assigned NRRL accession number B-30050 .

Example 3

Isolation of the NIMI homologue from Brassica napus

Phagemids were excised from the λ ZAPII Brassica napus cDNA libraries using the Stratagene protocol. The phagemids (plasmids) were mass transformed into E. coli XL1-Blue in 10 groups of approximately 80,000 clones each and DNA was extracted from these groups. PCR groups were screened for NIMI homologs using the following primers: 5'-AGATTATTGTCAAGTCTAATG-3 '(SEQ ID NO: 9) and

5'-TTCCATGTACCTTTGCTTC-3 '(SEQ ID NO: 10). It was confirmed that the sequences amplified from these groups contained NIMI homologs by cloning the PCR amplified DNA fragment and sequencing. Groups were sequentially shrunk and screened by PCR using the same primers listed above for the presence of NIMI homologs until one clone containing the homolog was obtained. If the cDNA clone contained a partial gene without the 5 'end, the 5' RACE (Rapid Amplification of cDNA Ends) method was used to obtain the complete gene sequence.

• 4

· 4

4444 • 4 · 4

4 «4

44 9

4 «4

4 4 4

9 4 4

A partial cDNA sequence of this Brassica napus NIMI homolog is shown in SEQ ID NO: 2. No. 5 and the protein encoded by this cDNA sequence is shown in SEQ ID NO. 6. A NIMI Brassica napus homologue comprising the sequence of SEQ ID NO. No. 5 was deposited as pNOV1203 in the NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A.), Aug. 17, 1998, assigned NRRL accession number B-30049.

Example 4

Isolation of the NIMI homolog from Arabidopsis thaliana

BLAST searches using the Arabidopsis or tomato NIMI amino acid sequence as a search sequence detected a GenBank B26306 record that contained the Arabidopsis genomic sequence from a bacterial artificial chromosome (BAC)

F18D8.

Part of the BAC sequence is predicted to encode a protein with significant similarity (47% amino acid identity) to NIMI. For F18D8 region sequences were designed following primers: 5'-TCAAGGCCTTGGATTCAGATG-3 '(SEQ ID. NO. 13) and ^{5'-ATTAACTGCGCTACGTCCGTC-3R} (SEQ ID. NO. 14). The primers were used in PCR reaction with DNA from the Arabidopsis cDNA library based on pFL61 as a template. Preferred cycling conditions were 94 degrees for 30 seconds, 53 degrees for 30 seconds, 72 degrees for 30 seconds. The reaction was preferably carried out for 40 cycles. A predicted size PCR product (290 bp) was detected and the cDNA clone corresponding to the F18D8 primers was purified from the cDNA library by sequential purification by increasing a small amount of E. coli library passage and re-determining the clone by PCR. Finally, one positive clone was obtained and sequenced. The sequence of the clone confirmed the occurrence of an open reading frame with significant homology to NIMI.

The complete cDNA sequence of this NIMI Arabidopsis thaliana homolog is shown in SEQ ID NO. No. 7 and the protein encoded by this cDNA sequence is shown in SEQ ID NO. 8. The NIMI homolog of Arabidopsis thaliana comprising the sequence of SEQ ID NO. No. 7 was deposited as AtNMLc5 in E. coli at NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, USA) on May 25, 1999, with assigned NRRL accession number B-30139

Example 5

Design of degenerate primers

In addition to the NIMI gene (Ryals et al., 1997) and the NIM-like gene described above in Example 4 (AtNMLc5 - SEQ ID NO: 7), Arabidopsis thaliana contains three additional NIM-like genomic sequences (NML): AtNMLc2 (SEQ ID NO: 7). 15), AtNMLc4-1 (SEQ ID NO: 17), and AtNMLc4-2 (SEQ ID NO: 19), wherein c [#] represents the chromosome number on which a particular NML gene is located. Using the GCG Seqweb multiple sequence comparison program (Pretty, Wisconsin Gentics Computer Group), NIMI sequences from Arabidopsis thaliana (Ryals et al., 1997), Nicotiana tabacum (Example 1 - SEQ ID NO: 1) were compared, * to · · · · · ** · ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** And Lycopersicon esculentum (Example 2 - SEQ ID NO: 3), as well as the NML sequence from Arabidopsis thaliana (SEQ ID NOs: 7, 15, 17, and 19). Based on this comparison, three regions were sufficiently conserved to design degenerate PCR primers for PCR amplification of NIMI homologs from other species of crop plants, including sugar beet, sunflower, potato and canola. Primers designed from these framework regions are listed in Table 1 below. NIM 1 primers (AD) are designed using LINEUP algorithm only with NIMI genes from Arabidopsis thaliana (Ryals et al., 1997), Nicotiana tabacum (Example 1 of SEQ ID NO: 1). 1), and Lycopersicon esculentum (Example 2 of SEQ ID NO: 3). NIM 2 primers (A-D) are designed using LINEUP with these three sequences in addition to the four NML sequences from Arabidopsis thaliana (SEQ ID NOs: 7, 15,

17, and 19). The primers were preferably synthesized by Genosys Biotechnologies, Inc. (The Woodlas, Texas). Degeneration positions are indicated in Table 1 by recording more than one base at one oligonucleotide site. "Orientation indicates whether the primer is directed to the 3-terminus (downsteram, downstream) or the 5-terminus (upstream, upstream) of the cDNA.

Table 1

Degenerated primers

Primer Sequence (5 'to 3') sequence xcl · c · Orientation NIM IA GAGATTATTGTCAAGTCTAATGTAGATA T T sequence id. No 21 in the direction NIM 1B ACTGGACTCGGATGATATTGAATTA T T T G G sequence id. No 22 in the direction NIM IC TAACTCAACATCATCAGAATCAAATGC T T C G C G sequence id. No 23 in the opposite direction

φφ ···· φφφ φ · ♦ · «· · · · · · · · · ·

99 · ♦ · 9 99 φ ΦΦ φ φ φ ♦ • ♦ Φ

NIM ID GTTGAGCAAGAGCAACTCTATTTTCAAG T C CC G T sequence id. No 24 in the opposite direction NIM 2A TGCATAGAAATAATTGTGAAGTCTAATGTAGA TG TG TG sequence id. No 25 in the direction NIM 2B GGCACTGGACTCAGATGATGTTGAACT TTT GT sequence id. No 26 in the direction NIM 2C AACTCAACATCATCAGAATCCAATGCC GT T G G sequence id. No 27 in the opposite direction NIM 2D AGTTGAGCAAGGCCAACTCGATTTTCAAAAT TCA T GG T sequence id. No 28 in the opposite direction

Example 6

PCR amplification of NIM-like DNA fragments from plant species

NIM-like DNA fragments were amplified from Arabidopsis, tomato, tobacco, sugar beet, sunflower, potato and canola using either genomic DNA or cDNA as templates. Combinations of the primers used, together with the expected fragment sizes, are shown in Table 2 below.

Table 2

Combination of primers and DNA fragment size

Left Primer Right Primer Fragment size (bp) NIM IA NIM ID 669 NIM IA NIM 1C 195 NIM 1B NIM ID 499 NIM 2A NIM 2D 676 NIM 2A NIM 2C 200 NIM 2B NIM 2D 503

• · · · · · · ·

The degenerate primer PCR was preferably performed with Ready-To-Go PCR Beads (Amersham, Piscataway, NJ) in a GenAmp PCR System 9700 (PE Applied Biosystems, Foster City, CA). 20 to 40 ng of genomic DNA or 5 to 10 ng of cDNA were used in each reaction, with each primer at a final concentration of 0.8 M. Preferred cycling parameters were: 94 ° C for 1 minute, 3 cycles [94 ° C for 30 seconds, 37 ° C for 30 seconds, 72 ° C for 2 minutes]; 35 cycles [94 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 2 minutes]; 72 ° C for 7 minutes, 4 ° C to completion. The reaction products were analyzed on 2% agarose gels and DNA fragments of the appropriate size were excised. DNA fragments were isolated from agarose bands using, for example, the Genclean III kit

Kit (BIO 101, Inc.,

Carlsbad, CA) and cloned using, for example, a kit

TOPO TA Cloning Kit (Invitrogen

Corporation, Carlsbad,

CA). Plasmids were isolated using, for example, the CONCERT Rapid Plasmid Miniprep System kit (Life Technologies, Inc, Rockville, MD) and sequenced using standard protocols.

NIM-like DNA fragments were obtained from all experimental plant species, and in many cases multiple unique NIM-like sequences were isolated. Table 3 and Figure 2 detail NIM-like fragments that were isolated.

9 • 9

Table 3

NIM-like PCR fragments

Species Successful primers steam PCR template Unique clones SEQ ID NO. C. Arabidopsis 1A / 1D 1B / 1D Genomic DNA one Tobacco 1A / 1D 2A / 2D 1B / 1D, 2B / 2D cDNA four 29, 31, 33, and 35 Tomato 1A / 1D 2A / 2D 1B / 1D, 2B / 2D Genomic DNA, cDNA one 37 Sugar beet 1B / 1D, 2B / 2D Genomic DNA, cDNA one 39 Sunflower 2B / 2D cDNA two 41 and 43 Potato 1A / 1D 1B / 1D, 2B / 2D 1A / 1C 2A / 2D cDNA three 45, 47, and 49 Canoe 2B / 2D cDNA four 51, 53, 55, and 57

Based on these results, the degenerate PCR primers described above can amplify NIM-like fragments from a variety of plant species. In particular, the combination of NIM 2B / NIM 2D primers is successful with cDNA as a template in all species tested. The use of Ready-To-Go PCR Beads is particularly useful for obtaining products. Furthermore, the use of cDNA as a template is preferred for all samples except Arabidopsis, tomato and sugar beet, where genomic DNA is sufficient.

Example 7

Other degenerate primers

A new pair of degenerate primers was designed based on sequence comparison of the four tobacco fragments (SEQ ID NO.

* · ·· ·· • • • • • · • • • • ·· • • • ·· • ♦ « • • • • • • • · • · · ··· • · • • • • • · • · • • · • «« • · ·· ·· ·

29, 31, 33, and 35) and the tomato sequence (SEQ ID NO: 37) for use in determining whether a tomato also contains the same NIM-like sequences that are not amplified with the degenerate primers listed in Table 1. These fragments are listed in Table 3 below and were preferably synthesized by Genosys Biotechnologies, Inc. (The Woodlas, Texas). Degeneration positions are indicated in Table 3 by recording more than one base at one oligonucleotide site. "Orientation indicates whether the primer is directed to the 3-terminus (downstream) or the 5-terminus (upstream) of the cDNA.

Table 4

Other degenerate primers

Primer Sequence (5 'TO 3') sequence id. C. Orientation NIM 3A TAGATGAAGCATACGCTCTCCACTATGCTGT T C T T T sequence id. No. 59 in the direction NIM 3B GGCTCCTTACGCATGGCAGCAACATGAAGGAC T C T TG C sequence id. No. 60 in the opposite direction

PCR with degenerate primers was performed as described above using tomato cDNA, and potential products were cloned and sequenced. Sequence analysis revealed two kinds of NIM-like fragments: the first is identical to the tomato sequence shown in SEQ ID NO. No. 37 and the other is unique in tomato and 88% identical to the tobacco sequences shown in SEQ ID NOs. 31 and 33. This novel tomato sequence is shown in SEQ ID NO. No. 61.

· * ·· ·· · • · • • • • · • · • · • • · »· • • • · • · • • · • · • · • ··· • · · • • • • · • • • • · • ·· ·· ·· ·· ···

Example 8

Complete cDNA similar to NIM

Corresponding cDNA sequences upstream and downstream of NIM-like PCR fragments are preferably obtained by RACE PCR using the SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA). Preferably, at least three independent RACE products have been sequenced with either 5 or 3 termini to avoid PCR errors. The resulting complete cDNA sequences for the NIMI homologs of sugar beet, sunflower B and tobacco B, which correspond to the PCR fragments similar to NIM shown in SEQ ID NOs. Nos. 39, 43, and 31, are presented as SEQ ID NO. No. 63, 65 and 73, respectively.

Arabidopsis thaliana cDNAs similar to NIM corresponding to NIM-like genomic sequences AtNMLc2 (SEQ ID NO: 15), AtNMLc4-1 (SEQ ID NO: 17) and AtNMLc4-2 (SEQ ID NO: 19) were preferably cloned by RT- PCR. Total RNA from Arabidopsis thaliana was reverse transcribed using oligo dT primers. The resulting first strand cDNA was amplified by PCR using specific sense and antisense oligonucleotide primers designed based on the 5 'and 3' ends of the coding region of each genomic sequence (SEQ ID NOs 15, 17, and 19). PCR fragments of putative sizes were cloned into the vector and sequenced to verify that these cDNA clones correspond to NIM-like genomic sequences. The cDNA sequence corresponding to the NIM-like genomic sequence AtNMLc2 (SEQ ID NO: 15) is presented as SEQ ID NO: 15. No. 67 and the complete cDNA sequence corresponding to the NIM-like genomic sequence AtNMLc4-1 (SEQ ID NO: 17) is presented as SEQ ID NO: 17. No. 69 and the complete cDNA sequence corresponding to the NIM-like genomic sequence AtNMLc4-2 (SEQ ID NO: 19) is presented as SEQ ID NO. No. 71.

Example 9

Northern analysis

Northern data show that expression of an NIM-like sugar clone (SEQ ID NOS: 39 and 63) increases 3 to 7 fold after treatment with ΙΟΟμΜ or 300μΜ BTH (benzo (1,2,3) thiadiazole-7-carbothioic acid S-methyl ester) ). Northern data also show that the expression of a NIM-like sunflower A clone (SEQ ID NO: 41) is constitutive. In addition, Northern data show that expression of a NIM-like sunflower B clone (SEQ ID NOS: 43 and 65) increases twice after treatment with ošetřeníμΜ or 300μΜ BTH.

II. Expression of the gene sequence of the invention in plants

The NIMI homolog of the present invention can be introduced into plant cells using conventional recombinant DNA technology. Generally, this involves inserting the coding sequence of the invention into an expression system for which the coding sequence is heterologous (i.e., not normally found therein) using standard cloning techniques known in the art. The vector contains the necessary elements for transcription and translation of the inserted protein coding sequence. A large number of φ can be used

vector systems known in the art, such as plasmids, bacteriophage viruses and other modified viruses. Suitable vectors include, but are not limited to, viral vectors such as the lambda-gt11, Agt10, and Charon 4 vector systems; plasmid vectors such as pBI121, pBR322, pACYC177, PACYC184, pAR series, pKK223-3, pUC8, pUC9, pUC18, pUC19, pLG339, pRK290, pKC37, pKC101, pCDNAII, and other similar systems. The components of the expression system may also be modified to increase expression. For example, truncated sequences, nucleotide substitutions, or other modifications may be used. The expression systems described herein can be used to transform potentially each plant cell of a crop plant under suitable conditions. The transformed cells can be regenerated into whole plants, so that the NIMI homolog increases SAR gene expression and increases disease resistance in transgenic plants.

Example 10

Construction of plant expression cassettes

The coding sequences intended for expression in transgenic plants are first assembled in expression cassettes behind a suitable promoter that is expressed in the plants. The expression cassettes may also contain any additional sequence required or selected for expression of the transgenes. These sequences include, but are not limited to, transcription terminators, foreign expression enhancement sequences, such as introns, vital sequences, and sequences intended for gene targeting. Product into specific organelles and cell compartments. These expression cassettes can then be easily transferred to the plant transformation vectors described below. The various components of typical expression cassettes are described below.

1. Promotors

The choice of promoter used in the expression cassettes determines the spatial and temporal nature of the expression of the transgene in the transgenic plant. The selected promoters express transgenes in specific cell types (such as leaf epidermis cells, mesophyll cells, root bark cells) or in specific tissues or organs (such as roots, leaves or flowers) and selection reflects the desired location of gene product accumulation. Alternatively, the selected promoter can direct gene expression under various inducing conditions. Promoters differ in their strength, ie. the ability to trigger transcription. Depending on the host cell system used, any of a variety of suitable promoters, including the native gene promoter, may be used. The following are non-limiting examples of promoters that can be used in expression cassettes.

Constitutive expression, ubiquitin promoter:

Ubiquitin is a gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (eg sunflower - Binet et al., 1991, Christensen et al., 1989 corn) and Arabidopsis - Norris et al., 1993).

The maize ubiquitin promoter has been developed in transgenic monocotyledon systems, and its sequences and vectors designed to transform monocotyledonous plants are described in patent publication EP 0 342 926 (Lubrizol). Taylor et al. (1993) describe a vector (pAHC25) that contains the maize ubiquitin promoter and the first intron and its high activity in cell suspensions of numerous monocotyledons when introduced by bombardment with microparticles (microprojectiles). The ubiquitin promoter from Arabidopsis is particularly preferred for use with the NIMI homologs of the present invention. The ubiquitin promoter is suitable for gene expression in transgenic plants, both monocotyledonous and dicotyledonous. Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by introduction of the appropriate ubiquitin promoter and / or intron sequence.

b. Constitutive expression, CaMV 35S promoter:

The construction of plasmid pCGN1761 is described in published patent application EP 0 392 225 (Example 23). pCGN1761 contains a double CaMV 35S promoter and a tmi transcription terminator with a unique EcoRI site between the promoter and terminator and has a pUC-type backbone. A derivative of pCGN1761 has been constructed having a modified polylinker that includes NotI and XhoI sites in addition to the already existing EcoRI site. This derivative was designated pCGN1761ENX. pCGN1761ENX is useful for cloning a cDNA sequence or coding sequence (including a microbial ORF sequence) into its polylinker for expression under the control of the 35S promoter in transgenic plants. The entire cassette of this 35S promoter-coding sequence-terminator construct

it can be excised using the HindIII, SphI, SalI and XbaI 5 sites to the promoter and the XbaI, BamHI, and BglI 3 sites to the terminator for transfer to transformation vectors, such as those described below. In addition, the double promoter fragment can be removed

35S using 5 excision with HindIII, Sphl, Sali,

XbaI or PstI and 3 'excision with any of the polylinker restriction sites (EcoRI, NotI or XhoI) to be replaced by another promoter.

If desired, modifications can be made around the cloning sites by introducing a sequence that can enhance translation.

This is particularly useful when overexpression is desired. For example, pCGN1761ENX can be modified by optimizing the translation initiation site as described in Example 37 of US Patent No. 5,639

949.

c. Constitutive expression, actin promoter:

It is known that several actin isoforms are expressed in most cell types and therefore the actin promoter is a good choice as a constitutive promoter. In particular, the Act1 rice gene promoter has been cloned and characterized (McElroy et al., 1990).

The fragment was found to contain all regulatory in rice protoplasts. In addition to expression vectors based on the 1.3 kb promoter elements necessary for the expression of this, numerous Act1 promoters have been constructed specifically for use in monocotyledons (McElroy et al., 1991). These include the ActT-intron 1, the AdhI 5 'flanking sequence, and the AdhJ-intron 1 (from the maize alcohol dehydrogenase gene) and the sequence from the CaMV 35S promoter. The vectors expressing the highest expression were fusions of 35S and the Act1 intron or the 5 Act1 flanking sequence and the Act1 intron.

Sequence optimization around the initiating ATG (from the reporter • φ • φ

The GUS gene also amplified expression. The promoter expression cassettes described by McElroy et al. (1991) can be readily modified for gene expression and are particularly preferred for use in monocotyledonous recipients. For example, fragments containing the promoter were removed from McElroy constructs and used to replace the 35S double promoter in pCGN1761ENX, which is then useful for insertion of a specific gene sequence. The fusion genes thus constructed can then be transferred to appropriate transformation vectors. In a different publication, it was also found that the Act1 rice promoter, with its first intron, also controls high expression in cultured barley cells (Chibbar et al., 1993).

d. Inducible expression, PR-1 promoter:

The 35S double promoter in pCGN1761ENX can be replaced by any other promoter of choice that will result in a suitably high degree of expression. For example, one of the chemically controllable promoters described in U.S. Patent No. 5,614,395 can replace the double 35S promoter. The choice promoter is preferably excised from its source by restriction enzymes, but alternatively, it can also be amplified by PCR using primers which carry the respective terminal restriction sites. If PCR amplification is performed, then the promoter should be re-sequenced to avoid amplification errors after cloning the amplified promoter into the target vector. The chemically / pathogenic PR-1α tobacco promoter was cleaved from plasmid pCIB1004 (for construction see Example 21 of EP 0 332 104) and transferred to plasmid pCGN1761ENX (Uknes et al., 1992). pCIB1004 is digested with NcoI and the resulting 3 overhang

The linearized fragment is blinded by treatment with T4 DNA polymerase. The fragment is then digested with HindIII and the resulting fragment containing the PR-1a promoter is gel purified and cloned into pCGN1761ENX from which the 35S double promoter has been removed. This is accomplished by digestion with XhoI and blinding with T4 polymerase, followed by digestion with HindIII and isolation of a larger vector fragment containing the terminator into which the promoter fragment pCIB1004 is cloned. This gives rise to a pCGN1761ENX derivative with a PR-1α promoter and a tmi terminator and an intervening polylinker with unique EcoRI and NotI sites. A selected coding sequence can be inserted into this vector, and the fusion products (ie, promoter-gene-terminator) can then be transferred to any selected transformation vector, including those described below. Various chemical regulators can be used to induce expression of a selected coding sequence in plants transformed according to the present invention, including benzothiadiazole, isonicotinic acid and salicylic acid compounds described in United States Patent Nos. 5,523,311 and 5,514,395.

e. Inducible expression, ethanol-inducible promoter:

A promoter inducible by certain alcohols or ketones, such as ethanol, can also be used to induce expression of the coding sequence of the present invention. Such a promoter is, for example, the promoter of the alcA gene from Aspergillus nidulans (Caddick et al., 1998). In A. nidulans, the alcA gene encodes alcohol dehydrogenase I whose expression is regulated by AlcR transcription factors in the presence of a chemical inducer. For purposes of the present invention, the CAT coding sequences in the palcA: CAT plasmid containing the alcA gene promoter sequence fused to the minimal 35S promoter (Caddick et al., 1998) are replaced by the coding sequence of the present invention to produce an expression cassette having the coding sequence under gene control. alcA. This is done using methods well known in the art.

f. Inducible expression, glucocorticoid-inducible promoter:

Induction of NIMI homolog expression according to the present invention using steroid hormone-based systems is also contemplated. For example, a glucocorticoid-mediated induction system has been used (Aoyama and Chua, 1997) and gene expression is induced by administration of a glucocorticoid, for example a synthetic glucocorticoid, preferably dexamethasone, preferably at a concentration ranging from 0.1mM to 1mM, more preferably from 10mM to 100mM. For the purposes of the present invention, the luciferase gene sequences have been replaced by a gene sequence encoding a NIMI homolog to produce an expression cassette having a gene sequence encoding an NIMI homolog under the control of six copies of GAL4 upstream of the activation sequences fused to the minimal 35S promoter. This was done using methods well known in the art. The transactivating factor comprises a GAL4 DNA binding domain (Keegan et al., 1986) fused to the transactivating domain of the herpes VP16 virus protein (Triezenberg et al., 1988) fused to the rat glucocorticoid receptor hormone binding domain (Picard et al., 1988). Expression of the fusion protein is under the control of any promoter suitable for expression in plants known in the art or described herein. This • φ expression cassette is also contained in a plant containing a gene sequence encoding an NIMI homolog fused to the 6xGAL4 / minimal promoter. Thus, tissue or organ specificity of the fusion protein is achieved by introducing inducible tissue or organ specificity into the NIMI homolog.

g. Root-specific expression:

Another type of gene expression is root expression. A suitable root promoter is described by de Framond (1991), as well as in published patent application EP 0 452 269. This promoter was transferred to a suitable vector, such as pCGN1761ENX, for insertion of the selected gene, followed by transfer of the entire promoter-gene-terminator cassette to transformation vector.

h. Injury Inducible Promoters:

Injury-inducible promoters may also be suitable for gene expression. Numerous promoters of this type have been described (eg, Xu et al., 1993, Logemann et al., 1989, Rohrmeier & Lehle, 1993, Firek et al., 1993, Warner et al., 1993) and all are suitable for use with the present invention. Logemann et al. disclose the 5 'upstream sequences of the dicot potato wunl gene. Xu et al. have shown that the injury-inducible promoter from dicotyledonous potato (pin2) is also active in a monocotyledonous plant - rice. In addition, Rohrmeier & Lehle described cloning of Wip1 cDNA from wound-induced maize that can be used to isolate the analog promoter using standard techniques. Similarly, Firek et al.

and Warner et al. described a gene induced by injury from monocotyledon Asparagus officinalis, which is expressed locally at the site of injury and pathogen invasion sites. Using cloning techniques known in the art, these promoters can be transferred to suitable vectors fused to the genes of the invention and used to express these genes at plant injury sites.

i. Marrow-preferred expression:

WO 93/07278 describes the isolation of a maize trpA gene, which is preferably expressed in marrow cells. A gene sequence and a promoter extending up to -1726 bp from the start of transcription are described. Using standard molecular biology techniques, the promoter or parts thereof can be transferred to a vector, such as pCGN1761, where it can replace the 35S promoter and can be used to direct the expression of the foreign gene in a preferred pulp fashion. In fact, fragments containing a pulp-preferred promoter or portions thereof can be transferred to any vector and modified for use in transgenic plants.

j. Leaf specific expression:

The maize gene encoding phosphoenol carboxylase (PEPC) has been described by Hudspeth & Grula (1989). Using standard molecular biology techniques, a promoter for this gene can be used to direct the expression of any leaf-specific gene in transgenic plants.

• Φ φ «· ♦ ♦ ♦ ♦ ♦ ♦ ♦ ♦ ΦΦ 9 9 9 · 9 9 9 9 9 9 · 9 9 9 · 9 9 9 9

Φ φ φφ φφ ♦ · ΦΦ · ΦΦ ·

Pollen-specific expression:

WO 93/07278 describes the isolation of the maize calcium dependent protein kinase (CDPK) gene, which is expressed in pollen cells. The gene sequence and promoter reach 1400 bp from the start of transcription. Using standard molecular biology techniques, this promoter or parts thereof can be transferred to a vector, such as pCGN1761, where it can replace the 35S promoter and can be used to control the expression of the NIMI homolog of the present invention specifically for pollen.

2. Transcription terminators

A variety of transcription terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation. Suitable transcriptional terminators are those known to act in plants and include the CaMV 35S terminator, the tmi terminator, the nopaline synthase terminator, and the pea rbcS E9 terminator. These can be used in both monocotyledonous and dicotyledonous plants. In addition, a native gene transcription terminator may be used.

3. Sequences for enhancing or regulating expression

Numerous sequences have been found to enhance gene expression from within from a transcriptional unit, and these sequences can be used in conjunction with genes of this sequence to increase their expression in transgenic plants.

• ·

Various intron sequences have been shown to enhance expression, especially in monocotyledons. For example, introns of the maize Adh1 gene have been found to significantly increase expression of the wild-type gene under its analogue promoter when introduced into maize cells. Intron 1 was found to be particularly potent and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis et al., 1987). In the same experimental systems, the intron from the maize bronze gene had a similar effect on expression increase. Intron sequences have been routinely incorporated into plant transformation vectors, typically into the untranslated leader region.

It is known that a number of untranslated viral-derived leader sequences also increase expression and are particularly effective in dicotyledonous plants. Specifically, the tobacco mosaic virus (TMV, W-sequence) leader sequence, maize chlorotic blotch virus (MCMV) and alfalfa mosaic virus (AMV) have been shown to be effective in enhancing expression (e.gr. Gallie et al., 1987, Skuzeski et al., 1990).

4. Targeting a gene product in a cell

It is known that there are various mechanisms for targeting gene products in plants and the sequences controlling the action of these mechanisms have been characterized to some extent. For example, targeting of gene products to chloroplasts is driven by a signal sequence found on the amino-terminal portion of various proteins that are cleaved during import into chloroplasts to produce the mature protein (eg, Comai et al., 1988). These signal sequences can be fused to heterologous products.

·· genes to import heterologous products into chloroplast (van den Broeck, et al., 1985). DNA encoding the appropriate signal sequence can be isolated from the 5 'end of the cDNA encoding the RUBISCO protein, the CAB protein, the EPSP synthase enzyme, the GS2 protein, and many other proteins known to be localized in the chloroplast. (See also the section entitled Expression With Chloroplast Targeting in Example 37 of U.S. Patent No. 5,639,949).

Other gene products are localized to other organelles, such as mitochondria and peroxisomes (eg, Unger et al., 1989). The cDNAs encoding these products can also be manipulated to target heterologous gene products to these organelles. Examples of these sequences are ATPases encoded in the nucleus and specific isoforms of aspartate aminotransferase for mitochondria. Targeting of major portions of cellular proteins has been described by Rogers et al. (1985).

In addition, sequences that cause targeting of gene products to other cell compartments have been characterized. The amino-terminal sequences are responsible for targeting ER, apoplast, and extracellular secretion from aleurone cells (Koehler & Ho, 1990). In addition, the amino-terminal sequences in conjunction with the carboxy-terminal sequence are responsible for targeting gene products to vacuoles (Shinshi et al., 1990).

By fusing the appropriate targeting sequences described above with the transgenic sequences of interest, it is possible to direct the transgenic product to any organelle or cell compartment.

For example, to target chloroplasts, it is in frame to the amino terminus

ATG transgene fused chloroplast signal sequence from gene

RUBISCO, CAB gene, EPSP synthase gene or GS2 gene. Selected

The 4 signal sequence should include a known cleavage site and the constructed fusion should take into account all amino acids after the cleavage site that are necessary for cleavage. In some cases, this requirement can be met by adding a small number of amino acids between the cleavage site and the ATG of the transgene or, alternatively, by replacing some of the amino acids in the transgene sequence. Fusions designed for import into chloroplasts can be tested for efficacy of absorption into chloroplasts by in vitro translation of in vitro transcribed constructs, followed by an in vitro absorption of chloroplasts using techniques described by Bartlett et al. (1982) and Wasmann et al. (1986). These techniques are well known in the art and are equally suitable for mitochondria and peroxisomes.

The above-described cellular targeting mechanisms can be used not only in conjunction with their analogous promoters, but also in conjunction with heterologous promoters to effect targeting of a specific cell under transcriptional regulation of a promoter having a different expression type than the promoter from which the targeting signal originates .

Example 11

Design of plant transformation vectors

Numerous transformation vectors suitable for plant transformation are known to those skilled in the art of plant transformation, and genes associated with the present invention can be used in conjunction with each of these vectors. The choice of vector depends on the preferred transformation technique and the target variety for transformation. Different antibiotic or herbicidal selection markers may be preferred for certain target varieties. Selection markers used routinely in transformation include the npt11 gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982, Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., 1990, Spencer et al., 1990), the hph gene conferring resistance to the antibiotic hygromycin (Blochinger & Diggelmann) and the dhfr gene conferring methotrexate resistance (Bourouis et al., 1983) and the EPSPS gene conferring glyphosate resistance (patent) No. 4,940,935 and 5,188,642).

1. Vectors suitable for mediated transformation

Agrobacterium

A variety of suitable vectors exist for transformation using Agrobacterium tumefaciens. They typically carry at least one T-DNA flanking sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res., 1984) and pXYZ. The construction of two typical vectors suitable for Agrobacterium-mediated transformation is described below.

PCIB200 and pCIB2001;

The binary vectors pcIB200 and pCIB2001 are used to construct recombinant vectors for use with Agrobacterium and are constructed as follows: pTJS75kan is created by digestion of pTJS75 with Narl (Schmidhauser & Helinski, 1985), allowing excision of the tetracycline resistance gene, followed by insertion of the AccI fragment. from a pUC4K carrying NPTII (Messing & Vierra, 1982, Bevan et al., 1983, &lt; RTI ID = 0.0 &gt;), &lt; / RTI &gt; McBride et al.,

1990). The XhoI linker sequences are ligated to the EcoRV fragment of PCIB7, which contains the left and right T-DNA borders, the plant selectable chimeric nos / nptII gene, and the pUC polylinker (Rothstein et al., 1987), and the XhoI digested fragment is cloned into pTJS75kan cleaved with SalI. formation of pCIB200 (see also EP 0 332 104, Example 19). pCIB200 contains the following unique restriction sites in the polylinker: EcoRI, SstI, KpnI, BglII, XbaI, and SalI. pCIB2001 is a derivative of pCIB200 created by insertion of additional restriction sites into the polylinker. Unique restriction sites in polylinker pCIB2001 are EcoRI, SstI, KpnI, BglII, XbaI, SalI, Mini, Bell, AvrII, ApaI, HpaI, and StuI. pCIB2001, besides containing these unique restriction sites, also has kanamycin selection for plants and bacteria, right and left T-DNA boundaries for Agrobacterium-mediated transformation, RK2-derived trfA function for mobilization between E. coli and other recipients, and OriT function and OriV also from RK2. The pCIB2001 polylinker is suitable for cloning plant expression cassettes containing their own regulatory signals.

b. pCIB10 and its derivatives with hygromycin selection:

The binary vector pCIB10 contains the gene encoding kanamycin resistance for selection in plants and the right and left T-DNA flanking sequences, and comprises sequences from plasmid pRK252 with a large number of recipients, allowing it to replicate in both E. coli and Agrobacterium. Its construction is described by Rothstein et al., 1987. Various pCIB10 derivatives have been constructed which contain the hygromycin B phosphotransferase gene described by Gritz et al., 1983. These derivatives allow selection of transgenic plant cells with only hygromycin (pCIB743) or hygromycin and kanamycin (pCIB715, pCIB717).

2. Vectors suitable for transformation other than mediated transformation

Agrobacterium

Transformation without the use of Agrobacterium tumefaciens bypasses the requirement for the presence of a T-DNA sequence in a selected transformation vector, and in addition to the vectors described above that contain TDNA sequences, vectors lacking these sequences can also be used. Transformation techniques that do not rely on Agrobacterium include transformation through bombardment by microparticles, absorption by protoplasts (eg, PEG and electroporation), and microinjection. The choice of vectors depends largely on the selection preferred for the transformed variety. Further, the construction of typical vectors suitable for non-Agrobacterium-mediated transformation is described.

a. pCIB3064:

pCIB3064 is a pUC-based vector suitable for direct gene transfer techniques in combination with Basta (or phosphinothricin) herbicide selection. Plasmid pCIB246 contains the CaMV 35S promoter in functional fusion with the E. coli GUS gene and the CaMV 35S transcription terminator and is described in published PCT application WO 93/07278. The 35S promoter of this vector contains two ATG sequences 5 'from the start site. These sites are mutated using standard PCR techniques to remove ATG sequences and create SspI and PvuII restriction sites. The new restriction sites are 96 and 37 bp distant from the unique site to this unique site.

They are 101 and 42 bp away from the current starting point. The resulting derivative of pCIB246 is designated pCIB3025. The GUS gene is then excised from pCIB3025 by digestion with SalI and SacI, its ends blunt-ended and ligated again to form plasmid pCIB3060. Plasmid pJIT82 was obtained from John Innes Center, Norwich, and the SmaI fragment of 400 bp containing the bar gene from Streptomyces viridochromogens is excised and inserted into the HpaI site of pCIB3060 (Thompson et al., 1987). This resulted in pCIB3064, which contained the bar gene under the control of the CaMV 35S promoter and a terminator for herbicide selection, an ampicillin resistance gene (for E. coli selection) and a polylinker with unique SphI, PstI, HindIII and BamHI sites. This vector is suitable for cloning plant expression cassettes containing their own regulatory signals.

b. pSOG19 and pSOG35:

pSOG35 is a transformation vector that uses the E. coli dihydrofolate reductase (DFR) gene as a marker of selection conferring methotrexate resistance.

PCR is used to amplify the 35S promoter (-800 bp), intron 6 from the maize Adh1 gene (-550 bp) and 18 bp from the GUS untranslated leader sequence from pSOG10. The 250 bp fragment encoding the E. coli type II dihydrofolate reductase gene is also amplified by PCR and the two PCR fragments are linked to

Sacl-Pst1 fragment from pB1221 (Clontech), which contains the pUC19 vector backbone and a nopaline synthase terminator.

Replacement of the GUS leader sequence in pSOG19 with the maize chlorotic spots virus (MCMV) leader sequence creates the pSOG35 vector. pSOG19 and pSOG35 carry the pUC gene for ampicillin resistance, and have sites of &quot; ampicillin resistance &quot; and have sites of &quot; ampicillin resistance &quot; · ♦ · ^e

HindIII, Sphl, Pstl and

EcoRI useful for cloning foreign substances.

Example 12

Transformation

Once the expression system is present, the desired gene sequence cloned into can be transformed (i.e., introduced by transformation) into a plant cell. Methods for transforming and regenerating plants are known in the art. For example, Ti plasmid vectors have been used to deliver foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection and microparticles / microprojectiles. In addition, bacteria of the genus Agrobacterium can be used to transform plant cells. Described below are representative techniques for transforming both dicotyledons and monocotyledons.

1. Transformation of dicotyledonous plants

Transformation techniques for dicotyledonous plants are well known in the art and include techniques based on

Agrobacterium and techniques that do not require Agrobacterium.

Techniques of non-mediated genetic material directly

Agrobacterium require absorption by protoplasts or cells. This can be accomplished by PEG-mediated absorption or electroporation, particle-bombardment-mediated application, or microinjection. Examples of these techniques are described by the authors

Paszkowski et al., 1984, Potrykus et al., 1985, Reich et al., *, &Quot;, &quot;, &quot;, &quot; · ♦ • • 0 0 <00 0 000 00 00 0

0 0 0 00 0 ΦΦ0 ·· 9 9 99 00 ·· 0 * 0

1986 and Klein et al., 1987. Transformed cells are each regenerated using standard techniques known in the art.

Agrobacterium-mediated transformation is a convenient technique for transforming dicotyledonous plants due to high transformation efficiency and wide utility in many different species. Agrobacterium-mediated transformation typically involves the transfer of a binary vector carrying the foreign DNA of interest (eg, pCIB200 or pCIB2001) to a suitable Agrobacterium strain, which may depend on complement of the virus genes carried by the Agrobacterium host strain either in a co-resident Ti plasmid or chromosomally (e.g. and pCIB2001 (Uknes et al., 1993) Transfer of the recombinant binary vector to Agrobacterium is accomplished by triplexal mating using E. coli carrying a recombinant binary vector, an E. coli helper strain carrying a plasmid such as pRK2013, and which is capable of mobilizing a recombinant binary vector into an Agrobacterium target strain, or the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (Hofgen & Willmitzer, 1988).

Transformation of target plant varieties with recombinant Agrobacterium usually involves co-cultivation of Agrobacterium with plant explants and following protocols known in the art. The transformed tissue is regenerated on a selectable medium and carries an antibiotic or herbicide resistance marker that occurs between the T-DNA boundaries of a binary plasmid.

Another approach to transforming plant cells with a gene involves injecting inert or biologically active particles into plant tissues and cells. This technique is described

«· •in • • · • • »» • · • • ·· • • ··· • • • · • · • • • • « • · • ··· · • · • Φ • • · • • • • • • «· * · and"· * · ·

U.S. Pat. Nos. 4,945,050, 5,036,006, and 5,100,792. Generally, the process involves injecting inert or biologically active particles into cells under conditions permitting penetration of the outer surface of the cell and providing incorporation into its interior. When inert particles are used, the vector can be introduced into the cell by applying to the particles a vector containing the gene of interest. Alternatively, the target cell may be in a vector containing environment such that the vector is introduced into the cell by passage of the particle. Biologically active particles (eg, dry yeast, dry bacteria or bacteriophage containing DNA) can also be injected into plant tissue or cells.

2. Transformation of monocotyledons

The transformation of most monocotyledon species has now become routine. Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation and microparticle bombardment of callus tissue. Transformations can be performed with one or more DNA species (i.e., co-transformation) and both are suitable for use in the present invention. Cotransformation may have the advantage of bypassing the construction of the full-length vector and that transgenic plants are formed without combining the loci of the gene of interest and the selectable marker, allowing removal of the selectable marker in future generations, if this is found desirable. However, the disadvantage of using cotransformation is that the frequency with which individual DNA species are integrated into the genome is less than 100% (Schocher et al., 1986).

• ·

• • • • •

Patent applications EP 0 292 435, EP 0 392 225 and WO 93/07278 describe techniques for the preparation of callus and protoplasts from a selected inbred maize line, transformation of protoplasts using PEG or electroporation and regeneration of maize plants from transformed protoplasts. Gordon-Kamm et al. (1990) and Fromm et al. (1990) published techniques for transforming maize derived A188 using particle bombardment. In addition, WO 93/07278 and Koziel et al. (1993) describe techniques for transforming selected inbred corn lines by particle bombardment. This technique uses immature 1.5-2.5 mm maize embryos removed from the corn cob 14 to 15 days after pollination and a PDS-100OHe Biolistics shelling device.

Transformation of rice can also be accomplished by direct gene transfer techniques using protoplasts or particle bombardment. Protoplast-mediated transformation has been described for Japonica and Indica (Zhang et al., 1988,

Shimamoto et al., 1989, Datta et al., 1990). Both types are also routinely transformable using particle bombardment (Christou et al., 1991). In addition, WO 93/21335 describes techniques for transforming rice by electroporation.

Patent application EP 0 332 581 describes techniques for the generation, transformation and regeneration of Pooideae protoplasts. This technique allows the transformation of Dactylis and wheat. In addition, wheat transformation has been described by Vasil et al. (1992) using particle bombardment into type C cells of long-term regenerable callus, as well as by Vasil et al. (1993) a

Weeks et al. (1993) using immature embryo bombardment and callus derived from immature embryos. But a preferred technique for transforming wheat involves transforming wheat.

by bombardment with immature embryo particles and prior to gene delivery, it comprises the step of incubating to a high concentration of sucrose or maltose. Before bombardment, any number of embryos (0.75-1 mm long) was placed on MS medium with 3% sucrose (Murashiga & Skoog, 1962) and 3 mg / L 2,4-D to induce somatic embryos that took place in the dark . On the chosen day of bombardment, the embryos were removed from the induction medium and placed on the osmoticum (i.e. induction medium with sucrose or maltose added to the desired leave was left for 2-3 hours, bombarded. A concentration, typically 15%) is typical.

for plasmolysis, embryos on the target dish,

The embryo was then when the count was not critical.

A suitable plasmid carrying the gene (such as pCIB3064 or pSG35) was precipitated on gold e.g.

The cleaning is of the order of micrometers in a standard way. Each embryonic plate was bombarded using a DuPont Biolistics® helium device with a shot pressure of approximately 68954 kPa (1000 psi) and an 80 mesh grid. After shelling, the embryos were placed back in the dark for recovery for 24 hours (still on osmotics). After 24 hours, the embryos were removed from the osmotic and placed back on the induction medium where they remained for about a month until regeneration. About one month later, embryo explants that developed embryogenic callus were transferred to regeneration medium (MS + 1 mg / l NAA, 5 mg / l GA) containing a suitable selection agent (10 mg / l).

Basta for pCIB3064 and 2 mg / l methotrexate for pSOG35). After approximately one month, the developing aerial portions were transferred to larger sterile containers known as GA7s containing 1/2 MS medium, 2% sucrose, and selection agents as described above.

Transformation of monocotyledons through

Agrobacterium has been described elsewhere, see e.g. WO 94/00977 and

U.S. Pat. Patent 5,591,616.

III. Breeding and seed production

Example 13

Breeding

The plants obtained by transformation with the gene according to the invention can be plants of virtually any biological species, both dicotyledonous and monocotyledonous, but the plants used in the methods of the invention are preferably selected from the list of agronomically important crops mentioned above. Expression of the gene of the invention in combination with other properties important for production and quality can be introduced into plant lines through breeding. Methods of breeding are known to those skilled in the art, see, e.g., Welsh J. R. (1981); Wood D. R. (Ed.) (1983); Mayo, 0. (1987); Singh, D.P. (1986); and Wricke and

Weber (1986).

The genetic properties introduced into the transgenic seeds and plants described above are transmitted by sexual reproduction or vegetative growth and can thus be maintained and propagated in subsequent generations of plants. Generally, such maintenance and reproduction uses agricultural methods suitable for specific purposes such as cultivation of land, sowing or harvesting. Special methods such as hydroponics or greenhouse cultivation can also be used. Because growing crops are susceptible

To attack and damage insects or infections, as well as competition with weeds, action must be taken against weeds, diseases, insects, nematodes, and other pests to improve yields. These can be both mechanical measures such as soil cultivation by gates or the removal of weeds or diseased plants, as well as the use of agrochemicals such as herbicides, fungicides, gametocides, nematicides, growth regulators, ripening agents and insecticides.

Advantageous genetic properties of the transgenic plants and seeds of the invention can further be utilized in breeding to obtain plants with improved properties such as pest, herbicide or stress tolerance, improved nutritional value, increased yield, or improved structure to reduce losses due to lying or crushing. The individual steps of the breeding process are characterized by well-defined human interventions such as selecting lines for crossing, controlling pollination of parental lines, or selecting offspring. Different breeding measures are carried out depending on the desired characteristics. Corresponding techniques are well known in the art and are not limited to hybridization, inbreeding, backcross, multi-lineage crossing, variety crossing, interspecific hybridization, aneuploid techniques and the like. Thus, the transgenic seeds and plants of the present invention can be used to breed improved plant for example, they increase the efficacy of conventional methods such as herbicide or pesticide treatments, or because of their modified genetic properties, they can do without these methods. Alternatively, it is possible to obtain new crops with improved stress tolerance that they provide due to their optimized genetic equipment

• better quality products than plant products that are unable to tolerate comparatively unfavorable developmental conditions.

Example 14

Seed production

In seed production, the germination quality and seed uniformity are essential characteristics of the product, while the germination quality and uniformity of the seeds harvested and sold by farmers are not so important. Because it is difficult to keep the crop clean without the seed of another crop or weed, to control seed-borne diseases, and to produce seed with good germination quality, very extensive and well-defined seed production techniques have been developed by seed producers with experience in cultivation, maintenance and sale of pure seed. It is common practice for a farmer to purchase certified seed that meets quality standards, instead of using seed from his own crop. The material used as a seed is usually treated with a protective layer containing herbicides, insecticides, fungicides, bactericides, nematicides, moluscicides or various mixtures thereof. Commonly used protective layers include compounds such as captan, carboxin, thiram (TMTD®), metalaxyl (Apron®) and pirimifosmetyl (Actellic®). If desired, these compounds form the composition together with other adjuvants, carriers, surfactants or adjuvants to facilitate administration, as is commonly used in the art to protect against damage by bacterial, fungal or animal pests. The protective layer can be applied by impregnating the seed with a liquid composition

or by combined application of a liquid and a dry composition. Other routes of administration may also be used, eg, direct treatment of buds or fruits.

Another aspect of the present invention relates to novel methods in agriculture, such as those mentioned above using transgenic plants, transgenic plant material or transgenic seeds of the invention.

The seeds are stored in a bag / container, container or container which is of suitable packaging materials and can be sealed. The sack, container or container is made for either short or long term seed storage, or both. Examples of suitable packaging materials include paper, such as cardboard, rigid or flexible plastic or other polymer materials, metal and glass. Preferably, the bag, container or container is a plurality of layers of packaging material of the same or different kind. In one preferred embodiment, the bag, container or container is made to eliminate or at least reduce the water and moisture contained in the seeds. In one preferred embodiment, the bag, container or container is sealed, e.g., heat sealed, to prevent moisture ingress. In another embodiment, a water absorbing material is interposed between the layers of packaging material. In yet another embodiment, the bag, container or container, or packaging material from which they are made is treated to reduce, suppress or eliminate diseases, contamination, or other adverse effects in seed storage and transportation. Such treatment is, for example, sterilization, eg, by chemical means or by irradiation. The invention further relates to a commercial bag comprising seeds of transgenic plants comprising a gene of the invention which is expressed at a higher level in transgenic plants than in wild-type plants, together with a suitable carrier, with instructions for use to obtaining plants with resistance to a wide range of diseases.

IV. Evaluation of disease resistance

Assessment of disease resistance was performed by methods known to those skilled in the art, e.g. as described by Uknes et al. (1993); Gorlach et al. (1996); Alexaer et al. (1993). As an example, several resistance tests are described in the following examples.

Example 15

Test of resistance to Phytophthora parasitica (black stem rot)

Phytophthora parasitica resistance tests, which cause black stem rot, are performed on 6 week old plants grown as described by Alexander et al. (1993). Plants are potted and after removal of excess water they are inoculated by applying 10 ml of sporangia suspension (300 sporangia / ml) to the soil. The inoculated plants are then kept in a greenhouse at 23-25 ° C by day and 20-22 ° C by night. The following wilting index was used in the test: 0 = no symptoms, 1 = weak wilting symptoms with reduced turgor, 2 = clear wilting symptoms but no rot or curl, 3 = clear wilting symptoms with curl but no apparent stem rot, 4 = strong wilting with visible stem rot and slight damage to the root system, 5 = as in grade 4, moreover, plants are nearing death and have a strongly reduced root system. All plants are scored blindly in a randomized experiment.

Example 16

Pseudomonas syringae resistance test

Pseudomonas syringae pv. Tabaci, strain # 551, was injected into the two lower leaves of 6-7 week old plants at a concentration of 10 ⁶ or 3 x 10 ⁶ / ml in H ₂ O. Six individual plants were evaluated at each time point. Plants infected with Pseudomonas tabaci were evaluated on a five-point scale, with 5 = 100% dead tissue and 0 = no symptoms. A T-test (LSD) was used to evaluate each group, and the groups are scored at an average score. Values marked with the same letter on a certain day are not statistically significantly different.

Example 17

Cercospora nicotianae resistance test

Cercospora nicotianae spore suspension (ATCC # 18366) (100 000

150,000 spores / ml) was sprayed immediately onto the leaf surface. The plants were then maintained for 5 days in 100% air humidity. Then the plants were misted 5-10 times a day. Six plants were evaluated at each time point. Cercospora infections were evaluated in% leaf area showing symptoms of the disease. Cercospora infection was evaluated in% leaf area showing disease symptoms. Ttest (LSD) was used to evaluate each group, and the groups are scored at an average score. Values marked with the same letter on a certain day are not statistically significantly different.

Example 18

Peronospora parasitica resistance test

Peronospora parasitica resistance assays are performed as described in Uknes et al. (1993). Plants were inoculated with a compatible P. parasitica isolate by spraying a conidia suspension (approximately 5 x 10 ⁴ spores / ml). The inoculated plants were incubated in a humidified environment at 17 ° C in a 14 hour day / 10 hour night growth chamber. The plants were examined after 3 to 14 days, preferably 7 to 12 days after inoculation for the presence of conidiophores. In addition, several plants were randomly selected from each group and stained with lactophenol-trypan blue (Keogh et al., 1980) for microscopic examination.

All embodiments of the invention described above are illustrative. One skilled in the art will readily appreciate that various modifications and variations are possible in the invention. However, these obvious variations fall within the scope of the described invention as defined by the claims.

φ φ · · · φφ

BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LIST

SEQ ID NO. No. 1 - The complete cDNA sequence of the NIMI homolog of Nicotiana tabacum.

SEQ ID NO. 2 - The protein sequence of the NIMI homolog of Nicotiana tabacum encoded by SEQ ID NO. no. 1.

SEQ ID NO. 3 - Complete cDNA sequence of the NIMI homolog of Lycopersicon esculentum.

SEQ ID NO. 4 - Protein sequence of the NIMI homolog of Lycopersicon esculentum encoded by SEQ ID NO. No 3.

SEQ ID NO. 5 - Partial cDNA sequence of the homologue of NIMI from Brassica napus.

SEQ ID NO. 6 - Partial protein sequence of the NIMI homolog

Brassica napus encoded by SEQ ID NO. No 5.

SEQ ID NO. No. 7 - The complete cDNA sequence of the NIMI homolog (AtNMLc5) from Arabidopsis thaliana.

SEQ ID NO. No. 8 - Complete protein sequence of Arabidopsis thaliana homologue of NIMI AtNMLc5 encoded by SEQ ID NO. No 7.

SEQ ID NO. SEQ ID NO: 9-14 - Oligonucleotide primers used in Examples 1-4.

SEQ ID NO. No. 15 - Genomic DNA sequence of the NIMI homolog (AtNMLc2) from Arabidopsis thaliana.

SEQ ID NO. 16 - The protein sequence of the Arabidopsis thaliana homologue of NIMI AtNMLc2 encoded by SEQ ID NO. No 15.

SEQ ID NO. No. 17 - Genomic DNA sequence of the NIMI homolog (AtNMLc4-1) from Arabidopsis thaliana.

SEQ ID NO. 18 - The protein sequence of the Arabidopsis thaliana homologue of NIMI AtNMLc4-1 encoded by SEQ ID NO. No 17.

SEQ ID NO. No. 19 - Genomic DNA sequence of the NIMI homolog (AtNMLc4-2) from Arabidopsis thaliana.

* ♦

SEQ ID NO. 20 - Protein sequence of Arabidopsis thaliana homologue of NIMI AtNMLc4-2 encoded by SEQ ID NO. No 19.

Sequence id. in C. 21 - PCR primer NIM IA. Sequence id. C. 22nd - PCR primer NIM 1B. Sequence id. C. 23 - PCR primer NIM IC. Sequence id. v c. 24 - PCR primer NIM ID Sequence id. sz c. 25 - PCR primer NIM 2A. Sequence id. C. 26 - PCR primer NIM 2B. Sequence id. C. 27 Mar: - PCR primer NIM 2C. Sequence id. NW C. 28 - PCR primer NIM 2D.

SEQ ID NO. No. 29 - DNA fragment similar to NIM of size

659 bp amplified from Nicotiana tabacum (Tobacco A), which is a canonical sequence of 36 sequences and is 67% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 30 - Protein sequence encoded by SEQ ID NO. No 29.

SEQ ID NO. No. 31 - DNA fragment similar to NIM of size

The 498 bp amplified from Nicotiana tabacum (Tobacco B), a canonical sequence of 2 sequences, is 62% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 32 - Protein sequence encoded by SEQ ID NO.

No. 31.

SEQ ID NO. 33 - NIM-like DNA fragment of size

The 498 bp amplified from Nicotiana tabacum (Tobacco C), which is a canonical sequence of 3 sequences and is 63% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 34 - Protein sequence encoded by SEQ ID NO. No 33.

SEQ ID NO. No. 35 - NIM-like DNA fragment of size

399 bp amplified from Nicotiana tabacum (Tobacco D), whose sequence is 59% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 36 - Protein sequence encoded by SEQ ID NO. No 35.

SEQ ID NO. No. 3 7 - NIM-like DNA fragment of size

The 498 bp amplified from Lycopersicon esculentum (tomato A), a canonical sequence of 8 sequences, is 67% identical to the Arabidopsis thaliana NIMI gene sequence.

SEQ ID NO. 38 - Protein sequence encoded by SEQ ID NO. No 37.

SEQ ID NO. No. 3 9 - NIM-like DNA fragment of size

The 498 bp amplified from Beta vulgaris (sugar beet), which is a canonical sequence of 24 sequences and is 66% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 40 - Protein sequence encoded by SEQ ID NO. No. 39.

SEQ ID NO. No. 41 - NIM-like DNA fragment of size

The 498 bp amplified from Helianthus annuus (Sunflower A), which is a canonical sequence of 9 sequences and is 61% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 42 - Protein sequence encoded by SEQ ID NO. No 41.

SEQ ID NO. No. 43 - DNA fragment similar to NIM of size

The 498 bp amplified from Helianthus annuus (Sunflower B), which is a canonical sequence of 10 sequences and is 59% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 44 - Protein sequence encoded by SEQ ID NO. No 43.

SEQ ID NO. No. 45 - NIM-like DNA fragment of size

A 653 bp amplified from Solanum tuberosum (potato A), a canonical sequence of 15 sequences and 68% identical to the Arabidopsis thaliana NIMI gene sequence.

SEQ ID NO. 46 - Protein sequence encoded by SEQ ID NO. No. 45.

SEQ ID NO. No. 47 - NIM-like DNA fragment of size

498 bp amplified from Solanum tuberosum (potato Β), which is a canonical sequence of 3 sequences and is 61% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 48 - Protein sequence encoded by SEQ ID NO. No. 47.

SEQ ID NO. No. 49 - NIM-like DNA fragment of size

The 477 bp amplified from Solanum tuberosum (potato C), which is a canonical sequence of 2 sequences and is 62% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 50 - Protein sequence encoded by SEQ ID NO. No. 49.

SEQ ID NO. No. 51 - NIM-like DNA fragment of size

A 501 bp amplified from Brassica napus (canola A), a canonical sequence of 5 sequences and 59% identical to the Arabidopsis thaliana NIMI gene sequence.

SEQ ID NO. 52 - Protein sequence encoded by SEQ ID NO. No. 51.

SEQ ID NO. No. 53 - DNA fragment similar to NIM of size

A 501 bp amplified from Brassica napus (canola Β), which is a canonical sequence of 5 sequences and is 58% identical to the Arabidopsis thaliana NIMI gene sequence.

SEQ ID NO. 54 - Protein sequence encoded by SEQ ID NO. No. 53.

SEQ ID NO. 55 - NIM-like DNA fragment of size

498 bp amplified from Brassica napus (canola C), whose sequence is 56% identical to that of the Arabidopsis thaliana NIMI gene.

SEQ ID NO. 56 - Protein sequence encoded by SEQ ID NO. No. 55.

SEQ ID NO. No. 57 - DNA fragment similar to NIM of size

498 bp amplified from Brassica napus (canola D), whose sequence is 73% identical to the Arabidopsis NIMI gene sequence

thaliana. Sequence id. C. 58 - Protein sequence encoded SEQ ID NO. No. 57. Sequence id. C. 59 - PCR primer NIM 3A. Sequence id. C. 60 - PCR primer NIM 3B. Sequence id. C 61 - NIM-like DNA fragment about size

148 bp amplified from Lycopersicon esculentum (tomato B), a canonical sequence of 3 sequences and 72% identical to the Arabidopsis thaliana NIMI gene sequence.

SEQ ID NO. 62 - Protein sequence encoded by SEQ ID NO. No. 61.

SEQ ID NO. 63 - The complete cDNA sequence of the homologue of NIMI from Beta vulgaris (sugar beet), which corresponds to the PCR fragment of SEQ ID NO. No. 39.

SEQ ID NO. 64 - Protein sequence of a sugar beet NIMI homolog encoded by SEQ ID NO. No. 62.

SEQ ID NO. No. 65 - The complete cDNA sequence of the NIMI homolog of Helianthus annuus (Sunflower B), which corresponds to the PCR fragment of SEQ ID NO. No 43.

SEQ ID NO. No. 66 - Helianthus annuus protein sequence of the NIMI homolog encoded by SEQ ID NO. No. 65.

• 0 • ·

SEQ ID NO. No. 67 - cDNA sequence corresponding to the NIM-like genomic sequence of AtNMLc2 from Arabidopsis thaliana (SEQ ID NO.

No. 15).

SEQ ID NO. 68 - Protein sequence encoded by SEQ ID NO. No. 67.

SEQ ID NO. No. 69 - cDNA sequence corresponding to the NIM-like genomic sequence of AtNMLc4-1 from Arabidopsis thaliana (SEQ ID NO: 17).

SEQ ID NO. 70 - Protein sequence encoded by SEQ ID NO. No. 69.

SEQ ID NO. No. 71 - cDNA sequence corresponding to the NIM-like genomic sequence AtNMLc4-2 of Arabidopsis thaliana (SEQ ID NO: 19).

SEQ ID NO. 72 - Protein sequence encoded by SEQ ID NO. No. 71.

SEQ ID NO. 73 - The complete cDNA sequence of the NIMI homolog of Nicotiana tabacum (tobacco Β), which corresponds to the PCR fragment of SEQ ID NO. No 31.

SEQ ID NO. 74 - NIMI homolog protein sequence from Nicotiana tabacum encoded by SEQ ID NO. No 73.

SAVING SAMPLES

The biological material listed below was deposited in the collection of patented cultures at the Agricultural Research Service (NRRL),

1815 North University Street, Peoria, Illinois 61604, USA, under the Budapest Treaty on the Storage of Microorganisms for Patent Purposes. All restrictions on the availability of samples to the public will be lifted after the patent is granted.

• ·

Clone Access. Number Date saved

pNOV1203 NRRL B-30049 17. August 1998 pNOV1204 NRRL B-30050 17. August 1998 pNOV1206 NRRL B-30051 17. August 1998 AtNMLc5 NRRL Β-3,139 25. May 1999

LIST OF Cited PUBLICATIONS

The publications in the following list represent the state of the art. Each of these publications is fully incorporated by reference in the present application.

U.S. Pat. Patent No. 4,940,935 U.S. Pat. Patent No. 4,945,050 U.S. Pat. Patent No. 5,036,006 U.S. Pat. Patent No. 5,100,792 U.S. Pat. Patent No. 5,188,642 U.S. Pat. Patent No. 5,523,311 U.S. Pat. Patent No. 5,591,616 U.S. Pat. Patent No. 5,614,395 U.S. Pat. Patent No. 5,639,949 U.S. Pat. Patent No. 5,792,904 EP 0 292 435 EP 0 332 104 EP 0 332 581 EP 0 342 926 EP 0 392 225 EP 0 452 269 International PCT application WO 93/07278 International PCT application WO 93/21335 International PCT application WO 94/00977 International PCT application WO 94/13822 International PCT application WO 94/16077 International PCT application WO 97/49822 International PCT application WO 98/06748 International PCT application WO 98/26082 International PCT application WO 98/29537

Alexaer et al., Proc. Nati. Acad. Sci. USA 90: 7327-7331 (1993).

Aoyama and Hua, The Plant Journal 11: 605-612 (1997)

Ausubel, F.M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987)

Bartlett et al., In: Edelmann et al. (Eds.) Methods in Chloroplast Molecular Biology, Elsevier pp. 1081-1091 (1982)

Bevan et al., Nature 304: 184-187 (1983)

Bevan, Bored. Acids Res. (1984)

Bi et al., Plant J. 8: 235-245 (1995).

Binet et al. Plant Science 79: 87-94 (1991).

Blochinger & Diggelmann, Mol Cell. Biol. 4: 2929-2931

Bourouis et al. , EMBO J. 2 (7): 1099-1104 (1983).

Boutry et al., Nature 328: 340-342 (1987)

Caddick et al., Nat. Biotechnol 16: 177-180

Callis et al., Gens Develop. 1: 1183-1200

Cameron et al., Plant J. 5: 715-725 (1994).

Cao et al., Plant Cell 6, 1583-1592 (1994).

Cao et al., Cell 88: 57-63 (1997).

Casas et al., Proc. Nati. Acad. Sci. USA 90: 11212-11216 (1993).

Century et al., Proc. Nati. Acad. Sci. USA 92: 6597-6601 (1995).

Chibbar et al., Plant Cell Rep. 12: 506-509

Chrispeels, Ann. Roar. Plant Physiol. Plant Mol. Biol. 42: 21-53

Christou et al., Plant Physiol. 87: 671-674 (1988).

Christou et al., Biotechnology 9: 957-962 (1991).

Christensen et al., Plant Molec. Biol. 12: 619-632.

Comai et al., J. Biol. Chem. 263: 15104-15109 (1988).

Crossway et al., BioTechniques 4: 320-334 (1986).

Datta et al., Biotechnology 8: 736-740 (1990) de Framond, FEBS 290: 103-106 (1991).

Delaney et al., Science 266: 1247-1250 (1994).

Delaney et al., Proc. Nati. Acad. Sci. USA 92: 6602-6606 (1995).

Dempsey & Klessig, Bulletin de L'Institut Pasteur 93: 167-186 (1995)

Dietrich et al., Cell 77: 565-577 (1994).

Firek et al., Plant Molec. Biol. 22: 129-142 (1993).

Fromm et al., Biotechnology 8: 833-839 (1990).

Gaffney et al., Science 261: 754-756 (1993).

Gallie et al., Nud. Acids Res. 15: 8693-8711 (1987).

Glazebrook et al., Gentics 143: 973-982 (1996).

Gordon-Kamm et al., Plant Cell 2: 603-618 (1990).

Gordon-Kamm et al., In Transgenic Plants, vol. 2, pp. 21-33, pub. by Academie Press

Gorlach et al., Plant Cell 8: 629-643 (1996).

4 4 4 5 4 444444

9 4, 4, 4, 4, 44, 44, 44, 1990 (1988) (1989)

Greenberg et al., Cell 77: 551-563 (1994). Gritz et al., Gen 25: 179-188 (1983)

Hayashimoto et al., Plant Physiol. 93: 857-863

Hill et al., Euphytica 85: 119-123 (1995).

Hinchee et al., Biotechnology 6: 915-921 (1988).

Hofgen & Willmitzer, Nucl. Acids Res. 16: 9877

Hudspeth & Grula, Plant Molec. Biol. 12: 579-589

Hunt and Ryals, Crit. Roar. in Plant Sci. 15: 583-606 (1996).

Innis et al., PCR Protocols, and Guide to Methods and Applications eds., Academic Press (1990)

Ishida et al., Nature Biotechnology 14: 745-750 (1996)

Jahne et al., Theor. Appl. Gent. 89: 525-533.

Keegan et al., Science 231: 699-704 (1986).

Keogh

Klein

Klein

Klein

Klein

Koziel et al.,

Koziel et al.,

792: 164-171

Lawton et al., Resistance

B. Fritig

et al., Trance. Br. Mycol. Soc. 74 : 329-333 (1980) et al. , Nature 327: 70-73 (1987) et al. , Why. Nati. Acad. Sci. USA 85: 4305 -4309 (1988) et al., Bio / Technology 5: 559-563 (1988) et al., Plant Physiol. 91 : 440-444 (1988)

194-200

New York biology

Academy of Sciences of Systemic Aquired Responses in Plants, M. Legra, eds (Dordrecht, The Netherlas:

Biotechnology 11: Annals of the

The molecular in Mechanisms of Defense a

Kluwer Academic Publishers) 422-432 (1993) Lawton et al., Plant J. 10: 71-82 (1996) Logemann et al., Plant Cell 1: 151-158 (1989) Maher et al., Proc. Nati. Acad. Sci. USA 91: 7802-7806 Mauch-Mani and Slusarenko, Mol. Plant-Microbe Interact.

383

Mauch-Mani and Slusarenko, Plant Cell 8: 203-212 (1996) Mayo O, Theory of Plant Breeding, Second

Clarendon Press, Oxford

Mazur et al., Plant Physiol. 85: 1110 (1987) McBride et al., Plant Molecular Biology 14: 266-276 (1990) McCabe et al., Biotechnology 6: 923-926 (1988) McElroy et al., Plant Cell 2: 163-171 (1990) McElroy et al., Mol. Gene. Gent. 231: 150-160 (1991) Messing & Vierra, Gen 19: 259-268 (1982)

Murashiga & Skoog, Physiologia Plantarum 15: 473-497 (1962)

Nehra et al., The Plant Journal 5: 285-297 (1994).

Neuhaus et al., Proc. Nati. Acad.

(1991)

Norris et al., Plant Mol. Biol. 21:

Pallas et al., Plant J. 10: 281-293 (1994).

7: 378Edition

Sci. USA 88: 10362-10366

895-906 (1993)

<·· • 4 * <· 44 • • ♦ • • 4 • 4 4 4 ·· • • ··· • · • 4 4 4 • • • • · • · · ··· 4 4 4 4 4 · * · • · • · ·· • 4 4 4 444

Parker et al., Plant Cell 8: 2033-2046 (1996).

Paszkowski et al., EMBO J. 3: 2717-2722 (1984).

Payne et al., Plant Mol. Biol. 11: 89-94

Picard et al. Cell 54: 1073-1080 (1988).

Potrykus et al., Mol. Gene. Gent. 199: 169-177

Reich et al., Biotechnology 4: 1001-1004 (1986).

Riggs et al., Proc. Nati. Acad. Sci. USA 83: 5602-5606 (1986).

Rogers et al., Proc. Nati. Acad. Sci. USA 82: 6512-6516 (1985) Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993) Rothstein et al., Gen. 53: 153-161 (1987)

Ryals et al., Plant Cell 8: 1809-1819 (1996).

Ryals et al., Plant Cell 9: 425-439 (1997).

Sambrook et al. Molecular Cloning, eds., Cold Spring Harbor Laboratory Press (1989)

Sanford et al., Particulate Science and Technology 5: 27-37 (1987) Schmidhauser & Helinski, J. Bacteriol. 164: 446-455 (1985) Schocher et al., Biotechnology 4: 1093-1096 (1986).

Shimamoto et al., Nature 338: 274-277 (1989)

Shinshi et al., Plant Molec. Biol. 14: 357-368 (1990).

Shulaev et al. Plant Cell 7: 1691-1701 (1995).

Cross-eyed, et al. , Experimente with Gen Fusions, eds., Cold

Spring Harbor Laboratory Press

Singh, D.P., Breeding for Resistance to Diseases, and Insect Pests, Springer-Verlag, NY (1986)

Skuzeski et al., Plant Molec. Biol. 15: 65-79

Somers et al., Bio / Technology 10: 1589-1594 (1992).

Spencer et al., Theor. Appl. Gent. 79: 625-631 (1990).

Stanford et al., Mol. Gene. Gent. 215: 200-208

Svab et al., Proc. Nati. Acad. Sci. USA 87: 8526-8530 (1990).

Taylor et al., Plant Cell Rep. 12: 491-495

Thompson et al. EMBO J. 6: 2519-2523 (1987).

Torbert et al., Plant Cell Reports 14: 635-640 (1995). Triezenberg et al., Gens Devel. 2: 718-729

Uknes et al., Plant Cell 4: 645-656 (1992).

Uknes et al. Plant Cell 5: 159-169 (1993).

Uknes et al., Molecular Plant Microbe Interactions 6: 680-685 (1993).

Uknes et al., Mol. Plant-Microbe Interact. 6: 692-698

Umbeck et al., Bio / Technology 5: 263-266 (1987).

Unger et al., Plant Molec. Biol. 13: 411-418 (1989) van den Broeck, et al., Nature 313: 358-363 (1985).

Vasil et al., Biotechnology 10: 667-674 (1992).

Vasil et al., Biotechnology 11: 1553-1558 (1993).

Vernooij et al., Plant Cell 6: 959-965 (1994).

Vernooij et al., Mol. Plant-Microbe Interact. 8: 228-234 (1995).

Von Heijne et al., Plant Mol. Biol. Rep. 9: 104-126 (1991) Vorst et al., Gen. 65: 59 (1988)

Wan et al., Plant Physiol. 104: 37-48

Ward et al., Plant Cell 3: 1085-1094 (1991).

Warner et al., Plant J. 3:

Wasmann et al., Mol. Gene. Gent. 205: 446-453 (1986).

Weeks et al., Plant Physiol. 102: 1077-1084 (1993) Weissinger et al. Gent. 22: 421-477 (1988) Welsh J.R.

191-201

Fundamentals of Plant Gentics and Breeding, John Wiley & Sons, NY (1981)

Weymann et al., Plant Cell 7: 2013-2022 (1995).

White et al., Nucl. Acids Res. 18: 1062 (1990) Wood D.R. (Ed.) Crop Breeding,

Madison, Wisconsin (1983) Wricke and Weber, Quantitative

Breeding by Walter de Gruyter

Xu et al., Plant Molec. Biol. 22: 573-588 (1993).

Zhang et al., Plant Cell Rep. 7: 379-384 (1988).

American Society of Agronomy

Gentics and Selection Plant and Co., Berlin (1986)

• · · · ·

SEQUENCE LIST <160> 74 <170> PatentIn Ver. 2.1 <210> 1 <211> 1767 <212> DNA <213> Nicotiana tabacum <220>

<221> CDS <222> (1) .. (1764) <223> Full-length cDNA sequence, tobacco <400> 1

atg gat aat Asn agt Ser agg Arg 5 act gcg ttt tet gat Ser Asp 10 tcg aat Ser Asn gac atc agc gga 48 Met 1 Asp Thr Ala Phe Asp Ile Ser 15 Dec Gly agc agt agt ata tgc tgc atc ggc ggc ggc atg act gaa ttt ttc tcg 96 Ser Ser Ser Ile Cys Cys Ile Gly Gly Gly Met Thr Glu Phe Phe Ser 20 May 25 30 ccg gag act tcg ccg gcg gag atc act tea ctg aaa ege cta tcg gaa 144 For Glu Thr Ser For Ala Glu Ile Thr Ser Leu Lys Arg Leu Ser Glu 35 40 45 aca ctg gaa tet atc ttc gat gcg tet ttg ccg gag ttt gac tray ttc 192 Thr Leu Glu Ser Ile Phe Asp Ala Ser Leu For Glu Phe Asp Tyr Phe 50 55 60 gcc gac gct aag ctt gtg gtt tcc ggc ccg tgt aag gaa att ccg gtg 240 Ala Asp Ala Lys Leu Wall Wall Ser Gly For Cys Lys Glu Ile For Wall 65 70 75 80 cac cgg tgc att ttg tcg gcg agg agt ccg ttc ttt aag aat ttg ttc 288 His Arg Cys Ile Leu Ser Ala Arg Ser For Phe Phe Lys Asn Leu Phe 85 90 95 tgc ggt aaa aag gag aag aat agt agt aag gtg gaa ttg aag gag gtg 336 Cys Gly Lys Lys Glu Lys Asn Ser Ser Lys Wall Glu Leu Lys Glu Wall 100 ALIGN! 105 110 atg aaa gag cat gag gtg agc melt gat gct gta atg agt gta ttg gct 384 Met Lys Glu His Glu Wall Ser Tyr Asp Ala Wall Met Ser Wall Leu Ala 115 120 125 melt ttg melt agt ggt aaa gtt agg cct tea cct aaa gat gtg tgt gtt 432 Tyr Leu Tyr Ser Gly Lys Wall Arg For Ser For Lys Asp Wall Cys Wall 130 135 140

tgt gg gac Asat Asp tgc Cys 150 tet Ser cat gtr His Val Ala tgt agg approx gct gtg gca Ala 160 480 Cys 145 Val Asp Cys 155 Arg For Ala Wall ttc ctg gtt gag gtt ttg tray aca tea ttt acc ttt cag atc tet gaa 528 Phe Leu Wall Glu Wall Leu Tyr Thr Ser Phe Thr Phe Gin Ile Ser Glu 165 170 175 ttg gtt gac aag ttt cag aga cac cta ctg gat att ctt gac aaa act 576 Leu Wall Asp Lys Phe Gin Arg His Leu Leu Asp Ile Leu Asp Lys Thr 180 185 190 gca gca gac gat gta atg atg gtt tta tet gtt gca aac att tgt ggt 624 Ala Ala Asp Asp Wall Met Met Wall Leu Ser Wall Ala Asn Ile Cys Gly 195 200 205 aaa gca tgc gag aga ttg ctt tea agc tgc att gag att att gtc aag 672 Lys Ala Cys Glu Arg Leu Leu Ser Ser Cys Ile Glu Ile Ile Wall Lys 210 215 220 tet aat gtt gat atc ata acc ctt gat aaa gcc ttg cct cat gac att 720 Ser Asn Wall Asp Ile Ile Thr Leu Asp Lys Ala Leu For His Asp Ile 225 230 235 240 gta aaa caa att act gat tea ega gcg gaa ctt ggt cta caa ggg cct 768 Wall Lys Gin Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gin Gly For 245 250 255 gaa agc aac ggt ttt cct gat aaa cat gtt aag agg ata cat agg gca 816 Glu Ser Asn Gly Phe For Asp Lys His Wall Lys Arg Ile His Arg Ala 260 265 270 ttg gat tet gat gat gtt gaa tta cta caa atg ttg cta aga gag ggg 864 Leu Asp Ser Asp Asp Wall Glu Leu Leu Gin Met Leu Leu Arg Glu Gly 275 280 285 cat act acc cta gat gat gca melt gct ctc cat melt gct gta gcg melt 912 His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Wall Ala Tyr 290 295 300 tgc gat gca aag act aca gca gaa ctt cta gat ctt gca ctt gct gat 960 Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ala Leu Ala Asp 305 310 315 320 att aat cat caa aat tea agg gga tray acg gtg ctg cat gtt gca gcc 1008 Ile Asn His Gin Asn Ser Arg Gly Tyr Thr Wall Leu His Wall Ala Ala 325 330 335 atg agg aaa gag cct aaa att gta gtg tcc ctt tta acc aaa gga gct 1056 Met Arg Lys Glu For Lys Ile Wall Wall Ser Leu Leu Thr Lys Gly Ala 340 345 350

«· • ·

aga cct tet gat Ser Asp 355 ctg aca tcc gat gga aga aaa gca ctt caa Gin atc Ile gcc Ala 1104 Arg For Leu Thr Ser Asp Gly 360 Arg Lys Ala Leu 365 aag agg ctc act agg ctt gtg gat ttc agt aag tet ccg gag gaa gga 1152 Lys Arg Leu Thr Arg Leu Wall Asp Phe Ser Lys Ser For Glu Glu Gly 370 375 380 aaa tet gct tcg aat gat cgg tta tgc att gag att ctg gag caa gca 1200 Lys Ser Ala Ser Asn Asp Arg Leu Cys Ile Glu Ile Leu Glu Gin Ala 385 390 395 400 gaa aga aga gac cct ctg cta gga gaa gct tet gta tet ctt gct atg 1248 Glu Arg Arg Asp For Leu Leu Gly Glu Ala Ser Wall Ser Leu Ala Met 405 410 415 gca ggc gat gat ttg cgt atg aag ctg tta tray ctt gaa aat aga gtt 1296 Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Wall 420 425 430 ggc ctg gct aaa ctc ctt ttt approx atg gaa gct aaa gtt gca atg gac 1344 Gly Leu Ala Lys Leu Leu Phe For Met Glu Ala Lys Wall Ala Met Asp 435 440 445 att gct caa gtt gat ggc act tet gag ttc approx ctg gct age atc ggc 1392 Ile Ala Gin Wall Asp Gly Thr Ser Glu Phe For Leu Ala Ser Ile Gly 450 455 460 aaa aag atg gct aat gca cag agg aca aca gta gat ttg aac gag gct 1440 Lys Lys Met Ala Asn Ala Gin Arg Thr Thr Wall Asp Leu Asn Glu Ala 465 470 475 480 cct ttc aag ata aaa gag gag cac ttg aat cgg ctt aga gca ctc tet 1488 For Phe Lys Ile Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser 485 490 495 aga act gta gaa ctt gga aaa ege ttc ttt approx cgt tgt tca gaa gtt 1536 Arg Thr Wall Glu Leu Gly Lys Arg Phe Phe For Arg Cys Ser Glu Wall 500 505 510 cta aat aag atc atg gat gct gat gac ttg tet gag ata gct tray atg 1584 Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met 515 520 525 ggg aat gat acg gca gaa gag cgt caa ctg aag aag caa agg tray atg 1632 Gly Asn Asp Thr Ala Glu Glu Arg Gin Leu Lys Lys Gin Arg Tyr Met 530 535 540 gaa ctt caa gaa att ctg act aaa gca ttc act gag gat aaa gaa gaa 1680 Glu Leu Gin Glu Ile Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu 545 550 555 560

• · · · · · · · · ·

tat Tyr gat Asp aag Lys act Thr aac Asn 566 aac Asn atc Ile tcc Ser tca Ser tet Ser 570 tgt Cys tcc Ser tet Ser aca Thr tet Ser 575 aag Lys 1728 gga gta gat aag ccc aat aag ctc cct ttt agg aaa tag 1767 Gly Wall Asp Lys For Asn Lys Leu For Phe Arg Lys

580 585 <210> 2 <211> 588 <212> PRT <213> - Nicotiana tabacum

<400> 2 Arg 5 Thr Ala Phe Ser Asp 10 Ser Asn Asp Ile Ser Gly 15 Dec Met 1 Asp Asn Ser Ser Ser Ser Ile Cys Cys Ile Gly Gly Gly Met Thr Glu Phe Phe Ser 20 May 25 30 For Glu Thr Ser For Ala Glu Ile Thr Ser Leu Lys Arg Leu Ser Glu 35 40 45 Thr Leu Glu Ser Ile Phe Asp Ala Ser Leu For Glu Phe Asp Tyr Phe 50 55 60 Ala Asp Ala Lys Leu Wall Wall Ser Gly For Cys Lys Glu Ile For Wall 65 70 75 80 His Arg Cys Ile Leu Ser Ala Arg Ser For Phe Phe Lys Asn Leu Phe 85 90 95 Cys Gly Lys Lys Glu Lys Asn Ser Ser Lys Wall Glu Leu Lys Glu Wall 100 ALIGN! 105 110 Met Lys Glu His Glu Wall Ser Tyr Asp Ala Wall Met Ser Wall Leu Ala 115 120 125 Tyr Leu Tyr Ser Gly Lys Wall Arg For Ser For Lys Asp Wall Cys Wall 130 135 140 Cys Wall Asp Asn Asp Cys Ser His Wall Ala Cys Arg For Ala Wall Ala 145 150 155 160 Phe Leu Wall Glu Wall Leu Tyr Thr Ser Phe Thr Phe Gin Ile Ser Glu 165 170 175 Leu Wall Asp Lys Phe Gin Arg His Leu Leu Asp Ile Leu Asp Lys Thr 180 185 190 Ala Ala Asp Asp Wall Met Met Wall Leu Ser Wall Ala Asn Ile Cys Gly 195 200 205

φ φ · · «· · · · · φ · · · · ·

Lys Ala Cys Glu Arg Leu Leu 215 Ser Ser Cys Ile Glu 220 Ile Ile Wall Lys 210 Ser Asn Wall Asp Ile Ile Thr Leu Asp Lys Ala Leu For His Asp Ile 225 230 235 240 Wall Lys Gin Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gin Gly For 245 250 255 Glu Ser Asn Gly Phe For Asp Lys His Wall Lys Arg Ile His Arg Ala 260 265 270 Leu Asp Ser Asp Asp Wall Glu Leu Leu Gin Met Leu Leu Arg Glu Gly 275 280 285 His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Wall Ala Tyr 290 295 300 Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ala Leu Ala Asp 305 310 315 320 Ile Asn His Gin Asn Ser Arg Gly Tyr Thr Wall Leu His Wall Ala Ala 325 330 335 Met Arg Lys Glu For Lys Ile Wall Wall Ser Leu Leu Thr Lys Gly Ala 340 345 350 Arg For Ser Asp Leu Thr Ser Asp Giy Arg Lys Ala Leu Gin Ile Ala 355 360 365 Lys Arg Leu Thr Arg Leu Wall Asp Phe Ser Lys Ser For Glu Glu Gly 370 375 380 Lys Ser Ala Ser Asn Asp Arg Leu Cys Ile Glu Ile Leu Glu Gin Ala 385 390 395 400 Glu Arg Arg Asp For Leu Leu Gly Glu Ala Ser Wall Ser Leu Ala Met 405 410 415 Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Wall 420 425 430 Gly Leu Ala Lys Leu Leu Phe For Met Glu Ala Lys Wall Ala Met Asp 435 440 445 Ile Ala Gin Wall Asp Gly Thr Ser Glu Phe For Leu Ala Ser Ile Gly 450 455 460 Lys Lys Met Ala Asn Ala Gin Arg Thr Thr Wall Asp Leu Asn Glu Ala 465 470 475 480 For Phe Lys Ile Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser 485 490 495

• Φ

9 Φ • 9

Φ Φ Φ Φ

Arg Thr Val Glu 500 Leu Gly Lys Arg Phe 505 Phe For Arg Cys Ser 510 Glu Wall Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met 515 520 525 Gly Asn Asp Thr Ala Glu Glu Arg Gin Leu Lys Lys Gin Arg Tyr Met 530 535 540 Glu Leu Gin Glu Ile Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu 545 550 555 560 Tyr Asp Lys Thr Asn Asn Ile Ser Ser Ser Cys Ser Ser Thr Ser Lys 565 570 575 Gly Wall Asp Lys For Asn Lys Leu For Phe Arg Lys 580 585

<210> 3 <211> 1732 <212> DNA <213> bycopersicon esculentum <220>

<221> CDS <222> (2). . (1728) <223> full-length cDNA sequence, tomato <400> 3

atg Met 1 gat Asp agt Ser aga Arg act Thr 5 gct Ala ttt Phe tcg gat Ser Asp tcc Ser 10 aat gat Asn Asp att Ile agt gga Ser Gly 15 Dec agc Ser 48 agt agt ata tgc tgc atg aac gaa tcg gaa act tea ctg gca gac gtc 96 Ser Ser Ile Cys Cys Met Asn Glu Ser Glu Thr Ser Leu Ala Asp Wall 20 May 25 30 aat tcc ctc aaa cgt cta tea gaa aca cta gag tet atc ttc gat gcg 144 Asn Ser Leu Lys Arg Leu Ser Glu Thr Leu Glu Ser Ile Phe Asp Ala 35 40 45 tet gcg ccg gat ttc gac ttc ttc gct gat gct aag ctt ctg gct approx 192 Ser Ala For Asp Phe Asp Phe Phe Ala Asp Ala Lys Leu Leu Ala For 50 55 60 ggc ggt aag gaa att ccg gtg cat cgg tgc att ttg tcg gcg agg agt 240 Gly Gly Lys Glu Ile For Wall His Arg Cys Ile Leu Ser Ala Arg Ser 65 70 75 80 cct ttt ttt aag aat gta ttc tgt ggg aaa gat agc agc acg aag ctg 288 For Phe Phe Lys Asn Wall Phe Cys Gly Lys Asp Ser Ser Thr Lys Leu 85 90 95

gaa ctc aaa gag ctg ata aaa gag tat gag gtg agt Ser ttt Phe gat Asp 110 gcc Ala gtg Val 336 Glu Leu Lys Glu 100 ALIGN! Leu Met Lys Glu Tyr 105 Glu Wall gtc agt gtg ctc gcc melt ttg melt agt gga aaa gtt agg cct gca tet 384 Wall Ser Wall Leu Ala Tyr Leu Tyr Ser Gly Lys Wall Arg For Ala Ser 115 120 125 aaa gat gtg tgt gtt tgt gtg gac aat gag tgc ttg cat gta gct tgt 432 Lys Asp Wall Cys Wall Cys Wall Asp Asn Glu Cys Leu His Wall Ala Cys 130 135 140 agg approx gct gtg gcc ttc atg gtt cag gtt ttg tray gca tcc ttt acc 480 Arg For Ala Wall Ala Phe Met Wall Gin Wall Leu Tyr Ala Ser Phe Thr 145 150 155 160 ttt cag atc tet caa ttg gtc gac aag ttt cag aga cac cta ttg gat 528 Phe Gin Ile Ser Gin Leu Wall Asp Lys Phe Gin Arg His Leu Leu Asp 165 170 175 att ctt gac aaa gct gta gca gat gat gta atg atg gtt tta tcc gtt 576 Ile Leu Asp Lys Ala Wall Ala Asp Asp Wall Met Met Wall Leu Ser Wall 180 185 190 gca aac att tgc ggt aaa gca tgt gaa aga tta ctt tca aga tgc att 624 Ala Asn Ile Cys Gly Lys Ala Cys Glu Arg Leu Leu Ser Arg Cys Ile 195 200 205 gat att att gtc aag tet aat gtt gat atc ata acc ctt gat aag tcc 672 Asp Ile Ile Wall Lys Ser Asn Wall Asp Ile Ile Thr Leu Asp Lys Ser 210 215 220 ttg cct cat gac att gta aaa caa atc act gat tca cgt gct gaa ctt 720 Leu For His Asp Ile Wall Lys Gin Ile Thr Asp Ser Arg Ala Glu Leu 225 230 235 240 ggt ctg caa ggg cct gaa agc aat ggt ttt cct gat aaa cat gtt aag 768 Gly Leu Gin Gly For Glu Ser Asn Gly Phe For Asp Lys His Wall Lys 245 250 255 agg ata cat aga gca ttg gac tet gat gat gtt gaa tta cta agg atg 816 Arg Ile His Arg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu Arg Met 260 265 270 ttg ctt aaa gag ggg cat act act ctt gat gat gca melt gct ctc cac 864 Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His 275 280 285 melt gct gta gca melt tgc gat gca aag act aca gca gaa ctt tta gat 912 Tyr Ala Wall Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp 290 295 300

φφφφ

ctt Leu 305 tea Ser ctt Leu get Ala gat Asp gtt Wall 310 aat Asn cat His caa Gin aat Asn cct For 315 aga Arg gga Gly cac His acg Thr gta Wall 320 960 ctt cat gtt get gcc atg agg aaa gaa cct aaa att ata gtg tcc ctt 1008 Leu His Wall Ala Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu 325 330 335 tta acc aaa gga get aga cct tet gat ctg aca tcc gat ggc aaa aaa 1056 Leu Thr Lys Gly Ala Arg For Ser Asp Leu Thr Ser Asp Gly Lys Lys 340 345 350 gca ctt caa att get aag agg ctc act agg ctt gta gat ttt acc aag 1104 Ala Leu Gin Ile Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe Thr Lys 355 360 365 tet aca gag gaa gga aaa tet get approx aag gat cgg tta tgc att gag 1152 Ser Thr Glu Glu Gly Lys Ser Ala For Lys Asp Arg Leu Cys Ile Glu 370 375 380 att ctg gag caa gca gaa aga aga gat approx cta cta gga gaa get tea 1200 Ile Leu Glu Gin Ala Glu Arg Arg Asp For Leu Leu Gly Glu Ala Ser 385 390 395 400 tta tet ctt get atg gca ggc gat gat ttg cgt atg aag ctg tta tray 1248 Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr 405 410 415 ctt gaa aat aga gtt ggt ctg get aaa ctc ctt ttt ccc atg gaa gca 1296 Leu Glu Asn Arg Wall Gly Leu Ala Lys Leu Leu Phe For Met Glu Ala 420 425 430 aaa gtt gca atg gac att gca caa gtt gat ggc acg tet gaa tta ccc 1344 Lys Wall Ala Met Asp Ile Ala Gin Wall Asp Gly Thr Ser Glu Leu For 435 440 445 ctg get agc atg agg aag aag ata get gat gca cag agg aca aca gtg 1392 Leu Ala Ser Met Arg Lys Lys Ile Ala Asp Ala Gin Arg Thr Thr Wall 450 455 460 gat ttg aac gag get cct ttc aag atg aaa gag gag cac ttg aat cgg 1440 Asp Leu Asn Glu Ala For Phe Lys Met Lys Glu Glu His Leu Asn Arg 465 470 475 480 ctt agg get ctc tet aga act gtg gaa ctt gga aaa cgg ttc ttt approx 1488 Leu Arg Ala Leu Ser Arg Thr Wall Glu Leu Gly Lys Arg Phe Phe For 485 490 495 cgt tgt tea gaa gtt cta aat aag atc atg gat get gat gac ttg tet 1536 Arg Cys Ser Glu Wall Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser 500 505 510

gag ata get Ala 515 tac Tyr atg Met ggg aat gat Asp 520 aca gta ga gag cgt caa Gin ctg aag 1584 Glu Ile Gly Asn Thr Wall Glu Glu Arg 525 Leu Lys aag caa agg tray atg gaa ctt caa gaa att ttg tet aaa gca ttc acg 1632 Lys Gin Arg Tyr Met Glu Leu Gin Glu Ile Leu Ser Lys Ala Phe Thr 530 535 540 gag gat aaa gaa gaa ttt get aag act aac atg tec tea tet tgt tcc 1680 Glu Asp Lys Glu Glu Phe Ala Lys Thr Asn Met Ser Ser Ser Cys Ser 545 550 555 560 tet aca tet aag gga gta gat aag ccc aat aat ctc approx ttt agg aaa 1728 Ser Thr Ser Lys Gly Wall Asp Lys For Asn Asn Leu For Phe Arg Lys 565 570 575

tag

1731 <210> 4 <211> 576 <212> PRT <213> - Lycopersicon esculentum

<400> 4 Ser Asp Ser Asn Asp 10 Ile Ser Gly 15 Dec Ser Met 1 Asp Ser Arg Thr 5 Ala Phe Ser Ser Ile Cys Cys Met Asn Glu Ser Glu Thr Ser Leu Ala Asp Wall 20 May 25 30 Asn Ser Leu Lys Arg Leu Ser Glu Thr Leu Glu Ser Ile Phe Asp Ala 35 40 45 Ser Ala For Asp Phe Asp Phe Phe Ala Asp Ala Lys Leu Leu Ala For 50 55 60 Gly Gly Lys Glu Ile For Wall His Arg Cys Ile Leu Ser Ala Arg Ser 65 70 75 80 For Phe Phe Lys Asn Wall Phe Cys Gly Lys Asp Ser Ser Thr Lys Leu 85 90 95 Glu Leu Lys Glu Leu Met Lys Glu Tyr Glu Wall Ser Phe Asp Ala Wall 100 ALIGN! 105 110 Wall Ser Wall Leu Ala Tyr Leu Tyr Ser Gly Lys Wall Arg For Ala Ser 115 120 125 Lys Asp Wall Cys Wall Cys Wall Asp Asn Glu Cys Leu His Wall Ala Cys 130 135 140 Arg For Ala Wall Ala Phe Met Wall Gin Wall Leu Tyr Ala Ser Phe Thr 145 150 155 160

Phe Gin Ile Ser Gin 165 Leu Val Asp Lys Phe 170 Gin Arg His Leu Leu 175 Asp Ile Leu Asp Lys Ala Wall Ala Asp Asp Wall Met Met Wall Leu Ser Wall 180 185 190 Ala Asn Ile Cys Gly Lys Ala Cys Glu Arg Leu Leu Ser Arg Cys Ile 195 200 205 Asp Ile Ile Wall Lys Ser Asn Wall Asp Ile Ile Thr Leu Asp Lys Ser 210 215 220 Leu For His Asp Ile Wall Lys Gin Ile Thr Asp Ser Arg Ala Glu Leu 225 230 235 240 Gly Leu Gin Gly For Glu Ser Asn Gly Phe For Asp Lys His Wall Lys 245 250 255 Arg Ile His Arg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu Arg Met 260 265 270 Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His 275 280 285 Tyr Ala Wall Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp 290 295 300 Leu Ser Leu Ala Asp Wall Asn His Gin Asn For Arg Gly His Thr Wall 305 310 315 320 Leu His Wall Ala Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu 325 330 335 Leu Thr Lys Gly Ala Arg For Ser Asp Leu Thr Ser Asp Gly Lys Lys 340 345 350 Ala Leu Gin Ile Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe Thr Lys 355 360 365 Ser Thr Glu Glu Gly Lys Ser Ala For Lys Asp Arg Leu Cys Ile Glu 370 375 380 Ile Leu Glu Gin Ala Glu Arg Arg Asp For Leu Leu Gly Glu Ala Ser 385 390 395 400 Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr 405 410 415 Leu Glu Asn Arg Wall Gly Leu Ala Lys Leu Leu Phe For Met Glu Ala 420 425 430 Lys Wall Ala Met Asp Ile Ala Gin Wall Asp Gly Thr Ser Glu Leu For 435 440 445

·

Leu Ala 450 Ser Met Arg Lys Lys 455 Ile Ala Asp Ala Gin Arg 460 Thr Thr Wall Asp Leu Asn Glu Ala For Phe Lys Met Lys Glu Glu His Leu Asn Arg 465 470 475 480 Leu Arg Ala Leu Ser Arg Thr Wall Glu Leu Gly Lys Arg Phe Phe For 485 490 495 Arg Cys Ser Glu Wall Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser 500 505 510 Glu Ile Ala Tyr Met Gly Asn Asp Thr Wall Glu Glu Arg Gin Leu Lys 515 520 525 Lys Gin Arg Tyr Met Glu Leu Gin Glu Ile Leu Ser Lys Ala Phe Thr 530 535 540 Glu Asp Lys Glu Glu Phe Ala Lys Thr Asn Met Ser Ser Ser Cys Ser 545 550 555 560 Ser Thr Ser Lys Gly Wall Asp Lys For Asn Asn Leu For Phe Arg Lys 565 570 575

<210> 5 <211> 1740 <212> DNA <213> Brassica napus

<221> CDS <222> (1) .. (1737) <223> canola cDNA sequence <400> 5

atg gag acc Thr att Ile gct Ala 5 rga Xaa ttt Phe gat Asp gat Asp ttc Phe 10 melt Tyr gag Glu atc Ile agc Ser agc Ser 15 Dec act Thr 48 Met 1 Glu agc ttc cyc gcc gca ccg gcg approx acc gat aac tcc gga tca tcc acc 96 Ser Phe Xaa Ala Ala For Ala For Thr Asp Asn Ser Gly Ser Ser Thr 20 May 25 30 gtc twc ccg acg gag ctt ytc acc aga ccc gag gta tcc gcg ttt caa 144 Wall Xaa For Thr Glu Leu Xaa Thr Arg For Glu Wall Ser Ala Phe Gin 35 40 45 ctc ctc tcc aac agc ctc gag tcc gtc ttc gac tcg ccg gaa gcg ttc 192 Leu Leu Ser Asn Ser Leu Glu Ser Wall Phe Asp Ser For Glu Ala Phe 50 55 60

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·· ·· ···

tray Tyr 65 ag gac gcc aag ctt gtt Wall ctc Leu tcc gac gac Asp 75 aag Lys gaa gta tcc Ser ttc Phe 80 240 Ser Asp Ala Lys Leu 70 Ser Asp Glu Wall cac cgt tgc att ctc tcg gcg aga agc ctc ttc ttc aag gcc gct ttg 288 His Arg Cys Ile Leu Ser Ala Arg Ser Leu Phe Phe Lys Ala Ala Leu 85 90 95 rca gcc gcc gag aag gtg cag aag tcc acc ccc gtg aag ctc gag ctg 336 Xaa Ala Ala Glu Lys Wall Gin Lys Ser Thr For Wall Lys Leu Glu Leu 100 ALIGN! 105 110 aag aca ctc gcg gcg gaa tray gac gtc ggg ttc gat tet gtg gtg gct 384 Lys Thr Leu Ala Ala Glu Tyr Asp Wall Gly Phe Asp Ser Wall Wall Ala 115 120 125 gtt ctg gcg tray gtt tray agc ggc aga gtg agg ccg cct ccg aag gga 432 Wall Leu Ala Tyr Wall Tyr Ser Gly Arg Wall Arg For For For Lys Gly 130 135 140 gtt tet gaa tgc gca gac gak agc tgc tgc cac gtg gcg tgc cgt ccg 480 Wall Ser Glu Cys Ala Asp Xaa Ser Cys Cys His Wall Ala Cys Arg For 145 150 155 160 gct gtg gat ttc atg gtg gag gtt ctc tray ttg gct ttc gtc ttc cag 528 Ala Wall Asp Phe Met Wall Glu Wall Leu Tyr Leu Ala Phe Wall Phe Gin 165 170 175 att cag gaa ctg gtt acc atg melt cag agg cat tta ctg gat gtt gta 576 Ile Gin Glu Leu Wall Thr Met Tyr Gin Arg His Leu Leu Asp Wall Wall 180 185 190 gac aaa gtt awc ata gaa gac act ttg gtc gtc ctc aag ctt gct aac 624 Asp Lys Wall Xaa Ile Glu Asp Thr Leu Wall Wall Leu Lys Leu Ala Asn 195 200 205 atc tgc ggt aaa gcg tgc aag aag cta ttc gat aag tgc aga gag atc 672 Ile Cys Gly Lys Ala Cys Lys Lys Leu Phe Asp Lys Cys Arg Glu Ile 210 215 220 att gtc aag tet aac gtg gat gtt gtt act cta aag aag tea ttg cct 720 Ile Wall Lys Ser Asn Wall Asp Wall Wall Thr Leu Lys Lys Ser Leu For 225 230 235 240 gag rac att gcc aag caa gta atc gat atc ege aaa gag ctc ggc ttg 768 Glu Xaa Ile Ala Lys Gin Wall Ile Asp Ile Arg Lys Glu Leu Gly Leu 245 250 255 gag gta gct gaa approx gag aaa cat gtc tcc aac ata cac aag gcg ctt 816 Glu Wall Ala Glu For Glu Lys His Wall Ser Asn Ile His Lys Ala Leu 260 265 270

• ·

gag tca gac gat Asp ctt Leu gac Asp ctt Leu gtc gtt atg Met ctt Leu ttg Leu aaa gag ggc Gly cac His 864 Glu Ser Asp 275 Wall 280 Wall Lys 285 Glu acg aat cta gac gaa gcg melt gct ctc cat ttt gct gtt gcg melt tgc 912 Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Wall Ala Tyr Cys 290 295 300 gat gag aag aca gcg agg aat ctc ctg gaa ctg ggg ttt gcg gat gtc 960 Asp Glu Lys Thr Ala Arg Asn Leu Leu Glu Leu Gly Phe Ala Asp Wall 305 310 315 320 aac cgg aga aac ccg aga ggg tray acg gta att cac gtc gct gcg atg 1008 Asn Arg Arg Asn For Arg Gly Tyr Thr Wall Ile His Wall Ala Ala Met 325 330 335 agg aaa gag ccg aca ctg ata gca ttg ttg ttg acg aaa ggg gct aat 1056 Arg Lys Glu For Thr Leu Ile Ala Leu Leu Leu Thr Lys Gly Ala Asn 340 345 350 gca tta gaa atg tet ttg gac ggg aga act gct ctg ttg atc gcg aaa 1104 Ala Leu Glu Met Ser Leu Asp Gly Arg Thr Ala Leu Leu Ile Ala Lys 355 360 365 caa gtc act aag gcg gcc gag tgt tgt att ctg gag aaa ggg aag tta 1152 Gin Wall Thr Lys Ala Ala Glu Cys Cys Ile Leu Glu Lys Gly Lys Leu 370 375 380 gct gcc aaa ggc gga gta tgt gta gag ata ctc aag caa approx gac aac 1200 Ala Ala Lys Gly Gly Wall Cys Wall Glu Ile Leu Lys Gin For Asp Asn 385 390 395 400 aca ega gaa approx ttt cct gaa gat gtt tet ccc tcc ctt gca gtg gct 1248 Thr Arg Glu For Phe For Glu Asp Wall Ser For Ser Leu Ala Wall Ala 405 410 415 gct gat caa ttc aag ata agg ttg att gat ctt gaa aac aga gtt caa 1296 Ala Asp Gin Phe Lys Ile Arg Leu Ile Asp Leu Glu Asn Arg Wall Gin 420 425 430 atg gct ega tgt ctc melt approx atg gaa gca caa gtt gca atg gat ttc 1344 Met Ala Arg Cys Leu Tyr For Met Glu Ala Gin Wall Ala Met Asp Phe 435 440 445 gcc ega atg aag gga aca ege gag ttt gtc gtg acg aca gca act gac 1392 Ala Arg Met Lys Gly Thr Arg Glu Phe Wall Wall Thr Thr Ala Thr Asp 450 455 460 cta cac atg gaa cct ttc aag ttc gta gaa atg cat cag agt aga cta 1440 Leu His Met Glu For Phe Lys Phe Wall Glu Met His Gin Ser Arg Leu 465 470 475 480

• ·

aca Thr gcg Ala ctt Leu tet Ser aaa Lys 485 act Thr gtg gaa ttc Phe ggg aaa ege Arg ttc Phe ttc Phe approx For 495 ege Arg 1488 Wall Glu Gly 490 Lys tgt tcg aaa gtg ctc gat gat att gtg gac tet gag gac ttg act ata 1536 Cys Ser Lys Wall Leu Asp Asp Ile Wall Asp Ser Glu Asp Leu Thr Ile 500 505 510 ctg gct ctc gta gaa gaa gac act cct gag caa ega caa caa aag agg 1584 Leu Ala Leu Wall Glu Glu Asp Thr For Glu Gin Arg Gin Gin Lys Arg 515 520 525 cag agg ttc atg gaa ata cag gag att gtt caa atg gcg ttt agt aaa 1632 Gin Arg Phe Met Glu Ile Gin Glu Ile Wall Gin Met Ala Phe Ser Lys 530 535 540 gac aag gag gat ctt gga aag tcg tet ctc tea gct tcg tet tet tcc 1680 Asp Lys Glu Asp Leu Gly Lys Ser Ser Leu Ser Ala Ser Ser Ser Ser 545 550 555 560 aca tcc aaa tta act ggt aaa aag agg tet att gct aaa ccc tet cac 1728 Thr Ser Lys Leu Thr Gly Lys Lys Arg Ser Ile Ala Lys For Ser His 565 570 575 cgg cgt cgg tga 1740 Arg Arg Arg

<210> 6 <211> 579 <212> PRT <213> Brassica napus

Met Glu 1 Thr Ile Ala Xaa Phe Asp Asp Phe Tyr Glu Ile Ser Ser 15 Dec Thr 5 10 Ser Phe Xaa Ala Ala For Ala For Thr Asp Asn Ser Gly Ser Ser Thr 20 May 25 30 Wall Xaa For Thr Glu Leu Xaa Thr Arg For Glu Wall Ser Ala Phe Gin 35 40 45 Leu Leu Ser Asn Ser Leu Glu Ser Wall Phe Asp Ser For Glu Ala Phe 50 55 60 Tyr Ser Asp Ala Lys Leu Wall Leu Ser Asp Asp Lys Glu Wall Ser Phe 65 70 75 80 His Arg Cys Ile Leu Ser Ala Arg Ser Leu Phe Phe Lys Ala Ala Leu 85 90 95 Xaa Ala Ala Glu Lys Wall Gin Lys Ser Thr For Wall Lys Leu Glu Leu 100 ALIGN! 105 110

· Φ φ et et et et et et et et et et et et et et et et et et et et et et et et et et et φφ

Lys Thr Leu Ala Ala Glu Tyr Asp Val Gly Phe Asp Ser Wall Wall Ala 115 120 125 Wall Leu Ala Tyr Wall Tyr Ser Gly Arg Wall Arg For For For Lys Gly 130 135 140 Wall Ser Glu Cys Ala Asp Xaa Ser Cys Cys His Wall Ala Cys Arg For 145 150 155 160 Ala Wall Asp Phe Met Wall Glu Wall Leu Tyr Leu Ala Phe Wall Phe Gin 165 170 175 Ile Gin Glu Leu Wall Thr Met Tyr Gin Arg His Leu Leu Asp Wall Wall 180 185 190 Asp Lys Wall Xaa Ile Glu Asp Thr Leu Wall Wall Leu Lys Leu Ala Asn 195 200 205 Ile Cys Gly Lys Ala Cys Lys Lys Leu Phe Asp Lys Cys Arg Glu Ile 210 215 220 Ile Wall Lys Ser Asn Wall Asp Wall Wall Thr Leu Lys Lys Ser Leu For 225 230 235 240 Glu Xaa Ile Ala Lys Gin Wall Ile Asp Ile Arg Lys Glu Leu Gly Leu 245 250 255 Glu Wall Ala Glu For Glu Lys His Wall Ser Asn Ile His Lys Ala Leu

260 265 270

Glu Ser Asp Leu Asp Leu Val Val Met Leu Leu

275 280285

Thr Asn Leu Asp Glu Ala Tyr Ala 295 Leu His Phe Ala 300 Wall Ala Tyr Cys 290 Asp Glu Lys Thr Ala Arg Asn Leu Leu Glu Leu Gly Phe Ala Asp Wall 305 310 315 320 Asn Arg Arg Asn For Arg Gly Tyr Thr Wall Ile His Wall Ala Ala Met 325 330 335 Arg Lys Glu For Thr Leu Ile Ala Leu Leu Leu Thr Lys Gly Ala Asn 340 345 350 Ala Leu Glu Met Ser Leu Asp Gly Arg Thr Ala Leu Leu Ile Ala Lys 355 360 365 Gin Wall Thr Lys Ala Ala Glu Cys Cys Ile Leu Glu Lys Gly Lys Leu 370 375 380 Ala Ala Lys Gly Gly Wall Cys Wall Glu Ile Leu Lys Gin For Asp Asn 385 390 395 400

»♦ · « 9 * • · 4 • • • a and a • · • 4 * « • and a • and • · • 4 A · • • » and • · • · 4 and • and a ·· * · ·· 99 ··

Thr Arg Glu Pro Phe 405 For Glu Asp Wall Ser Pro 410 Ser Leu Ala Wall 415 Ala Ala Asp Gin Phe Lys Ile Arg Leu Ile Asp Leu Glu Asn Arg Wall Gin 420 425 430 Met Ala Arg Cys Leu Tyr For Met Glu Ala Gin Wall Ala Met Asp Phe 435 440 445 Ala Arg Met Lys Gly Thr Arg Glu Phe Wall Wall Thr Thr Ala Thr Asp 450 455 460 Leu His Met Glu For Phe Lys Phe Wall Glu Met His Gin Ser Arg Leu 465 470 475 480 Thr Ala Leu Ser Lys Thr Wall Glu Phe Gly Lys Arg Phe Phe For Arg 485 490 495 Cys Ser Lys Wall Leu Asp Asp Ile Wall Asp Ser Glu Asp Leu Thr Ile 500 505 510 Leu Ala Leu Wall Glu Glu Asp Thr For Glu Gin Arg Gin Gin Lys Arg 515 520 525 Gin Arg Phe Met Glu Ile Gin Glu Ile Wall Gin Met Ala Phe Ser Lys 530 535 540 Asp Lys Glu Asp Leu Gly Lys Ser Ser Leu Ser Ala Ser Ser Ser Ser 545 550 555 560 Thr Ser Lys Leu Thr Gly Lys Lys Arg Ser Ile Ala Lys For Ser His 565 570 575

Arg Arg Arg <210> 7 <211> 1761 <212> DNA <212> Arabidopsis thaliana <220>

<221> CDS <222> (2). . (1758) <223> AtNMLc5 cDNA sequence <400> 7 atg gct act ttg act gag ca.

0 · 00 • 0 00 00 0 • 0 0 0 • 0 0 0 0 «0 0 0 00 « • · 0 0 0 0 0 0 · 0 0 0 0 0 «00 • 0 0 0 • 0 0 0 0 0 0 0 0 0 00 • 0 00 0 » «* 0 000

100 ALIGN!

cat His ttc Phe tet Ser melt Tyr 20 May ggt Gly tet Ser att ggg tcc Ser 25 aat Asn cac His ttc Phe tea tea agc tea Ser 96 Ile Gly Ser Ser 30 Ser gct tet aat cct gaa gtt gtt agt cta acc aaa ctc agc tcc aat ctt 144 Ala Ser Asn For Glu Wall Wall Ser Leu Thr Lys Leu Ser Ser Asn Leu 35 40 45 gag cag ctt ctt agt aat tea gat tgt gat tray agt gat gca gag atc 192 Glu Gin Leu Leu Ser Asn Ser Asp Cys Asp Tyr Ser Asp Ala Glu Ile 50 55 60 att gtt gat ggt gtt approx gtt ggt gtt cat aga tgc att tta gct gca 240 Ile Wall Asp Gly Wall For Wall Gly Wall His Arg Cys Ile Leu Ala Ala 65 70 75 80 aga agt aag ttt ttc caa gat ttg ttt aag aaa gaa aag aaa att tcg 288 Arg Ser Lys Phe Phe Gin Asp Leu Phe Lys Lys Glu Lys Lys Ile Ser 85 90 95 aaa act gag aaa approx aag melt cag ttg aga gag atg tta cct melt gga 336 Lys Thr Glu Lys For Lys Tyr Gin Leu Arg Glu Met Leu For Tyr Gly 100 ALIGN! 105 110 gct gtt gct cat gaa gct ttc ttg melt ttc ttg agt melt ata melt act 384 Ala Wall Ala His Glu Ala Phe Leu Tyr Phe Leu Ser Tyr Ile Tyr Thr 115 120 125 ggg aga tta aag cct ttt approx ttg gag gtt tcg act tgt gtt gat approx 432 Gly Arg Leu Lys For Phe For Leu Glu Wall Ser Thr Cys Wall Asp For 130 135 140 gtt tgt tet cat gat tgt tgt ega cct gcc att gat ttt gtt gtt caa 480 Wall Cys Ser His Asp Cys Cys Arg For Ala Ile Asp Phe Wall Wall Gin 145 150 155 160 ttg atg melt gct tcc tet gtt ctc caa gtg cct gag cta gtt tea tet 528 Leu Met Tyr Ala Ser Ser Wall Leu Gin Wall For Glu Leu Wall Ser Ser 165 170 175 ttt cag cgg cgg ctt tgt aac ttt gtg gag aag acc ctt gtt gag aat 576 Phe Gin Arg Arg Leu Cys Asn Phe Wall Glu Lys Thr Leu Wall Glu Asn 180 185 190 gtt ctt ccc att ctt atg gtt gct ttc aat tgt aag ttg act cag ctt 624 Wall Leu For Ile Leu Met Wall Ala Phe Asn Cys Lys Leu Thr Gin Leu 195 200 205 ctt gat cag tgt att gag aga gtg gcg agg tea gat ctt tray agg ttc 672 Leu Asp Gin Cys Ile Glu Arg Wall Ala Arg Ser Asp Leu Tyr Arg Phe 210 215 220

101

tgt Cys 225 att Ile gaa Glu aag gaa gtt cct For ccc For gaa Glu gta gca gag Glu aag Lys att Ile aaa Lys cag Gin 240 720 Lys Glu Wall 230 Wall Ala 235 ctt ega ctt ata tcc ccg caa gac gaa gaa acc agt ccc aag att tcg 768 Leu Arg Leu Ile Ser For Gin Asp Glu Glu Thr Ser For Lys Ile Ser 245 250 255 gag aaa ttg ctt gaa aga atc ggt aaa att ctc aag gcc ttg gat tea 816 Glu Lys Leu Leu Glu Arg Ile Gly Lys Ile Leu Lys Ala Leu Asp Ser 260 265 270 gat gat gtt gag ctt gtg aag ctt ctt ttg act gag tea gat atc act 864 Asp Asp Wall Glu Leu Wall Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr 275 280 285 cta gat caa gcc aat ggt ctg cat melt tet gtt gtg melt agt gat ccg 912 Leu Asp Gin Ala Asn Gly Leu His Tyr Ser Wall Wall Tyr Ser Asp For 290 295 300 aaa gtt gtt gcc gag att ctt get ctg gat atg ggt gat gtg aac tray 960 Lys Wall Wall Ala Glu Ile Leu Ala Leu Asp Met Gly Asp Wall Asn Tyr 305 310 315 320 agg aat tcc cgg ggt tray acg gtt ctt cat ttt get gcg atg cgt aga 1008 Arg Asn Ser Arg Gly Tyr Thr Wall Leu His Phe Ala Ala Met Arg Arg 325 330 335 gag approx tcg atc att ata tcg ctt atc gat aaa ggc gcc aat gca tet 1056 Glu For Ser Ile Ile Ile Ser Leu Ile Asp Lys Gly Ala Asn Ala Ser 340 345 350 gag ttt aca tet gac gga ege agc gca gtt aat ata ttg aga aga ctg 1104 Glu Phe Thr Ser Asp Gly Arg Ser Ala Wall Asn Ile Leu Arg Arg Leu 355 360 365 aca aat approx aag gat melt cat acc aaa aca gca aaa ggg cgt gaa tet 1152 Thr Asn For Lys Asp Tyr His Thr Lys Thr Ala Lys Gly Arg Glu Ser 370 375 380 agt aag gcc agg cta tgc atc gat ata ttg gaa aga gaa atc agg aag 1200 Ser Lys Ala Arg Leu Cys Ile Asp Ile Leu Glu Arg Glu Ile Arg Lys 385 390 395 400 aac ccc atg gtt cta gat aca approx atg tgt tcc att tet atg cct gaa 1248 Asn For Met Wall Leu Asp Thr For Met Cys Ser Ile Ser Met For Glu 405 410 415 gat ctc cag atg aga ctg ttg tray cta gaa aag aga gtg ggt ctt get 1296 Asp Leu Gin Met Arg Leu Leu Tyr Leu Glu Lys Arg Wall Gly Leu Ala 420 425 430 cag ttg ttc ttt approx acg gaa get aaa gtg get atg gac att ggt aac 1344 Gin Leu Phe Phe For Thr Glu Ala Lys Wall Ala Met Asp Ile Gly Asn 435 440 445

• ·

102

gta Val gaa ggt Glu Gly 450 aca Thr agt Ser gag Glu ttc Phe 455 aca Thr ggg Gly ttg Leu tea Ser cct For 460 cct For tea Ser agt Ser ggg Gly 1392 tta acc gga aac ttg agt cag gtt gat tta aac gaa act cct cat atg 1440 Leu Thr Gly Asn Leu Ser Gin Wall Asp Leu Asn Glu Thr For His Met 465 470 475 480 caa acc caa aga ctt ctt act cgt atg gtg gct cta atg aaa aca gtt 1488 Gin Thr Gin Arg Leu Leu Thr Arg Met Wall Ala Leu Met Lys Thr Wall 485 490 495 gag act ggt ega agg ttt ttt approx melt ggt tea gag gtt cta gat aag 1536 Glu Thr Gly Arg Arg Phe Phe For Tyr Gly Ser Glu Wall Leu Asp Lys 500 505 510 tray atg gct gag melt ata gac gac gac atc ctc gac gat ttc cat ttt 1584 Tyr Met Ala Glu Tyr Ile Asp Asp Asp Ile Leu Asp Asp Phe His Phe 515 520 525 gag aag gga tet aca cat gaa aga aga ttg aaa aga atg aga melt aga 1632 Glu Lys Gly Ser Thr His Glu Arg Arg Leu Lys Arg Met Arg Tyr Arg 530 535 540 gag ctt aag gat gat gtc caa aag gca melt age aaa gac aaa gag tet 1680 Glu Leu Lys Asp Asp Wall Gin Lys Ala Tyr Ser Lys Asp Lys Glu Ser 545 550 555 560 aag att gcg cgg tet tgt ctt tet gct tea tet tet cct tet tet tet 1728 Lys Ile Ala Arg Ser Cys Leu Ser Ala Ser Ser Ser For Ser Ser Ser 565 570 575 tcc ata aga gat gat ctg cac aac aca aca tga 1761 Ser Ile Arg Asp Asp Leu His Asn Thr Thr 580 585

<210> 8 <211> 586 <212> PRT <213> Arabidopsis thaliana

Met 1 Ala Thr Leu Thr 5 Glu For Ser Ser Ser 10 Leu Ser Phe Thr Ser 15 Dec Ser His Phe Ser Tyr 20 May Gly Ser Ile Gly Ser 25 Asn His Phe Ser Ser 30 Ser Ser Ala Ser Asn For Glu Wall Wall Ser Leu Thr Lys Leu Ser Ser Asn Leu

40 45

Glu Gin Leu Leu Ser Asn Ser

55 60

103

Ile 65 Wall Asp Gly Wall For Val Gly Val His Arg Cys Ile Leu Ala Ala 80 70 75 Arg Ser Lys Phe Phe Gin Asp Leu Phe Lys Lys Glu Lys Lys Ile Ser 85 90 95 Lys Thr Glu Lys For Lys Tyr Gin Leu Arg Glu Met Leu For Tyr Gly 100 ALIGN! 105 110 Ala Wall Ala His Glu Ala Phe Leu Tyr Phe Leu Ser Tyr Ile Tyr Thr 115 120 125 Gly Arg Leu Lys For Phe For Leu Glu Wall Ser Thr Cys Wall Asp For 130 135 140 Wall Cys Ser His Asp Cys Cys Arg For Ala Ile Asp Phe Wall Wall Gin 145 150 155 160 Leu Met Tyr Ala Ser Ser Wall Leu Gin Wall For Glu Leu Wall Ser Ser 165 170 175 Phe Gin Arg Arg Leu Cys Asn Phe Wall Glu Lys Thr Leu Wall Glu Asn 180 185 190 Wall Leu For Ile Leu Met Wall Ala Phe Asn Cys Lys Leu Thr Gin Leu 195 200 205 Leu Asp Gin Cys Ile Glu Arg Wall Ala Arg Ser Asp Leu Tyr Arg Phe 210 215 220 Cys Ile Glu Lys Glu Wall For For Glu Wall Ala Glu Lys Ile Lys Gin 225 230 235 240 Leu Arg Leu Ile Ser For Gin Asp Glu Glu Thr Ser For Lys Ile Ser 245 250 255 Glu Lys Leu Leu Glu Arg Ile Gly Lys Ile Leu Lys Ala Leu Asp Ser 260 265 270 Asp Asp Wall Glu Leu Wall Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr 275 280 285 Leu Asp Gin Ala Asn Gly Leu His Tyr Ser Wall Wall Tyr Ser Asp For 290 295 300 Lys Wall Wall Ala Glu Ile Leu Ala Leu Asp Met Gly Asp Wall Asn Tyr 305 310 315 320 Arg Asn Ser Arg Gly Tyr Thr Wall Leu His Phe Ala Ala Met Arg Arg 325 330 335 Glu For Ser Ile Ile Ile Ser Leu Ile Asp Lys Gly Ala Asn Ala Ser 340 345 350

104

Glu Phe Thr Ser Asp Gly Arg 360 Asn Ile Leu 365 Arg Arg Leu 355 Thr Asn For Lys Asp Tyr His Thr Lys Thr Ala Lys Gly Arg Glu Ser 370 375 380 Ser Lys Ala Arg Leu Cys Ile Asp Ile Leu Glu Arg Glu Ile Arg Lys 385 390 395 400 Asn For Met Wall Leu Asp Thr For Met Cys Ser Ile Ser Met For Glu 405 410 415 Asp Leu Gin Met Arg Leu Leu Tyr Leu Glu Lys Arg Wall Gly Leu Ala 420 425 430 Gin Leu Phe Phe For Thr Glu Ala Lys Wall Ala Met Asp Ile Gly Asn 435 440 445 Wall Glu Gly Thr Ser Glu Phe Thr Gly Leu Ser For For Ser Ser Gly 450 455 460 Leu Thr Gly Asn Leu Ser Gin Wall Asp Leu Asn Glu Thr For His Met 465 470 475 480 Gin Thr Gin Arg Leu Leu Thr Arg Met Wall Ala Leu Met Lys Thr Wall 485 490 495 Glu Thr Gly Arg Arg Phe Phe For Tyr Gly Ser Glu Wall Leu Asp Lys 500 505 510 Tyr Met Ala Glu Tyr Ile Asp Asp Asp Ile Leu Asp Asp Phe His Phe 515 520 525 Glu Lys Gly Ser Thr His Glu Arg Arg Leu Lys Arg Met Arg Tyr Arg 530 535 540 Glu Leu Lys Asp Asp Wall Gin Lys Ala Tyr Ser Lys Asp Lys Glu Ser 545 550 555 560 Lys Ile Ala Arg Ser Cys Leu Ser Ala Ser Ser Ser For Ser Ser Ser 565 570 575 Ser Ile Arg Asp Asp Leu His Asn Thr Thr 580 585

<210> 9 <211> 21 <212> DNA <213> Artificial sequence <220>

105 <223> Artificial sequence description: PCR Primer <400> 9 agattattgt caagtctaat g <210> 10 <211> 19 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR Primer <400> 10 ttccatgtac ctttgcttc <210> 11 <211> 23 <212> DNA <213> Artificial sequence <220>

<223> Description of artificial sequence: PCR Primer <400> 11 gcggatccat ggataatagt agg 23

<210> 12 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence description: PCR Primer <400> 12 gcggatccta tttcctaaaa ggg

<210> 13 <211> 21 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR Primer <400> 13 tcaaggcctt ggattcagat g

106 <210> 14 <211> 21 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR Primer <400> 14 attaactgcg ctacgtccgt c <210> 15 <211> 1477 <212> DNA <213> Arabidopsis thaliana <220>

<221> CDS <222> (1) .. (1476) <223> AtNMLc2 genomic sequence <400> 15

atg Met 1 agc Ser aat Asn ctt Leu gaa Glu 5 gaa Glu tet Ser ttg Leu aga Arg tet Ser 10 cta Leu tcg Ser ttg Leu gat Asp ttc Phe 15 Dec ctg Leu 48 aac cta cta atc aac ggt caa get ttc tcc gac gtg act ttc agc gtt 96 Asn Leu Leu Ile Asn Gly Gin Ala Phe Ser Asp Wall Thr Phe Ser Wall 20 May 25 30 gaa ggt cgt tta gtc cac get cac cgt tgt atc ctc gcc gca cgg agt 144 Glu Gly Arg Leu Wall His Ala His Arg Cys Ile Leu Ala Ala Arg Ser 35 40 45 ctt ttc ttc cgc aaa ttc ttt tgt ggg aca gac tea approx caa cct gtc 192 Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser For Gin For Wall 50 55 60 aca ggt ata gac ccg acc caa cat ggg tcc gta ccc get agc approx aca 240 Thr Gly Ile Asp For Thr Gin His Gly Ser Wall For Ala Ser For Thr 65 70 75 80 aga ggc tcc acg gcc approx get gga att ata approx gtg aac tea gtc ggt 288 Arg Gly Ser Thr Ala For Ala Gly Ile Ile For Wall Asn Ser Wall Gly 85 90 95 melt gag gtt ttt ctg ttg cta ctt cag ttt ctt melt agc gga caa gtc 336 Tyr Glu Wall Phe Leu Leu Leu Leu Gin Phe Leu Tyr Ser Gly Gin Wall 100 ALIGN! 105 110 tcc atc gtg ccg cag aaa cac gag cct aga cct aat tgt ggc gag aga 384 Ser Ile Wall For Gin Lys His Glu For Arg For Asn Cys Gly Glu Arg 115 120 125

107

gga Gly tgt Cys 130 tgg cac act Thr cat His tgc Cys 135 tea gcc gcc gtt gat Asp 140 ctt Leu gct Ala ctt Leu gat Asp 432 Trp His Ser Ala Ala Val act ctc gcc gcc tet cgt tray ttc ggc gtc gag cag ctc gca ttg ctc 480 Thr Leu Ala Ala Ser Arg Tyr Phe Gly Wall Glu Gin Leu Ala Leu Leu 145 150 155 160 acc cag aaa caa ttg gca agc atg gtg gag aaa gcc tet atc gaa gat 528 Thr Gin Lys Gin Leu Ala Ser Met Wall Glu Lys Ala Ser Ile Glu Asp 165 170 175 gtg atg aaa gtt tta ata gca tea aga aag caa gac atg cat caa tta 576 Wall Met Lys Wall Leu Ile Ala Ser Arg Lys Gin Asp Met His Gin Leu 180 185 190 tgg acc acc tgc tet cac tta gtt atg agc aat ctt gaa gaa tet ttg 624 Trp Thr Thr Cys Ser His Leu Wall Met Ser Asn Leu Glu Glu Ser Leu 195 200 205 aga tet cta tcg ttg gat ttc ctg aac cta cta atc aac ggt caa gct 672 Arg Ser Leu Ser Leu Asp Phe Leu Asn Leu Leu Ile Asn Gly Gin Ala 210 215 220 ttc tcc gac gtg act ttc agc gtt gaa ggt cgt tta gtc cac gct cac 720 Phe Ser Asp Wall Thr Phe Ser Wall Glu Gly Arg Leu Wall His Ala His 225 230 235 240 cgt tgt atc ctc gcc gca cgg agt ctt ttc ttc ege aaa ttc ttt tgt 768 Arg Cys Ile Leu Ala Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys 245 250 255 ggg aca gac tea approx caa cct gtc aca ggt ata gac ccg acc caa cat 816 Gly Thr Asp Ser For Gin For Wall Thr Gly Ile Asp For Thr Gin His 260 265 270 ggg tcc gta ccc gct agc approx aca aga ggc tcc acg gcc approx gct gga 864 Gly Ser Wall For Ala Ser For Thr Arg Gly Ser Thr Ala For Ala Gly 275 280 285 att ata approx gtg aac tea gtc ggt melt gag gtt ttt ctg ttg cta ctt 912 Ile Ile For Wall Asn Ser Wall Gly Tyr Glu Wall Phe Leu Leu Leu Leu 290 295 300 cag ttt ctt melt agc gga caa gtc tcc atc gtg ccg cag aaa cac gag 960 Gin Phe Leu Tyr Ser Gly Gin Wall Ser Ile Wall For Gin Lys His Glu 305 310 315 320 cct aga cct aat tgt ggc gag aga gga tgt tgg cac act cat tgc tea 1008 For Arg For Asn Cys Gly Glu Arg Gly Cys Trp His Thr His Cys Ser 325 330 335

108

gcc Ala gcc Ala gtt Wall gat Asp 340 ctt Leu get Ala ctt Leu gat Asp act Thr 345 ctc Leu gcc Ala gcc Ala tet Ser cgt Arg 350 tray Tyr ttc Phe 1056 ggc gtc gag cag ctc gca ttg ctc acc cag aaa caa ttg gca agc atg 1104 Gly Wall Glu Gin Leu Ala Leu Leu Thr Gin Lys Gin Leu Ala Ser Met 355 360 365 gtg gag aaa gcc tet atc gaa gat gtg atg aaa gtt tta ata gca tea 1152 Wall Glu Lys Ala Ser Ile Glu Asp Wall Met Lys Wall Leu Ile Ala Ser 370 375 380 aga aag caa gac atg cat caa tta tgg acc acc tgc tet cac tta gtt 1200 Arg Lys Gin Asp Met His Gin Leu Trp Thr Thr Cys Ser His Leu Wall 385 390 395 400 atg agc aat ctt gaa gaa tet ttg aga tet cta tcg ttg gat ttc ctg 1248 Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu 405 410 415 aac cta cta atc aac ggt caa get ttc tcc gac gtg act ttc agc gtt 1296 Asn Leu Leu Ile Asn Gly Gin Ala Phe Ser Asp Wall Thr Phe Ser Wall 420 425 430 gaa ggt cgt tta gtc cac get cac cgt tgt atc ctc gcc gca cgg agt 1344 Glu Gly Arg Leu Wall His Ala His Arg Cys Ile Leu Ala Ala Arg Ser 435 440 445 ctt ttc ttc cgc aaa ttc ttt tgt ggg aca gac tea approx caa cct gtc 1392 Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser For Gin For Wall 450 455 460 aca ggt ata gac ccg acc caa cat ggg tcc gta ccc get agc approx aca 1440 Thr Gly Ile Asp For Thr Gin His Gly Ser Wall For Ala Ser For Thr 465 470 475 480 aga ggc tcc acg gcc approx get gga att ata approx gtg and 1477 Arg Gly Ser Thr Ala For Ala Gly Ile Ile For Wall 485 490

<210> 16 <211> 491 <212> PRT <213> Arabidopsis thaliana <400> 16

Met Ser Asn Leu

Asn Leu Leu Ile

Glu Glu Ser

Asn Gly Gin

Leu Arg

Ala Phe Ser Asp

Ser Leu Asp Phe Leu

Val Thr Phe Ser Val

109

Glu Gly Arg 35 Leu Val His Ala His Arg Cys 40 Ile Leu Ala 45 Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser For Gin For Wall 50 55 60 Thr Gly Ile Asp For Thr Gin His Gly Ser Wall For Ala Ser For Thr 65 70 75 80 Arg Gly Ser Thr Ala For Ala Gly Ile Ile For Wall Asn Ser Wall Gly 85 90 95 Tyr Glu Wall Phe Leu Leu Leu Leu Gin Phe Leu Tyr Ser Gly Gin Wall 100 ALIGN! 105 110 Ser Ile Wall For Gin Lys His Glu For Arg For Asn Cys Gly Glu Arg 115 120 125 Gly Cys Trp His Thr His Cys Ser Ala Ala Wall Asp Leu Ala Leu Asp 130 135 140 Thr Leu Ala Ala Ser Arg Tyr Phe Gly Wall Glu Gin Leu Ala Leu Leu 145 150 155 160 Thr Gin Lys Gin Leu Ala Ser Met Wall Glu Lys Ala Ser Ile Glu Asp 165 170 175 Wall Met Lys Wall Leu Ile Ala Ser Arg Lys Gin Asp Met His Gin Leu 180 185 190 Trp Thr Thr Cys Ser His Leu Wall Met Ser Asn Leu Glu Glu Ser Leu 195 200 205 Arg Ser Leu Ser Leu Asp Phe Leu Asn Leu Leu Ile Asn Gly Gin Ala 210 215 220 Phe Ser Asp Wall Thr Phe Ser Wall Glu Gly Arg Leu Wall His Ala His 225 230 235 240 Arg Cys Ile Leu Ala Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys 245 250 255 Gly Thr Asp Ser For Gin For Wall Thr Gly Ile Asp For Thr Gin His 260 265 270 Gly Ser Wall For Ala Ser For Thr Arg Gly Ser Thr Ala For Ala Gly 275 280 285 Ile Ile For Wall Asn Ser Wall Gly Tyr Glu Wall Phe Leu Leu Leu Leu 290 295 300 Gin Phe Leu Tyr Ser Gly Gin Wall Ser Ile Wall For Gin Lys His Glu 305 310 315 320

110

For Arg Pro Asn Cys 325 Gly Glu Arg Gly Cys 330 Trp His Thr His Cys 335 Ser Ala Ala Wall Asp Leu Ala Leu Asp Thr Leu Ala Ala Ser Arg Tyr Phe 340 345 350 Gly Wall Glu Gin Leu Ala Leu Leu Thr Gin Lys Gin Leu Ala Ser Met 355 360 365 Wall Glu Lys Ala Ser Ile Glu Asp Wall Met Lys Wall Leu Ile Ala Ser 370 375 380 Arg Lys Gin Asp Met His Gin Leu Trp Thr Thr Cys Ser His Leu Wall 385 390 395 400 Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu 405 410 415 Asn Leu Leu Ile Asn Gly Gin Ala Phe Ser Asp Wall Thr Phe Ser Wall 420 425 430 Glu Gly Arg Leu Wall His Ala His Arg Cys Ile Leu Ala Ala Arg Ser 435 440 445 Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser For Gin For Wall 450 455 460 Thr Gly Ile Asp For Thr Gin His Gly Ser Wall For Ala Ser For Thr 465 470 475 480 Arg Gly Ser Thr Ala For Ala Gly Ile Ile For Wall 485 490

<210> 17 <211> 1803 <212> DNA <213> Arabidopsis thaliana <220>

<221> CDS <222> (1) .. (1803) <223> AtNMLc4-1 genomic sequence <400> 17

atg Met 1 get Ala gca Ala act Thr gca Ala 5 ata Ile gag Glu approx For tet Ser tea Ser 10 tet Ser ata Ile agt Ser ttc Phe aca Thr 15 Dec tet Ser 48 tet cac tta tea aac cct tet cct gtt gtt act act melt cac tea get 96 Ser His Leu Ser Asn For Ser For Wall Wall Thr Thr Tyr His Ser Ala 20 May 25 30

111

gct Ala aat Asn ctt gaa gag ctc Leu age Ser tet Ser 40 aac Asn ttg Leu gag Glu cag Gin ctt Leu 45 ctc Leu act Thr aat Asn 144 Leu 35 Glu Glu approx gat tgc gat tray act gac gca gag atc atc att gaa gaa gaa gct 192 For Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala 50 55 60 aac cct gtg agt gtt cat aga tgt gtt tta gct gct agg age aag ttt 240 Asn For Wall Ser Wall His Arg Cys Wall Leu Ala Ala Arg Ser Lys Phe 65 70 75 80 ttt ctt gat ctg ttt aag aaa gat aaa gat agt agt gag aag aaa cct 288 Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys For 85 90 95 aag melt caa atg aaa gat tta tta approx melt gga aat gtg gga cgt gag 336 Lys Tyr Gin Met Lys Asp Leu Leu For Tyr Gly Asn Wall Gly Arg Glu 100 ALIGN! 105 110 gca ttt ctg cat ttc ttg age melt atc tray act ggg agg tta aag cct 384 Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys For 115 120 125 ttt cct atc gag gtt tca act tgt gtt gat tca gtt tgt gct cat gat 432 Phe For Ile Glu Wall Ser Thr Cys Wall Asp Ser Wall Cys Ala His Asp 130 135 140 tet tgt aaa ccg gcc att gat ttt gct gtt gag ttg atg melt gct tca 480 Ser Cys Lys For Ala Ile Asp Phe Ala Wall Glu Leu Met Tyr Ala Ser 145 150 155 160 ttt gtg ttc caa atc ccg gat ctt gtt tcg tca ttt cag cgg aag ctt 528 Phe Wall Phe Gin Ile For Asp Leu Wall Ser Ser Phe Gin Arg Lys Leu 165 170 175 cgt aac melt gtt gag aag tca cta gta gag aat gtt ctt cct atc ctc 576 Arg Asn Tyr Wall Glu Lys Ser Leu Wall Glu Asn Wall Leu For Ile Leu 180 185 190 tta gtt gcg ttt cat tgt gat ttg aca cag ctt ctt gat caa tgc att 624 Leu Wall Ala Phe His Cys Asp Leu Thr Gin Leu Leu Asp Gin Cys Ile 195 200 205 gag aga gtg gcg aga tca gac tta gac aga ttc tgt atc gaa aag gag 672 Glu Arg Wall Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu 210 215 220 ctt cct tta gaa gta ttg gaa aaa atc aaa cag ctt ega gtt aag tcg 720 Leu For Leu Glu Wall Leu Glu Lys Ile Lys Gin Leu Arg Wall Lys Ser 225 230 235 240

• · ··

112

gtg aac ata ccc gag gtg gag gat Asp aaa Lys tcg Ser 250 ata gag aga aca ggg aaa Lys 768 Wall Asn Ile For Glu 245 Wall Glu Ile Glu Arg Thr Gly 255 gta ctc aag gca ttg gat tea gat gat gta gaa ctc gtg aag ctt ctt 816 Wall Leu Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu 260 265 270 ttg act gag tea gat ata act cta gac caa gcc aat ggt cta cat melt 864 Leu Thr Glu Ser Asp Ile Thr Leu Asp Gin Ala Asn Gly Leu His Tyr 275 280 285 gca gtg gca tray agt gat ccg aaa gtt gtg aca cag gtt ctt gat cta 912 Ala Wall Ala Tyr Ser Asp For Lys Wall Wall Thr Gin Wall Leu Asp Leu 290 295 300 gat atg gct gat gtt aat ttc aga aat tcc agg ggg melt acg gtt ctt 960 Asp Met Ala Asp Wall Asn Phe Arg Asn Ser Arg Gly Tyr Thr Wall Leu 305 310 315 320 cat att gct gct atg cgt aga gag approx aca att atc ata approx ctt att 1008 His Ile Ala Ala Met Arg Arg Glu For Thr Ile Ile Ile For Leu Ile 325 330 335 caa aaa gga gct aat gct tea gat ttc acg ttt gat gga ege agt gcg 1056 Gin Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala 340 345 350 gta aat ata tgt agg aga ctc act agg ccg aaa gat melt cat acc aaa 1104 Wall Asn Ile Cys Arg Arg Leu Thr Arg For Lys Asp Tyr His Thr Lys 355 360 365 acc tea agg aaa gaa cct agt aaa tray ege tta tgc atc gat atc ttg 1152 Thr Ser Arg Lys Glu For Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu 370 375 380 gaa agg gaa att aga agg aat approx ttg gtt agt ggg gat aca ccc act 1200 Glu Arg Glu Ile Arg Arg Asn For Leu Wall Ser Gly Asp Thr For Thr 385 390 395 400 tgt tcc cat tcg atg ccc gag gat ctc caa atg agg ttg tta tray tta 1248 Cys Ser His Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu 405 410 415 gaa aag ega tgg gac ttg cgt cag ttg ttc ttc approx gca gaa gcc aat 1296 Glu Lys Arg Trp Asp Leu Arg Gin Leu Phe Phe For Ala Glu Ala Asn 420 425 430 gtg gct atg gac gtt gct aat gtt gaa ggg aca agc gag tgc aca ggt 1344 Wall Ala Met Asp Wall Ala Asn Wall Glu Gly Thr Ser Glu Cys Thr Gly 435 440 445 ctt cta act approx cct approx tea aat gat aca act gaa aac ttg ggt aaa 1392 Leu Leu Thr For For For Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys 450 455 460

113

gtc Val 465 gat Asp tta Leu aat Asn gaa Glu acg Thr 470 cct For melt Tyr gtg Wall caa Gin acg Thr 475 aaa Lys aga Arg atg Met ctt Leu aca Thr 480 1440 cgt atg aaa gcc ctc atg aaa aca ggt aaa age tta agg aaa tgt act 1488 Arg Met Lys Ala Leu Met Lys Thr Gly Lys Ser Leu Arg Lys Cys Thr 485 490 495 ttc aag ttt melt tet ctg acc aca aga ttg act gat tcg aaa ccg ttc 1536 Phe Lys Phe Tyr Ser Leu Thr Thr Arg Leu Thr Asp Ser Lys For Phe 500 505 510 aac aac gca gtt gag aca ggt cgg aga tray ttc approx tet tgt melt gag 1584 Asn Asn Ala Wall Glu Thr Gly Arg Arg Tyr Phe For Ser Cys Tyr Glu 515 520 525 gtt ctg gat aag tray atg gat cag melt atg gac gaa gaa atc cct gat 1632 Wall Leu Asp Lys Tyr Met Asp Gin Tyr Met Asp Glu Glu Ile For Asp 530 535 540 atg tcg melt ccc gag aaa ggc act gtg aaa gag aga aga cag aag agg 1680 Met Ser Tyr For Glu Lys Gly Thr Wall Lys Glu Arg Arg Gin Lys Arg 545 550 555 560 atg aga melt aac gag ctg aag aac gac gtt aaa aaa gca melt age aaa 1728 Met Arg Tyr Asn Glu Leu Lys Asn Asp Wall Lys Lys Ala Tyr Ser Lys 565 570 575 gac aaa gtc gcg cgg tet tgt ctt tet tet tea tea approx gct tet tet 1776 Asp Lys Wall Ala Arg Ser Cys Leu Ser Ser Ser Ser For Ala Ser Ser 580 585 590 ctt aga gaa gcc tta gag aat approx aca t 1804 Leu Arg Glu Ala Leu Glu Asn For Thr 595 600

<210> 18 <211> 601 <212> PRT <213> Arabidopsis thaliana <400> 18

Met 1 Ala Ala Thr Ala 5 Ile Glu For Ser Ser 10 Ser Ile Ser Phe Thr 15 Dec Ser Ser His Leu Ser 20 May Asn For Ser For Wall 25 Wall Thr Thr Tyr His 30 Ser Ala Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gin Leu Leu Thr Asn

40 45

For Asp Cys Asp Tyr Thr Asp

55 60

114

Asn Pro Val 65 Ser Val His Arg Cys 70 Wall Leu Ala 75 Arg Ser Lys Phe 80 Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys For 85 90 95 Lys Tyr Gin Met Lys Asp Leu Leu For Tyr Gly Asn Wall Gly Arg Glu 100 ALIGN! 105 110 Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys For 115 120 125 Phe For Ile Glu Wall Ser Thr Cys Wall Asp Ser Wall Cys Ala His Asp 130 135 140 Ser Cys Lys For Ala Ile Asp Phe Ala Wall Glu Leu Met Tyr Ala Ser 145 150 155 160 Phe Wall Phe Gin Ile For Asp Leu Wall Ser Ser Phe Gin Arg Lys Leu 165 170 175 Arg Asn Tyr Wall Glu Lys Ser Leu Wall Glu Asn Wall Leu For Ile Leu 180 185 190 Leu Wall Ala Phe His Cys Asp Leu Thr Gin Leu Leu Asp Gin Cys Ile 195 200 205 Glu Arg Wall Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu 210 215 220 Leu For Leu Glu Wall Leu Glu Lys Ile Lys Gin Leu Arg Wall Lys Ser 225 230 235 240 Wall Asn Ile For Glu Wall Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys 245 250 255 Wall Leu Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu 260 265 270 Leu Thr Glu Ser Asp Ile Thr Leu Asp Gin Ala Asn Gly Leu His Tyr 275 280 285 Ala Wall Ala Tyr Ser Asp For Lys Wall Wall Thr Gin Wall Leu Asp Leu 290 295 300 Asp Met Ala Asp Wall Asn Phe Arg Asn Ser Arg Gly Tyr Thr Wall Leu 305 310 315 320 His Ile Ala Ala Met Arg Arg Glu For Thr Ile Ile Ile For Leu Ile 325 330 335 Gin Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala 340 345 350

• 1 »

115

Wall Asn Ile 355 Cys Arg Arg Leu Thr 360 Arg Pro Lys Asp Tyr 365 His Thr Lys Thr Ser Arg Lys Glu For Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu 370 375 380 Glu Arg Glu Ile Arg Arg Asn For Leu Wall Ser Gly Asp Thr For Thr 385 390 395 400 Cys Ser His Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu 405 410 415 Glu Lys Arg Trp Asp Leu Arg Gin Leu Phe Phe For Ala Glu Ala Asn 420 425 430 Wall Ala Met Asp Wall Ala Asn Wall Glu Gly Thr Ser Glu Cys Thr Gly 435 440 445 Leu Leu Thr For For For Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys 450 455 460 Wall Asp Leu Asn Glu Thr For Tyr Wall Gin Thr Lys Arg Met Leu Thr 465 470 475 480 Arg Met Lys Ala Leu Met Lys Thr Gly Lys Ser Leu Arg Lys Cys Thr 485 490 495 Phe Lys Phe Tyr Ser Leu Thr Thr Arg Leu Thr Asp Ser Lys For Phe 500 505 510 Asn Asn Ala Wall Glu Thr Gly Arg Arg Tyr Phe For Ser Cys Tyr Glu 515 520 525 Wall Leu Asp Lys Tyr Met Asp Gin Tyr Met Asp Glu Glu Ile For Asp 530 535 540 Met Ser Tyr For Glu Lys Gly Thr Wall Lys Glu Arg Arg Gin Lys Atg 545 550 555 560 Met Arg Tyr Asn Glu Leu Lys Asn Asp Wall Lys Lys Ala Tyr Ser Lys 565 570 575 Asp Lys Wall Ala Arg Ser Cys Leu Ser Ser Ser Ser For Ala Ser Ser 580 585 590 Leu Arg Glu Ala Leu Glu Asn For Thr 595 600

<210> 19 <211> 1803 <212> DNA «* r r φ φ · · · ·

Φ

4 »« · Λ ·· <

♦ · · · • Φ Φ

ΦΦΦ Φ ΦΦΦ 9 ♦ Φ

Φ · · Λ · Φ · · ·

115 <213> Arabidopsis thaliana <220>

<221> CDS <222> (1) .. (1803) <223> AtNMLc4-2 genomic sequence <400> 19

atg Met 1 gcc Ala acc acc acc Thr 5 acc Thr acc Thr acc Thr acc Thr gct aga ttc tet Ser gat tca tac 48 Thr Thr Ala 10 Arg Phe Asp Ser 15 Dec Tyr gag ttc agc aac aca agc ggc aat agc ttc ttc gcc gcc gag tca tet 96 Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser Ser 20 May 25 30 ctt gat melt ccg acg gaa ttt ctc acg approx ccg gag gta tca gct ctt 144 Leu Asp Tyr For Thr Glu Phe Leu Thr For For Glu Wall Ser Ala Leu 35 40 45 aaa ctt ctg tet aac tgc ctc gag tet gtt ttc gac tcg ccg gag acg 192 Lys Leu Leu Ser Asn Cys Leu Glu Ser Wall Phe Asp Ser For Glu Thr 50 55 60 ttc tray agc gat gct aag cta gtt ctc gcc ggc ggc cgg gaa gtt tet 240 Phe Tyr Ser Asp Ala Lys Leu Wall Leu Ala Gly Gly Arg Glu Wall Ser 65 70 75 80 ttt cac cgt tgt att ctt tcc gcg aga att cct gtc ttc aaa agc gct 288 Phe His Arg Cys Ile Leu Ser Ala Arg Ile For Wall Phe Lys Ser Ala 85 90 95 tta gcc acc gtg aag gaa caa aaa tcc tcc acc acc gtg aag ctc cag 336 Leu Ala Thr Wall Lys Glu Gin Lys Ser Ser Thr Thr Wall Lys Leu Gin 100 ALIGN! 105 110 ctg aaa gag atc gcc aga gat tray gaa gtc ggc ttt gac tcg gtt gtg 384 Leu Lys Glu Ile Ala Arg Asp Tyr Glu Wall Gly Phe Asp Ser Wall Wall 115 120 125 gcg gtt ttg gcg melt gtt tray agc ggc aga gtg agg tcc ccg ccg aag 432 Ala Wall Leu Ala Tyr Wall Tyr Ser Gly Arg Wall Arg Ser For For Lys 130 135 140 gga gct tet gct tgc gta gac gac gat tgt tgc cac gtg gct tgc cgg 480 Gly Ala Ser Ala Cys Wall Asp Asp Asp Cys Cys His Wall Ala Cys Arg 145 150 155 160 tca aag gtg gat ttc atg gtg gag gtt ctt melt ctg tet ttc gtt ttc 528 Ser Lys Wall Asp Phe Met Wall Glu Wall Leu Tyr Leu Ser Phe Wall Phe 165 170 175

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ··· · · · · · · · · · · ·

117

cag att caa Gin gaa Glu 180 tta gtt Leu Val act Thr ctg gag agg cag ttc Phe ttg Leu 190 gaa Glu att Ile 576 Gin Ile Leu Tyr Glu 185 Arg Gin gta gac aaa gtt gta gtc gaa gac atc ttg gtt ata ttc aag ctt gat 624 Wall Asp Lys Wall Wall Wall Glu Asp Ile Leu Wall Ile Phe Lys Leu Asp 195 200 205 act cta tgt ggt aca aca tray aag aag ctt ttg gat aga tgc ata gaa 672 Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile Glu 210 215 220 att atc gtg aag tet gat ata gaa cta gtt agt ctt gag aag tet tta 720 Ile Ile Wall Lys Ser Asp Ile Glu Leu Wall Ser Leu Glu Lys Ser Leu 225 230 235 240 cct caa cac att ttc aag caa atc ata gac atc ege gaa gcg ctc tgt 768 For Gin His Ile Phe Lys Gin Ile Ile Asp Ile Arg Glu Ala Leu Cys 245 250 255 cta gag approx cct aaa cta gaa agg cat gtc aag aac ata tray aag gcg 816 Leu Glu For For Lys Leu Glu Arg His Wall Lys Asn Ile Tyr Lys Ala 260 265 270 cta gac tea gat gat gtt gag ctt gtc aag atg ctt ttg cta gaa gga 864 Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Met Leu Leu Leu Glu Gly 275 280 285 cac acc aat ctc gat gag gcg melt gct ctt cat ttt gct atc gct cac 912 His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Ile Ala His 290 295 300 tgc gct gtg aag acc gcg melt gat ctc ctc gag ctt gag ctt gcg gat 960 Cys Ala Wall Lys Thr Ala Tyr Asp Leu Leu Glu Leu Glu Leu Ala Asp 305 310 315 320 gtt aac ctt aga aat ccg agg gga tray act gtg ctt cat gtt gct gcg 1008 Wall Asn Leu Arg Asn For Arg Gly Tyr Thr Wall Leu His Wall Ala Ala 325 330 335 atg cgg aag gag ccg aag ttg ata ata tet ttg tta atg aaa ggg gca 1056 Met Arg Lys Glu For Lys Leu Ile Ile Ser Leu Leu Met Lys Gly Ala 340 345 350 aat att tta gac aca aca ttg gat ggt aga acc gct tta gtg att gta 1104 Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala Leu Wall Ile Wall 355 360 365 aaa ega ctc act aaa gcg gat gac tray aaa act agt acg gag gac ggt 1152 Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser Thr Glu Asp Gly 370 375 380

• · • ·

118

acg cct tet Ser ctg Leu aaa Lys ggc Gly 390 gga Gly tta tgc ata Ile gag Glu 395 gta Val ctt Leu gag Glu cat His gaa Glu 400 1200 Thr 385 For Leu Cys caa aaa cta gaa melt ttg tcg cct ata gag gct tea ctt tet ctt approx 1248 Gin Lys Leu Glu Tyr Leu Ser For Ile Glu Ala Ser Leu Ser Leu For 405 410 415 gta act approx gag gag ttg agg atg agg ttg ctc melt melt gaa aac ega 1296 Wall Thr For Glu Glu Leu Arg Met Arg Leu Leu Tyr ' Tyr Glu Asn Arg 420 425 430 gtt gca ctt gct ega ctt ctc ttt approx gtg gaa act gaa act gta cag 1344 Wall Ala Leu Ala Arg Leu Leu Phe For Wall Glu Thr Glu Thr Wall Gin 435 440 445 ggt att gcc aaa ttg gag gaa aca tgc gag ttt aca gct tet agt ctc 1392 Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr Ala Ser Ser Leu 450 455 460 gag cct gat cat cac att ggt gaa aag cgg aca tea cta gac cta aat 1440 Glu For Asp His His Ile Gly Glu Lys Arg Thr Ser Leu Asp Leu Asn 465 470 475 480 atg gcg ccg ttc caa atc cat gag aag cat ttg agt aga cta aga gca 1488 Met Ala For Phe Gin Ile His Glu Lys His Leu Ser Arg Leu Arg Ala 485 490 495 ctt tgt aaa acc gtg gaa ctg ggg aaa ege tray ttc aaa ega tgt tcg 1536 Leu Cys Lys Thr Wall Glu Leu Gly Lys Arg Tyr Phe Lys Arg Cys Ser 500 505 510 ctt gat cac ttt atg gat act gag gac ttg aat cat ctt gct agc gta 1584 Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser Wall 515 520 525 gaa gaa gat act cct gag aaa cgg cta caa aag aag caa agg tray atg 1632 Glu Glu Asp Thr For Glu Lys Arg Leu Gin Lys Lys Gin Arg Tyr Met 530 535 540 gaa cta caa gag act ctg atg aag acc ttt agt gag gac aag gag gaa 1680 Glu Leu Gin Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu Glu 545 550 555 560 tgt gga aag tet tcc aca ccg aaa approx acc tet gcg gtg agg tet aat 1728 Cys Gly Lys Ser Ser Thr For Lys For Thr Ser Ala Wall Arg Ser Asn 565 570 575 aga aaa ctc tet cac cgg ege cta aaa gtg gac aaa cgg gat ttt ttg 1776 Arg Lys Leu Ser His Arg Arg Leu Lys Wall Asp Lys Arg Asp Phe Leu 580 585 590

• ·

119

1803 aaa ega cct tac ggg aac ggg gat taa

Lys Arg Pro Tyr Gly Asn Gly Asp

595 600 <210> 20 <211> 600 <212> PRT <213> Arabidopsis thaliana

<400> 20 Met 1 Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe Ser Asp Ser 15 Dec Tyr 5 10 Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser Ser 20 May 25 30 Leu Asp Tyr For Thr Glu Phe Leu Thr For For Glu Wall Ser Ala Leu 35 40 45 Lys Leu Leu Ser Asn Cys Leu Glu Ser Wall Phe Asp Ser For Glu Thr 50 55 60 Phe Tyr Ser Asp Ala Lys Leu Wall Leu Ala Gly Gly Arg Glu Wall Ser 65 70 75 80 Phe His Arg Cys Ile Leu Ser Ala Arg Ile For Wall Phe Lys Ser Ala 85 90 95 Leu Ala Thr Wall Lys Glu Gin Lys Ser Ser Thr Thr Wall Lys Leu Gin 100 ALIGN! 105 110 Leu Lys Glu Ile Ala Arg Asp Tyr Glu Wall Gly Phe Asp Ser Wall Wall 115 120 125 Ala Wall Leu Ala Tyr Wall Tyr Ser Gly Arg Wall Arg Ser For For Lys 130 135 140 Gly Ala Ser Ala Cys Wall Asp Asp Asp Cys Cys His Wall Ala Cys Arg 145 150 155 160 Ser Lys Wall Asp Phe Met Wall Glu Wall Leu Tyr Leu Ser Phe Wall Phe 165 170 175 Gin Ile Gin Glu Leu Wall Thr Leu Tyr Glu Arg Gin Phe Leu Glu Ile 180 185 190 Wall Asp Lys Wall Wall Wall Glu Asp Ile Leu Wall Ile Phe Lys Leu Asp 195 200 205 Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile Glu 210 215 220

Ile 225 Ile Wall Lys Ser Asp 230 Ile Glu Leu For Gin His Ile Phe 245 Lys Gin Ile Ile Leu Glu For For 260 Lys Leu Glu Arg His 265 Leu Asp Ser 275 Asp Asp Wall Glu Leu 280 Wall His Thr 290 Asn Leu Asp Glu Ala 295 Tyr Ala Cys 305 Ala Wall Lys Thr Ala 310 Tyr Asp Leu Wall Asn Leu Arg Asn 325 For Arg Gly Tyr Met Arg Lys Glu 340 For Lys Leu Ile Ile 345 Asn Ile Leu 355 Asp Thr Thr Leu Asp 360 Gly Lys Arg 370 Leu Thr Lys Ala Asp 375 Asp Tyr Thr 385 For Ser Leu Lys Gly 390 Gly Leu Cys Gin Lys Leu Glu Tyr 405 Leu Ser For Ile Wall Thr For Glu 420 Glu Leu Arg Met Arg 425 Wall Ala Leu 435 Ala Arg Leu Leu Phe 440 For Gly Ile 450 Ala Lys Leu Glu Glu 455 Thr Cys Glu 465 For Asp His His Ile 470 Gly Glu Lys Met Ala For Phe Gin 485 Ile His Glu Lys Leu cys Lys Thr 500 Wall Glu Leu Gly Lys 505

• · «· • · • · • · • · * • · · • · • · • · · · · · · · · · · · · · · · · · · • · · · · · · · · · · · · · · • · · · ··· 120 Wall Ser 235 Leu Glu Lys Ser Leu 240 Asp 250 Ile Arg Glu Ala Leu 255 Cys Wall Lys Asn Ile Tyr 270 Lys Ala Lys Met Leu Leu 285 Leu Glu Gly Leu His Phe 300 Ala Ile Ala His Leu Glu 315 Leu Glu Leu Ala Asp 320 Thr 330 Wall Leu His Wall Ala 335 Ala Ser Leu Leu Met Lys 350 Gly Ala Arg Thr Ala Leu 365 Wall Ile Wall Lys Thr Ser 380 Thr Glu Asp Gly Ile Glu 395 Wall Leu Glu His Glu 400 Glu 410 Ala Ser Leu Ser Leu 415 For Leu Leu Tyr Tyr Glu 430 Asn Arg Wall Glu Thr Glu 445 Thr Wall Gin Glu Phe Thr 460 Ala Ser Ser Leu Arg Thr 475 Ser Leu Asp Leu Asn 480 His 490 Leu Ser Arg Leu Arg 495 Ala Arg Tyr Phe Lys Arg 510 Cys Ser

121

Leu Asp His 515 Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser Wall 520 525 Glu Glu Asp Thr For Glu Lys Arg Leu Gin Lys Lys Gin Arg Tyr Met 530 535 540 Glu Leu Gin Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu Glu 545 550 555 560 Cys Gly Lys Ser Ser Thr For Lys For Thr Ser Ala Wall Arg Ser Asn 565 570 575 Arg Lys Leu Ser His Arg Arg Leu Lys Wall Asp Lys Arg Asp Phe Leu 580 585 590 Lys Arg For Tyr Gly Asn Gly Asp

595 600 <210> 21 <211> 28 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: NIM IA PCR primer <400> 21 gakattattg tcaagtctaa tgtwgata <210> 22 <211> 25 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM 1B <400> 22 aytkgaytck gatgatrttg artta <210> 23 <211> 27 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: NIM IC PCR primer <400> 23 taaytcaaya tcatcmgart cmartgc • ·

122 <210> 24 <211> 28 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM ID <220>

<221> miscellaneous <222> (1) .. (28) <223> n = a, t, c or g <400> 24 gttkagcmag nscaactcta ttttcaag <210> 25 <211> 32 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM 2A <400> 25 tgcatwgara twrttgtsaa gtctratgtw ga <210> 26 <211> 27 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM 2B <400> 26 ggcaytggay tcwgatgatg ttgaryt <210> 27 <211> 27 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM 2C <400> 27 arytcaacat catcwgartc cartgcc

123 <210> 28 <211> 31 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: NIM 2D PCR primer <400> 28 agttkagcma gdccaactck attttcaarr t <210> 29 <211> 659 <212> DNA <213> Nicotiana tabacum <220>

<221> CDS <222> (1) .. (658) <223> Tobacco A <400> 29

tgc Cys 1 atg Met gag att att Ile 5 gtc aag tet Ser aat gtt gat Asn Val Asp 10 atc Ile ata Ile acc Thr ctt Leu 15 Dec gat Asp 48 Glu Ile Wall Lys aag gcc ttg cct cat gac att gta aaa caa att acc gat tea ega gca 96 Lys Ala Leu For His Asp Ile Wall Lys Gin Ile Thr Asp Ser Arg Ala 20 May 25 30 gaa ctt ggt cta caa ggg cct gaa agc aat ggt ttt cct gat aaa cat 144 Glu Leu Gly Leu Gin Gly For Glu Ser Asn Gly Phe For Asp Lys His 35 40 45 gtt aag agg ata cat agg gca tta gat tet gat gat gtt gaa tta ctg 192 Wall Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu 50 55 60 cag atg ttg cta aga gag ggg cat act act cta gat gat gca melt get 240 Gin Met Leu Leu Arg Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala 65 70 75 80 ctc cac melt get gta gca melt tgc gat gca aag act aca gca gaa ctt 288 Leu His Tyr Ala Wall Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu 85 90 95 cta gat ctt gca ctt get gat gtt aat cat caa aat tea aga gga tray 336 Leu Asp Leu Ala Leu Ala Asp Wall Asn His Gin Asn Ser Arg Gly Tyr 100 ALIGN! 105 110

124

aca Thr gtg Wall ctg cat gtt gca gcc atg agg aaa gag cct aaa att ata Ile gtg Val 3 84 Leu 115 His Wall Ala Ala Met Arg 120 Lys Glu For Lys 125 Ile tcc ctt tta acc aaa gga gct aga cct tet gat ctg aca tcc gat ggc 432 Ser Leu Leu Thr Lys Gly Ala Arg For Ser Asp Leu Thr Ser Asp Gly 130 135 140 aga aaa gca ctt caa att gcc aag agg ctc act agg ctt gtg gat ttc 480 Arg Lys Ala Leu Gin Ile Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe 145 150 155 160 agt aag tet approx gag gaa gga aaa tet gct tcg aag gat cgg tta tgc 528 Ser Lys Ser For Glu Glu Gly Lys Ser Ala Ser Lys Asp Arg Leu Cys 165 170 175 att gag att ctg gag caa gca gaa aga aga gat approx ctg cta gga gaa 576 Ile Glu Ile Leu Glu Gin Ala Glu Arg Arg Asp For Leu Leu Gly Glu 180 185 190 gct tet gta tet ctt gct atg gcg ggc gat gat ttg cgt atg aag ctg 624 Ala Ser Wall Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu 195 200 205 tta tray ctt gaa aat aga gtt ggc ctt gct caa ct 659 Leu Tyr Leu Glu Asn Arg Wall Gly Leu Ala Gin 210 215

<210> 30 <211> 219 <212> PRT <213> - Nicotiana tabacum

<400> 30 Ile Ile Thr Leu Asp 15 Dec Cys Met 1 Glu Ile Ile Val 5 Lys Ser Asn Wall 10 Asp Lys Ala Leu For His Asp Ile Wall Lys Gin Ile Thr Asp Ser Arg Ala 20 May 25 30 Glu Leu Gly Leu Gin Gly For Glu Ser Asn Gly Phe For Asp Lys His 35 40 45 Wall Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu 50 55 60 Gin Met Leu Leu Arg Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala 65 70 75 80 Leu His Tyr Ala Wall Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu 85 90 95

125

Leu Asp Leu Ala Wall Asn His 105 Gin Asn Ser Arg 110 Gly Tyr Thr Wall Leu His Wall Ala Ala Met Arg Lys Glu For Lys Ile Ile Wall 115 120 125 Ser Leu Leu Thr Lys Gly Ala Arg For Ser Asp Leu Thr Ser Asp Gly 130 135 140 Arg Lys Ala Leu Gin Ile Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe 145 150 155 160 Ser Lys Ser For Glu Glu Gly Lys Ser Ala Ser Lys Asp Arg Leu Cys 165 170 175 Ile Glu Ile Leu Glu Gin Ala Glu Arg Arg Asp For Leu Leu Gly Glu 180 185 190 Ala Ser Wall Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu 195 200 205 Leu Tyr Leu Glu Asn Arg Wall Gly Leu Ala Gin 210 215

<210> 31 <211> 497 <212> DNA <213> Nicotiana tabacum <220>

<221> CDS <222> (2) .. (496) <223> Tobacco Β <400> 31g gca ctg gat tet gat gat gtt gag ctg gtc aag ctt cta ctc aac gag 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Valu Leu Leu Leu Asn Glu

1 5 10 15 Dec tet gag ata agc tta gat gaa gcc tray get ctt cat melt get gtt gca 97 Ser Glu Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 melt tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg ggt gtt get 145 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 gat gtc aat cta cgt aat act ege ggt tray act gtg ctt cac att get 193 Asp Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala

55 60

126

gcc atg Ala Met 65 cgt Arg aag gag approx. gca Pro Ala 70 ata Ile att gta tcg ctt ttg Leu act Thr aag Lys gga Gly 80 241 Lys Glu Ile Wall Ser 75 Leu gct cat gtg tca gag att aca ttg gat ggg caa agt gct gtt agt atc 289 Ala His Wall Ser Glu Ile Thr Leu Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95 tgt agg agg cta act agg cct aag gag tray cat gca aaa aca gaa caa 337 Cys Arg Arg Leu Thr Arg For Lys Glu Tyr His Ala Lys Thr Glu Gin 100 ALIGN! 105 110 ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125 gag atg cgt cgc aac approx atg gct gga gat gca ttg ctt tet tcc caa 433 Glu Met Arg Arg Asn For Met Ala Gly Asp Ala Leu Leu Ser Ser Gin 130 135 140 atg ttg gcc gat gat ctg cac atg aaa ctg cac melt ttt gaa aat ega 481 Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Phe Glu Asn Arg 145 150 155 160

497 gtt gga ctt gct caa ct

Val Gly Leu, Ala Gin

165 <210> 32 <211> 165 <212> PRT <213> - Nicotiana tabacum

<400> 32 Leu Leu Leu Asn 15 Dec Glu Ala 1 Leu Asp Ser Asp 5 Asp Wall Glu Leu Val 10 Lys Ser Glu Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 Asp Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 Ala Met Arg Lys Glu For Ala Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 Ala His Wall Ser Glu Ile Thr Leu Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95

on ·

127

Cys Arg Arg Leu 100 ALIGN! Thr Arg For Lys Glu 105 Tyr His Ala Lys Thr 110 Glu Gin Gly Gin Glu 115 Ala Asn Lys Asp Arg 120 Wall Cys Ile Asp Wall 125 Leu Glu Arg Glu Met 130 Arg Arg Asn For Met 135 Ala Gly Asp Ala Leu 140 Leu Ser Ser Gin Met 145 Leu Ala Asp Asp Leu 150 His Met Lys Leu His 155 Tyr Phe Glu Asn Arg 160

Val Gly Leu, Ala Gin

165 <210> 33 <211> 497 <212> DNA <213> Nicotiana tabacum <220>

<221> CDS <222> (2) .. (496) <223> Tobacco C <400> 33g gca ctg gac tcw gat gat gtt gag ttt gtc aag ctt cta ctg agt gag 49 Ala Leu Asp Xaa Asp Asp Val Glu Phe Val Lys Leu Leu Leu Ser Glu

tet Ser aac Asn ata agc tta gat Leu Asp gaa gcc tac get ctt Leu cat His tat get gg gca 97 Ile Ser 20 May Glu Ala Tyr 25 Ala Tyr Ala 30 Wall Ala melt tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg ggt gtt gcg 145 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 gat gtc aac cta cgt aat act cgt ggt tray act gtg ctt cac att get 193 Asp Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 tcc atg cgt aag gag approx gca gta att gta tcg ctt ttg act aag gga 241 Ser Met Arg Lys Glu For Ala Wall Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 get cgt gca tea gag act aca ttg gat ggg cag agt get gtt agt atc 289 Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95

• · ·· ♦

128

tgt Cys agg agg ctg Arg Arg Leu 100 ALIGN! act Thr agg cct Arg Pro aag gag tac cat gca aaa aca gaa caa Gin 337 Lys Glu 105 Tyr His Ala Lys Thr 110 Glu ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125 gag atg cgt cgc aac approx atg get gga gat gca ttg ttt tet tcc approx 433 Glu Met Arg Arg Asn For Met Ala Gly Asp Ala Leu Phe Ser Ser For 130 135 140 atg ttg gcc gat gat ctg cac atg aaa ctg cac tray ctt gaa aat aga 481 Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Leu Glu Asn Arg 145 150 155 160 gtt ggc ctg get caa ct 498 Wall Gly Leu Ala Gin

165 <210> 34 <211> 165 <212> PRT <213> - Nicotiana tabacum

<400> 34 Ala Leu 1 Asp Xa and Asp Asp 5 Wall Glu Phe Wall 10 Lys Leu Leu Leu Ser 15 Dec Glu Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 Asp Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 Ser Met Arg Lys Glu For Ala Wall Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95 Cys Arg Arg Leu Thr Arg For Lys Glu Tyr His Ala Lys Thr Glu Gin 100 ALIGN! 105 110 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125 Glu Met Arg Arg Asn For Met Ala Gly Asp Ala Leu Phe Ser Ser For 130 135 140

129

Met Leu Al Asp Asp Leu His Met Lys Leu His 155 Tyr Leu Glu Asn Arg 160 145 150 Wall Gly Leu Ala Gin 165

<210> 35 <211> 399 <212> DNA <213> Nicotiana tabacum

<221> CDS <222> (1) .. (399) <223> Tobacco D <400> 35

act gat tcg gat Ser Asp gat Asp 5 gtt gag tta ctt aag tta ctt Leu ctt gaa gag tet Ser 48 Thr 1 Asp Wall Glu Leu Leu Lys 10 Leu Leu Glu Glu 15 Dec aat gtc act tta gac gat gct tgt gct ctt cat melt gca gct gct melt 96 Asn Wall Thr Leu Asp Asp Ala Cys Ala Leu His Tyr Ala Ala Ala Tyr 20 May 25 30 tgt aac tcc aag gtt gtg aat gag gtc ctc gag ctg gat tta gct gat 144 Cys Asn Ser Lys Wall Wall Asn Glu Wall Leu Glu Leu Asp Leu Ala Asp 35 40 45 gtc aat ctt cag aac tcc ega gga melt aac gtc ctt cac gtt gct gct 192 Wall Asn Leu Gin Asn Ser Arg Gly Tyr Asn Wall Leu His Wall Ala Ala 50 55 60 aga aga aag gag approx tea ata ata atg gga cta ctt gaa aaa gga gca 240 Arg Arg Lys Glu For Ser Ile Ile Met Gly Leu Leu Glu Lys Gly Ala 65 70 75 80 tet ttc ttg aat act aca cgg gat gga aac aca gca cta tet atc tgt 288 Ser Phe Leu Asn Thr Thr Arg Asp Gly Asn Thr Ala Leu Ser Ile Cys 85 90 95 cgg aga ttg act cgg approx aag gat melt aat gag approx aca aag caa ggg 336 Arg Arg Leu Thr Arg For Lys Asp Tyr Asn Glu For Thr Lys Gin Gly 100 ALIGN! 105 110 aaa gaa act aat aag gac ege ata tgc att gat att ttg gag aga gag 384 Lys Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Ile Leu Glu Arg Glu 115 120 125

acg aat agg aat cct

Thr Asn Arg Asn Pro

399 ·· · · · ««.. «.... · • • • • • • 399 · · · ····· · · · · · · · · · · · · · · · · · · · ·

130 <210> 36 <211> 133 <212> PRT <213> Nicotiana tabacum

Thr 1 Asp Ser Asp Asp 5 Wall Glu Leu Leu Lys 10 Leu Leu Leu Glu Glu 15 Dec Ser Asn Wall Thr Leu Asp Asp Ala Cys Ala Leu His Tyr Ala Ala Ala Tyr 20 May 25 30 Cys Asn Ser Lys Wall Wall Asn Glu Wall Leu Glu Leu Asp Leu Ala Asp 35 40 45 Wall Asn Leu Gin Asn Ser Arg Gly Tyr Asn Wall Leu His Wall Ala Ala 50 55 60 Arg Arg Lys Glu For Ser Ile Ile Met Gly Leu Leu Glu Lys Gly Ala 65 70 75 80 Ser Phe Leu Asn Thr Thr Arg Asp Gly Asn Thr Ala Leu Ser Ile Cys 85 90 95 Arg Arg Leu Thr Arg For Lys Asp Tyr Asn Glu For Thr Lys Gin Gly 100 ALIGN! 105 110 Lys Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Ile Leu Glu Arg Glu

115 120 125 Thr Asn Arg Asn Pro 130

<210> 37 <211> 497 <212> DNA <213> Lycopersicon esculentum

<220> <221> CDS <222> (49) <223> Tomato A <400> 37 g gca ttg gat tet gat gat gtt gag tta cta agg atg ttg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu Arg Met Leu 1 5 10

ctt aaa gag leu lys glu

* 9 • 9 • 9 9 · • • 4 • • 9 • 4 • • • 4 • · • * · • 4 4 4 • · 4 • 9 • · • 4 · • • 9 4 • • 4 ♦ 4 «· • · • 4 4 • • 4 · « «4 4 4 94

131

ggg cat Gly His act Thr act Thr 20 May ctt gat gat Asp gca tat gct Ala Tyr Ala 25 ctc Leu cac His tat Tyr gct gta gca Ala 97 Leu Asp Ala 30 Wall melt tgc gat gca aag act aca gca gaa ctt tta gat ctt tca ctt gct 145 Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala 35 40 45 gat gtt aat cat caa aat cct aga gga cac acg gta ctt cat gtt gct 193 Asp Wall Asn His Gin Asn For Arg Gly His Thr Wall Leu His Wall Ala 50 55 60 gcc atg agg aaa gaa cct aaa att ata gtg tcc ctt tta acc aaa gga 241 Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 gct aga cct tet gat ctg aca tcc gat ggc aaa aaa gca ctt caa att 289 Ala Arg For Ser Asp Leu Thr Ser Asp Gly Lys Lys Ala Leu Gin Ile 85 90 95 gct aag agg ctc act agg ctt gta gat ttt acc aag tet aca gag gaa 337 Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe Thr Lys Ser Thr Glu Glu 100 ALIGN! 105 110 gga aaa tet gct approx aag gat cgg tta tgc att gag att ctg gag caa 385 Gly Lys Ser Ala For Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gin 115 120 125 gca gaa aga aga gat approx cta cta gga gaa gct tca tta tet ctt gct 433 Ala Glu Arg Arg Asp For Leu Leu Gly Glu Ala Ser Leu Ser Leu Ala 130 135 140 atg gca ggc gat gat ttg cgt atg aag ctg tta tray ctt gaa aat aga 481 Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160 gtt ggc ctt gct aaa ct 498 Wall Gly Leu Ala Lys

165 <210> 38 <211> 165 <212> PRT <213> Lycopersicon esculentum

<400> 38 Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Lys Glu 1 5 10 15 Dec

Gly His Thr Thr Thu Le Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala

25 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 000 000 0 0 0 0 0 0 ♦ 0 0 0 0 ♦ · ·· 0 * »· 00 00 00

132

Tyr Cys Asp Ala Lys Thr Thr Ala 40 Glu Leu Leu Asp Leu Ser 45 Leu Ala 35 Asp Wall Asn His Gin Asn For Arg Gly His Thr Wall Leu His Wall Ala 50 55 60 Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 Ala Arg For Ser Asp Leu Thr Ser Asp Gly Lys Lys Ala Leu Gin Ile 85 90 95 Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe Thr Lys Ser Thr Glu Glu 100 ALIGN! 105 110 Gly Lys Ser Ala For Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gin 115 120 125 Ala Glu Arg Arg Asp For Leu Leu Gly Glu Ala Ser Leu Ser Leu Ala 130 135 140 Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160

Val Gly Leu Ala Lys

165 <210> 39 <211> 498 <212> DNA <213> Beta vulgaris

<221> CDS <222> (1). . (496) <223> Sugar beet <400> 39 g gca ttg gat tet gat gat gtt gag tta gtc aga atg ctt tta aaa gag 49 Ala Leu Asp Ser Asp

ege Arg cat aca act cta Leu gat Asp gat gca Asp Ala tat gcc Tyr Ala 25 ctt Leu cac His tat Tyr gct Ala 30 gtg Wall gca Ala 97 His Thr Thr 20 May cat tgt gat gcc aag acc acc acg gag ctt ctt gag ctt ggg ctt gca 145 His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala

40 45

133

gat gtt aat Asn ctt Leu aga Arg aat Asn cta agg ggt cac act gtg cta cat gtg gca Ala 193 Asp Wall 50 Leu 55 Arg Gly His Thr Wall 60 Leu His Wall gcc atg aga aaa gag cct aag ata att gta tcc ttg tta acc aag gga 241 Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 gcc cat ccg tet gat ata aca tca gat gat aaa aaa gca ctg cag ata 289 Ala His For Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu Gin Ile 85 90 95 gca aag aga cta aca aaa gct gtg gac ttc melt aaa act aca gaa caa 337 Ala Lys Arg Leu Thr Lys Ala Wall Asp Phe Tyr Lys Thr Thr Glu Gin 100 ALIGN! 105 110 gga aaa gat gca approx aag gat cgg ttg tgc att gaa ata ctg gag caa 385 Gly Lys Asp Ala For Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gin 115 120 125 gct gaa aga aga gaa approx ttg cta gga gaa ggt tet gtt tet ctt gca 433 Ala Glu Arg Arg Glu For Leu Leu Gly Glu Gly Ser Wall Ser Leu Ala 130 135 140 aag gca gga gat gat ctg cgt atg aag cta tta tray ctt gaa aat ega 481 Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160

497 gtt ggc ctt gct caa ct

Val Gly Leu, Ala Gin

165 <210> 40 <211> 165 <212> PRT <213> Beta vulgaris

<400> 40 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Arg Met 10 Leu Leu Lys 15 Dec Glu 1 5 Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala 35 40 45 Asp Wall Asn Leu Arg Asn Leu Arg Gly His Thr Wall Leu His Wall Ala 50 55 60 Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80

134

Ala His For Ser Asp 85 Ile Thr Ser Ala Lys Arg Leu 100 ALIGN! Thr Lys Ala Wall Gly Lys Asp 115 Ala For Lys Asp Arg 120 Ala Glu 130 Arg Arg Glu For Leu 135 Leu Lys 145 Ala Gly Asp Asp Leu 150 Arg Met Wall Gly Leu Ala Gin 165

Asp Asp 90 Lys Lys Ala Leu Gin 95 Ile Asp 105 Phe Tyr Lys Thr Thr 110 Glu Gin Leu Cys Ile Glu Ile 125 Leu Glu Gin Gly Glu Gly Ser 140 Wall Ser Leu Ala Lys Leu Leu 155 Tyr Leu Glu Asn Arg 160

<210> 41 <211> 497 <212> DNA <213> Helianthus annuus <220>

<221> CDS <222> (2) .. (496) <223> Sunflower A <400> 41g gca ttg gat tet gat gat gtt gag yta gtc aca atg tta tta ega gaa 49 Ala Leu Asp Ser Asp Asp Val Glu Xaa Val Thr Met

ggt Gly cat His act Thr tea tta gac ggt tet Asp Gly Ser tgc gct ctt Leu cat His tac Tyr gct Ala 30 gtt Wall gcg Ala 97 Ser 20 May Leu Cys 25 Ala tray gca gat gct aaa acg aca acc gaa tta ctg gat tta gca ctt gct 145 Tyr Ala Asp Ala Lys Thr Thr Thr Glu Leu Leu Asp Leu Ala Leu Ala 35 40 45 gac gta aat cat aaa aac tcg agg ggt ttt acc gta ctt cat gtt gcc 193 Asp Wall Asn His Lys Asn Ser Arg Gly Phe Thr Wall Leu His Wall Ala 50 55 60 gct atg aga aaa gag ccg agt att atc gtt tcg ctt ctt acg aaa ggg 241 Ala Met Arg Lys Glu For Ser Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 gcc ega ccc tcg gat ctc acc cct gat ggg aga aaa gca cta cag att 289 Ala Arg For Ser Asp Leu Thr For Asp Gly Arg Lys Ala Leu Gin Ile 85 90 95

135

tcg Ser aag Lys Agg ttg Arg Leu 100 ALIGN! acc Thr aga gcg gtt gac melt Tyr tac Tyr aag tea aac gag gat Asp 337 Arg Ala Wall Asp 105 Lys Ser Asn 110 Glu gat aaa gag tea acg aaa ggt cgt ttg tgt att gag ata ttg gaa caa 385 Asp Lys Glu Ser Thr Lys Gly Arg Leu Cys Xle Glu Ile Leu Glu Gin 115 120 125 gcc gaa aga aga aat approx ttg tta ggt gaa gct tcg gct tet ctt gca 433 Ala Glu Arg Arg Asn For Leu Leu Gly Glu Ala Ser Ala Ser Leu Ala 130 135 140 atg gcc gga gat gat ttg cgt gga aag ttg ttg tray ctt gaa aat ega 481 Met Ala Gly Asp Asp Leu Arg Gly Lys Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160

498 gtt ggc gct caa ct

Val Gly Leu, Ala Gin

165 <210> 42 <211> 165 <212> PRT <213> Helianthus annuus

<400> 42 Xaa Val Thr Met Leu Leu Arg Glu Ala 1 Leu Asp Ser Asp Asp 5 Wall Glu 10 15 Dec Gly His Thr Ser Leu Asp Gly Ser Cys Ala Leu His Tyr Ala Wall Ala 20 May 25 30 Tyr Ala Asp Ala Lys Thr Thr Thr Glu Leu Leu Asp Leu Ala Leu Ala 35 40 45 Asp Wall Asn His Lys Asn Ser Arg Gly Phe Thr Wall Leu His Wall Ala 50 55 60 Ala Met Arg Lys Glu For Ser Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 Ala Arg For Ser Asp Leu Thr For Asp Gly Arg Lys Ala Leu Gin Ile 85 90 95 Ser Lys Arg Leu Thr Arg Ala Wall Asp Tyr Tyr Lys Ser Asn Glu Asp 100 ALIGN! 105 110 Asp Lys Glu Ser Thr Lys Gly Arg Leu Cys Ile Glu Ile Leu Glu Gin 115 120 125 Ala Glu Arg Arg Asn For Leu Leu Gly Glu Ala Ser Ala Ser Leu Ala 130 135 140

136

Met Ala Gly Asp Asp Leu Arg Gly Lys Leu Leu Tyr Leu Glu

Val Gly Leu, Ala Gin

165

<210> 43 <211> 498 <212> DNA <213> Helianthus annuus <220> <221> CDS <222> (49) <223> Sunflower B

<400> 43 g gca ttg gac gat gat gat gtt gag ctt gtg aaa atg att tta gac gaa 49 Ala Leu

tcc Ser aaa atc acg tta gat gaa Glu gcc Ala tgc gct ctt Leu cat His tat Tyr gcg Ala 30 gtc Wall atg Met 97 Lys Ile Thr 20 May Leu Asp Cys 25 Ala melt tgt aat caa gaa gtt gct aag gag att ctt aac tta aac cgt gcg 145 Tyr Cys Asn Gin Glu Wall Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala 35 40 45 gat gtt aat ctt aga aac tca ega gat tray acc gtg ctt cat gtt gct 193 Asp Wall Asn Leu Arg Asn Ser Arg Asp Tyr Thr Wall Leu His Wall Ala 50 55 60 gcc atg cgt aaa gaa approx tca ctt att gtt tcg att cta age aaa ggc 241 Ala Met Arg Lys Glu For Ser Leu Ile Wall Ser Ile Leu Ser Lys Gly 65 70 75 80 gcg tgt gca tcg gat act act ttt gat gga caa agt gcg gtt agt att 289 Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95 tgc agg aga ega aca agg ccc aag gat melt melt gtg aaa acc gaa cac 337 Cys Arg Arg Arg Thr Arg For Lys Asp Tyr Tyr Wall Lys Thr Glu His 100 ALIGN! 105 110 ggg caa gaa aca aat aaa gat cgt ata tgc atc gat gtt ttg gag cgg 385 Gly Gin Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Wall Leu Glu Arg 115 120 125

137

gaa Glu ata Ile 130 aag Lys agg Arg aat Asn ccg Pro atg Met 135 ata Ile gca gtg gct gat gat ttg cat atg Ala Wall Ala Asp Asp Leu His Met 145 150 gtt ggc ctt gct caa ct Wall Gly Leu Ala Gin 165

ggc Gly gat Asp gtt Wall tcc gtg tgt tet Ser tea Ser 433 Ser 140 Wall Cys aat tta ctc tray ttt gaa aat ega 481 Asn Leu Leu Tyr Phe Glu Asn Arg 155 160

498 <210> 44 <211> 165 <212> PRT <213> Helianthus annuus

Ala Leu Asp 1 Ser Asp 5 Asp Val Glu Leu Val 10 Lys Met Ile Leu Asp 15 Dec Glu Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala Leu His Tyr Ala Wall Met 20 May 25 30 Tyr Cys Asn Gin Glu Wall Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala 35 40 45 Asp Wall Asn Leu Arg Asn Ser Arg Asp Tyr Thr Wall Leu His Wall Ala 50 55 60 Ala Met Arg Lys Glu For Ser Leu Ile Wall Ser Ile Leu Ser Lys Gly 65 70 75 80 Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95 Cys Arg Arg Arg Thr Arg For Lys Asp Tyr Tyr Wall Lys Thr Glu His 100 ALIGN! 105 110 Gly Gin Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Wall Leu Glu Arg 115 120 125 Glu Ile Lys Arg Asn For Met Ile Gly Asp Wall Ser Wall Cys Ser Ser 130 135 140 Ala Wall Ala Asp Asp Leu His Met Asn Leu Leu Tyr Phe Glu Asn Arg 145 150 155 160

Val Gly Leu, Ala Gin

165

138 <210> 45 <211> 652 <212> DNA <213> Solanum tuberosum <220>

<221> CDS <222> (1) .. (652) <223> Potato Α <400> 45

gak att att gtc Ile Val aag Lys 5 tet Ser aat Asn gtt Wall gat Asp atc Ile 10 ata Ile acc ctt gat Asp aag Lys 15 Dec tcc Ser 48 Xaa 1 Ile Thr Leu ttg cct cat gac atc gta aaa caa atc act gat tca cgt gct gaa ctt 96 Leu For His Asp Ile Wall Lys Gin Ile Thr Asp Ser Arg Ala Glu Leu 20 May 25 30 ggt cta caa ggg cct gaa agc aat ggt ttt cct gat aaa cat gtt aag 144 Gly Leu Gin Gly For Glu Ser Asn Gly Phe For Asp Lys His Wall Lys 35 40 45 agg ata cat agg gca ttg gac tet gat gat gtt gag tta cta agg atg 192 Arg Ile His Arg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu Arg Met 50 55 60 ttg ctt aaa gaa ggg cat act act ctc gat gat gca melt gct ctc cac 240 Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His 65 70 75 80 melt gct gta gca melt tgc gat gca aag act aca gca gaa ctt tta gat 288 Tyr Ala Wall Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp 85 90 95 ctt tca ctt gct gat gtt aat cat caa aat cct aga gga tray acg gta 336 Leu Ser Leu Ala Asp Wall Asn His Gin Asn For Arg Gly Tyr Thr Wall 100 ALIGN! 105 110 ctt cat gtt gct gcc atg agg aaa gag cct aaa att ata gtg tcc ctt 384 Leu His Wall Ala Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu 115 120 125 tta acc aaa gga gct aga cct tet gat ctg aca tet gat ggc aaa aaa 432 Leu Thr Lys Gly Ala Arg For Ser Asp Leu Thr Ser Asp Gly Lys Lys 130 135 140 gca ctt caa att gct aag agg ctc act agg ctt gtg gat ttt act aag 480 Ala Leu Gin Ile Ala Lys Arg Leu Thr Arg Leu wall Asp Phe Thr Lys 145 150 155 160 tet aca gag gaa gga aaa tet gct approx aaa gat cgg tta tgc att gag 528 Ser Thr Glu Glu Gly Lys Ser Ala For Lys Asp Arg Leu Cys Ile Glu 165 170 175

139

att Ile ctg gag caa gca gaa aga aga gat Asp 185 approx cta cta gga gaa Glu 190 get Ala tea Ser 576 Leu Glu Gin 180 Ala Glu Arg Arg For Leu Leu Gly tta tet ctt get atg gca ggc gat gat ttg cgt atg aag ctg tta tray 624 Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr 195 200 205 ctt gaa aat ega gtt ggc ctk get caa ct 653 Leu Glu Asn Arg Wall Gly Xaa Ala Gin 210 215

<210> 46 <211> 217 <212> PRT <213> - Solanum tuberosum

<400> 46 Lys 5 Ser Asn Wall Asp Ile 10 Ile Thr Leu Asp Lys 15 Dec Ser Xaa 1 Ile Ile Wall Leu For His Asp Ile Wall Lys Gin Ile Thr Asp Ser Arg Ala Glu Leu 20 May 25 30 Gly Leu Gin Gly For Glu Ser Asn Gly Phe For Asp Lys His Wall Lys 35 40 45 Arg Ile His Arg Ala Leu Asp Ser Asp Asp Wall Glu Leu Leu Arg Met 50 55 60 Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His 65 70 75 80 Tyr Ala Wall Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp 85 90 95 Leu Ser Leu Ala Asp Wall Asn His Gin Asn For Arg Gly Tyr Thr Wall 100 ALIGN! 105 110 Leu His Wall Ala Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu 115 120 125 Leu Thr Lys Gly Ala Arg For Ser Asp Leu Thr Ser Asp Gly Lys Lys 130 135 140 Ala Leu Gin Ile Ala Lys Arg Leu Thr Arg Leu Wall Asp Phe Thr Lys 145 150 155 160 Ser Thr Glu Glu Gly Lys Ser Ala For Lys Asp Arg Leu Cys Ile Glu 165 170 175

· * «« «« Φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ · ·· ·· «φ ·· ·

Ile Leu

Leu Ser

Leu Glu

210

Glu Gin

180

Leu Ala

195

Asn Arg

Ala Glu

Met Ala

Val Gly

Arg Arg

Gly Asp

200

Xaa Ala

215

140

Asp Pro

185

Asp Leu

Gin

Leu Leu

Arg Met

Gly Glu

190

Lys Leu

205

Ala Ser

Leu Tyr <210> 47 <211> 497 <212> DNA <213> Solanum tuberosum <220>

<221> CDS

<222> (49) <223> Potato (B) <400> 47 g gca ttg gat tea gat gat gtt gag ttt gtc aag ctt cta ctt aat gag 4 9 Ala Leu Asp Ser Asp Asp Wall Glu Phe Wall Lys Leu Leu Leu Asn Glu 1 5 10 15 Dec

tet gac Ser Asp ata agt tta gat Leu Asp gga gcc Gly Ala tac get ctt Leu cat His tray Tyr get Ala 30 gtt Wall gca Ala 97 Ile Ser 20 May Tyr 25 Ala melt tgt gac ccc aag gtt gtt act gag gtt ctt gga ctg ggt gtt get 145 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 aat gtc aac ctt cgg aat aca cgt ggt tray act gtg ctt cac att get 193 Asn Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 gcc atg cgt aag gaa ccc tea atc att gta tea ctt ttg act aag gga 241 Ala Met Arg Lys Glu For Ser Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 get cat gca tea gaa att aca ttg gat ggg cag agt get gtt ggc atc 289 Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gin Ser Ala Wall Gly Ile 85 90 95 tgt agg agg ctg agt agg cct aag gag tray cat gca aaa aca gaa caa 337 Cys Arg Arg Leu Ser Arg For Lys Glu Tyr His Ala Lys Thr Glu Gin 100 ALIGN! 105 110 ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125

141

gag Glu atg Met 130 cgt Arg cac His aac Asn approx For atg Met 135 acc Thr atg ttg gcc gat gat ctg ccc atg Met Leu Ala Asp Asp Leu For Met 145 150 gtt ggc ctt gct aaa ct Wall Gly Leu Ala Lys 165

gga Gly gat Asp gca Ala tta Leu 140 ttt Phe tet Ser tcc Ser ccc For 433 aaa ctg ctc tray ctt gaa aat ega 481 Lys Leu Leu Tyr Leu Glu Asn Arg 155 160

498 <210> 48 <211> 165 <212> PRT <213> Solanum tuberosum

Ala 1 Leu Asp Ser Asp Asp Val 5 Glu Phe Val Lys 10 Leu Leu Leu Asn 15 Dec Glu Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 Asn Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 Ala Met Arg Lys Glu For Ser Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gin Ser Ala Wall Gly Ile 85 90 95 Cys Arg Arg Leu Ser Arg For Lys Glu Tyr His Ala Lys Thr Glu Gin 100 ALIGN! 105 110 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125 Glu Met Arg His Asn For Met Thr Gly Asp Ala Leu Phe Ser Ser For 130 135 140 Met Leu Ala Asp Asp Leu For Met Lys Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160

Val Gly Leu Ala Lys

166 «♦ • ·

142 <210> 49 <211> 478 <212> DNA <213> Solanum tuberosum <220>

<221> CDS

<222> (47) <223> Potato C <400> 49 g gca ctg gac tet gat gat gtt gag ttt gtc aag ctt cta ctt aat gag 49 Ala Leu Asp Ser Asp Asp Wall Glu Phe Wall Lys Leu Leu Leu Asn Glu 1 5 10 15 Dec

tet gac ata agt tta gat gga gcc tac gct Tyr Ala 25 ctt Leu cat His tray Tyr gct Ala 30 gtt gca 97 Ser Asp Ile Ser 20 May Leu Asp Gly Ala Wall Ala melt tgt gac ccc aag gtt gtt act gag gtt ctt gga ctg ggt gtt gct 145 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 aat gtc aac ctt cgg aat aca cgt ggt tray act gtg ctt cac att gct 193 Asn Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 gcc atg cgt aag gaa ccc tea atc att gta tea ctt ttg act aag gga 241 Ala Met Arg Lys Glu For Ser Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 gct cat gca tea gaa att aca ttg gat ggg cag agt gct gtt agc atc 289 Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95 tgt agg agg ctg act agg cct aag gag tray cat gca aaa aca gaa caa 337 Cys Arg Arg Leu Thr Arg For Lys Glu Tyr His Ala Lys Thr Glu Gin 100 ALIGN! 105 110 ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125 gag atg cgt ege aac approx atg acc gga gat gca tta ttt tet tcc ccc 433 Glu Met Arg Arg Asn For Met Thr Gly Asp Ala Leu Phe Ser Ser For 130 135 140 atg aaa cag ctc tray ctt gaa aat aga gtt ggc ctt gct aaa ct 477 Met Lys Gin Leu Tyr Leu Glu Asn Arg Wall Gly Leu Ala Lys 145 150 155

<210> 50 <211> 158

143 <212> PRT <213> Solanum tuberosum

<400> 50 Asp Wall Glu Phe Wall 10 Lys Leu Leu Leu Asn 15 Dec Glu Ala Leu 1 Asp Ser Asp 5 Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu Gly Wall Ala 35 40 45 Asn Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu His Ile Ala 50 55 60 Ala Met Arg Lys Glu For Ser Ile Ile Wall Ser Leu Leu Thr Lys Gly 65 70 75 80 Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gin Ser Ala Wall Ser Ile 85 90 95 Cys Arg Arg Leu Thr Arg For Lys Glu Tyr His Ala Lys Thr Glu Gin 100 ALIGN! 105 110 Gly Gin Glu Ala Asn Lys Asp Arg Wall Cys Ile Asp Wall Leu Glu Arg 115 120 125 Glu Met Arg Arg Asn For Met Thr Gly Asp Ala Leu Phe Ser Ser For 130 135 140 Met Lys Gin Leu Tyr Leu Glu Asn Arg Wall Gly Leu Ala Lys 145 150 155

<210> 51 <211> 501 <212> DNA <213> Brassica napus <220>

<221> CDS <222> (2) .. (499) <223> Kanola A <400> 51g gca ttg gat gat gat gat gtt gag ttt gg aag ttg ctt ttg act gag 49 Ala Leu Phe Val Lys Leu Leu Leu Thr Glu 15 1015 tea gat gc gat gat gat gat gat gat gat gat gat gat gat gat gt gt gt

Ser Asp Ile Thr Leu As Glu Ala Asn His Tyr Ser Val Val

2530

144

tat Tyr agt gat ccc For aaa Lys gtt Wall gtt gcc gag att Ile ctt Leu act Thr ctt Leu 45 gat atg ggt Gly 145 Ser Asp 35 Wall Ala Glu 40 Asp Met gat gtc aac cac aga aac tea cgt ggc tray acg gtt ctt cat ctc gca 193 Asp Wall Asn His Arg Asn Ser Arg Gly Tyr Thr Wall Leu His Leu Ala 50 55 60 gcc atg ege aaa gag ccg tcc atc atc ata tet ctt ctc aag aga ggt 241 Ala Met Arg Lys Glu For Ser Ile Ile Ile Ser Leu Leu Lys Arg Gly 65 70 75 80 gcc aat gcg tet ggc ttc acg tgt gat gga ege agt gcg gtt aat ata 289 Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Wall Asn Ile 85 90 95 tgt aga aga ttg aca act approx aag gat melt cat acg aaa aca gct gcg 337 Cys Arg Arg Leu Thr Thr For Lys Asp Tyr His Thr Lys Thr Ala Ala 100 ALIGN! 105 110 aaa ggg agg gaa gct agt aaa gca cgg tta tgt ata gat ctc ttg gaa 385 Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu 115 120 125 aga gaa gta agg agg aac cct atg gtt gtt gat tea approx atg tgt tcc 433 Arg Glu Wall Arg Arg Asn For Met Wall Wall Asp Ser For Met Cys Ser 130 135 140 ctt tet atg cct gaa gat ctc caa atg aga ctg tta tray ctt gaa aat 481 Leu Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu Glu Asn 145 150 155 160 ega gtt ggc ctt gct caa ct 501 Arg Wall Gly Leu Ala Gin

165 <210> 52 <211> 166 <212> PRT <213> Brassica napus

<400> 52 Ala Leu Asp Ser Asp Asp Wall Glu Phe Wall Lys Leu Leu Leu Thr Glu 1 5 10 15 Dec Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Wall Wall 20 May 25 30

Tyr Ser Asp Lys Val Val Glu Ile Leu Thr Leu Asp Met Gly

40 44 • ·

145

Asp Val Asn 50 His Arg Asn Ser Arg Gly 55 Tyr Thr Wall 60 Leu His Leu Ala Ala Met Arg Lys Glu For Ser Ile Ile Ile Ser Leu Leu Lys Arg Gly 65 70 75 80 Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Wall Asn Ile 85 90 95 Cys Arg Arg Leu Thr Thr For Lys Asp Tyr His Thr Lys Thr Ala Ala 100 ALIGN! 105 110 Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu 115 120 125 Arg Glu Wall Arg Arg Asn For Met Wall Wall Asp Ser For Met Cys Ser 130 135 140 Leu Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu Glu Asn 145 150 155 160 Arg Wall Gly Leu Ala Gin

165 <210> 53 <211> 501 <212> DNA <213> Brassica napus <220>

<221> CDS <222> (2) .. (499) <223> Kanola B <400> 53g gca ttg gat gat gat gat gtt gag ttt gg aag ctt ctt ttg acc gag 49 Ala Leu Phe Val Lys Leu Leu Leu Thr Glu

tca gat atc Ile act Thr 20 May cta gat gaa gcc aat Asn 25 ggt Gly ctt Leu cat His tac Tyr tca gtg Ser Val 30 gtg Val 97 Ser Asp Leu Asp Glu Ala melt agt gat ccc aaa gtt gtt gcc gag att ctt act ctt gat atg ggt 145 Tyr Ser Asp For Lys Wall Wall Ala Glu Ile Leu Thr Leu Asp Met Gly 35 40 45 gat gtt aac cac aga aac tca cgt ggc tray acg gtt ctg cat ctc gca 193 Asp Wall Asn His Arg Asn Ser Arg Gly Tyr Thr Wall Leu His Leu Ala 50 55 60

♦ · • · • ♦ 9 9 • 9 • • • • • · 9 9 • 9 Φ ♦ • • • ·· • · 9 • • • • • ♦ • · · 9 9 9 9 • • · • • • • • · 9 9 • «« • • · ♦ · 99 9 9 · ♦ Φ · ·

146

gcc Ala 65 atg Met ege Arg aaa Lys gag Glu ccg For 70 tcc Ser atc Ile atc Ile ata Ile tet Ser 75 ctt Leu ctc Leu aag Lys aaa Lys ggt Gly 80 241 gcc aat gcg tet ggc ttc acc tgt gat gga ege agt gcg gtt aat ata 289 Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Wall Asn Ile 85 90 95 tgt aga aga ttg aca act approx aag gat melt cat act aaa aca gct gcg 337 Cys Arg Arg Leu Thr Thr For Lys Asp Tyr His Thr Lys Thr Ala Ala 100 ALIGN! 105 110 aaa ggg agg gaa gct agt aaa gca cgg tta tgt ata gat ctc ttg gaa 385 Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu 115 120 125 aga gaa gta agg agg aac cct atg gtt gtt gag tea approx atg tgt tet 433 Arg Glu Wall Arg Arg Asn For Met Wall Wall Glu Ser For Met Cys Ser 130 135 140 ctt tet atg cct gaa gat ctc caa atg aga ctg tta tray ctt gaa aat 481 Leu Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu Glu Asn 145 150 155 160 ega gtt ggc ctg gct caa ct 501 Arg Wall Gly Leu Ala Gin

165 <210> 54 <211> 166 <212> PRT <213> Brassica napus

<400> 54 Asp Val Glu Phe Val 10 Lys Leu Leu Leu Thr 15 Dec Glu Ala Leu 1 Asp Ser Asp 5 Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Wall Wall 20 May 25 30 Tyr Ser Asp For Lys Wall Wall Ala Glu Ile Leu Thr Leu Asp Met Gly 35 40 45 Asp Wall Asn His Arg Asn Ser Arg Gly Tyr Thr Wall Leu His Leu Ala 50 55 60 Ala Met Arg Lys Glu For Ser Ile Ile Ile Ser Leu Leu Lys Lys Gly 65 70 75 80

Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile 85 90 95 9 9 9 99

9 9 9 9 9 99

9 9 99 9 9 9 9 ·

147

Cys Arg Arg Leu 100 ALIGN! Thr Thr For Lys Asp 105 Tyr His Thr Lys Thr 110 Ala Ala Lys Gly Arg 115 Glu Ala Ser Lys Ala 120 Arg Leu Cys Ile Asp 125 Leu Leu Glu Arg Glu 130 Wall Arg Arg Asn For 135 Met Wall Wall Glu Ser 140 For Met Cys Ser Leu 145 Ser Met For Glu Asp 150 Leu Gin Met Arg Leu 155 Leu Tyr Leu Glu Asn 160 Arg Wall Gly Leu Ala Gin

165

<210> 55 <211> 498 <212> DNA <213> Brassica napus

<220>

<221> CDS <222> (2) .. (496) <223> Kanola C <400> 55g gca ctg gat tet gat gat gtt gag ctt gtg aag ctt ctt ttg acc gag 49 Ala Leu Leu Val Lys Leu Leu Leu Thr Glu

tea Ser gat Asp atc Ile act Thr 20 May cta gat gaa gcc aat Asn 25 ggt Gly ctg Leu cat His tray Tyr tea Ser 30 gtg Val gtg Wall 97 Leu Asp Glu Ala melt agt gat ccc aaa gtt gtt gca gag ata ctt gcc ctt ggt tta ggt 145 Tyr Ser Asp For Lys Wall Wall Ala Glu Ile Leu Ala Leu Gly Leu Gly 35 40 45 gat gtc aat cac aga aac tea cgt ggc tray tcg gtt ctt cat ttc gct 193 Asp Wall Asn His Arg Asn Ser Arg Gly Tyr Ser Wall Leu His Phe Ala 50 55 60 gcc atg cgt aga gag cct tcc atc atc ata tet ctt ctc aag gaa ggc 241 Ala Met Arg Arg Glu For Ser Ile Ile Ile Ser Leu Leu Lys Glu Gly 65 70 75 80 gcc aat gcg tet agc ttc act ttt gat gga ege agt gcg gtt aat ata 289 Ala Asn Ala Ser Ser Phe Thr Phe Asp Gly Arg Ser Ala Wall Asn Ile 85 90 95

337

148

tgt Cys agg aga ctg Arg Arg Leu 100 ALIGN! aca Thr act Thr cca aag Pro Lys gat Asp 105 melt Tyr cat His aca aag and aca tcc aaa Thr Lys 110 aag agg gaa get agt aaa gca agg ctg tgc ata gat ctc ttg gaa aga Lys Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg 115 120 125 gag gtt agg agg aac cct atg Ctt get gat acg approx atg tgt tea ctt Glu Wall Arg Arg Asn For Met Leu Ala Asp Thr For Met Cys Ser Leu 130 135 140 act atg cct gaa gat ctc caa atg aga ctg tta tray ctt gaa aat ega Thr Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160 gtt ggt ctt get aaa ct Wall Gly Leu Ala Lys 165 <210> 56 <211> 165 <212> PRT <213> Brassica napus <400> 56 Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu Leu Thr Glu 1 5 10 15 Dec Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Wall Wall 20 May 25 30 Tyr Ser Asp For Lys Wall Wall Ala Glu Ile Leu Ala Leu Gly Leu Gly 35 40 45 Asp Wall Asn His Arg Asn Ser Arg Gly Tyr Ser Wall Leu His Phe Ala 50 55 60 Ala Met Arg Arg Glu For Ser Ile Ile Ile Ser Leu Leu Lys Glu Gly 65 70 75 80 Ala Asn Ala Ser Ser Phe Thr Phe Asp Gly Arg Ser Ala Wall Asn Ile 85 90 95 Cys Arg Arg Leu Thr Thr For Lys Asp Tyr His Thr Lys Thr Ser Lys 100 ALIGN! 105 110 Lys Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg 115 120 125 Glu Wall Arg Arg Asn For Met Leu Ala Asp Thr For Met Cys Ser Leu 130 135 140

385

433

481

498

Thr Met Pro Glu Asp Leu Gin Met Leu Leu Tyr Leu Glu Asn Arg

145 150 155 160

• · * · ·· • · • · • • · • · • · · • • ··· • · «· • · • · • · • · · · # ♦ · • · • • «· • · • • · ·· ♦ · • · • · · «·

149

Val Gly Leu Ala Lys

165 <210> 57 <211> 498 <212> DNA <213> Brassica napus <220>

<221> CDS <222> (2) .. (496) <223> Kanola D <400> 57g gca ctg gac tet gat gat gtt gag ctt gtc aag atg ctt ttg aca gaa 49 Ala Leu Leu Val Lys Met Leu Leu Thr Glu

gga cac Gly His acg Thr agt Ser 20 May cac gac gac gcc Ala tray Tyr 25 gct Ala ctt Leu cac His tac Tyr gct Ala 30 gtt Val gca Ala 97 Leu Asp Asp cat tcc gat gtg aag acg gcc tet gat ctc ata gac ctt gag ctt gcg 145 His Ser Asp Wall Lys Thr Ala Ser Asp Leu Ile Asp Leu Glu Leu Ala 35 40 45 gat gtt gac cat aga aac ctg agg ggg tray acg gcg ctt cac gtt gct 193 Asp Wall Asp His Arg Asn Leu Arg Gly Tyr Thr Ala Leu His Wall Ala 50 55 60 gcg atg agg aac gag ccg aag ctg atg gtt melt tta ttg act aaa ggt 241 Ala Met Arg Asn Glu For Lys Leu Met Wall Tyr Leu Leu Thr Lys Gly 65 70 75 80 gcg aat gcg tcg gag aca acg ttt gac ggt aga acg gct ctt gtg att 289 Ala Asn Ala Ser Glu Thr Thr Phe Asp Gly Arg Thr Ala Leu Wall Ile 85 90 95 gca aaa aga ctc act aaa gct tet gag melt aat gct agt acg gag caa 337 Ala Lys Arg Leu Thr Lys Ala Ser Glu Tyr Asn Ala Ser Thr Glu Gin 100 ALIGN! 105 110 ggg aag cct tet ctg aaa gga ggg cta tgc ata gag gta cta gag cat 385 Gly Lys For Ser Leu Lys Gly Gly Leu Cys Ile Glu Wall Leu Glu His 115 120 125 gcg. cgg aaa cta ggt agg ttg cct aga gat ggt tta cct tet ctt approx 433 Ala Arg Lys Leu Gly Arg Leu For Arg Asp Gly Leu For Ser Leu For 130 135 140

• 9 • · · · ·

150

gct Ala 145 act Thr cct For gat Asp gaa Glu ctg Leu 150 agg and agg ttg ctc tac Tyr ctt gaa aat Asn ega Arg 160 481 Arg Met Arg Leu Leu 155 Leu Glu gtt ggc ctg gct caa ct 498 Wall Gly Leu Ala Gin

165 <210> 58 <211> 165 <212> PRT <213> Brassica napus

Ala 1 Leu Asp Ser Asp Asp Val 5 Glu Leu Wall 10 Lys Met Leu Leu Thr 15 Dec Glu Gly His Thr Ser Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Wall Ala 20 May 25 30 His Ser Asp Wall Lys Thr Ala Ser Asp Leu Ile Asp Leu Glu Leu Ala 35 40 45 Asp Wall Asp His Arg Asn Leu Arg Gly Tyr Thr Ala Leu His Wall Ala 50 55 60 Ala Met Arg Asn Glu For Lys Leu Met Wall Tyr Leu Leu Thr Lys Gly 65 70 75 80 Ala Asn Ala Ser Glu Thr Thr Phe Asp Gly Arg Thr Ala Leu Wall Ile 85 90 95 Ala Lys Arg Leu Thr Lys Ala Ser Glu Tyr Asn Ala Ser Thr Glu Gin 100 ALIGN! 105 110 Gly Lys For Ser Leu Lys Gly Gly Leu Cys Ile Glu Wall Leu Glu His 115 12 0 125 Ala Arg Lys Leu Gly Arg Leu For Arg Asp Gly Leu For Ser Leu For 130 135 140 Ala Thr For Asp Glu Leu Arg Met Arg Leu Leu Tyr Leu Glu Asn Arg 145 150 155 160

Val Gly Leu, Ala Gin

165 <210> 59 <211> 31 <212> DNA

151 <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM 3A <400> 59 tagatgawgc mtaygctcty caytatgctg t <210> 60 <211> 32 <212> DNA <213> Artificial sequence <220>

<223> Artificial sequence description: PCR primer NIM 3B <400> 60 ggctcyttmc kcatggcagc aayrtgaags ac <210> 61 <211> 148 <212> DNA <213> Lycopersicon esculentum <220>

<221> CDS <222> (4) .. (147) <223> Tomato B <400> 61

tag atg Met 1 atg Met cat His atg Met ctc Leu 5 ttc Phe att Ile atg ctg ttg cat att gtg acc Thr approx For 15 Dec 48 Met Leu Leu 10 His Ile Wall agg ttg ttg ctg agg ttc ttg gac tgg gtg ttg cta atg tca acc ttc 96 Arg Leu Leu Leu Arg Phe Leu Asp Trp Wall Leu Leu Met Ser Thr Phe 20 May 25 30 gga atg cac gtg gtt aca ctg tcc ttc acg ttg ctg approx tgc gga aag 144 Gly Met His Wall Wall Thr Leu Ser Phe Thr Leu Leu For Cys Gly Lys 35 40 45

agc c Ser <210> 62 <211> 48 <212> PRT <213> - Lycopersicon esculentum <400> 62

148

152

Met 1 Met His Met Leu 5 Phe Ile Met Leu Leu 10 His Ile Wall Thr For 15 Dec Arg Leu Leu Leu Arg 20 May Phe Leu Asp Trp Wall 25 Leu Leu Met Ser Thr 30 Phe Gly Met His Wall Wall Thr Leu Ser Phe Thr Leu Leu For Cys Gly Lys Ser

40 <210> 63 <211> 2296 <212> DNA <213> Beta vulgaris <220>

<221> CDS <222> (113) .. (1927) <223> full length cDNA sequence, sugar beet <400> 63 cacacacaca cccgacgccg tatgcgtatc cattctctct cctcaacctc

Met Thr

acc Thr acc Thr tcc Ser 5 aca Thr aca Thr atg Met gtg Val atc Ile 10 gat Asp tet Ser ege Arg acc Thr gct Ala 15 Dec ttc Phe tcc Ser gat Asp 166 tcc aac gac atc age aat ggc agt age atc tgc tgc gtc gcc gca aca 214 Ser Asn Asp Ile Ser Asn Gly Ser Ser Ile Cys Cys Wall Ala Ala Thr 20 May 25 30 aca act aca aca aca acc gcc gca gaa aac tet ctc tcc ttt act ccc 262 Thr Thr Thr Thr Thr Thr Ala Ala Glu Asn Ser Leu Ser Phe Thr For 35 40 45 50 gac gcc gcc gct ctt ctc ege ctc tet gaa aac ctc gac tcg ctt ttc 310 Asp Ala Ala Ala Leu Leu Arg Leu Ser Glu Asn Leu Asp Ser Leu Phe 55 60 65 caa ccc tcg ctt tet ctc tcc gac tcc gac tet ttc gcc gac gct aaa 358 Gin For Ser Leu Ser Leu Ser Asp Ser Asp Ser Phe Ala Asp Ala Lys 70 75 80 atc gtc gtt tcc ggt gat tcg cgt gaa gtc gcc gtt cat cgg tgt gtt 406 Ile Wall Wall Ser Gly Asp Ser Arg Glu Wall Ala Wall His Arg Cys Wall 85 90 95

• W ·· • * · • e ·· <

• · · · · · · · · · · · · · · · · · · · · · · · ·

9 · t «· * 99 99 99 99 99

153

ctc tcg tet cgg age tcg Ser ttc Phe 105 ttt Phe cgg tcc gct ttt gct Phe Ala 110 tcg Ser aaa Lys ega Arg 454 Leu Ser Ser 100 ALIGN! Arg Ser Arg Ser Ala gag aag gag aag gag agg gat aaa gag aga gtg gtg aag ctt gag ctt 502 Glu Lys Glu Lys Glu Arg Asp Lys Glu Arg Wall Wall Lys Leu Glu Leu 115 120 125 130 aag gat tta gct ggt gat ttt gag gtt gga ttt gat tcg gtt gtt gcg 550 Lys Asp Leu Ala Gly Asp Phe Glu Wall Gly Phe Asp Ser Wall Wall Ala 135 140 145 gtt tta ggt melt ttg melt agt ggc aaa gtt agg aat ttg cct aga gga 598 Wall Leu Gly Tyr Leu Tyr Ser Gly Lys Wall Arg Asn Leu For Arg Gly 150 155 160 att tgt gtt tgt gtt gat gag gat tgc tet cat gaa gct tgt cgt cct 646 Ile Cys Wall Cys Wall Asp Glu Asp Cys Ser His Glu Ala Cys Arg For 165 170 175 gct gtt gat ttt gtt gtt gag gtt ctc melt ttg tet cac aaa ttc gag 694 Ala Wall Asp Phe Wall Wall Glu Wall Leu Tyr Leu Ser His Lys Phe Glu 180 185 190 att gtc gaa ttg gtt tcg ctt melt cag agg cac cta ctg gat att ctt 742 Ile Wall Glu Leu Wall Ser Leu Tyr Gin Arg His Leu Leu Asp Ile Leu 195 200 205 210 gac aag att gca approx gat gac gtt cta gta gtg tta tet gtc gct gag 790 Asp Lys Ile Ala For Asp Asp Wall Leu Wall Wall Leu Ser Wall Ala Glu 215 220 225 atg tgt gga aat gcg tgt gac gga ttg ctg gca agg tgt att gac aag 838 Met Cys Gly Asn Ala Cys Asp Gly Leu Leu Ala Arg Cys Ile Asp Lys 230 235 240 att gtg agg tcc gat att gac gta acc acc att gat aaa tcc ttg ccg 886 Ile Wall Arg Ser Asp Ile Asp Wall Thr Thr Ile Asp Lys Ser Leu For 245 250 255 cag aat gtt gtg aaa cag ata atc gac acg ega aag gaa ctt ggg ttt 934 Gin Asn Wall Wall Lys Gin Ile Ile Asp Thr Arg Lys Glu Leu Gly Phe 260 265 270 act gaa cct ggg cgt gtt gag ttt cct gat aag cat gtg aag aga ata 982 Thr Glu For Gly Arg Wall Glu Phe For Asp Lys His Wall Lys Arg Ile 275 280 285 290 cac aga gct ttg gaa tcc gat gat gta gag tta gtc aga atg ctt tta 1030 His Arg Ala Leu Glu Ser Asp Asp Wall Glu Leu Wall Arg Met Leu Leu 295 300 305

E· »· 00 00 00 0 • • 0 0 0 0 0 0 · • 0 • · • U 0 0 0 0 0 0 0 • · 0 0 0 0 0 000 0 0 0 0 • • 0 0 0 0 0 0 < 0 »< 0 » 0 » 00 00 000

154

aaa Lys gag Glu cgc Arg cat His 310 aca Thr act Thr cta Leu gat Asp gat Asp 315 gca Ala melt Tyr gcc Ala ctt Leu cac His 320 melt Tyr gct Ala 1078 gtg gca cat tgt gat gcc aag acc acc acg gag ctt ctt gag ctt ggg 1126 Wall Ala His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly 325 33 0 335 ctt gca gat gtt aat ctt aga aat cta agg ggt cac act gtg cta cat 1174 Leu Ala Asp Wall Asn Leu Arg Asn Leu Arg Gly His Thr Wall Leu His 340 345 350 gtg gca gcc atg aga aaa gag cct aag ata att gta tcc ttg tta acc 1222 Wall Ala Ala Met Arg Lys Glu For Lys Ile Ile Wall Ser Leu Leu Thr 355 360 365 370 aag gga gcc cat ccg tet gat ata aca tea gat gat aaa aaa gca ctg 1270 Lys Gly Ala His For Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu 375 380 385 cag ata gca aag aga cta aca aaa gct gtg gac ttc melt aaa act aca 1318 Gin Ile Ala Lys Arg Leu Thr Lys Ala Wall Asp Phe Tyr Lys Thr Thr 390 395 400 gaa caa gga aaa gat gca approx aag gat cgg ttg tgc att gaa ata ctg 1366 Glu Gin Gly Lys Asp Ala For Lys Asp Arg Leu Cys Ile Glu Ile Leu 405 410 415 gag caa gct gaa aga aga gaa approx ttg cta gga gaa ggt tet gtt tet 1414 Glu Gin Ala Glu Arg Arg Glu For Leu Leu Gly Glu Gly Ser Wall Ser 420 425 430 ctt gca aag gca gga gat gat ctg cgt atg aag cta tta melt ctt gaa 1462 Leu Ala Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu 435 440 445 450 aat aga gtt gca ctt gct cgg ttg ctc ttt approx atg gaa gcg aaa gtg 1510 Asn Arg Wall Ala Leu Ala Arg Leu Leu Phe For Met Glu Ala Lys Wall 455 460 465 gct atg gat att gct caa gtg gac gga act tet gaa ttc aca ttg tea 1558 Ala Met Asp Ile Ala Gin Wall Asp Gly Thr Ser Glu Phe Thr Leu Ser 470 475 480 aag aat ata gct gat gca ega aga aat gcg gtg gac ttg aat gag gct 1606 Lys Asn Ile Ala Asp Ala Arg Arg Asn Ala Wall Asp Leu Asn Glu Ala 485 490 495 ccc ttt ata ttg aaa gag gag cat ttg cag agg atg aaa gca ctg tet 1654 For Phe Ile Leu Lys Glu Glu His Leu Gin Arg Met Lys Ala Leu Ser 500 505 510

155

aaa act gtt Wall gag Glu ctt Leu ggc Gly 520 aag Lys cgt Arg ttc Phe ttt Phe cca ege For Arg 525 tgc Cys tcc gat Ser Asp gtt Wall 530 1702 Lys 515 Thr ctt aat aag att atg gac gcc gaa gat cta tca cag ctt gca ttt tta 1750 Leu Asn Lys Ile Met Asp Ala Glu Asp Leu Ser Gin Leu Ala Phe Leu 535 540 545 gga aaa gat act approx gag gaa cgg caa agg aag aga aaa ega tray ctt 1798 Gly Lys Asp Thr For Glu Glu Arg Gin Arg Lys Arg Lys Arg Tyr Leu 550 555 560 gaa ctg caa gac gct tta act aag gct ttt aca gag gac aaa gaa gag 1846 Glu Leu Gin Asp Ala Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu 565 570 575 ttt gac cgt tet aca tta tca tca tcg tcg tcg tcg act approx atg ggg 1894 Phe Asp Arg Ser Thr Leu Ser Ser Ser Ser Ser Ser Thr For Met Gly 580 5 85 590 agg approx melt ggt aag acc aat ttc aag agg taa ctccttagca gctcaaagtt 1947 Arg For Tyr Gly Lys Thr Asn Phe Lys Arg 595 600 605

gcatacgacg tcacttgtat aatattcatg tatatgtatg aaaatttctt tttgttctcc 2007 ccttctattg atggccacgg tttegatett tttggtctgt attataattt ttgaccgatt 2067 aettgataga attgtattct atacatcttt ataagctcat agtaacacca gatttaggta 2127 ctatccgttg gagacacata ctcttgtgtg cgatgatgaa tcaatcatca gattacatta 2187 cacgagccat ttcctgccat attgtaattc atgtatcaag gtacaaataa atagcgtcgt 2247 ggggttgcac ctcttgcatt atcgaaaaaa aaaaaaaaaa aaaaaaaaa 2296

<210> 64 <211> 604 <212> PRT <213> Beta Vulgaris <400> 64

Met 1 Thr Thr Thr Ser 5 Thr Thr Met Wall Ile 10 Asp Ser Arg Thr Ala 15 Dec Phe Ser Asp Ser Asn Asp Ile Ser Asn Gly Ser Ser Ile Cys Cys Wall Ala 20 May 25 30 Ala Thr Thr Thr Thr Thr Thr Thr Ala Ala Glu Asn Ser Leu Ser Phe

40 45

Thr Pro Asp Alu Ala Alu Leu Arg Leu Ser Glu Asn Leu Asp Ser

55 60 · 9 · 9 · 9 · · · · · · · · · · · · · · · · · · ·

156

Leu 65 Phe Gin Ser Leu 70 Ser Leu Ser Asp Ser 75 Asp Ser Phe Ala Asp 80 Ala Lys Ile Wall Wall Ser Gly Asp Ser Arg Glu Wall Ala Wall His Arg 85 90 95 Cys Wall Leu Ser Ser Arg Ser Ser Phe Phe Arg Ser Ala Phe Ala Ser 100 ALIGN! 105 110 Lys Arg Glu Lys Glu Lys Glu Arg Asp Lys Glu Arg Wall Wall Lys Leu 115 120 125 Glu Leu Lys Asp Leu Ala Gly Asp Phe Glu Wall Gly Phe Asp Ser Wall 130 135 140 Wall Ala Wall Leu Gly Tyr Leu Tyr Ser Gly Lys Wall Arg Asn Leu For 145 150 155 160 Arg Gly Ile Cys Wall Cys Wall Asp Glu Asp Cys Ser His Glu Ala Cys 165 170 175 Arg For Ala Wall Asp Phe Wall Wall Glu Wall Leu Tyr Leu Ser His Lys 180 185 190 Phe Glu Ile Wall Glu Leu Wall Ser Leu Tyr Gin Arg His Leu Leu Asp 195 200 205 Ile Leu Asp Lys Ile Ala For Asp Asp Wall Leu Wall Wall Leu Ser Wall 210 215 220 Ala Glu Met Cys Gly Asn Ala Cys Asp Gly Leu Leu Ala Arg Cys Ile 225 230 235 240 Asp Lys Ile Wall Arg Ser Asp Ile Asp Wall Thr Thr Ile Asp Lys Ser 245 250 255 Leu For Gin Asn Wall Wall Lys Gin Ile Ile Asp Thr Arg Lys Glu Leu 260 265 270 Gly Phe Thr Glu For Gly Arg Wall Glu Phe For Asp Lys His Wall Lys 275 280 285 Arg Ile His Arg Ala Leu Glu Ser Asp Asp Wall Glu Leu Wall Arg Met 290 295 300 Leu Leu Lys Glu Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His 305 310 315 320 Tyr Ala Wall Ala His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu 325 330 335 Leu Gly Leu Ala Asp Wall Asn Leu Arg Asn Leu Arg Gly His Thr Wall 340 345 350

157

Leu His Wall 355 Ala Ala Met Arg Lys Glu 360 For Lys Ile Ile 365 Wall Ser Leu Leu Thr Lys Gly Ala His For Ser Asp Ile Thr Ser Asp Asp Lys Lys 370 375 380 Ala Leu Gin Ile Ala Lys Arg Leu Thr Lys Ala Wall Asp Phe Tyr Lys 385 390 395 400 Thr Thr Glu Gin Gly Lys Asp Ala For Lys Asp Arg Leu Cys Ile Glu 405 410 415 Ile Leu Glu Gin Ala Glu Arg Arg Glu For Leu Leu Gly Glu Gly Ser 420 425 430 Wall Ser Leu Ala Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr 435 440 445 Leu Glu Asn Arg Wall Ala Leu Ala Arg Leu Leu Phe For Met Glu Ala 450 455 460 Lys Wall Ala Met Asp Ile Ala Gin Wall Asp Gly Thr Ser Glu Phe Thr 465 470 475 480 Leu Ser Lys Asn Ile Ala Asp Ala Arg Arg Asn Ala Wall Asp Leu Asn 485 490 495 Glu Ala For Phe Ile Leu Lys Glu Glu His Leu Gin Arg Met Lys Ala 500 505 510 Leu Ser Lys Thr Wall Glu Leu Gly Lys Arg Phe Phe For Arg Cys Ser 515 520 525 Asp Wall Leu Asn Lys Ile Met Asp Ala Glu Asp Leu Ser Gin Leu Ala 530 535 540 Phe Leu Gly Lys Asp Thr For Glu Glu Arg Gin Arg Lys Arg Lys Arg 545 550 555 560 Tyr Leu Glu Leu Gin Asp Ala Leu Thr Lys Ala Phe Thr Glu Asp Lys 565 570 575 Glu Glu Phe Asp Arg Ser Thr Leu Ser Ser Ser Ser Ser Ser Thr For 580 585 590 Met Gly Arg For Tyr Gly Lys Thr Asn Phe Lys Arg

595 600 <210> 65 <211> 2844 <212> DNA

159 <213> Helianthus annuus <220>

<221> CDS <222> (737). . (2512) <223> full-length cDNA sequence, sunflower B <400> 65

gacgataaaa cccctctctc tttttgctac caagaacctt cctactttct tgcaccaaag 60 tttctttgca ggttctttga agcttcttta tcatcatacg ttggtttgat attgtttttg 120 atgcatcttt tcacatgggt tttgcttatt gagtgattat ctgttgtggg tatttgatac 180 aaattgaaaa aaagatgatt agatttggta tttagggttt tggttattga agattttatt 240 aattagggtt tgattagggt ttgattaaga ttcttgtatt ggatgggttg atttagatcc 300 agctgtttgt gggtttcaaa tttttgtttt ggtatttgca tatctcattc taatctattc 360 agaggttgag gttctttagg tttgactttg actttgactt ttgggtactt tcttgtacat 420 gtataatgtt tgatttgatc cattatatgt gttttgtaat tgaatcatag caaattttct 480 tgcctgtata tatatgtttt attgaggatt tggttcaagt tttgaccttt ttgggaaaaa 540 aagtcaaaca catattcttg ttcatgtagt tttgcaaatc aatcatttca caaatctttc 600 tttatgttgg gaatccatct caatcataaa aaagtttctt tctttctttg agttcttgtt 660 agctatgaaa gtttatgatt tgtccttttt gtgataaagt caaaccccta atcatcctgg 720

gactttgact aaatcg atg gcg aat tca tcc gaa ccg tca tcc ata agc 772 Met Ala Asn Ser Ser Glu Ser Ser Ile Ser 15 10

ttc Phe acc Thr tca Ser 15 Dec tet Ser tca Ser cac His ata Ile tet Ser 20 May aac Asn ggc Gly gca Ala act Thr agc Ser 25 tray Tyr aac Asn ata Ile 820 CCC approx approx tca atc ccc gag approx cgg tcg aat att gaa atc att ggc 868 For For For Ser Ile For Glu For Arg Ser Asn Ile Glu Ile Ile Gly 30 35 40 tta aat aga ctc agc aca aac cta gag aag ctc gta ttc gat tca ggt 916 Leu Asn Arg Leu Ser Thr Asn Leu Glu Lys Leu Wall Phe Asp Ser Gly 45 50 55 60 tet gaa tet gat tgc aat tray agc gat gct gaa gtt gtt gtt gag ggt 964 Ser Glu Ser Asp Cys Asn Tyr Ser Asp Ala Glu Wall Wall Wall Glu Gly 65 70 75

159

att Ile tet Ser gta ggc att Ile cat His cgg Arg tgt Cys att Ile 85 tta gcc Leu Ala act Thr aga Arg agt Ser 90 acg Thr ttt Phe 1012 Wall Gly 80 ttt agc gat ttg ttt aag aag aac aaa ggt tgt gta gag aag gac agt 1060 Phe Ser Asp Leu Phe Lys Lys Asn Lys Gly Cys Wall Glu Lys Asp Ser 95 100 ALIGN! 105 aag ccg aaa melt aac atg agt gat ttg ttg ccg melt ggg agc gtt ggg 1108 Lys For Lys Tyr Asn Met Ser Asp Leu Leu For Tyr Gly Ser Wall Gly 110 115 120 melt gat gcg ttt ctc gtg ttt tta agc melt gtt melt act ggg aaa ctg 1156 Tyr Asp Ala Phe Leu Wall Phe Leu Ser Tyr Wall Tyr Thr Gly Lys Leu 125 130 135 140 aaa gcg tet cct ccg gag gtt tea acc tgc gtt gat gat ggg tgt ctt 1204 Lys Ala Ser For For Glu Wall Ser Thr Cys Wall Asp Asp Gly Cys Leu 145 150 155 cat gat get tgt tgg cct get att aac ttt get gtt gag ttg act melt 1252 His Asp Ala Cys Trp For Ala Ile Asn Phe Ala Wall Glu Leu Thr Tyr 160 165 170 gcg tet tcg gtt ttt caa gtt ccg gaa tta gtt tcg ctt ttt cag cgt 1300 Ala Ser Ser Wall Phe Gin Wall For Glu Leu Wall Ser Leu Phe Gin Arg 175 180 185 cgt ctt ctc aac ttt gtg gac aag get ctt gtt gaa gac gtg atc ccg 1348 Arg Leu Leu Asn Phe Wall Asp Lys Ala Leu Wall Glu Asp Wall Ile For 190 195 200 atc ctt gtt gtg gcc ttt cac tgt cag ttg caa aac gtc tta tet cgt 1396 Ile Leu Wall Wall Ala Phe His Cys Gin Leu Gin Asn Wall Leu Ser Arg 205 210 215 220 tgc att gac ega gta gtt agg tea aag ctc gat act att tcc att gaa 1444 Cys Ile Asp Arg Wall Wall Arg Ser Lys Leu Asp Thr Ile Ser Ile Glu 225 230 235 aaa gag ctt approx ttt gaa gtc acc caa atg atc aaa tcc att gat aac 1492 Lys Glu Leu For Phe Glu Wall Thr Gin Met Ile Lys Ser Ile Asp Asn 240 245 250 atc atc caa gaa gat gac gaa cat aca gtc gaa tea gaa gtc gtg tta 1540 Ile Ile Gin Glu Asp Asp Glu His Thr Wall Glu Ser Glu Wall Wall Leu 255 260 265 cgt gaa aag aga att aaa agc ata cac aaa gca tta gac tgt gac gat 1588 Arg Glu Lys Arg Ile Lys Ser Ile His Lys Ala Leu Asp Cys Asp Asp 270 275 280

• ·

160

gtt Wall 285 gag Glu ctt Leu gtg Wall aaa Lys atg Met 290 att Ile tta Leu gac gaa tcc Ser 295 aaa Lys atc Ile acg Thr tta Leu gat Asp 300 1636 Asp Glu gaa gcc tgc gct ctt cat melt gcg gtc atg melt tgt aat caa gaa gtt 1684 Glu Ala Cys Ala Leu His Tyr Ala Wall Met Tyr Cys Asn Gin Glu Wall 305 310 315 gct aag gag att ctt aac tta aac cgt gcg gat gtt aat ctt aga aac 1732 Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala Asp Wall Asn Leu Arg Asn 320 325 330 tca ega gat tray acc gtg ctt cat gtt gct gcc atg cgt aaa gaa approx 1780 Ser Arg Asp Tyr Thr Wall Leu His Wall Ala Ala Met Arg Lys Glu For 335 340 345 tca ctt att gtt tcg att cta agc aaa ggc gcg tgt gca tcg gat act 1828 Ser Leu Ile Wall Ser Ile Leu Ser Lys Gly Ala Cys Ala Ser Asp Thr 350 355 360 act ttt gat gga caa agt gcg gtt agt att tgc agg aga ega aca agg 1876 Thr Phe Asp Gly Gin Ser Ala Wall Ser Ile Cys Arg Arg Arg Thr Arg 365 370 375 380 ccc aag gat melt melt gtg aaa acc gaa cac ggg caa gaa aca aat aaa 1924 For Lys Asp Tyr Tyr Wall Lys Thr Glu His Gly Gin Glu Thr Asn Lys 385 390 395 gat cgt ata tgc atc gat gtt ttg gag cgg gaa ata aag agg aat ccg 1972 Asp Arg Ile Cys Ile Asp Wall Leu Glu Arg Glu Ile Lys Arg Asn For 400 405 410 atg ata ggc gat gtt tcc gtg tgt tet tca gca gtg gct gat gat ttg 2020 Met Ile Gly Asp Wall Ser Wall Cys Ser Ser Ala Wall Ala Asp Asp Leu 415 420 425 cat atg aat tta ctc tray tta gaa aac ega gtg gca ttt gct ega ctg 2068 His Met Asn Leu Leu Tyr Leu Glu Asn Arg Wall Ala Phe Ala Arg Leu 430 435 440 tta ttt ccg tca gaa gcg aaa cta gca atg gaa att gcg cat gcc caa 2116 Leu Phe For Ser Glu Ala Lys Leu Ala Met Glu Ile Ala His Ala Gin 445 450 455 460 acg act gca cag melt ccg ggt cta ttg gca tcg aaa ggg tca aat ggt 2164 Thr Thr Ala Gin Tyr For Gly Leu Leu Ala Ser Lys Gly Ser Asn Gly 465 470 475 aac tta agg gag atg gat ttg aac gag aca ccg ttg gtg cag aac aaa 2212 Asn Leu Arg Glu Met Asp Leu Asn Glu Thr For Leu Wall Gin Asn Lys 480 485 490

• · * ·

161

aga Arg ttg Leu ctt Leu 495 tca Ser aga Arg atg gaa gcc Ctt Leu tcc Ser cgg aca gtg gaa Glu atg Met ggt Gly 2260 Met Glu Ala 500 Arg Thr Wall 505 agg ega melt ttc cct cat tgt tca gag gtt ctg gat aag ttc atg gag 2308 Arg Arg Tyr Phe For His Cys Ser Glu Wall Leu Asp Lys Phe Met Glu 510 515 520 gac gat cta cag gat ctt ttt atc ctc gag aag ggt acc gaa gaa gaa 2356 Asp Asp Leu Gin Asp Leu Phe Ile Leu Glu Lys Gly Thr Glu Glu Glu 525 530 535 540 caa gaa atc aaa agg acg ega ttt atg gag Ctt aaa gaa gat gtc caa 2404 Gin Glu Ile Lys Arg Thr Arg Phe Met Glu Leu Lys Glu Asp Wall Gin 545 550 555 aga gcc ttt acc aag gac aag gcc gag ctt cat ege ggt ttg tcc tca 2452 Arg Ala Phe Thr Lys Asp Lys Ala Glu Leu His Arg Gly Leu Ser Ser 560 565 570 tca atg tray acc ccc aca gtg aga aac ggg tca aag agt aaa gcc ege 2500 Ser Met Tyr Thr For Thr Wall Arg Asn Gly Ser Lys Ser Lys Ala Arg 575 580 585

aaa tac tca tca aacccccgtg tttctttgat gatcttttaa cacgctttta 2552

Lys Tyr Ser

590

cgtgcctaat attagaggca aaacatatgt atgaagaaat aatggtggtg catgatgatg 2612 tttagggctc aggtttaggg tttatatgta ctaaattttg tgatttgacg ctaaaaatgc 2672 tatgttgttt tttttttttt ttggataata tggtgtgaaa gctaacgcct tttactagta 2732 gcatgttaat gtttgtgttt gaatcatagt tttttatgca tgtttgtttt acttgcacaa 2792 caactaataa atataatttt tcataataaa aaaaaaaaaa aaaaaaaaaa aa 2844

<210> 66 <211> 592 <212> PRT <213> Helianthus annuus <400> 66

Met 1 Ala Asn Ser Ser 5 Glu For Ser Ser Ser 10 Ile Ser Phe Thr Ser 15 Dec Ser Ser His Ile Ser 20 May Asn Gly Ala Thr Ser 25 Tyr Asn Ile For For 30 For Ser Ile For Glu For Arg Ser Asn Ile Glu Ile Ile Gly Leu Asn Arg Leu

40 45 · 9 «·« «« «« «* * * * * * * * · · · · * · · · ·· · · · · ···

162

Ser Thr 50 Asn Leu Glu Lys Leu Val 55 Phe Asp Ser Gly 60 Ser Glu Ser Asp Cys Asn Tyr Ser Asp Ala Glu Wall Wall Wall Glu Gly Ile Ser Wall Gly 65 70 75 80 Ile His Arg Cys Ile Leu Ala Thr Arg Ser Thr Phe Phe Ser Asp Leu 85 90 95 Phe Lys Lys Asn Lys Gly Cys Wall Glu Lys Asp Ser Lys For Lys Tyr 100 ALIGN! 105 110 Asn Met Ser Asp Leu Leu For Tyr Gly Ser Wall Gly Tyr Asp Ala Phe 115 120 125 Leu Wall Phe Leu Ser Tyr Wall Tyr Thr Gly Lys Leu Lys Ala Ser For 130 135 140 For Glu Wall Ser Thr Cys Wall Asp Asp Gly Cys Leu His Asp Ala Cys 145 150 155 160 Trp For Ala Ile Asn Phe Ala Wall Glu Leu Thr Tyr Ala Ser Ser Wall 165 170 175 Phe Gin Wall For Glu Leu Wall Ser Leu Phe Gin Arg Arg Leu Leu Asn 180 185 190 Phe Wall Asp Lys Ala Leu Wall Glu Asp Wall Ile For Ile Leu Wall Wall 195 200 205 Ala Phe His Cys Gin Leu Gin Asn Wall Leu Ser Arg Cys Ile Asp Arg 210 215 220 Wall Wall Arg Ser Lys Leu Asp Thr Ile Ser Ile Glu Lys Glu Leu For 225 230 235 240 Phe Glu Wall Thr Gin Met Ile Lys Ser Ile Asp Asn Ile Ile Gin Glu 245 250 255 Asp Asp Glu His Thr Wall Glu Ser Glu Wall Wall Leu Arg Glu Lys Arg 260 265 270 Ile Lys Ser Ile His Lys Ala Leu Asp Cys Asp Asp Wall Glu Leu Wall 275 280 285 Lys Met Ile Leu Asp Glu Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala 290 295 300 Leu His Tyr Ala Wall Met Tyr Cys Asn Gin Glu Wall Ala Lys Glu Ile 305 310 315 320 Leu Asn Leu Asn Arg Ala Asp Wall Asn Leu Arg Asn Ser Arg Asp Tyr 325 330 335

• ·

163

Thr Wall Leu His 340 Val Ala Ala Met Arg Lys 345 Glu Pro Ser Leu 350 Ile Wall Ser Ile Leu Ser Lys Gly Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly 355 360 365 Gin Ser Ala Wall Ser Ile Cys Arg Arg Arg Thr Arg For Lys Asp Tyr 370 375 380 Tyr Wall Lys Thr Glu His Gly Gin Glu Thr Asn Lys Asp Arg Ile Cys 385 390 395 400 Ile Asp Wall Leu Glu Arg Glu Ile Lys Arg Asn For Met Ile Gly Asp 405 410 415 Wall Ser Wall Cys Ser Ser Ala Wall Ala Asp Asp Leu His Met Asn Leu 420 425 430 Leu Tyr Leu Glu Asn Arg Wall Ala Phe Ala Arg Leu Leu Phe For Ser 435 440 445 Glu Ala Lys Leu Ala Met Glu Ile Ala His Ala Gin Thr Thr Ala Gin 450 455 460 Tyr For Gly Leu Leu Ala Ser Lys Gly Ser Asn Gly Asn Leu Arg Glu 465 470 475 480 Met Asp Leu Asn Glu Thr For Leu Wall Gin Asn Lys Arg Leu Leu Ser 485 490 495 Arg Met Glu Ala Leu Ser Arg Thr Wall Glu Met Gly Arg Arg Tyr Phe 500 505 510 For His Cys Ser Glu Wall Leu Asp Lys Phe Met Glu Asp Asp Leu Gin 515 520 525 Asp Leu Phe Ile Leu Glu Lys Gly Thr Glu Glu Glu Gin Glu Ile Lys 530 535 540 Arg Thr Arg Phe Met Glu Leu Lys Glu Asp Wall Gin Arg Ala Phe Thr 545 550 555 560 Lys Asp Lys Ala Glu Leu His Arg Gly Leu Ser Ser Ser Met Tyr Thr 565 570 575 For Thr Wall Arg Asn Gly Ser Lys Ser Lys Ala Arg Lys Tyr Ser 580 585 590

<210> 67 <211> 1477 <212> DNA <213> Arabidopsis thaliana

164 <220>

<221> CDS <222> (1) .. (804) <223> AtNMLc2 cDNA sequence <220>

<221> miscellaneous <222> (1) .. (1477) <223> n = a, t, c or g <400> 67

atg Met 1 agc Ser aat Asn ctt gaa gaa Glu tet Ser ttg aga tet Ser 10 cta tcg ttg gat Asp ttc Phe 15 Dec ctg Leu 48 Leu Glu 5 Leu Arg Leu Ser Leu aac cta cta atc aac ggt caa get ttc tcc gac gtg act ttc agc gtt 96 Asn Leu Leu Ile Asn Gly Gin Ala Phe Ser Asp Wall Thr Phe Ser Wall 20 May 25 30 gaa ggt cgt tta gtc cac get cac cgt tgt atc ctc gcc gca cgg agg 144 Glu Gly Arg Leu Wall His Ala His Arg Cys Ile Leu Ala Ala Arg Arg 35 40 45 ctt ttc ttc cgc aaa ttc ttt tgt ggg aca gac tea approx caa cct gtc 192 Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser For Gin For Wall 50 55 60 aca ggt ata gac ccg acc caa cat ggg tcc gta ccc get agc approx aca 240 Thr Gly Ile Asp For Thr Gin His Gly Ser Wall For Ala Ser For Thr 65 70 75 80 aga ggc tcc acg gcc approx get gga att ata approx gtg aac tea gtc ggt 288 Arg Gly Ser Thr Ala For Ala Gly Ile Ile For Wall Asn Ser Wall Gly 85 90 95 melt gag gtt ttt ctg ttg cta ctt cag ttt ctt melt agc gga caa gtc 336 Tyr Glu Wall Phe Leu Leu Leu Leu Gin Phe Leu Tyr Ser Gly Gin Wall 100 ALIGN! 105 110 tcc atc gtg ccg cag aaa cac gag cct aga cct aat tgt ggc gag aga 384 Ser Ile Wall For Gin Lys His Glu For Arg For Asn Cys Gly Glu Arg 115 120 125 gga tgt tgg cac act cat tgc tea gcc gcc gtt gat ctt get ctt gat 432 Gly Cys Trp His Thr His Cys Ser Ala Ala Wall Asp Leu Ala Leu Asp 130 135 140 act ctc gcc gcc tet cgt tray ttc ggc gtc gag cag ctc gca ttg ctc 480 Thr Leu Ala Ala Ser Arg Tyr Phe Gly Wall Glu Gin Leu Ala Leu Leu 145 150 155 160

165

acc Thr cag Gin aaa Lys caa Gin ttg gca Leu Ala 165 agc Ser atg Met gtg Wall gag Glu 170 aaa gcc tet Ser atc Ile gaa Glu 175 gat Asp 528 Lys Ala gtg atg aaa gtt tta ata gca tea aga aag caa gac atg cat caa tta 576 Wall Met Lys Wall Leu Ile Ala Ser Arg Lys Gin Asp Met His Gin Leu 180 185 190 tgg acc acc tgc tet cac tta gtt gct aaa tea ggt ctc approx approx gag 624 Trp Thr Thr Cys Ser His Leu Wall Ala Lys Ser Gly Leu For For Glu 195 200 205 att ctt gcc aag cat ctc cct att gac gtc gtc acc aaa ata gaa gag 672 Ile Leu Ala Lys His Leu For Ile Asp Wall Wall Thr Lys Ile Glu Glu 210 215 220 ctt cgt ctt aaa tet tet ata gct ege cgt tet cta atg cct cac aac 720 Leu Arg Leu Lys Ser Ser Ile Ala Arg Arg Ser Leu Met For His Asn 225 230 235 240 cac cac cat gat ctc agc ggn gnt caa nac cta aag ntc aaa gtt aga 768 His His His Asp Leu Ser Xaa Xaa Gin Xaa Leu Lys Xaa Lys Wall Arg 245 250 255 agg ttg agc ega Ctt gga ttc ttc aac gng aac tag taaagctgat 814 Arg Leu Ser Arg Leu Gly Phe Phe Asn Xaa Asn 260 265

ggtaatggan aaggactcca ttcttgatga agtcgtaagc attgcattac cgcttgttaa 874 aagctgtaga agagaagttg tgaagncttt ngcttgaagc ttggaagctg ccgatgtgaa 934 ttatccggcg ggtccggcaa ggnaaancac ctttgcactt cgcgggntga gatggtctct 994 ccagacatgg tggctgttct gttagcccnc catgcttgat cctaatgtga ggacagttgg 1054 tggaatcacg cctcttgata tccttagaac attaacttcg gatttcttgt tcaaggggca 1114 gttcctggat tgactcacat tgaaccgaat aaacttaggc tttgcctcga gcttgttcaa 1174 tccgctgcaa tggtgatatc tcgagaagaa ggaaacaata gcaacaacca aaacaatgat 1234 aacaataccg ggatttaccc tcatatgaat gaggagcaca atagtggaag cagtggaggg 1294 agcaataaca atttggattc aagattggtt tatctcaatc ttggagcagg tacgggtcag 1354 atgggtccag gtegagatea aggggatgac cataacagtc agagggaagg tatgagtcgg 1414 catcatcatc atcatcaaga cccatctaca atgtatcatc accatcatca acatcacttc 1474

tag 1477 <210> 68 φ · ·

166 <211> 267 <212> PRT <213> Arabidopsis thaliana

<400> 68 Glu Ser Leu Arg 10 Ser Leu Asp Phe 15 Dec Leu Met 1 Ser Asn Leu Glu 5 Asn Leu Leu Ile Asn Gly Gin Ala Phe Ser Asp Wall Thr Phe Ser Wall 20 May 25 30 Glu Gly Arg Leu Wall His Ala His Arg Cys Ile Leu Ala Ala Arg Arg 35 40 45 Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser For Gin For Wall 50 55 60 Thr Gly Ile Asp For Thr Gin His Gly Ser Wall For Ala Ser For Thr 65 70 75 80 Arg Gly Ser Thr Ala For Ala Gly Ile Ile For Wall Asn Ser Wall Gly 85 90 95 Tyr Glu Wall Phe Leu Leu Leu Leu Gin Phe Leu Tyr Ser Gly Gin Wall 100 ALIGN! 105 110 Ser Ile Wall For Gin Lys His Glu For Arg For Asn Cys Gly Glu Arg 115 120 125 Gly Cys Trp His Thr His Cys Ser Ala Ala Wall Asp Leu Ala Leu Asp 130 135 140 Thr Leu Ala Ala Ser Arg Tyr Phe Gly Wall Glu Gin Leu Ala Leu Leu 145 150 155 160 Thr Gin Lys Gin Leu Ala Ser Met Wall Glu Lys Ala Ser Ile Glu Asp 165 170 175 Wall Met Lys Wall Leu Ile Ala Ser Arg Lys Gin Asp Met His Gin Leu 180 185 190 Trp Thr Thr Cys Ser His Leu Wall Ala Lys Ser Gly Leu For For Glu 195 200 205 Ile Leu Ala Lys His Leu For Ile Asp Wall Wall Thr Lys Ile Glu Glu 210 215 220 Leu Arg Leu Lys Ser Ser Ile Ala Arg Arg Ser Leu Met For His Asn 225 230 235 240 His His His Asp Leu Ser Xaa Xaa Gin Xaa Leu Lys Xaa Lys Wall Arg 245 250 255

• ·

Arg Leu Gly Phe Phe Asn Xaa Asn

260

265

167 <210> 69 <211> 1725 <212> DNA <213> Arabidopsis thaliana

<221> CDS <222> (1) .. (1725) <223> AtNMLc4-1 cDNA sequence <400> 69

atg gct gca Ala act Thr gca Ala 5 ata gag Ile Glu approx For tet Ser tea Ser 10 tet Ser ata Ile agt Ser ttc Phe aca Thr 15 Dec tet Ser 48 Met 1 Ala tet cac tta tea aac cct tet cct gtt gtt act act melt cac tea gct 96 Ser His Leu Ser Asn For Ser For Wall Wall Thr Thr Tyr His Ser Ala 20 May 25 30 gcc aat ctt gaa gag ctc agc tet aac ttg gag cag ctt ctc act aat 144 Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gin Leu Leu Thr Asn 35 40 45 approx gat tgc gat tray act gac gca gag atc atc att gaa gaa gaa gct 192 For Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala 50 55 60 aac cct gtg agt gtt cat aga tgt gtt tta gct gct agg agc aag ttt 240 Asn For Wall Ser Wall His Arg Cys Wall Leu Ala Ala Arg Ser Lys Phe 65 70 75 80 ttt ctt gat ctg ttt aag aaa gat aaa gat agt agt gag aag aaa cct 288 Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys For 85 90 95 aag melt caa atg aaa gat tta tta approx melt gga aat gtg gga cgt gag 336 Lys Tyr Gin Met Lys Asp Leu Leu For Tyr Gly Asn Wall Gly Arg Glu 100 ALIGN! 105 110 gca ttt ctg cat ttc ttg agc melt atc tray act ggg agg tta aag cct 384 Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys For 115 120 125 ttt cct atc gag gtt tea act tgt gtt gat tea gtt tgt gct cat gat 432 Phe For Ile Glu Wall Ser Thr Cys Wall Asp Ser Wall Cys Ala His Asp 130 135 140

168

tet Ser 145 tgt Cys aaa Lys ccg For gcc Ala att Ile 150 gat Asp ttt Phe get Ala gtt Val gag Glu 155 ttg Leu atg Met tat Tyr get Ala tea Ser 160 480 ttt gtg ttc caa atc ccg gat ctt gtt tcg tea ttt cag cgg aag ctt 528 Phe Wall Phe Gin Ile For Asp Leu Wall Ser Ser Phe Gin Arg Lys Leu 165 170 175 cgt aac melt gtt gag aag tea cta gta gag aat gtt ctt cct atc ctc 576 Arg Asn Tyr Wall Glu Lys Ser Leu Wall Glu Asn Wall Leu For Ile Leu 180 185 190 tta gtt gcg ttt cat tgt gat ttg aca cag ctt ctt gat caa tgc att 624 Leu Wall Ala Phe His Cys Asp Leu Thr Gin Leu Leu Asp Gin Cys Ile 195 200 205 gag aga gtg gcg aga tea gac tta gac aga ttc tgt atc gaa aag gag 672 Glu Arg Wall Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu 210 215 220 ctt cct tta gaa gta ttg gaa aaa atc aaa cag ctt ega gtt aag tcg 720 Leu For Leu Glu Wall Leu Glu Lys Ile Lys Gin Leu Arg Wall Lys Ser 225 230 235 240 gtg aac ata ccc gag gtg gag gat aaa tcg ata gag aga aca ggg aaa 768 Wall Asn Ile For Glu Wall Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys 245 250 255 gta ctc aag gca ttg gat tea gat gat gta gaa ctc gtg aag ctt ctt 816 Wall Leu Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu 260 265 270 ttg act gag tea gat ata act cta gac caa gcc aat ggt cta cat melt 864 Leu Thr Glu Ser Asp Ile Thr Leu Asp Gin Ala Asn Gly Leu His Tyr 275 280 285 gca gtg gca tray agt gat ccg aaa gtt gtg aca cag gtt ctt gat cta 912 Ala Wall Ala Tyr Ser Asp For Lys Wall Wall Thr Gin Wall Leu Asp Leu 290 295 300 gat atg get gat gtt aat ttc aga aat tcc agg ggg melt acg gtt ctt 960 Asp Met Ala Asp Wall Asn Phe Arg Asn Ser Arg Gly Tyr Thr Wall Leu 305 310 315 320 cat att get get atg cgt aga gag approx aca att atc ata approx ctt att 1008 His Ile Ala Ala Met Arg Arg Glu For Thr Ile Ile Ile For Leu Ile 325 330 335 caa aaa gga get aat get tea gat ttc acg ttt gat gga ege agt gcg 1056 Gin Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala 340 345 350

169

gta Val aat Asn ata Ile 355 tgt Cys agg aga Arg Arg ctc Leu act Thr 360 agg ccg aaa gat Asp melt Tyr 365 cat His acc Thr aaa Lys 1104 Arg For Lys acc tea agg aaa gaa cct agt aaa tray ege tta tgc atc gat atc ttg 1152 Thr Ser Arg Lys Glu For Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu 370 375 380 gaa agg gaa att aga agg aat approx ttg gtt agt ggg gat aca ccc act 1200 Glu Arg Glu Ile Arg Arg Asn For Leu Wall Ser Gly Asp Thr For Thr 385 390 395 400 tgt tcc cat tcg atg ccc gag gat ctc caa atg agg ttg tta tray tta 1248 Cys Ser His Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu 405 410 415 gaa aag ega gtg gga ctt gct cag ttg ttc ttc approx gca gaa gcc aat 1296 Glu Lys Arg Wall Gly Leu Ala Gin Leu Phe Phe For Ala Glu Ala Asn 420 425 430 gtg gct atg gac gtt gct aat gtt gaa ggg aca agc gag tgc aca ggt 1344 Wall Ala Met Asp Wall Ala Asn Wall Glu Gly Thr Ser Glu Cys Thr Gly 435 440 445 ctt cta act approx cct approx tea aat gat aca act gaa aac ttg ggt aaa 1392 Leu Leu Thr For For For Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys 450 455 460 gtc gat tta aat gaa acg cct melt gtg caa acg aaa aga atg ctt aca 1440 Wall Asp Leu Asn Glu Thr For Tyr Wall Gin Thr Lys Arg Met Leu Thr 465 470 475 480 cgt atg aaa gcc ctc atg aaa aca gtt gag aca ggt cgg aga tray ttc 1488 Arg Met Lys Ala Leu Met Lys Thr Wall Glu Thr Gly Arg Arg Tyr Phe 485 490 495 approx tet tgt melt gag gtt ctg gat aag tray atg gat cag melt atg gac 1536 For Ser Cys Tyr Glu Wall Leu Asp Lys Tyr Met Asp Gin Tyr Met Asp 500 505 510 gaa gaa atc cct gat atg tcg melt ccc gag aaa ggc act gtg aaa gag 1584 Glu Glu Ile For Asp Met Ser Tyr For Glu Lys Gly Thr Wall Lys Glu 515 520 525 aga aga cag aag agg atg aga melt aac gag ctg aag aac gac gtt aaa 1632 Arg Arg Gin Lys Arg Met Arg Tyr Asn Glu Leu Lys Asn Asp Wall Lys 530 535 540 aaa gca melt agc aaa gac aaa gtc gcg cgg tet tgt ctt tet tet tea 1680 Lys Ala Tyr Ser Lys Asp Lys Wall Ala Arg Ser Cys Leu Ser Ser Ser

+420 545 550 555 560

170 tea approx gct tet Ser Pro Ala Ser gaa gcc tta

Glu Ala Leu

570 tet ctt aga

Ser Leu Arg

565 gag aat approx aca

Glu Asn Pro Thr tga 1725

575 <210> 70 <211> 574 <212> PRT <213> Arabidopsis thaliana <400> 70

Met Ala Ala 1 Thr Ala 5 Ile Glu For Ser Ser Ser 10 Ile Ser Phe Thr Ser 15 Dec Ser His Leu Ser Asn For Ser For Wall Wall Thr Thr Tyr His Ser Ala 20 May 25 30 Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gin Leu Leu Thr Asn 35 40 45 For Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala 50 55 60 Asn For Wall Ser Wall His Arg Cys Wall Leu Ala Ala Arg Ser Lys Phe 65 70 75 80 Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys For 85 90 95 Lys Tyr Gin Met Lys Asp Leu Leu For Tyr Gly Asn Wall Gly Arg Glu 100 ALIGN! 105 110 Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys For 115 120 125 Phe For Ile Glu Wall Ser Thr Cys Wall Asp Ser Wall Cys Ala His Asp 130 135 140 Ser Cys Lys For Ala Ile Asp Phe Ala Wall Glu Leu Met Tyr Ala Ser 145 150 155 160 Phe Wall Phe Gin Ile For Asp Leu Wall Ser Ser Phe Gin Arg Lys Leu 165 170 175 Arg Asn Tyr Wall Glu Lys Ser Leu Wall Glu Asn Wall Leu For Ile Leu 180 185 190 Leu Wall Ala Phe His Cys Asp Leu Thr Gin Leu Leu Asp Gin Cys Ile 195 200 205 Glu Arg Wall Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu 210 215 220

171

Leu Pro 225 Leu Glu Wall Leu Glu 230 Lys Ile Lys Gin 235 Leu Arg Wall Lys Ser 240 Wall Asn Ile For Glu Wall Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys 245 250 255 Wall Leu Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu 260 265 270 Leu Thr Glu Ser Asp Ile Thr Leu Asp Gin Ala Asn Gly Leu His Tyr 275 280 285 Ala Wall Ala Tyr Ser Asp For Lys Wall Wall Thr Gin Wall Leu Asp Leu 290 295 300 Asp Met Ala Asp Wall Asn Phe Arg Asn Ser Arg Gly Tyr Thr Wall Leu 305 310 315 320 His Ile Ala Ala Met Arg Arg Glu For Thr Ile Ile Ile For Leu Ile 325 330 335 Gin Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala 340 345 350 Wall Asn Ile Cys Arg Arg Leu Thr Arg For Lys Asp Tyr His Thr Lys 355 360 365 Thr Ser Arg Lys Glu For Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu 370 375 380 Glu Arg Glu Ile Arg Arg Asn For Leu Wall Ser Gly Asp Thr For Thr 385 390 395 400 Cys Ser His Ser Met For Glu Asp Leu Gin Met Arg Leu Leu Tyr Leu 405 410 415 Glu Lys Arg Wall Gly Leu Ala Gin Leu Phe Phe For Ala Glu Ala Asn 420 425 430 Wall Ala Met Asp Wall Ala Asn Wall Glu Gly Thr Ser Glu Cys Thr Gly 435 440 445 Leu Leu Thr For For For Ser Asn Asp Thr Thr Glu Asn Leu Giy Lys 450 455 460 Wall Asp Leu Asn Glu Thr For Tyr Wall Gin Thr Lys Arg Met Leu Thr 465 470 475 480 Arg Met Lys Ala Leu Met Lys Thr Wall Glu Thr Gly Arg Arg Tyr Phe 485 490 495 For Ser Cys Tyr Glu Wall Leu Asp Lys Tyr Met Asp Gin Tyr Met Asp 500 505 510

4 «* · * e ················

• 6 • 6 • d * # * ···

172

Glu Glu Ile 515 For Asp Met Ser Tyr 520 For Glu Lys Gly Thr 525 Wall Lys Glu Arg Arg 530 Gin Lys Arg Met Arg 535 Tyr Asn Glu Leu Lys 540 Asn Asp Wall Lys Lys 545 Ala Tyr Ser Lys Asp 550 Lys Wall Ala Arg Ser 555 Cys Leu Ser Ser Ser 560 Ser For Ala Ser Ser Leu Arg Glu Ala Leu Glu Asn For Thr

565 570 <210> 71 <211> 1818 <212> DNA <212> Arabidopsis thaliana <220>

<221> CDS <222> (13) .. (1818) <223> AtNMLc4-2 cDNA Sequence <400> 71 gccgatctcg tg atg atg gcc acc acc acc acc acc acc t acc 51 Met Met Ala Thr Thr Thr Thr 10 Thr Thr Thr Ala Arg Phe

tet Ser gat Asp 15 Dec tca Ser tray Tyr gag Glu ttc Phe age Ser 20 May aac Asn aca Thr age Ser ggc Gly aat Asn 25 age Ser ttc Phe ttc Phe gcc Ala 99 gcc gag tca tet ctt gat melt ccg acg gaa ttt ctc acg approx ccg gag 147 Ala Glu Ser Ser Leu Asp Tyr For Thr Glu Phe Leu Thr For For Glu 30 35 40 45 gta tca gct ctt aaa Ctt ctg tet aac tgc ctc gag tet gtt ttc gac 195 Wall Ser Ala Leu Lys Leu Leu Ser Asn Cys Leu Glu Ser Wall Phe Asp 50 55 60 tcg ccg gag acg ttc tray age gat gct aag cta gtt ctc gcc ggc ggc 243 Ser For Glu Thr Phe Tyr Ser Asp Ala Lys Leu Wall Leu Ala Gly Gly 65 70 75 cgg gaa gtt tet ttt cac cgt tgt att ctt tcc gcg aga att cct gtc 291 Arg Glu Wall Ser Phe His Arg Cys Ile Leu Ser Ala Arg Ile For Wall 80 85 90 ttc aaa age gct tta gcc acc gtg aag gaa caa aaa tcc tcc acc acc 339 Phe Lys Ser Ala Leu Ala Thr Wall Lys Glu Gin Lys Ser Ser Thr Thr 95 100 ALIGN! 105

• ·

173

gtg Wall 110 aag Lys ctc Leu cag ctg aaa Lys 115 gag atc gcc aga Arg gat Asp 120 tac gaa gtc Wall ggc Gly ttt Phe 125 387 Gin Leu Glu Ile Ala Tyr Glu gac tcg gtt gtg gcg gtt ttg gcg melt gtt tray agc ggc aga gtg agg 435 Asp Ser Wall Wall Ala Wall Leu Ala Tyr Wall Tyr Ser Gly Arg Wall Arg 130 135 140 tcc ccg ccg aag gga get tet get tgc gta gac gac gat tgt tgc cac 483 Ser For For Lys Gly Ala Ser Ala Cys Wall Asp Asp Asp Cys Cys His 145 150 155 gtg get tgc cgg tea aag gtg gat ttc atg gtg gag gtt ctt melt ctg 531 Wall Ala Cys Arg Ser Lys Wall Asp Phe Met Wall Glu Wall Leu Tyr Leu 160 165 170 tet ttc gtt ttc cag att caa gaa tta gtt act ctg melt gag agg cag 579 Ser Phe Wall Phe Gin Ile Gin Glu Leu Wall Thr Leu Tyr Glu Arg Gin 175 180 185 ttc ttg gaa att gta gac aaa gtt gta gtc gaa gac atc ttg gtt ata 627 Phe Leu Glu Ile Wall Asp Lys Wall Wall Wall Glu Asp Ile Leu Wall Ile 190 195 200 205 ttc aag ctt gat act cta tgt ggt aca aca tray aag aag ctt ttg gat 675 Phe Lys Leu Asp Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp 210 215 220 aga tgc ata gaa att atc gtg aag tet gat ata gaa cta gtt agt ctt 723 Arg Cys Ile Glu Ile Ile Wall Lys Ser Asp Ile Glu Leu Wall Ser Leu 225 230 235 gag aag tet tta cct caa cac att ttc aag caa atc ata gac atc ege 771 Glu Lys Ser Leu For Gin His Ile Phe Lys Gin Ile Ile Asp Ile Arg 240 245 250 gaa gcg ctc tgt cta gag approx cct aaa cta gaa agg cat gtc aag aac 819 Glu Ala Leu Cys Leu Glu For For Lys Leu Glu Arg His Wall Lys Asn 255 260 265 ata tray aag gcg cta gac tea gat gat gtt gag ctt gtc aag atg ctt 867 Ile Tyr Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Met Leu 270 275 280 285 ttg cta gaa gga cac acc aat ctc gat gag gcg melt get ctt cat ttt 915 Leu Leu Glu Gly His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe 290 295 300 get atc get cac tgc get gtg aag acc gcg melt gat ctc ctc gag ctt 963 Ala Ile Ala His Cys Ala Wall Lys Thr Ala Tyr Asp Leu Leu Glu Leu 305 310 315

174

gag ctt gcg gat gtt Wall aac Asn ctt Leu aga Arg 325 aat Asn ccg For agg Arg gga Gly tac Tyr 330 act Thr gtg Wall ctt Leu 1011 Glu Leu Ala 320 Asp cat gtt gct gcg atg cgg aag gag ccg aag ttg ata ata tet ttg tta 1059 His Wall Ala Ala Met Arg Lys Glu For Lys Leu Ile Ile Ser Leu Leu 335 340 345 atg aaa ggg gca aat att tta gac aca aca ttg gat ggt aga acc gct 1107 Met Lys Gly Ala Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala 350 355 360 365 tta gtg att gta aaa ega ctc act aaa gcg gat gac tray aaa act agt 1155 Leu Wall Ile Wall Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser 370 375 380 acg gag gac ggt acg cct tet ctg aaa ggc gga tta tgc ata gag gta 1203 Thr Glu Asp Gly Thr For Ser Leu Lys Gly Gly Leu Cys Ile Glu Wall 385 390 395 ctt gag cat gaa caa aaa cta gaa melt ttg tcg cct ata gag gct tea 1251 Leu Glu His Glu Gin Lys Leu Glu Tyr Leu Ser For Ile Glu Ala Ser 400 405 410 ctt tet ctt approx gta act approx gag gag ttg agg atg agg ttg ctc melt 1299 Leu Ser Leu For Wall Thr For Glu Glu Leu Arg Met Arg Leu Leu Tyr 415 420 425 melt gaa aac ega gtt gca ctt gct ega ctt ctc ttt approx gtg gaa act 1347 Tyr Glu Asn Arg Wall Ala Leu Ala Arg Leu Leu Phe For Wall Glu Thr 430 435 440 445 gaa act gta cag ggt att gcc aaa ttg gag gaa aca tgc gag ttt aca 1395 Glu Thr Wall Gin Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr 450 455 460 gct tet agt ctc gag cct gat cat cac att ggt gaa aag cgg aca tea 1443 Ala Ser Ser Leu Glu For Asp His His Ile Gly Glu Lys Arg Thr Ser 465 470 475 cta gac cta aat atg gcg ccg ttc caa atc cat gag aag cat ttg agt 1491 Leu Asp Leu Asn Met Ala For Phe Gin Ile His Glu Lys His Leu Ser 480 485 490 aga cta aga gca ctt tgt aaa acc gtg gaa ctg ggg aaa ege tray ttc 1539 Arg Leu Arg Ala Leu Cys Lys Thr Wall Glu Leu Gly Lys Arg Tyr Phe 495 500 505 aaa ega tgt tcg ctt gat cac ttt atg gat act gag gac ttg aat cat 1587 Lys Arg Cys Ser Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His 510 515 520 525

175

ctt Leu gct Ala agc Ser gta Wall gaa Glu 530 gaa gat act Thr cct For gag aaa cgg cta Leu caa Gin aag Lys 540 aag Lys 1635 Glu Asp Glu 535 Lys Arg caa agg tray atg gaa cta caa gag act ctg atg aag acc ttt agt gag 1683 Gin Arg Tyr Met Glu Leu Gin Glu Thr Leu Met Lys Thr Phe Ser Glu 545 550 555 gac aag gag gaa tgt gga aag tet tcc aca ccg aaa approx acc tet gcg 1731 Asp Lys Glu Glu Cys Gly Lys Ser Ser Thr For Lys For Thr Ser Ala 560 565 570 gtg agg tet aat aga aaa ctc tet cac cgg ege cta aaa gtg gac aaa 1779 Wall Arg Ser Asn Arg Lys Leu Ser His Arg Arg Leu Lys Wall Asp Lys 575 580 585 cgg gat ttt ttg aaa ega cct tray ggg aac ggg gat taa 1818 Arg Asp Phe Leu Lys Arg For Tyr Gly Asn Gly Asp 590 595 600

<210> 72 <211> 601 <212> PRT <213> Arabidopsis thaliana

<400> 72 Thr Thr 5 Thr Thr Thr Thr Thr Ala 10 Arg Phe Ser Asp 15 Dec Ser Met 1 Met Ala Tyr Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser 20 May 25 30 Ser Leu Asp Tyr For Thr Glu Phe Leu Thr For For Glu Wall Ser Ala 35 40 45 Leu Lys Leu Leu Ser Asn Cys Leu Glu Ser Wall Phe Asp Ser For Glu 50 55 60 Thr Phe Tyr Ser Asp Ala Lys Leu Wall Leu Ala Gly Gly Arg Glu Wall 65 70 75 80 Ser Phe His Arg Cys Ile Leu Ser Ala Arg Ile For Wall Phe Lys Ser 85 90 95 Ala Leu Ala Thr Wall Lys Glu Gin Lys Ser Ser Thr Thr Wall Lys Leu 100 ALIGN! 105 110 Gin Leu Lys Glu Ile Ala Arg Asp Tyr Glu Wall Gly Phe Asp Ser Wall 115 120 125 Wall Ala Wall Leu Ala Tyr Wall Tyr Ser Gly Arg Wall Arg Ser For For 130 135 140

• ·

176

Lys 145 Gly Ala Ser Ala Cys Val Asp Cys His Wall Ala Cys 160 150 155 Arg Ser Lys Wall Asp Phe Met Wall Glu Wall Leu Tyr Leu Ser Phe Wall 165 170 175 Phe Gin Ile Gin Glu Leu Wall Thr Leu Tyr Glu Arg Gin Phe Leu Glu 180 185 190 Ile Wall Asp Lys Wall Wall Wall Glu Asp Ile Leu Wall Ile Phe Lys Leu 195 200 205 Asp Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile 210 215 220 Glu Ile Ile Wall Lys Ser Asp Ile Glu Leu Wall Ser Leu Glu Lys Ser 225 230 235 240 Leu For Gin His Ile Phe Lys Gin Ile Ile Asp Ile Arg Glu Ala Leu 245 250 255 Cys Leu Glu For For Lys Leu Glu Arg His Wall Lys Asn Ile Tyr Lys 260 265 270 Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Met Leu Leu Leu Glu 275 280 285 Gly His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Ile Ala 290 295 300 His Cys Ala Wall Lys Thr Ala Tyr Asp Leu Leu Glu Leu Glu Leu Ala 305 310 315 320 Asp Wall Asn Leu Arg Asn For Arg Gly Tyr Thr Wall Leu His Wall Ala 325 330 335 Ala Met Arg Lys Glu For Lys Leu Ile Ile Ser Leu Leu Met Lys Gly 340 345 350 Ala Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala Leu Wall Ile 355 360 365 Wall Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser Thr Glu Asp 370 375 380 Gly Thr For Ser Leu Lys Gly Gly Leu Cys Ile Glu Wall Leu Glu His 385 390 395 400 Glu Gin Lys Leu Glu Tyr Leu Ser For Ile Glu Ala Ser Leu Ser Leu 405 410 415 For Wall Thr For Glu Glu Leu Arg Met Arg Leu Leu Tyr Tyr Glu Asn 420 425 430

• ·

177

Arg Val Ala 435 Leu Ala Arg Leu Leu Phe 440 For Val Glu Thr 445 Glu Thr Wall Gin Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr Ala Ser Ser 450 455 460 Leu Glu For Asp His His Ile Giy Glu Lys Arg Thr Ser Leu Asp Leu 465 470 475 480 Asn Met Ala For Phe Gin Ile His Glu Lys His Leu Ser Arg Leu Arg 485 490 495 Ala Leu Cys Lys Thr Wall Glu Leu Gly Lys Arg Tyr Phe Lys Arg Cys 500 505 510 Ser Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser 515 520 525 Wall Glu Glu Asp Thr For Glu Lys Arg Leu Gin Lys Lys Gin Arg Tyr 530 535 540 Met Glu Leu Gin Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu 545 550 555 560 Glu Cys Gly Lys Ser Ser Thr For Lys For Thr Ser Ala Wall Arg Ser 565 570 575 Asn Arg Lys Leu Ser His Arg Arg Leu Lys Wall Asp Lys Arg Asp Phe 580 585 590 Leu Lys Arg For Tyr Gly Asn Gly Asp 595 600

<210> 73 <211> 2672 <212> DNA <213> Nicotiana tabacum <220>

<221> CDS <222> (661). . (1767) <223> full-length cDNA sequence, tobacco B <220>

<221> miscellaneous <222> (1) .. (2673) <223> n = a, t, c or g <400> 73

178

ttttttagcc gaagtgaatg ttattccaat tgggtaagct gtgatcaagc agttgaagtt 180 ttttgttgca aaatttgcca gttatcttga ctttttgtga agttggtaaa tttttcattt 240 gggtaagttg tgatcaagca gttgaagatt tgcactttgt attcttactg tgaaattgca 300 gttttgttga ttatagatgg ggtggaattg ttaatttctt ctaaagtttt aaagggttga 360 tttggtttta cctgaaatag ggagaatatg acttgtagtt ttggaatttg cttcttttct 420 tggtctgcat agttgaatgt tattagaaaa cttatggaaa gttttggtca aacttttgtc 480 ctttgagaag aatttcttgt attggtgatt ggttatggtc ttggagaggt tctttttttt 540 tttgcataga gcctgtgcgg agaatattat acatggttaa aaacattaga ttttctggac 600 tttgactatc ttagatgtag ataaattttg tatatgtttt tagaccatta gaattgggaa 660

atg gct tgt Cys tet Ser gct Ala 5 gaa cca Glu Pro tca tca Ser Ser tet Ser 10 ata Ile agc Ser ttt Phe act Thr tca Ser 15 Dec tet Ser 708 Met 1 Ala tcc att aca tcg aat ggg tcg att ggc gtt ggc caa aac act cat gct 756 Ser Ile Thr Ser Asn Gly Ser Ile Gly Wall Gly Gin Asn Thr His Ala 20 May 25 30 melt ggc ggc tet gag aca ggg agt agt melt gaa atc atc agc ttg agt 804 Tyr Gly Gly Ser Glu Thr Gly Ser Ser Tyr Glu Ile Ile Ser Leu Ser 35 40 45 aaa ctc agt aac aat tta gag caa ctc ttg tca gat tcc agc tet gat 852 Lys Leu Ser Asn Asn Leu Glu Gin Leu Leu Ser Asp Ser Ser Ser Asp 50 55 60 ttt act gat gct gag att gtt gtt gag ggt gtt tca ctt ggt gtt cac 900 Phe Thr Asp Ala Glu Ile Wall Wall Glu Gly Wall Ser Leu Gly Wall His 65 70 75 80 cgt tgt ata tta gct gcc agg agt aaa ttt ttt cag gat ctt ttt agg 94 8 Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gin Asp Leu Phe Arg 85 90 95 aaa gag aag gga agt tgt gga aag gaa ggt aaa approx aga melt tet atg 996 Lys Glu Lys Gly Ser Cys Gly Lys Glu Gly Lys For Arg Tyr Ser Met 100 ALIGN! 105 110 acc gat att ttg cct melt ggt aag gtt gga melt gag gct ttc gtt acc 1044 Thr Asp Ile Leu For Tyr Gly Lys Wall Gly Tyr Glu Ala Phe Wall Thr 115 120 125 ttc cta agc melt ttg tray tca gga aaa ttg aag cat ttc cct ccg gag 1092 Phe Leu Ser Tyr Leu Tyr Ser Gly Lys Leu Lys His Phe For For Glu 130 135 140

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

179

gta Wall 145 tea aca tgt Cys atg Met gac Asp 150 act Thr ata Ile tgt gct cat gac tet Ser tgc Cys aga Arg approx For 160 1140 Ser Thr Cys Ala His 155 Asp gca att aat ttt agt gtg gag ttg atg melt gcc tet tcc atg ttt cag 1188 Ala Ile Asn Phe Ser Wall Glu Leu Met Tyr Ala Ser Ser Met Phe Gin 165 170 175 gtt approx gag cta gta tea ctt ttc ctg aga ege ctt atc aat ttt gtt 1236 Wall For Glu Leu Wall Ser Leu Phe Leu Arg Arg Leu Ile Asn Phe Wall 180 185 190 ggg aag gct ctt gtg gaa gat gtt atc approx ata ctt aga gtt gct ttt 1284 Gly Lys Ala Leu Wall Glu Asp Wall Ile For Ile Leu Arg Wall Ala Phe 195 200 205 cat tgc caa ttg age gag ctt ctc act cat tcc gtt gat aga gta gca 1332 His Cys Gin Leu Ser Glu Leu Leu Thr His Ser Wall Asp Arg Wall Ala 210 215 220 ega tea gat ctt gaa atc aca tgc att gag aaa gag gtt ccc ttt gaa 1380 Arg Ser Asp Leu Glu Ile Thr Cys Ile Glu Lys Glu Wall For Phe Glu 225 230 235 240 gtt gca gag aat att aaa tta ttg tgg ccg aaa tgt cag gtt gat gaa 1428 Wall Ala Glu Asn Ile Lys Leu Leu Trp For Lys Cys Gin Wall Asp Glu 245 250 255 agt aag gtt cta cct gtg gat ccc ttg cat gaa aag aga aaa aat agg 1476 Ser Lys Wall Leu For Wall Asp For Leu His Glu Lys Arg Lys Asn Arg 260 265 270 ata tray aag gca ttg gat tcg gat gat gtt gaa ctt gtc aag ctt cta 1524 Ile Tyr Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu 275 280 285 ctg agt gag tet aac ata age tta gat gaa gcc tray gct ctt cat melt 1572 Leu Ser Glu Ser Asn Ile Ser Leu Asp Glu Ala. Tyr Ala Leu His Tyr 290 295 300 gct gtg gca melt tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg 1620 Ala Wall Ala Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu 305 310 315 320 ggt gtt gcg gat gtc aac cta cgt aat act cgt ggt tray act gtg ctt 1668 Gly Wall Ala Asp Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu 325 330 335 cac att gct tcc atg cgt aag gag approx gca gta att gta tcg ctt ttg 1716 His Ile Ala Ser Met Arg Lys Glu For Ala Wall Ile Wall Ser Leu Leu 340 345 350

Ggg cag agt gct

Gly Gin Ser Ala

180 act aag gg gct cca gca tca gag act aca ttg gat Thr Lys Gly Ala

355 360

365

1764 gtt agtatctgta ggaggctgac taggcctaag gagtaccatg caaaaacaga 1817

Wall

acaaggccag gaagcaaaca aagatcgggt atgtattgat gttttggaga gagagatgcg 1877 tcgcaaccca atggctggag atgcattgtt ttcttcccca atgttggccg atgatctgca 1937 catgaaactg cactacctgg aaaatagagt ggcatttgca cggttactgt tccctcttga 1997 agccagacta gccatgcaaa ttgcaaatgc tgagactgca gctgaagtag cagtccgttt 2057 ggcatctaaa agtacatctg ggaacttgag ggaggttgat ttgaatgaga cacccataaa 2117 gcagaaagaa agacttcttt caaggatgca agccctctcg aagacagttg aacttggcaa 2177 gcgctatttt ccacattgct ctcaagttct ggacaagttt atggaggatg acttacccga 2237 cttaattttc cttgagatgg gccctccaga ggagcaaaag atcaagagga agcgatttaa 2297 ggagctcaaa gatgacgttc ancgggcatt taacaaagac aaagctgaac ttcattgctc 2357 ccgcttgtcc tcatcatcat gttcctcttc ttttaaagat ggngcaagtg tcaaacttag 2417 gaaactatga gtaaataggg ttttgtccta tagtttctct nccatctcag ttttgaatgt 2477 aagattaata gtttttataa agacttgtct tgtacancct tcattagagc gcctgctttg 2537 tcgctatcca tttccctatt cagcttgtta aacttccatg tttncagtag aaagaaattt 2597 gcttaggaac aagcttttgg aatagcttat atggaaaatt gattgtaaaa 3333333333 2657 aaaaaaaaaa aaaaaa 2673

<210> 74 <211> 369 <212> PRT <213> Nicotiana tabacum

Met 1 Ala Cys Ser Ala Glu Pro Ser Ser Ser Ile Ser Phe Thr 15 Dec Ser 5 10 Ser Ile Thr Ser Asn Gly Ser Ile Gly Wall Gly Gin Asn Thr His Ala 20 May 25 30 Tyr Gly Gly Ser Glu Thr Gly Ser Ser Tyr Glu Ile Ile Ser Leu Ser

40 45

181

Lys Leu Ser 50 Asn Asn Leu Glu Gin Leu Leu Ser Asp Ser Ser Ser Asp 55 60 Phe Thr Asp Ala Glu Ile Wall Wall Glu Gly Wall Ser Leu Gly Wall His 65 70 75 80 Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gin Asp Leu Phe Arg 85 90 95 Lys Glu Lys Gly Ser Cys Gly Lys Glu Gly Lys For Arg Tyr Ser Met 100 ALIGN! 105 110 Thr Asp Ile Leu For Tyr Gly Lys Wall Gly Tyr Glu Ala Phe Wall Thr 115 120 125 Phe Leu Ser Tyr Leu Tyr Ser Gly Lys Leu Lys His Phe For For Glu 130 135 140 Wall Ser Thr Cys Met Asp Thr Ile Cys Ala His Asp Ser Cys Arg For 145 150 155 160 Ala Ile Asn Phe Ser Wall Glu Leu Met Tyr Ala Ser Ser Met Phe Gin 165 170 175 Wall For Glu Leu Wall Ser Leu Phe Leu Arg Arg Leu Ile Asn Phe Wall 180 185 190 Gly Lys Ala Leu Wall Glu Asp Wall Ile For Ile Leu Arg Wall Ala Phe 195 200 205 His Cys Gin Leu Ser Glu Leu Leu Thr His Ser Wall Asp Arg Wall Ala 210 215 220 Arg Ser Asp Leu Glu Ile Thr Cys Ile Glu Lys Glu Wall For Phe Glu 225 230 235 240 Wall Ala Glu Asn Ile Lys Leu Leu Trp For Lys Cys Gin Wall Asp Glu 245 250 255 Ser Lys Wall Leu For Wall Asp For Leu His Glu Lys Arg Lys Asn Arg 260 265 270 Ile Tyr Lys Ala Leu Asp Ser Asp Asp Wall Glu Leu Wall Lys Leu Leu 275 280 285 Leu Ser Glu Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr 290 295 300 Ala Wall Ala Tyr Cys Asp For Lys Wall Wall Thr Glu Wall Leu Gly Leu 305 310 315 320 Gly Wall Ala Asp Wall Asn Leu Arg Asn Thr Arg Gly Tyr Thr Wall Leu 325 330 335

• · ·

182

His Ile Ala Ser Met Arg Lys 340 Glu Pro Ala Val 345 Ile Val Ser Leu Leu 350 Thr Lys Gly Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gin Ser Ala

355 360 365

Val • · ·· • ·

T \) Urf) n

Claims (21)

An isolated nucleic acid molecule comprising: (a) a nucleotide sequence that encodes sequence id. No 4, 6, 8, 16, 18, 20, 32 34, 36, 38, 40, 42, 44 46, 48, 50, 52, 54, 56, 58, 62, 64 6 6, 68, 70, 72 or 74; (b) sequence id, . C • 3, 5, 7, 15, 17, 19 31, 33, 35, 37, 39, 41, 43, 45, 47 49 , 51 , 53 55, 57, 61, 63 , 65 , 67 , 69, 71 or 7 3; (c) a nucleotide sequence that comprises a contiguous stretch of at least 20 consecutive bases sequence identical to a stretch of at least 20 consecutive bases of sequence id. No. 3, 5, 7, 15, 17, 19, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73; (d) a nucleotide sequence that is prepared from a Lycopersicon esculentum DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO: 2; 9 and 10, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. 25 and 28, SEQ ID NO. 26 and 28 or SEQ ID NO. Nos. 59 and 60; (e) a nucleotide sequence that is prepared from a Beta vulgaris DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO: 2; 22 and 24 or SEQ ID NO. Nos. 26 and 28; (f) a nucleotide sequence that is prepared from a Helianthus annuus DNA library by amplification in a polymerase chain reaction using a pair of primers set forth herein as SEQ ID NO: 2. C. 26 and 28; (g) a nucleotide sequence which is prepared from a DNA library by solar tuberosum amplification in a polymerase chain 184 • ·· · 9 · ··· 99 · 9999 9999 9 99 9 99 9 999 9999 reaction using a pair of primers listed herein as SEQ ID NO: 9; 21 and 24, SEQ ID NO. 21 and 23, SEQ ID NO. No. 22 a 24, No. 26 (h) nucleotide sequence, which is prepared from Brassica napus DNA libraries by amplification in a polymerase chain reaction using a pair of primers set forth herein as SEQ ID NO. No. 9 a 10 or SEQ ID NO. a 28; a nucleotide sequence that is prepared from a DNA library Arabidopsis thaliana by amplification in a polymerase chain reaction using the double primers set forth herein as SEQ ID NO. 13 and 14, SEQ ID NO. C. 21 and 24 or SEQ ID NO. Nos. 22 and 24; (j) a nucleotide sequence that is prepared from a Nicotiana tabacum DNA library by amplification in a polymerase chain reaction using a pair of primers set forth herein as SEQ ID NO: 2; 9 and 10, SEQ ID NO. 11 and 12, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. Nos. 25 and 28 or SEQ ID NOs. Nos. 26 and 28; or (k) a nucleotide sequence that DNA libraries by amplification in a polymerase chain reaction using a pair of primers comprising the first 20 nucleotides and the reverse complement of the last 20 nucleotides encoding sequence id. No 3, 5, 7, 15, 17, 19, 31, 33, 35, 37 39, 41, 43, 45, 47, 49, 51 53, 55, 57, 61, 63, 65, 67, 69, 71 or 73. The isolated nucleic acid molecule of claim 1 comprising a nucleotide sequence that encodes sequence id. C. 4, 6, 8, 16, 18, 20, 32, 34, 36 38, 40, 42, 44, 46, 48 50, 52, 54, 56, 58, 62, 64, 66, 68, 70, 72, or 74. φφφ 9 · · · 9 · 9 9 99 · · · · · · · · · · · · · · · · · · · · · · · · · · ΦΦ · Φ · · · · · 185 The isolated nucleic acid molecule of claim 1 comprising the sequence of SEQ ID NO: 2. No. 3, 5, 7, 15, 17, 19, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71 or 73. An isolated nucleic acid molecule according to claim 1 comprising a nucleotide sequence which comprises a contiguous stretch of at least 20 consecutive bases sequence identical to a stretch of at least 20 consecutive bases of sequence id. No. 3, 5, 7, 15, 17, 19, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73. The isolated nucleic acid molecule of claim 1 comprising a nucleotide sequence which is prepared from a Lycopersicon esculentum DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO: 2. 9 and 10, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. 25 and 28, SEQ ID NO. 26 and 28 or SEQ ID NO. No. 59 and 60. An isolated nucleic acid molecule according to claim 1 comprising a nucleotide sequence, which is prepared from a Beta vulgaris DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO: 2. 22 and 24 or SEQ ID NO. No. 26 and 28. An isolated nucleic acid molecule according to claim 1 comprising a nucleotide sequence which is prepared from a Helianthus annuus DNA library by amplification in a polymerase chain. 9 186 reaction using the pair of primers set forth herein as SEQ ID NO. No. 26 and 28. An isolated nucleic acid molecule according to claim 1 comprising a nucleotide sequence which is prepared from a Sola.num tuberosum DNA library by amplification in a polymerase chain reaction using the pair of primers listed herein as SEQ ID NO: 2. 21 and 24, SEQ ID NO. 21 and 23, SEQ ID NO. 22 and 24, SEQ ID NO. Nos. 25 and 28 or SEQ ID NOs. No. 26 and 28. The isolated nucleic acid molecule of claim 1 comprising a nucleotide sequence which is prepared from a Brassica napus DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO: 2. 9 and 10, or SEQ ID NO. No. 26 and 28. The isolated nucleic acid molecule of claim 1 comprising a nucleotide sequence, which is prepared from the Arabidopsis thaliana DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO. 13 and 14, SEQ ID NO. 21 and 24 or SEQ ID NO. No. 22 and 24. The isolated nucleic acid molecule of claim 1 comprising a nucleotide sequence, which is prepared from a Nicotiana tabacum DNA library by amplification in a polymerase chain reaction using the pair of primers set forth herein as SEQ ID NO: 1. 9 and 10, SEQ ID NO. 11 and 12, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. Nos. 25 and 28 or SEQ ID NOs. No. 26 and 28. · 99 99 99 and 9 99 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 99 99 · 99 99 99 The isolated nucleic acid molecule of claim 1 187 containing a nucleotide sequence that is prepared from a plant DNA library by amplification in a polymerase chain reaction using a pair of primers comprising the first 20 nucleotides and a reverse complement of the last 20 nucleotides of the coding sequence of SEQ ID NO: 187. 3, 5, 7, 15, 17, 19, 31 33, 35, 37 39, 41, 43, 45, 47 49, 51, 53 55, 57, 61, 63, 65, 67, 69, 71 or 73. A chimeric gene comprising a plant active promoter operably linked to a nucleic acid molecule according to any one of the preceding claims. A recombinant vector comprising the chimeric gene of claim 13 . A host cell comprising the chimeric gene of claim A plant comprising the chimeric gene of claim 13. A plant according to claim 16 selected from the group comprising the following plants: rice, wheat, barley, rye, canola, corn, potato, carrot, Jerusalem artichoke, sugar beet, beans, peas, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, pumpkin, gourd, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, vine, raspberry, blackberry, pineapple , avocado, papa, mango, 188 banana, soya, tobacco, tomato, sorghum and sugar cane. 18. Seeds of plants according to claim 16. 19. Method amplification expression genes SAR v plant marked u by that is in the plant expresses The chimeric gene of claim 13. 20. A method of increasing plant resistance to diseases, characterized in that the chimeric gene of claim 13 is expressed in the plant. 21. A primer for PCR selected from the group consisting of SEQ ID NOs. Nos. 9 to 14, 21 to 28, 59 and 60. 22. A method for isolating NIMI homologues involved in a signal transduction cascade resulting in systemic plant resistance, comprising preparing a DNA molecule from a plant DNA library by amplification in a polymerase chain reaction using a pair of primers corresponding to the first 20 nucleotides and reverse complement of the last 20 nucleotides encoding SEQ ID NO. No.3, 5, 7, 15, 17, 19, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71 or 73, or a pair of primers set forth herein as SEQ ID NO. 9 and 10, SEQ ID NO. 11 and 12, SEQ ID NO. 13 and 14, SEQ ID NO. 21 and 24, SEQ ID NO. 22 and 24, SEQ ID NO. 21 and 23, SEQ ID NO. 25 and 28, SEQ ID NO. 26 and 28 or SEQ ID NO. No. 59 and 60. 189 23. The method of claim 22, wherein the plant DNA library is from Nicotiana tabacum (tobacco), Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Beta vulgaris (sugar beet), Helianthus annuus (sunflower) or Solanum tuberosum (potato).